WO2017037462A2 - Methods - Google Patents

Abstract

The present invention relates to compositions and methods for the treatment of obligate or facultative intracellular microorganisms, such as bacteria, fungi or parasites such as protozoan parasites. The present invention also relates to compositions and methods for enhancing immune cell activation, for example macrophage, dendritic cell, monocytes and lymphocyte activation, which is considered to be useful in treating infection, cancer and asthma, for example.

Description

Methods

Field of the invention

The present invention relates to compositions and methods for the treatment of obligate or facultative intracellular microorganisms, such as bacteria, fungi or protozoa. The present invention also relates to compositions and methods for enhancing immune cell activation, for example macrophage, dendritic cell, monocyte and lymphocyte activation, where said activation is considered to be useful in treating cancer and asthma, for example.

Numerous disease-causing microorganisms must invade host cells in order to prosper. Collectively, such microorganisms are responsible for a staggering amount of human sickness and death throughout the world (Walker et al 2014). For example, Leishmaniasis, Chagas disease, toxoplasmosis, and malaria are neglected diseases and therefore are linked to socio-economical and geographical factors, affecting well over half the world's population. Such obligate intracellular microorganisms have co-evolved with humans to establish a complexity of specific molecular pathogen-host cell interactions, forming the basis of the pathogens' cellular tropism.

One medically important intracellular microorganism infection is Leishmaniasis, caused by protozoan parasites of the Leishmania genus that mainly affects the poorest regions of the world where patients cannot afford the costs for medication. It has persisted for centuries as a life-threatening and disfiguring disease, currently affecting about 350 million people in 98 countries across the globe, with an overall estimated prevalence of 12 million and a yearly incidence of 2 million new cases (Choi et al 2001 , WHO 2010).

Leishmaniasis is classically subdivided into three main clinical forms: Cutaneous (CL), mucocutaneous, and visceral.

Cutaneous Leishmaniasis is most frequently caused by the microorganisms L. major, L. tropica, L aethiopica, L mexicana and L amazonensis, which are intracellular microorganismsthat infect the macrophages and dendritic cells of the immune system. Visceral Leishmaniasis is usually caused by the Leishmania donovani, L. infantum, or L chagasi and it infects the mononuclear phagocyte system including spleen, liver and bone marrow. L donovani relies on phagocytosis to gain entry into the host cell. Mucutaneous Leishmaniasis is caused by more than 15 species of Leishmania.

Two thirds of all cases worldwide are CL presentations (WHO 2010, Lockwood 2004, Alvar ef al 2012). CL remains a neglected area of tropical disease, and medicine remains very far from providing suitable therapy. The available treatments are old and the systemic side effects often outweigh any clinical benefits (Momeni ef al 2013, Sundar ef al 2013).

Leishmaniasis therapy remains very challenging and relies on a few chemotherapy agents that lack appropriate efficacy, safety and affordability. After decades of research in drug development against leishmaniasis, there are no new commercial drugs available for CL treatment. This situation emphasizes the need for new and affordable drugs that overcome shortcomings in the present arsenal.

CL symptoms range from prevalent single, self-healing cutaneous wounds to a persistent, metastatic disease (Hartley et al 2014). The basis for such diverse pathologies is multifactorial and complex, and innate immune system functioning and its pattern recognition receptors are determining factors (Hartley ef al 2014, McCall ef al 2014). Thus, host immunity is a decisive factor that influences the outcome of Leishmania infection. Furthermore, Leishmania parasites manipulate and subvert host immune responses. For example, Leishmania infection shifts cellular immunity, associated with cytokines such as interleukin (IL)-12, interferon gamma (IFN-γ) and tumor necrosis factor (TNF)-a producing Th1 CD4⁺ T lymphocytes, to humoral immunity, associated with (Th2) CD4⁺ T lymphocytes responses in susceptible host (Hurdayal ef a/ 2014, Gonzalez-Leal ef a/ 2014, Schamber- Reis ef a/ 20 3).

Topical or local treatment has been recommended by WHO as a first line treatment approach for CL patients (WHO 2010). However, insufficient killing of stealth parasites inside macrophages and low drug concentrations in the dermis are factors that appear to hinder drugs currently used in clinics, suggesting a need for improved drug delivery, absorption and retention strategies (Moreno ef al 2014, Ben Salah ef al 2013). Importantly, it has been shown that liposomes loaded with drugs enhanced in vitro drug permeation across stripped skin and improved the in vivo anti-Ieishmanial activity in experimentally infected mice (Momeni et al 2013, Carneiro ef al 2010, Carneiro ef al 2012). Many other pathogenic infections such as parasitic infections and diseases involve stealth protozoa (e.g. stealth protozoan parasites), such as Trypanosoma cruzi, Plasmodium spp, Toxoplasma gondii and Cryptosporidium parvum, and bacterial infections can involve stealth bacteria such as Staphylococcus aureus.

Given the need to remove stealth parasites in CL, modulation of the immune microenvironment has been suggested as a potential therapeutic and prophylactic target (Jabbour ef al 2014).

Effective treatment of intracellular microorganism infections, such as parasitic infections and diseases, for example CL, can include wound management as well as eradication of the intracellular parasites causing the lesions. Therefore, it is considered that technologies that enhance delivery of immunomodulatory agents and modulate immune responses may improve the overall outcomes of anti-intracellular microorganism strategies.

A further medically important intracellular microorganism which is an intracellular pathogen is Staphylococcus aureus. The majority of invasive skin infections are now caused by S. aureus, specifically MRSA (Singer and Talan, 2014). Invasive strains of S. aureus are well known to exacerbate problems in clinics due to their stringent cell barriers and acquired drug resistance. Additionally, S. aureus is able to gain entry and replicate within various host cell types, including keratinocytes, endothelial cells, epithelial cells, fibroblasts, and osteoblasts, where antibiotic concentrations in situ are often sub-therapeutic (Garzoni and Kelley, 2009). This condition leads to incomplete eradication of bacteria during therapy. Intracellular invasion by S. aureus into keratinocytes can induce pyroptosis (cell death), followed by accumulation of bacteria that can then breach out from the keratinocyte into nearby cells (Soong et al., 2012).

The control of S. aureus, particularly MRSA, is further complicated by the emergence of epidemic strains that have greater virulence. These strains were reported as highly invasive and able to cause bactereamia in patients (Johnson et al., 2001 ). In the United Kingdom, epidemic methicillin-resistant S. aureus 15 (EMRSA-15) and EMRSA-16 strains constitute more than 60% and 35% of MRSA associated infections, respectively (Johnson et al., 2001). They are considered as the most successful strains at surviving, colonising and spreading in the hospital environment (Moore and Lindsay, 2002; Wolter et al., 2008; Holden et al., 2013). Simultaneously, in the United States (USA), community-acquired MRSA (CA-MRSA) USA 300 and USA 400 have been identified as the primary clones for CA-MRSA infections, with the USA 300 as the predominant cause of skin-and soft tissue infections (King et al., 2006). The USA 300 clone is widely disseminated across the USA and capable of causing clinical illness ranging from uncomplicated bacteraemia to endocarditis, necrotising pneumonia, and osteomyelitis (Tenover and Goering, 2009).

The recommended treatment for skin infections caused by S. aureus includes administration of topical and systemic antibiotics (Liu ef a/., 2011). Topical administration is often needed to ensure that drugs reach the site of infection. For example, in the case of burn injuries; damage to the local vascular system could limit oral antibiotic distribution to the infected sites. Therefore, topical antibiotics such as mupirocin, fusidic acid, and bacitracin are used (Lipsky and Hoey, 2009). Unfortunately, increasing resistance to these antibiotics make them less effective (Patel ef a/., 2009). More recently, nadifloxacin, a topical fluoroquinolone has been shown effective against aerobic and anaerobic Gram- positive pathogens isolated from skin infections (Nenoff ef a/., 2003). The antibacterial activity of nadifloxacin is through inhibition of DNA gyrase that is involved in bacterial DNA synthesis (Nenoff ef a/., 2003). This antibiotic is currently approved for acne treatment and skin infections (Narayanan et ai, 2014).

Cationic polymers are also becoming more widely used as antimicrobials in the clinic due to their broad-spectrum bactericidal activities. For example polyhexamethylene biguanide (PHMB) (Figure 15A) is a cationic polymer that provides potent topical antimicrobial effects against Gram-positive and Gram-negative bacteria (Gilbert and Moore, 2005), fungi (Messick etai, 1999; Hiti, 2002) and viruses (Romanowski etai, 2013), with a long history of topical use in clinics as well as in domestic applications (Gilbert and Moore, 2005). PHMB is available both as a disinfecting solution and impregnated into bio-cellulose dressings (Butcher, 2012). It is a relatively safe compound with no reported adverse reactions when used on the skin, eyes, epithelium of the nose and wounds (Gilliver, 2009). Although PHMB has been used in the clinic for more than 40 years, there are no reports of bacterial resistance for this compound (Moore and Gray, 2007). Due to its excellent antibacterial properties and safety profile, PHMB is considered to be a state-of-art antimicrobial for chronic wound care (Kaehn, 2010).

Synthetic and natural cationic polymers such as PHMB have been used as nucleic acids carriers by forming polyplex (any complex of a polymer and nucleic acids) nanostructures due to their ability to condense nucleic acids into smaller particles, while allowing it to dissociate once inside the cell (Samal ef a/ 2012, Carmona-Ribeiro et al 2013).

WO 2013/054123 discloses the ability of PHMB to enter bacteria, fungi and mammalian cells. WO 2013/054123 does not teach that PHMB can kill intracellular microorganisms. PHMB was also shown in WO 2013/054123 to be useful in delivering nucleic acids into the above cells. WO 2013/054123 makes no mention of immunomodulators. The inventors surprisingly found that even in the absence of CpG ODNs, PHMB alone had significant antileishmaniasis activity at submicromolar range of concentration, and was advantageously able to kill parasites located intracellularly, within macrophages. Moreover, PHMB alone is more potent against intracellular parasites than the current standard treatments. Furthermore, this effect is not limited to protozoa. The inventors have also found that PHMB is advantageously able to kill other intracellular microorganisms, such as intracellular Staphylococcus aureus. Taken together, these data make it more than plausible that PHMB and the agents and compositions of the invention are useful in the eradication of any unwanted intracellular microorganism. The effect of PHMB was found to be highly targeted, with the PHMB causing condensation of the parasite DNA, and therefore death of the parasite, whilst leaving the macrophage (and other host cell) DNA unaffected

It was not contemplated until the present inventors obtained the data set out in the examples that PHMB could kill intracellular microorganisms, let alone that this killing would be selective.

Polyhexametheylene monoguanide (PHMG) is an analogue of PHMB and is considered to have similar biological effects.

Thus PHMB or PHMG represent novel agents for use in treating infections and diseases caused by intracellular microorganisms, or for use in removing or killing any unwanted intracellular microorganism. PHMB or PHMG is considered to be particularly advantageous in the treatment of individuals where it is important to preserve the host cell rather than sacrifice the host cell to eradicate the intracellular microorganism, for example a parasite. For example, where the intracellular microorganism, for example a parasite, infects a macrophage, the invention is considered to be particularly useful for use in treating subjects wherein preservation of the macrophage is considered to be beneficial, for example if the subject has HIV.

Moreover, the inventors have found that the toxicity of a polyplex formed between PHMB and CpG ODNs (CpG oligodeoxynucleotides) towards mammalian cells is far less than free PHMB, allowing higher doses of PHMB to be used. Thus, forming a polyplex of PHMB or PHMG and CpG ODNs provides a safer method of delivering PHMB or PHMG in order to treat a subject infected with an intracellular microorganism, for example an intracellular parasite. It is considered that the reduction in toxicity may arise from the complexing of the PHMB or PHMG to the DNA, which is anionic. It is considered that a complex of PHMB or PHMG and any other anionic polymer would also show reduced toxicity.

Immunomodulatory agents, such as CpG ODNs, have been shown to provide protection against infectious diseases, allergy and cancer (Manuja er a/ 2013 lmmunopharmacology and Immunotoxicology 5: 535-544). Further, CpG ODNs are considered to be useful in the prevention and reversal of inflammation in asthma (Kline ef al 2007 Proc Am Thorac Soc 4: 283-288). Given the wide utility of these immunomodulatory agents, improved delivery mechanisms that allow increased efficiency of delivery of the immunomodulatory agents into the target cells are desired.

The inventors of the present invention discovered that polyplex formation of PHMB and CpG ODNs provides delivery of higher levels of CpG ODNs into cells, for example into macrophages, than is achieved through the use of free CpG ODNs. Thus the inventors have found that PHMB can also be used as a non-viral nucleic acid immune modulator delivery vehicle, for example for delivering CpG ODNs. In fact, polyplex formation between CpG ODN and PHMB increased the uptake efficiency of CpG ODN by about fifteen fold relative to the free form. Thus, a combination therapy with immunomodulatory agents, such as nucleic acid immune modulators such as CpG ODNs, in polyplex formation with PHMB is considered to be effective in not only anti-pathogenic therapy but in any disease or condition in which treatment with immune modulators such as CpG ODNs is beneficial, for example in the treatment of cancer or asthma. PHMB has been shown to form a complex with a wide array of entities such as DNA, RNA, protein and nadifloxacin. Other such examples are listed in WO 2013/054123. The inventors have recognized the difficulty in eradicating intracellular microorganisms, such as intracellular protozoa, for example Leishmania and intracellular bacteria, such as Staphylococcus aureus. The work disclosed herein identifies a novel set of agents that are able to kill intracellular microorganisms across a wide range of organisms, such as protozoan parasites and intracellular bacteria, providing improved agents for the use in the treatment of such infections. In doing so, the inventors surprisingly found that the agent also improved delivery of immunomodulatory agents, solving the additional problem of improving delivery of immunomodulatory agents, used to treat diseases such as cancer and asthma.

Therefore, PHMB and a PHMB/CpG ODN combination provide multiple benefits for therapy against intracellular microorganisms or other diseases.

The inventors have also shown for the first time that PHMB and the PHMB/CpG ODN polyplexes enters mammalian cells via endocytosis, likely via dynamin-dependent endocytosis.

Without wishing to be bound by any theory, it is possible, given the data presented herein, that PHMB or PMHG are taken into mammalian cells via endocytosis and thus resides in membranous vesicles within the mammalian cell, thus excluding PHMB or PHMG from the mammalian nucleus, preventing condensation of the mammalian nucleus. The presence of PHMB or PHMG in the membranous vesicles ideally places it for direct contact with intracellular microorganisms, which are often located within membranous compartments, for example Leishmaniasis resides in a parasitous vacuole. Direct contact between the pathogen and the PHMB or PHMG allows the PHMB or PHMG to enter the pathogen and affect the pathogen by, for example, condensing the genomic DNA. It is therefore considered that the agents and compositions of the present invention are useful against any intracellular microorganism, in particular against intracellular microorganisms that reside in, or temporarily reside in, an intracellular membranous vesicle, such as a vacuole or an endosome or an organelle. However, it will be appreciated that the presesnce of PHMB or PHMG in a membranous vesicle, such as the endosome, may be temporary, and that it may also reside in the cytosol. Thus, the agents and compositions of the present invention may also be effective against intracellular microorganisms that reside in the cytosol.

The listing or discussion of an apparently prior-published document in this specification should not necessarily be taken as an acknowledgement that the document is part of the state of the art or is common general knowledge.

Definitions and preferences for any term described below applies equally to all aspects and embodiments, unless otherwise stated. A first aspect of the invention provides PHMB or PHMG for use in treating a subject infected with an intracellular microorganism. It will be appreciated that the PHMB or PHMG may be part of a composition as described further below.

The invention also provides a method of treating a subject infected with an intracellular microorganism, for example an intracellular protozoa, or an intracellular bacteria, or an intracellular fungi comprising administration of PHMB or PHMG.

Additionally, the invention provides the use of PHMB or PHMG in the manufacture of a medicament for treating a subject infected with an intracellular microorganism, for example an intracellular protozoa, or an intracellular bacteria, or an intracellular fungi.

Polyhexametheylene biguandie (PHMB) is considered to have the following structure:

Polyhexametheylene monoguande (PHMG) is an analogue of PHMB and is considered to

It is considered that any disclosure and teaching in relation to PHMB also applies to PHMG. Some relevant properties of PHMB and PHMG are disclosed in WO 2013/054123.

As such, any example, disclosure, embodiment or treatment involving PHMB may alternatively relate to PHMG.

Also, any example, disclosure, embodiment or treatment involving PHMB or PHMG may equally apply to a mixture of both PHMB and PHMG, i.e. a composition of the invention may comprise PHMB and PHMG, and may also further comprise other components, for example immunomodulatory agents. By a subject we include the meaning of a mammal, for example a human, a mouse, a sheep, a horse or a cow. The subject may also be a bird, for example a chicken. In some embodiments the subject is a fish. The subject may also be an arthropod. The subject may also be a plant.

By the term "intracellular microorganism" we include the meaning of any organism that resides, even on a temporary basis, within another cell. The agents and compositions of the invention are directed towards the removal of such an intracellular microorganism, and so it will be understood that the presence of the organism may be unwanted. In most cases, where the removal of an intracellular microorganism is desired, it is because the intracellular microorganism is a pathogen and is harmful to the host organism. However, this may not be true in all cases. For example, the intracellular microorganism may not be harmful to the host organism in the sense of causing a disease, but it may nevertheless be desireable to remove it, for example for cosmetic reasons.

The intracellular microorganism may be any organism that resides in the host cell and includes bacteria and fungi and protozoa. It will be appreciated that the intracellular microorganism may be a parasite, and so it may be a bacterial parasite, a fungal parasite or a protozoan parasite. In a preferred embodiment, the intracellular microorganism is a protozoan parasite, such as Leishmania. In another preferred embodiment, the intracellular microorganism is a bacterial such as Staphylococcus aureus, for example MRSA. The intracellular microorganism may be a protozoa (for example a protozoan parasite), for example Apicomplexans, optionally Plasmodium spp., Toxoplasma gondii and Cryptosporidium parvum; Trypanosomatids optionally Leishmania spp. and Trypanosoma cruzi. The intracellular microorganism may be a bacteria, for example may be Staphylococcus spp, Pseudomonas spp, facultative or obligate £. coli, Bordetella pertussis, Brucella spp., Campylobacter spp., Group B Streptococcus, Leigonella spp., Listeria monocytogenes, Neisseria gonorrhoeae (menm^' gitides), Salmonella spp., Shigella spp, Yersinia spp., Chlamydia spp., Mycobacterium leprae, Rickettsia spp, Mycobacterium leprae. The intracellular microorganism may also be a fungus, for example Blastomyces dermatitidis, Candida albicans, Coccidioides immitis, Histoplasma capsulatum, Cryptococcus neoformans, Pneumocystis jirovecii. In one embodiment, the intracellular microorganism is not from the genus Leishmania.

In one embodiment the intracellular microorganism is not any of L. major, L tropica, L. aethiopica, L. mexicana or L. amazonensis, By a subject infected with an intracellular microorganism, for example an intracellular protozoan, intracellular bacteria or intracellular fungi, we include the meaning of any subject that has at least one cell infected by a pathogen, for example a protozoan, a bacteria or a fungi. The infection may typically cause symptoms but may alternatively not cause symptoms, for example skin lesions. The infection may be typically detrimental to the health of the subject, but may alternatively not be detrimental to the health of the subject but wherein the presence of the intracellular microorganism is still unwanted.

In one embodiment, the intracellular microorganism may or may not be detrimental to health, but the presence of the intracellular microorganism is unwanted due to its effects on cosmetic appearance. Thus, in one embodiment the invention provides a method for the cosmetic improvement of a subject infected with an intracellular microorganism.

By an infection we include the meaning of a mild infection of the subject, for example wherein as little as one cell of the subject is infected with an intracellular microorganism, to a severe infection where many cells of the subject are infected with an intracellular microorganism.

The infection may cause a specific disease or may cause a range of symptoms not specifically considered to be a disease. In one embodiment the disease is cutaneous leishmaniasis, for example cause by L major. In another embodiment the disease is may be mucocutaneous leishmaniasis. In another embodiment the disease is visceral leishmaniasis, for example caused by Leishmania donovani, L. infantum, or L. chagasi. Other diseases considered to be relevant to the present invention include, but are not limited to Malaria, for example caused by Plasmodum spp; Toxoplasmosis, for example caused by Toxoplasma gondii; cryptosporidiosis for example caused by Cryptosporidium parvum; and Chagas disease, for example caused by Trypanosoma cruzi; infection by Staphylococcus aureus, for example MRSA. In one embodiment the disease is not cutaneous Leishmaniasis. In another embodiment the disease is not leishmaniasis of any kind.

The subject may be infected by an intracellular microorganism, for example an intracellular pathogen such as any of intracellular protozoan, an intracellular bacteria, or an intracellular fungi, that infects any cell in the subject. The microorganism may be such that it only infects one specific cell type of the subject. Alternatively, the microorganism may be such that it infects more than one cell type of the subject. In one embodiment, the intracellular microorganism is a parasite that infects the macrophages. In a preferred embodiment the parasite is a protozoan parasite from the genus Leishmania and typically infects the macrophages. In another embodiment, the intracellular microorganism is an intracellular bacteria, for example Staphylococcus aureus, and may infect keratinocytes, endothelial cells, epithelial cells, fibroblasts and/or osteoblasts, or any other type of cell.

Leishmaniasis has been termed a kinetoplastid disease, along with human African trypanosomiasis (HAT), and Chagas disease (Barrett et at). The causative agents of these diseases share similar structural and biochemical features. These include a single mitochondrion with a discrete structured DNA body: the kinetoplast, specific organelles for glycolysis; the glycosomes, a sub-pellicular microtubular corset and a unique thiol metabolism. Drugs which may be useful against one of these parasites are considered to be potentially useful against the other parasites.

Leishmaniasis is classically subdivided into three main clinical forms: Cutaneous (CL), mucocutaneous, and visceral.

Cutaneous Leishmaniasis is mainly caused by the parasite L major which is an intracellular pathogen which infects the macrophages and dendritic cells of the immune system.

Visceral Leishmaniasis is usually caused by the Leishmania donovani, L. infantum, or L. chagasi and it infects the mononuclear phagocyte system including spleen, liver and bone marrow. L. donovani relies on phagocytosis to gain entry into the host cell. Mucutaneous Leishmaniasis is caused by more than 15 species of Leishmania. In one embodiment the intracellular parasite causes Visceral Leishmaniasis. In another embodiment the intracellular parasite causes Mucocutaneous Leishmaniasis. In a preferred embodiment the intracellular parasite causes Cutaneous Leishmaniasis. In a preferred embodiment, the intracellular microorganism is a single-celled parasite.

The intracellular microorganism may be an intracellular parasite and may be a protozoan, for example Trypanosomatids such as Leishmania spp and Trypanosoma cruzi, and Apicompiexans such as Plasmodium spp, Toxoplasma gondii and Cryptosporidium parvum. In one embodiment the intracellular microorganism is a protozoa but is not from the genus Leishmania.

The intracellular microorganism may be a fungus, for example Histoplasma capsulatum, and cause Histoplasmosis; or for example Cryptococcus neoformans, and cause cryptococcosis.

The intracellular microorganism may be from the clade Excavata, Amoeba, Chromalveolata or Rhizaria The intracellular microorganism may have an indirect life-cycle, wherein the microorganism, for example the parasite, requires an additional host vector for part of the life cycle, for example for transmission to new hosts. For example, the single celled parasite may be Apicompiexans, optionally Plasmodium spp., Toxoplasma gondii and Cryptosporidium parvum; Trypanosomatids optionally Leishmania spp. and Trypanosoma cruzi.

In one embodiment the intracellular parasite is a mesoparasite.

Where the microorganism is not an obligate intracellular microorganism, i.e. is a microorganism that lives inside a host cell for only part of its lifecycle, the treatment with PHMB or PHMG may act on the microorganism whilst it is outside of the host cell in addition to acting on the microorganism whilst it is inside the host cell. It is considered however that it is the intracellular action of PHMB or PHMG on the microorganism that is the surprising and beneficial effect, acting to rid the subject of stealth microorganisms. In a preferred embodiment, such a microorganism that only lives in the host cell for part of its life cycle lives in a phagocyte. In an even more preferred embodiment the parasite is of the genus Leishmania. In another preferred embodiment such a microorganism that only lives in the host cell for part of its life cycle lives in a keratinocyte, endothelial cell, epithelial cell, fibroblast and/or osteoblast, for example the microorganism may be S. aureus for example MRSA. By for use in treating we include the meaning of any reduction in growth or proliferation of the intracellular microorganism. In one embodiment the treatment results in death of the intracellular microorganism. The amount of microorganisms that are killed by the treatment will vary depending on various parameters, for example the type of microorganism, the type of treatment, the length of treatment, the dosage of treatment used, the number of administrations, and the subject to be treated. In a preferred embodiment the treatment will kill at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or essentially 100% of the microorganisms. For example, in an ex-v/Vo assay to assess the level of killing in infected macrophages, the level of killing is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or essentially 100% of the microorganisms. Preferably, for example, 100% of the microorganisms are killed at 2xIC50 values.

There are various methods available to the skilled person to determine the level of microorganism killing caused by any particular treatment regime. For example, the examples describe a method of determining the ability of PH B to kill intracellular microorganisms, such as the amastigotes of Leishmania. Briefly, parasites carrying a reporter gene, such as luciferase, are allowed to infect cells, for example bone derived macrophages. Following infection, the cells are exposed to the relevant treatment under investigation and then lysed. The reporter gene is assayed, by for example the use of luciferin in the case of a luciferase reporter gene. The level of reporter obtained correlates with the number of parasites obtained from the lysed cells.

Further, Example 21 and the accompanying relevant methods detail a method for the determination of the level of killing of an intracellular microorganism, in this case an intracellular bacteria. Briefly, the microorganism is allowed to infect the host cell, which is then treated with an agent that kills only extracellular microorganisms. The host cells are then treated with PHMB or PHMG or other agents and compositions of the invention. The host cells are then typically lysed and the numbers of internal microorganisms are scored by any suitable means, for example by allowing them to form colonies or plaques, or for example by counting the microorganisms using microscopy. Such an assay could readily be adapted by the skilled person to, for example, assay the effect a particular treatment, for example PH B or PHMG or their complex with CpG ODNs has had on a microorganism infection, for example with a parasite, for example with Leishmania, or with a bacteria, for example with Staphylococcus aureus. A sample may be obtained from a subject infected with the intracellular microorganism. The relevant cells, for example, macrophages or keratinocytes, may be purified using techniques well known in the art, treated in vitro with the treatment, and following treatment the amount of microorganisms can be assayed, via, for example, the use of a reporter gene, or other technique such as the use of a specific antibody.

Alternatively, a sample may be obtained from a subject prior to treatment, and again following treatment, and the amount of microorganisms within each sample assayed to determine the efficacy of the treatment. Samples may be taken any number of times, for example 1 time, 2 times, 3 times, 4 times, 5 times, 10 times, 15 times or more. Samples may be taken at any time interval, for example 30 minutes apart, 1 hour apart, 2 hours apart, 3 hours apart, 5 hours apart, 12 hours apart, 24 hours apart, 2 days apart, 7 days apart, 2 weeks apart, 1 month apart, 2 months apart or more.

A reduction in the amount of microorganisms, for example protozoa, bacteria or fungi, suggests that the treatment is killing the microorganism. An increase in the amount of microorganisms suggests that the treatment is not killing the microorganisms, and not inhibiting proliferation entirely. In such a situation, the treatment may be inhibiting proliferation to some degree. Maintenance of the amount of microorganisms suggests that the treatment is inhibiting proliferation of the microorganism, but not killing the microorganism.

The treatment may not kill the microorganism but may stop the microorganism from proliferating and/or infecting further cells. Assays to determine the level of infectivity of a particular treatment or treatment regime will be apparent to the skilled person and include routine methods such as PCR and microscopy. For example a sample may be obtained from a subject infected with a microorganism before and after treatment. Maintenance of the amount of microorganisms, rather than an increase in the number of microorganisms suggest that the treatment has prevented the microorganism from proliferating. A further assay may involve the treatment of a subject, or of cells, with the agents or compositions of the invention, extraction of the intracellular microorganism, for example intracellular protozoa, intracellular bacteria or intracellular fungi, and assessment of the ability of the intracellular microorganism that has been extracted from a treated subject or cells to infect a new subject or cells.

It will be appreciated that by treatment, we include the meaning of a single treatment or administration of the agents and compositions of the invention, and we also include the meaning of multiple administrations of the agents and compositions of the invention. For example, the term treatment may be taken to mean the cumulative administrations of the agents and compositions of the invention which are required to treat the pathogenic infection. The agents and compositions of the invention, for example PHMB or PHMG may be administered any number of times, for example between 1 and 100 times, for example between 5 and 95 times, for example between 10 and 90 times, for example between 15 and 85 times, for example between 20 and 80 times, for example between 25 and 75 times, for example between 30 and 70 times, for example between 35 and 65 times, for example between 40 and 60 times, for example between 45 and 55 times, for example 50 times. The number of administrations may be those required to entirely eliminate the intracellular microorganism from the subject, or may be the number of administrations required to partially eliminate the intracellular microorganism from the subject, or may be the number of administrations required to reduce symptoms of the intracellular microorganism infection to acceptable or tolerable levels.

The agents and compositions of the present invention may be administered at any frequency. The interval between administrations may be regular, or may be irregular. For example, the agents and compositions of the present invention may be administered every 30 minutes, every hour, every 2 hours, every 3 hours, every 4 hours, every 5 hours, every 6 hours, every 7 hours, every 8 hours, every 10 hours, every 12 hours, every 18 hours, every 24 hours, every 36 hours, every 48 hours, every 72 hours, every week, every two weeks, every month or more, or any combination, for example the agents and compositions of the present invention may be administered every 1 hour for a certain time period, and then every 24 hours for another time period.

By for use in treating we also include the meaning of the alleviation or reduction of any clinical symptoms. The treatment may alleviate the symptoms entirely, or only partially. The treatment may alleviate all symptoms, or only one, or a subset of symptoms. Some such symptoms include skin and mucosal lesion, fever, anaemia, liver and spleen damages. In a further embodiment of the invention, the invention provides PHMB alone for use in treating a subject infected with an intracellular microorganism. In an alternative embodiment, the invention provides PHMG alone for use in treating a subject infected with an intracellular microorganism.

By PHMB alone we mean PHMB in the absence of PHMG, but which may include any other compound, adjuvant or excipient, further defined below. Likewise, by PHMG alone for use in we mean PHMG in the absence of PHMB, but which may include any other compound, adjuvant or excipient, further defined below.

By PHMB alone we also include the meaning of in the absence of an immunomodulatory agent, such as a CpG ODN. Likewise, by PHMG alone we also include the meaning of in the absence of an immunomodulatory agent, such as a CpG ODN. It will be appreciated that any agent herein described, for example PHMB or PHMG may be administered prior to, following, or simultaneously with any other agent, for example PHMB or PHMG may be administered prior to, following, or simultaneously with one or more further agents, for example the further agent may be a therapeutic agent used for the treatment of any disease or condition, i.e. one unrelated to the disease, condition or infection for which the PHMB or PHMG is being administered, i.e. may be unrelated to an infection by an intracellular microorganism. In one embodiment the additional therapeutic agent is an anti-cancer agent, or an anti-asthma agent. In a preferred embodiment the therapeutic agent is for the treatment of the microorganism infection, and is, for example, an anti-protozoan agent, an anti-bacterial agent or an anti-fungal agent. In one embodiment the further therapeutic agent is paromomycin, miltefosine, pentamidine, pentavalent antimonials, fluconazole, itraconazole, amphotericin B, or tetracycline, penecillin, kanamycin, gentamycin, nadifloxacin, erythromycin, chloramphenicol.

Anti-protozoans are considered to include paromomycin, miltefosine, pentamidine, pentavalent antimonials; anti-fungals are considered to include: fluconazole, itraconazole, or amphotericin B; anti-bacterials are considered to include tetracycline, penecillin, kanamycin, gentamycin, nadifloxacin, erythromycin, chloramphenicol. However, the skilled person will appreciate that some drugs have appreciable action against a variety of microorganisms, for example several anti-fungals are also used as anti-protozoans, for example amphotercin B is used in both areas, and is considered to be a fairly good anti fungal and an acceptable anti-protozoan. PHMB or PHMG are also considered to have a stimulatory effect on the immune system on their own, i.e. in the absence of any further agents such as immunomodulatory agents as described below. Thus the invention also provides PHMB or PHMG for use in enhancing the immune response or in stimulating the immune response. PHMB or PHMG is therefore considered to have an excellent application in immunotherapy or vaccination and is considered to be suitable to treat diseases or conditions which require a modulation of the immune response, for example cancer and asthma or allergic diseases.

In one embodiment, the PHMB or PHMG enhances or stimulates the innate immune response. Thus, the PHMB or PHMG may increase the production of DAMPS in immune cells and/or the PHMB or PHMG may induce the production of pro-inflammatory cytokines, for example IL-6, IL-10 and IL-12 in immune cells (eg macrophages such as BMDM), and/or the PHMB or PHMG may stimulate the expression of maturation factors such as CD86 and MHCII.

In an additional or alternative embodiment, the PHMB or PHMG enhances or stimulates the adaptive immune response. For example, the inventors have demonstrated that treatment with PHMB causes immunogenic cell death of intracellular microorganisms. Specficially, PHMB was shown to induces expression of dead cell-associated antigens (eg PAMPs) on the surface of the dying/killed intracellular microorganism, which is considered to result in a stimulation of the adaptive immue response. Thus, the PHMB or PHMG may cause immunogenic cell death, for example by inducing expression of dead cell-associated antigens (eg PAMPs) on the surface of a dying/killed intracellular microorganism, thereby stimulating an adaptive immune response. The PAMPs may include any one or more of calreticulin (CRT) and HSP70 and HSP90. The dying/killed intracellular microorganism may increase expression of maturation markers such as CD86 and MHCII and CD40.

Through the direct effect of PHMB or PHMG on the immune system in addition to its effect on the intracellular microorganism itself, PHMB or PHMG is considered to have multiple modes of action in the removal or killing of the intracellular microorganism.Thus, the PHMB or PHMG may be for use in inducing immunogenic cell death of an intracellular microorganism, and/or of a host cell harbouring an intracellular microorganism. It will be appreciated that the invention also provides PMHB or PHMG for use in host-directed therapy, for example immunotherapy or vaccination. By host-directed therapy we include the meaning of any manipulation of the host organism's natural defences, for example the innate or adaptive immune system, or inflammatory responses. It will be appreciated that any agent herein described, for example PHMB or PHMG may be provided as part of a composition, and any reference to an agent, or administration of an agent, for example reference to PHMB or PHMG, can equally apply to a composition comprising that agent. Preferences for the routes of administration and other parameters detailed below in relation to a composition apply equally to the administration of PHMB or PHMG wherein the PHMB and/or the PHMG is not part of a composition.

Thus, a second aspect of the invention provides a composition comprising PHMB or PHMG for use in treating a subject infected with an intracellular microorganism. In a preferred embodiment the composition is a pharmaceutical composition and is suitable for use in therapy and administration to a subject.

Preferences for the composition, routes of administration and timings of administration are defined below following the other aspects of the invention and apply equally to all aspects, including the first aspect.

It will be appreciated that the composition may comprise further agents, in addition to PHMB or PHMG. In a preferred embodiment, the composition further comprises an additional agent. The further agent may be a therapeutic used for the treatment of any disease or condition, i.e. one unrelated to the disease, condition or infection for which the PHMB or PHMG is being administered, i.e. may be unrelated to an infection by an intracellular microorganism. In one embodiment the additional therapeutic agent is an anticancer agent, or an anti-asthma agent. In a preferred embodiment the therapeutic agent is for the treatment of the microorganism infection, and is, for example, an anti-protozoan agent, an anti-bacterial agent or an anti-fungal agent. In one embodiment the further therapeutic agent is paromomycin, miltefosine, pentamidine, pentavalent antimonials, fluconazole, itraconazole, or amphotericin B. In one embodiment the further agent is not considered to be a therapeutic agent. For example, in one embodiment, the further agent is an endocytosis stimulating agent. It is considered that PHMB and PHMG enter the host cell by endocytosis, such that providing an endocytosis stimulating agent will result in increased entry of the PHMB or PHMG into the host cell, improving therapeutic efficacy. For example, immunomodu!ators activate endocytosis and may be included in the composition of the invention. Microbial infections, such as protozoan infections or bacterial infections, activate the host immune system, which aims to eliminate the incoming pathogen (reviewed in Rassmusen ef al). The early immune response (the innate response), is activated through germline- encoded receptors, called pattern recognition receptors (PRRs), which recognize molecular patterns conserved through evolution in a wide range of pathogens. These molecules, called pathogen-associated molecular patterns (PAMPs), stimulate intracellular signaling, gene expression and hence activation of antimicrobial and inflammatory activities, which include the phagocytosis by macrophages and dendritic cells of the pathogen and the infected host cells themselves. The innate response therefore exerts a rapid first line of defense against the infection, but at the same time also initiates the process leading to eventual development of an adaptive immune response and establishment of immunological memory.

It is considered that PHMB or PHMG increases the entry of immunomodulatory agents, for example immunomodulatory nucleic acids, for example CpG oligonucleic acids, into the host cell. In one embodiment, it is considered useful if the immunomodulatory agents, for example immunomodulatory nucleic acids, for example CpG oligonucleic acids enters the endosome of the host cell. In a further embodiment it is not considered necessary for the immunomodulatory agents, for example immunomodulatory nucleic acids, for example CpG oligonucleic acids to enter any other compartment of the host cell or for example to enter the intracellular microorganism. In a further embodiment, the immunomodulatory agents, for example immunomodulatory nucleic acids, for example CpG oligonucleic acids dissociates from the PHMB or PHMG once the complex of PHMB or PHMG and the immunomodulatory agents, for example immunomodulatory nucleic acids, for example CpG oligonucleic acids reaches the endosomes of the host cell.

The innate immune system has a key role in the defence against microorganisms such as intracellular parasites. Therefore it is preferred if the immunomodulatory agent of the invention acts to modulate the innate immune system. In an even more preferred embodiment the agent acts to increase the activity of a macrophage and dendritic cells.

By immunomodulatory agents we include the meaning of any agent capable of modulating any aspect of the immune system. The immunomodulatory agent may be a lipid, a nucleic acid, a carbohydrate, a protein or fragment thereof, a small molecule, or an element. Preferences for the immunomodulatory agent are described below. The immunomodulatory agent may be an immunomodulatory nucleic acid, for example may be an unmethylated CpG oligodeoxynucleic acid, optionally CpG 7909, CpG ODN PF-3512676, ODN 1585, ODN 2216, ODN 2243, ODN 1668, ODN 2006; or a double- stranded RNA; or a double-stem loop Immunomodulatory dSLIM, optionally MGN1703; or a nucleic acid that comprises at least one nucleotide in L-conformation.

It is preferred if the immunomodulatory agent is one that requires uptake into a cell, for example into a phagocyte, for its action in stimulating the immune response. Such agents will be known to the skilled person, and several are exemplified below and include the pathogen associated molecular patterns and the damage associated molecular patterns.

In a preferred embodiment the immunomodulatory agent is a pathogen associated molecular pattern (PAMP), preferably a nucleic acid, preferably CpG oligodeoxynucleic acid.

PAMPs are microbial molecular structures that are evolutionarily conserved, and hence shared between different microbial species. In addition, most PAMPs are essential for microbial growth, and are therefore rarely modified by the micro-organism as a means to avoid innate recognition. Examples of PAMPs are well known to the skilled person. In one embodiment the immunomodulatory agent is a PAMP selected from the group consisting of one or more of: lipopolysaccharide (LPS) from Gram-negative bacteria, components from Gram-positive bacteria, including lipoteichoic acid (LTA); triacylated lipopeptides, such as the synthetic ligand Pam3CSK4; diacylated lipopeptides such as MALP-2; ; flagellin or flagellin fusion proteins; double stranded RNA, for example as produced by replicating viruses; the synthetic ligand polyriboinosinic polyribocytidylic acid (poly l:C); single stranded RNA such as that from viruses; synthetic single stranded RNA, such as R-848 and imiquimod; unmethylated CpG islands such as those found in bacterial and viral DNA; hemozoin; Imiquimod; the AS04 adjuvant system; polyriboinsinic- polyribocytidylic acid; or 852A.

PAMPs are recognized by Patter Recognition Receptors (PRRs), which also recognize Damage Associated Molecular Patterns (DAMPs). There are various PRRs, the majority of which are Toll-Like Receptors (TLRs). TLRs are membrane-bound PRRs able to recognize PAMPs in the extracellular space and in endosomes. There are 10 (TLRs 1-10) and 12 (TLRs 1-9 and 11-13) TLR family members in humans and mice, respectively. They are transmembrane proteins with a single membrane-spanning domain separating their cytoplasmic signaling domain from their ligand-recognizing receptor. Multiple repeats of a leucine-rich (LRR) motif are found in the ectodomain, where PAMP recognition takes place, whereas the intracellular domain is homologous to the cytoplasmic region of the interleukin (IL)1 receptor, known as the Toll/IL-1 receptor domain (TIR) domain, and is essential for downstream signaling (Rassmusen et al).

In one embodiment the immunomodulatory agent activates a PRR. In a further embodiment the immunomodulatory agent activates a TLR, for example TLR1 , TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, orTLRI 0. It will be appreciated that some PAMPs activate more than one TLR and so in a further embodiment the immunomodulatory agent is one that activates one, two, three, four, five, six, seven, eight, nine or ten TLRs.

TLR4 recognizes lipopolysaccharide (LPS) from Gram-negative bacteria. The recognition process is enhanced by LPS-binding protein (LBP), which carries LPS to the CD14 molecule, where it is then presented to the MD-2-TLR4 complex. TLR4 is expressed predominately on monocytes, mature macrophages and dendritic cells, mast cells and the intestinal epithelium (Hennessey et al).

Therefore in one embodiment the immunomodulatory agent is LPS from Gram-negative bacteria and stimulates TLR4.

TLR2 is expressed on monocytes, mature macrophages and dendritic cells, and mast cells. It specifically recognizes components from Gram-positive bacteria, including lipoteichoic acid (LTA) with the assistance of the scavenger receptor CD36. TLR2 can form a heterodimerwith either TLR1 to recognize triacylated lipopeptides, such as the synthetic ligand Pam3CSK4, or TLR6 to recognize diacylated lipopeptides like MALP-2.

In a further embodiment the immunomodulatory agent is a component from Gram-positive bacteria, for example LTA, and activates TLR2. TLR1 , TLR2 and TLR6 are highly similar and arose from an evolutionary gene duplication event. The dimerization of these TLRs allows the recognition of a more specific and wider array of microbial components (Hennessey et al).

TLR5 binds flagellin, a constituent of bacterial flagella. TLR5 is expressed primarily on cells of the intestinal epithelium and in monocytes, macrophages and dendritic cells (Hennessey et al). In one embodiment the immunomodulatory agent is flagellin and activates TLR5.

TLR3 is an endosomal TLR expressed in dendritic cells. It recognizes double stranded RNA, which is produced by replicating viruses and the synthetic ligand polyriboinosinic polyribocytidylic acid (poly l:C) (Hennessey et af .

In a further embodiment the immunomodulatory agent is double stranded RNA, for example poly l:C, and activates TLR3.

TLR7 and TLR8 are found in endosomes of monocytes and macrophages, with TLR7 also being expressed on piasmacytoid dendritic cells and TLR8 also being expressed in mast cells. Both these receptors recognize single stranded RNA from viruses. Synthetic ligands, such as R-848 and imiquimod, can be used to activate the TLR7 and TLR8 signaling pathways (Hennessey ef a/).

In a further embodiment the immunomodulatory agent is single stranded RNA, for example from a virus, or is a synthetic RNA such as R-848 or imiquimod, and activates TLR7 and/or TLR8. TLR9 is expressed in endosomes of monocytes, macrophages and piasmacytoid dendritic cells, and acts as a receptor for unmethylated CpG islands found in bacterial and viral DNA. Synthetic oligonucleotides that contain unmethylated CpG motifs are used to activate TLR9. Oligodeoxynucleotides that contain CpG islands are termed CpG ODNs. CpG ODNs are short single-stranded DNA molecules that contain a cytosine triphosphate deoxynucleotide ("C") followed by a guanine triphosphate deoxynucleotide ("G"). Therefore, in one embodiment, the immunomodulatory agent is a CpG ODN.

The cascade of events initiated by CpG DNA indirectly supports the maturation, differentiation and proliferation of natural killer cells, T cells and monocytes/macrophages.

The "p" of CpG ODN refers to the phosphodiester link between consecutive nucleotides, although some ODN have a modified phosphorothioate (PS) backbone instead. The use of phosphorothioate nucleotides enhances resistance to nuclease digestion when compared with native phosphodiester nucleotides, resulting in a substantially longer in vivo half-life (30-60 min compared with 5-10 min for phosphodiester) (Bode et al). In a further embodiment therefore, the CpG ODN contains a modified backbone, for example modified with a phosphorothioate. To date, four classes of synthetic CpG ODN have been described, each with distinct structural and biological properties (reviewed in Bode et al, see below). K-type ODNs (also referred to as B type) encode multiple CpG motifs on a phosphorothioate backbone. K-type ODNs trigger pDCs to differentiate and produce TNF- α , and B cells to proliferate and secrete IgM. In one embodiment the CpG ODN of the present invention is a K-type ODN. D-type ODNs (also referred to as A type) are constructed of a mixed phosphodiester/phosphorothioate backbone, contain a single CpG motif flanked by palindromic sequences and have poly G tails at the 3' and 5' ends (a structural motif that facilitates the formation of concatamers). D-type ODNs trigger pDCs to mature and secrete I FN- , but have no effect on B cells. The distinct activities of K- versus D-type ODNs have been traced to differences in the retention times of CpG/ TLR-9 complexes in the endosomes of pDCs. Whereas K-type ODNs are rapidly transported through early endosomes into late endosomes, D-type ODNs are retained for longer periods in the early endosome. Here, D type ODNs interact with MyD88/IRF-7 complexes, triggering a signaling cascade that supports IFN- a production. In one embodiment the CpG ODN of the present invention is a D-type ODN.

C-type ODNs resemble K-type in being composed entirely of phosphorothioate nucleotides, but resemble D-type in containing palindromic CpG motifs. This class of ODNs stimulate B cells to secrete IL-6 and pDCs to produce IFN-a. C-type ODNs are present in both early and late endosomes, and thus express properties in common with both K- and D-type ODNs. In one embodiment the CpG ODN of the present invention is a C-type ODN.

Additional classes of immunomodulatory ODNs have been described, for example the P- type. P-type ODNs contain two palindromic sequences, enabling them to form higher ordered structures. P-type ODNs activate B cells and pDCs, and induce substantially greater IFN- production when compared with C-type ODNs. In one embodiment the CpG ODN of the present invention is a P-type ODN. It is considered useful if the composition of the invention comprising PHMB or PHMG and one or more agents comprises more than one type of CpG ODN. Each specific CpG ODN is considered to have a particular effect on the immune system. By combining particular CpGs it is considered that an enhanced effect can be achieved. Methods for assessing the effect of any particular CpG on the immune system are detailed in the Examples, and can be equally applied to assess the effect of a combination or more than one CpG on the immune system.

The CpG ODNs of the present invention may be any length, may comprise any number of CpG motifs, any number of palindromic sequences of any length, and any number of modified bases or nucleotides, for example any number of phosphorothioate backbone resides.

For example, the CpG ODNs of the present invention may be between 6 and 60 nucleotides in length, for example between 10 and 50 nucleotides in length, for example between 15 and 45 nucleotides in length, for example between 20 and 40 nucleotides in length, for example between 25 and 35 nucleotides in length, for example 30 nucleotides in length.

The CpG ODNs of the present invention may comprise between 1 and 30 CpG motifs, for example between 2 and 25 CpG motifs, for example between 3 and 20 CpG motifs, for example between 4 and 19 CpG motifs, for example between 5 and 18 CpG motifs, for example between 6 and 17 CpG motifs, for example between 7 and 16 CpG motifs, for example between 8 and 15 CpG motifs, for example between 9 and 14 CpG motifs, for example between 10 and 13 CpG motifs, for example between 11 or 12 CpG motifs. The CpG ODNs of the present invention may comprise one or more palindromic sequences. For example the entire CpG ODN may be a palindrome, or more comprise one or more shorter palindromes, for example palindromes that are 4, 5, 6, 7, 8, 9, 10, 11 , 12 or more nucleotides in length. The CpG ODNs of the present invention may also comprise one or more modified bases, for example the CpG ODN may be made entirely of modified bases, or made comprise between 0 and 60 modified bases, for example between 5 and 55 modified bases, for example between 10 and 50 modified bases, for example between 15 and 45 modified bases, for example between 20 and 40 modified bases, for example between 25 and 35 modified bases, for example 30 modified bases. The CpG ODNs of the present invention may also comprise one or more phosphorothioates, for example the CpG ODN may be made entirely of phosphorothioates, or made comprise between 0 and 60 phosphorothioates, for example between 5 and 55 phosphorothioates, for example between 10 and 50 phosphorothioates, for example between 15 and 45 phosphorothioates, for example between 20 and 40 phosphorothioates, for example between 25 and 35 phosphorothioates, for example 30 phosphorothioates.

It will be appreciated that there are numerous possibilities of CpG which can vary in parameters such as length, sequences, GC content, number of CpG, modifications and secondary structure. All variants are contemplated within the invention. The skilled person is well equipped from the knowledge of the field and the use of routine assays to determine efficacy of stimulation of the immune system, to determine which particular combinations of the above parameters produce a useful CpG ODN for use in the invention.

Examples of CpG ODNs are provided below (Rothenfusser et al): (small letters: phosphorothioate linkage; capital letters: phosphodiester linkage 3' of the base; bold: CpG dinucleotides): ODN 2006: 5'-tcgtcgttttgtcgttttgtcgtt-3'

ODN 1585: 5'-ggGGTCAACGTTGAgggggG-3'

ODN 2216: 5'-ggGGGACGATCGTCgggggG-3'

ODN 2243 (GC-control to ODN 2216): 5'-ggGGGAGCATGCTCgggggG-3'.

ODN 1668 5' TCCATGACGTTCCTGATGCT 3'

CpG ODNs are considered to be particularly useful in the treatment of parasitic infections, such as leishmaniasis (Datta et al, Shivahare er al). Therefore it is preferred if the immunomodulatory agent is one or more CpG ODNs, particularly when the parasite is leishmania.

Double-Stem Loop ImmunoModulator (dSLIM) also activates TLR9 (Kapp et al). dSLIM comprises single and double stranded DNA, is covalently closed and consists of natural nucleotides only. dSLIM comprises CG motifs similar to the CpG ODNs. Immunoactivation by dSLIM is dependent on TLR9 bearing plasmacytoid dendritic cells and directs systemic activation of the immune response. Therefore, in one embodiment, the immunomodulatory agent is a dSLIM. The dSLIM of the present invention can be of any length, for example up to 100 nucleotides or more, for example between 20 and 80 nucleotides, for example between 30 and 70 nucleotides, for example between 40 and 60 nucleotides, for example 50 nucleotides. The dSLIM of the invention may comprise 2 loops spaced by a double-stranded stem, which may be for example between 10 and 40 nucleotides in length, for example between 20 and 30 nucleotides in length, for example 28 nucleotides in length.

The sequence of the dSLIM may be that as described in Kapp et al, for example:

GGTGGTAACCCCTAGGGGTTACCACCTTCATTGGAAAACGTTCTTCGGGGCGTTCT TAGGTGGTAACCCCTAGGGGTTACCACCTTCATTGGAAAACGTTCTTCGGGGCGTT CTTA

TLR9 also recognizes hemozoin, an insoluble crystalline by product generated by Plasmodium falciparum during the process of detoxification after host hemoglobin is digested (Kawasaki et al). In one embodiment, the immunomodulatory agent of the present invention is hemozoin.

Dependent on the TLR, the TIR domain is involved in assembling various intracellular adaptor molecules, which also contain a TIR domain. Different combinations of the adaptor molecules give rise to specificity in TLR signaling. TLR 3, 7, 8 and 9 are located in the membranes of endosomes and the remaining TLRs are located in the cell-surface membrane (Rassmusen et al).

In one embodiment the immunomodulatory agent activates a TLR located on the cell- surface membrane. In another embodiment the immunomodulatory agent activates a TLR located in the membranes of endosomes. The inventors have identified that a PHMB causes an increase in the uptake of CpG ODN by macrophages. Therefore it is considered particularly useful of the immunomodulatory has an intracellular effect, for example is an agent that activates an intracellular receptor, for example an intracellular PRR, for example TLR3, TLR7, TLR8 and/or TLR9.

Parallel to TLR3 and 7/8, two cytosolic PRRs named RIG-I and melanoma differentiation associated gene 5 (MDA5) detect intracellular RNA species, associated with virus infection, and initiate activation of downstream signaling and induction of cytokines (Rassmusen et al). Therefore, in another embodiment of the invention, the immunomodulatory agent activates the MDA5 and/or RIG-I PRR(s). A group of nucleotide-binding and oligomerisation domain (NOD)-like receptors (NLRs) are also PRRs. The family consists of 23 and 34 members in humans and mice, respectively, among which are the NODs and Nalps (NACHT, LRR and pyrin domain (PYD) containing) (Rassmusen et al). Therefore, the immunomodulatory agent of the present invention may be capable of activating any one of, or more than one of NLRs, for example any one of or more than one of NODs and Nalps.

PRRs also include cytosolic DNA PRRs. Thus, in addition to being recognized in endosomes by TLR9, DNA is also an intracellular PAMP. Cytosolic dsDNA (synthetic or naturally derived from either pathogen or host cells) induces a type I IFN response independent of both TLRs and RLRs. One such identified PRR is termed DNA dependent activator of IFN regulatory factors (IRFs) (Rassmusen et al). Therefore, the immunomodulatory agent may be capable of activating one or more cytosolic DNA PRRs, for example the DNA dependent activator of IRFs.

A common characteristic shared by all families of PRRs is their ability to activate the three major signaling pathways: mitogen-activated protein kinases (MAPKs), IRFs and nuclear factor (NF)-kB. The MAPK pathway activates the transcription factor activator protein 1 (AP-1), and together with NF-kB, contributes to induction of proinflammatory cytokines (Rassmussen et al). Therefore in one embodiment the immunomodulatory agent activates AP-1.

TLR-mediated signaling pathways lead to the translocation of transcription factors, such as NFkB and IRFs in the nucleus, where they activate the transcription of several genes involved in the immune response. Activation of the PRRs can therefore result in expression of pro-inflammatory cytokines such as IL-6, TNFa and IL-12, anti-inflammatory cytokines such as IL-10, type I IFNs which are involved in anti-viral responses, chemokines which attract other immune cells to the site of infection, chemokine receptors which, for example, allow TLR-activated cells to migrate to lymph nodes, anti-microbial molecules, and co-stimulatory molecules such as CD80/86 and CD40 which are involved in T-cell activation by antigen presenting cells.

It is considered beneficial if the immunomodulatory agent results in the expression of IL-6, TNFa, IL10, IL4, IL-12 and INF-gamma.

IL-12 has an important function in enhancing the innate immune response. Helper T-cells which have not yet differentiated into Th1 or Th2 cells exposed to IL-12 differentiate into Th1 cells and the Th2 response is repressed. Th1 cells produce pro-inflammatory cytokines like IFN-g, TNF-b and IL-2, while Th2 cells produce the cytokines IL-4, IL-13, and IL-5, which are responsible for IgE production by B cells, eosinophil activation and recruitment, and mucus production (Deo et a/). Indeed, immune deviation towards Th1 responses by immune modulating agents like CpG ODNs show promising efficacy against leishmanaisis (Gupta et al 2011 , Lima-Junior et al 2013, Datta et al 2003).

It is considered useful therefore if the immunomodulatory agent of the present invention is able to drive the differentiation of ThO cells towards Th1 cells, rather than Th2 cells. Such agents will be known to the skilled person. In one embodiment the immunomodulatory agent stimulates the production of IL-12 from macrophages and dendritic cells. In a further embodiment the immunomodulatory agent is one that stimulates the immune cells, for example to increase production of inducible nitric oxide synthase and increase phagocytosis Stimulation of macrophages and other immune cells may occur directly, for example by the immunomodulatory agent binding directly to the macrophage and dendritic cells or for example to a receptor in the immune cells, or may indirectly stimulate the immune cells, by for example binding to or activating another cell to, for example, release cytokines. Th1 cells produce Interferon gamma (IFNg) which further stimulates the phagocyte, for example the macrophage, to increase lysosome activity and upregulate inducible nitric oxide synthase, resulting in enhanced destruction of the intracellular microorganism or phagocytsed infected host cell. This positive feedback loop escalates the innate immune response towards eradication of the invading parasite or pathogen. Therefore, the immunomodulatory agent may be one that results in the expression of interferon gamma from Th1 cells, either by directly acting on the Th1 cell, or indirectly by acting on antigen presenting cells, for example a macrophage inducing it to produce IL-12. In one embodiment the immunomodulatory agent is IL-2, in another embodiment the immunomodulatory agent is IL-12.

Therefore, it is considered that by using an immunomodulatory molecule to activate the production of cytokines from phagocytes, the innate immune system can be stimulated, resulting in enhanced removal of the intracellular microorganism, for example an intracellular parasite/pathogen by, for example, the enhanced phagocytosis of infected cells. In addition to PAMPS, PRRs also recognize damage-associated molecular patterns (DAMPs), which are associated with cell components released during cell damage.

Damage-associated molecular patterns (DAMPs), also known as alarmins, are molecules released by stressed cells undergoing necrosis that act as endogenous danger signals to promote and exacerbate the inflammatory response. DAMPs include a HSP; HMGB1;

ATP; mitochondrial formyl peptides; mitochondrial DNA; uric acid; NY-ESO-1 ; Hyaluron; heparan sulfate fragments; S100 family proteins, for example S100A8 (MRP8, calgranulin

A) and S100A9 (MRP14, calgranulin B); fibronectin; surfactant protein A; biglycan; versican; mitochondrial DNA; and Serum amyloid A (SAA).

(http://www.invivogen.com/review-damage-associated-molecular-patterns).

In one embodiment therefore the immunomodulatory agent of the invention is a DAMP, for example is selected from the group consisting of a HSP; HMGB1; ATP; mitochondrial formyl peptides; mitochondrial DNA; uric acid; NY-ESO-1 ; Hyaluron; heparan sulfate fragments; S100 family proteins, optionally S100A8 (MRP8, calgranulin A) and S100A9 (MRP14, calgranulin B); fibronectin; surfactant protein A; biglycan; versican; mitochondrial DNA; and Serum amyloid A (SAA). HMGB1 is passively released by necrotic but not apoptotic death of normal cells and actively secreted by a variety of activated immune and non-immune cells. Contrary to many reports, HMGB1 is not a pro-inflammatory cytokine per se (http://www.invivogen.com/review-damage-associated-molecular-patterns). HMGB1 by itself has little or no pro-inflammatory activity but it binds to mediators of inflammation such as LPS, DNA or IL-1 β and induces signaling pathways leading to NF-κΒ activation thereby potentiating inflammatory responses. Although the signaling pathways elicited by HMGB1 are not fully defined, there is evidence that the triggering occurs via several receptors including the multiligand receptor for advanced glycation end products (RAGE), TLR2, and TLR4.

S100A8 (MRP8, calgranulin A) and S100A9 (MRP14, calgranulin B) are calcium-binding proteins expressed in cells of myeloid origin (http://www.invivogen. com/review-damage- associated-molecular-patterns). As intracellular calcium-binding molecules, S100A8 and S100A9 have a role in migration and cytoskeletal metabolism. Cell damage or activation of phagocytes triggers their release into the extracellular space where they become danger signals that activate immune cells and vascular endothelium. S100A8 and S100A9 seem to interact with RAGE4 and TLRs (http://www.invivogen.com/review-darnage-associated- molecular-patterns).

Serum amyloid A (SAA), an acute-phase protein, is produced predominantly by hepatocytes in response to injury, infection, and inflammation. SAA is chemotactic for neutrophils and induces the production of proinflammatory cytokines NO. The downstream signaling pathways triggered by SAA include ERK and p38 activation. Several receptors appear to mediate the effect of SAA, including FPRL1, RAGE, TLR2 and TLR4 (http://www.invivogen.com/review-damage-associated-molecular-patterns).

Receptor for advanced glycation end products (RAGE) is a multiligand receptor of the immunoglobulin superfamily expressed on macrophages, neurons, endothelial cells and a variety of tumor cells. RAGE interacts with various ligands, including AGE (advanced glycation end products), H GB1 , S100 proteins and β-amyloids. Stimulation of RAGE induces the activation of NF- Β and the MAPKs, Erk1/2 and p38. RAGE can both initiate and perpetuate the inflammatory response.

In one embodiment, the immunomodulatory agent stimulates the RAGE receptor. Some DAMPs can engage TLRs to induce and amplify the inflammatory response. TLR2 and TLR4 signaling have been shown to mediate NF- Β activation initiated by HMGB1 , S100A8 and SAA (http://www.invivogen.com/review-damage-associated-molecular- patterns). Different signaling pathways are involved that may cross-talk at several levels, but all culminate in the activation of NF- B.

Mincle, a transmembrane C-type lectin receptor (CLR), is also involved in mediating inflammatory responses to necrotic cells (http://www.inv^'ivogen. com/review-damage- associated-molecular-patterns). Mincle was originally identified as a LPS-inducible protein in macrophages and has been shown to stimulate inflammatory responses to Candida albicans. Mincle associates with the Fc receptor common g-chain leading to intracellular signaling through Syk and CARD9. Mincle recognizes a soluble factor released by necrotic cells identified as spliceosome-associated protein 130 (SAP130). Stimulation of macrophages with purified SAP130 was shown to induce inflammatory responses, suggesting that this protein acts as a DAMP (http://www.invivoqen.com/review- damage-associated-molecular-patterns). In one embodiment the immunomodulatory agent activates the CLR. In one embodiment the immunomodulatory agent is SAP130.

Triggering receptor expressed on myeloid cells 1 (TREM-1) is a new member of the immunoglobulin superfamily present on monocytes and neutrophils. TREM-1 is a positive regulator of inflammatory responses (http://www.invivogen.com/review-damage- associated-molecular-patterns). It has been shown to synergize with TLR4 to mediate the effects of HMGB1 and another DAMP, HSP70, from necrotic cells. TLR9 recognises mitochondrial DNA from leaky mitochondria and therefore detects damaged/dead cells (Kapp et al), therefore TLR9 is also activated by, for example, dying cancer cells.

Additional PAMPs and DAMPs include Bacillus Calmette-Guein, Imiquimod, AS04 adjuvant system, flagellin-protein fusions, or 852A. Therefore, any of Bacillus Calmette- Guein, Imiquimod, AS04 adjuvant system, flagellin-protein fusions, or 852A may be considered an immunomodulatory agent which may comprise part of the composition/polyplex. It is well known that particular PAMPs and DAMPs can activate more than one PRR. Therefore in one embodiment the immunomodulatory agent activates one or more PRRs. For example it is considered that all of TLR3, TLR7, and TLR9 are required to induce IL- 12 in mice in response to L. major infection (Schamber-Reis et al 2013 JBC doi: 10.1074/jbc.M112.407684), whilst synergistic activation of TLRs nay help promote T helper type 1 responses (Napolitani et al Nature Immunology 6, 769 - 776 (2005). It will also be appreciated that the composition can comprise more than one immunomodulatory agent, and the individual immunomodulatory agents may activate different PRRs. Therefore in a further embodiment the composition comprises more than one immunomodulatory agent, wherein the immunomodulatory agents stimulate different PRRs.

In a particular embodiment, the immunomodulatory agent stimulates the activation of macrophages and/or dendritic cells and/or monocytes and/or natural killer (NK) cells, for example plasmacytoid dendritic cells. By activation of macrophages we include the meaning of stimulation of the macrophage to produce any of the following non-exhaustive list of cytokines: IL-6, IL-10 and/or inducible nitric oxide synthase, CD80/86, MHCll, CD40 and other cytokines such as CXCL9, CXCL10, CXCL11 , G-CSF, GM-CSF, IFNp, IL-1a, IL-Ιβ, IL-8, IL-12, p40 & p70, IL-18, IL-23, IL-27, M-CSF, MIP-2a (CXCL2), RANTES (CCL5), T Fa.

By activation of a dendritic cell we include the meaning of stimulation of the dendritic cell to produce any of the following non-exhaustive list of cytokines: GM-CSF, IFNa, IL-1a, IL- 1β, IL-6, IL-8, IL- 0, IL-12, IL-15, IL-18, IL-23, IL-27, IP-10, M-CSF, RANTES , CCL5), TGF , TNFa.

Where the intracellular microorganism, for example an intracellular parasite infects macrophages, for example where the parasite is Leishmania spp, the immunomodulatory agent stimulates the activation of macrophages. Such agents are described above and will be known to the skilled person, and include the PAMPs and DA Ps. Other agents which bypass the PRR receptors, for example IL-12 and IFNgamma are also contemplated as being encompassed by the invention.

The ability of a particular immunomodulatory agent to stimulate activation of a particular cell type, for example a macrophage, a dendritic cell, or a plasmacytoid dendritic cell is assayed according to standard techniques available to the skilled person, such as the use of ELISA, as described in the examples. In addition other parameters of protein expression rather than actual direct measurement of the level of protein can be employed, such as assaying the level of mRNA produced from a given gene, before and after application of the immunomodulatory agent.

Preferably, the level of protein, or for example, mRNA is measured in sample taken from a population of cells obtained previously from a subject. Particular cell types can be isolated and/or purified from a sample taken from a subject by techniques known in the art, such as those described in the Examples.

The level of protein, or for example, mRNA is assayed in a sample of the cells before application of the immunomodulatory agent, and the same parameters assayed in a sample of the cells following application of the agent. If the agent results in an increase or decrease in mRNA or protein of any of the relevant mRNAs or proteins, such as IL-6, IL- 10 and/or inducible nitric oxide synthase, CD80/86, MHCII, CD40 and other cytokines such as CXCL9, CXCL10, CXCL11, G-CSF, GM-CSF, IFN , IL-1a, IL- β, IL-8, IL-12, p40 & p70, IL-18, IL-23, IL-27, M-CSF, MIP-2a (CXCL2), RANTES (CCL5), TNFa, the immunomodulatory agent is considered to be useful in the invention. It is considered that the increase or decrease in the level of particular proteins made by the for example macrophages or dendritic cells, is disease/pathogen dependent. For example, where the intracellular microorganism is Leishmania, or the disease is cancer increased IL-12, IL-6 or decreased IL-4, IL-10 is to be beneficial. Some such immunomodulatory agents are known and described in the present specification, for example CpG ODNs. Other agents may be as yet unidentified and the simple method described above will allow the identification of such useful agents by the skilled person.

It is preferred if the immunomodulatory agents causes a greater activation of the particular cell, for example a macrophage, a dendritic cell, or a plasmacytoid dendritic cell, when in the presence of, or when complexed to, PHMB or PHMG, for example as part of a polyplex. It is considered that the PHMB or PHMG enhances uptake of the immunomodulatory agent, and therefore enhances cell activation. The skilled person can routinely perform the above described assays for PHMB or PHMG alone, immunomodulatory agent alone, and the combination of PHMB or PHMG and determine the level of cell activation, by for example, measuring the increase in levels of protein or mRNA of, for example IL-6, IL-10 and/or inducible nitric oxide synthase, CD80/86, MHCII, CD40 and other cytokines such as CXCL9, CXCL10, CXCL11 , G-CSF, GM-CSF, IFNP, IL-1a, IL-Ιβ, IL-8, IL-12, p40 & p70, IL-18, IL-23, IL-27, M-CSF, MIP-2a (CXCL2), RANTES (CCL5), TNFa. The mechanism behind the utility of the immunomodulatory agent lies in the activation of one or more immune cells. The invention therefore provides a composition comprising PHMB or PHMG and one or more immunomodulatory agents, for example a CpG ODN, for use in enhancing immune cell activation, for example in enhancing cells of the innate immune system, for example a macrophage, dendritic cell and/or plasmacytoid dendritic cell.

It is considered that for enhancing immune cell activation, it is the delivery of the immunomodulatory agent, for example the CpG ODN that is the limiting factor. As the proportion of immunomodulatory nucleic acid, for example a CpG ODN increases, the level of immune cell activation increases. Thus, for the enhancement of immune cell activation, it is considered that polyplexes with a higher proportion of the immunomodulatory nucleic acid relative to the PHMB or PHMG are preferred. Therefore, in one embodiment, the invention provides a polyplex comprising PHMB or PHMG and an immunomodulatory nucleic acid, for example a CpG ODN, wherein the molar ratio of immunomodulatory agent (for example nucleic acid, for example CpG ODN) and PHMB or PHMG may be in the range of 1:0.1 to 1:50 or 1 :0.5 to 1:1000, for example 1:1 to 1:10 or 1:5, for example around 1 :1.5. An appropriate weigh weight ratio of immunomodulatory agent and PHMB or PHMG may be in the range of 1:0.1 to 1:50 or 1:0.5 to 1 :1000, for example 1:1 to 1:10 or 1 :5, for example around 1 :1.5. Typically it is considered that excess PHMB or PHMG enhances the stability of the nanoparticle. In one embodiment therefore there is an excess amount PHMB or PHMG relative to the amount of immunomodulatory agent, for example immunomodulatory nucleic acid, for example CpG ODN.

In one embodiment the invention provides a method for delivering an immunomodulatory agent to a cell, the method comprising contacting the cell with the immunomodulatory agent and PHMB or PMHG. The immunomodulatory agent may be a CpG ODN or any of the immunomodulatory agents described herein. The cell may be any cell, for example may be a cancer cell or a cell of a subject with asthma or allergic diseases, or any other cell described herein.

The method for delivering an immunomodulatory agent is considered to enhance the delivery of the immunomodulatory agent to a cell. For example, contacting the cell with an immunomodulatory agent and PHMB or PHMG delivers more immunomodulatory agent to the cell than is delivered in the absence of PHMB or PHMG. In one embodiment the PHMB or PHMG is in a complex with the immunomodulatory agent. Preferences for a complex, or polyplex, or PHMB or PHMG and an immunomodulatory agent as as described herein. The inventors have shown that PHMB or PHMG form polyplexes with immunomodulatory agents such as immunomodulatory nucleic acids, such as CpG ODNs. These polyplexes were found to have surprising characteristics, for example polyplex formation increases the efficiency of CpG ODN uptake into cells, and reduces toxicity of PHMB compared to free PHMB. It is considered that a combination of PHMB or PHMG and an immunomodulatory agent, such as an immunomodulatory nucleic acid, for example a CpG ODN, has a synergistic effect on the treatment of a subject infected with an intracellular microorganism, for example an intracellular parasite or an intracellular bacteria. On the one hand, the PHMB or PHMG component directly affects the intracellular pathogen. On the other hand, the immunomodulatory component stimulates the immune system to remove the infection. Finally, the combination of the two, as for example a polyplex, causes an increased amount of the CpG ODN to enter the cell, enhancing the effect of the CpG ODN. Thus this new combination of PHMB or PHMG and an immunomodulatory agent, for example a CpG ODN has surprising synergistic benefits in the treatment of such infections.

Any composition described above, for example a composition of PHMB or PHMG and one or more further agents, such as an endocytosis stimulator or an immunomodulatory agent, is considered to be able to form a polyplex, and the term polyplex relates to these compositions equally.

By the term polyplex we include the meaning of any complex of PH B or PHMG and one or more immunomodulatory agents such as an immunomodulatory nucleic acid, such as a CpG ODN.

In a preferred embodiment, a polyplex is a complex between nucleic acid and PHMB or PHMG, for example between DNA and PHMB or PHMG. In one embodiment the components of the complex physically bind to each other through one or more of electrostatic interactions, hydrophobic interactions and H-bonding.

In an even more preferred embodiment, a polyplex is a complex formed between PHMB or PHMG and one or more CpG ODNs.

PHMB and PHMG are considered to have a positive charge. Thus it is considered that polyplexes will form between PHMB or PHMG and negatively charged entities, such as DNA. Thus in one embodiment the poylplex is formed of PHMB or PHMG and one or more negatively charged entities, for example DNA, for example a CpG ODN. This is also considered to be a potential means by which the complex or polyplex of PHMB or PHMG and the CpG ODN is less toxic, as the CpG ODN neutralises, at least in part, the positive charge of PHMB or PHMG, which is considered to be toxic.

Methods of making the composition or polyplex will be known to the skilled person.

The composition or polyplex may be prepared by mixing the PHMB or PHMG and the immunomodulatory agent, for example a CpG ODN in appropriate ratios and under appropriate conditions of, for example, pH and salt concentration, for example as set out in the examples. The method may, for example, be performed from up to 100 fold molar excess of immunomodulatory agent over PHMB or PHMG, through using an equal molar concentration of PHMB or PHMG and immunomodulatory agent, to up to 1000 fold molar excess of PHMB or PHMG over immunomodulatory agent. For example, an appropriate molar ratio of immunomodulatory agent (for example nucleic acid, for example CpG ODN) and PHMB or PHMG may be in the range of 1:0.1 to 1 :50 or 1 :0.5 to 1 :1000, for example 1 :1 to 1:10 or 1:5, for example around 1:1.5. An appropriate weight:weight ratio of immunomodulatory agent and PHMB or PHMG may be in the range of 1 :0.1 to 1 :50 or 1 :0.5 to 1 :1000, for example 1:1 to 1:10 or 1:5, for example around 1 :1.5. The pH at which the PHMB or PHMG and the immunomodulatory agent are mixed/incubated may be a high pH, for example 10-13.5.

The polyplex may be formed by a method which comprises incubating the PHMB or PHMG and the further agent, for example an immunomodulatory agent in a complexation buffer, for example at a high pH, for example at a pH of 10-13.5. It is considered that nanoparticles are formed comprising the PHMB or PHMG and the immunomodulatory agent, for example oligonucleotide polymers (DNA, PNA, siRNA), proteins, peptides and small molecules. Specifically, formation of nanoparticles can be achieved by incubating PHMB or PHMG and similar molecules as described above in an appropriate buffer. An appropriate incubation buffer may include water, PBS, and other buffers used commonly in laboratories. High pH buffers are described above. The optimal buffer may depend on the specific identity of both the entry promoting agent and the delivered molecule, as will be apparent to those skilled in the art. Nanoparticle formation and cell delivery typically is achieved by dilution of both partner molecules in complexation buffer prior to mixing the two components. Also, mixing of the two components typically is carried out prior to combination with other excipients or active ingredients and application to cells or use in vivo. Efficient nanoparticle formation is considered to occur within seconds or minutes but the procedure may be carried out over a number of hours. An appropriate ratio for efficient nanoparticle formation varies with different partner combinations. For example, 1-20:1 (wt:wt) for PHMB or PHMG:plasmid DNA, preferably 2:1 PHMB or PHMG : CpG ODN provides efficient nanoparticle formation. Examples are given above for PHMB or PHMG;DNA combinations that result in nanoparticle formation. A person skilled in the art will be able to assess nanoparticle formation and delivery efficiencies when using different partner molecule ratios. Nanoparticle formation can be assessed in a number of ways. For example, an individual skilled in the art will be able to assess nanoparticle formation using dynamic light scattering (DLS) and microscopy methods.

As stated above, it is considered that a composition comprising PHMB or PHMG and one or more immunomodulatory nucleic acids, for example a CpG ODN may form a polyplex, and such polyplexes can be used to treat a subjected infected with an intracellular microorganism, as well as to treat a subject with cancer or a disease characterised by inappropriate levels of inflammation. The polyplexes of the invention, formed between the PHMB or PHMG and the immunomodulatory nucleic acid, for example a CpG ODN, may have a relative weight ratio of between 2:1 and 1.5:1. In a preferred embodiment, the polyplexes have a relative weight ratio of≥ 0.25. Techniques to assay the relative weight ratio of the polyplexes will be apparent to the skilled person, and such assays are detailed in the examples, for example through gel retardation assays with reporter-labelled CpG ODN. The polyplexes of the invention may have a size of between 50-500 nm, for example between 100-400nm, for example between 150-350nm, for example between 173.6nm to 341.4nm, for example between 193.6 to 310.9nm, for example between 231.6 to 280.4nm. Techniques to monitor the particle size of the polyplex will be apparent to the skilled person and include dynamic light scattering and electrophoretic light scattering, as detailed in the methods.

It is preferred if the polyplexes of the invention are stable. By stable we include the meaning that the components of the polyplex remain associated with one another under imposed conditision for a given amount of time. In an alternative or additional embodiment, we include the meaning that one or more of the individual components of the polyplex are not degraded under imposed conditision for a given amount of time. Stability of the polyplexes can be measured by any means available to the skilled person, such as assaying the zeta potential by measuring the electrophoretic light scattering, as detailed in the examples. In a preferred embodiment the zeta potential is net positive or net negative.

The stability of the polyplexes can be assayed by the use of transmission electron microscopy and the electrophoretic mobility shift assay. For example, after a period of storage, for example for two months, for example for two months in the fridge, the stability of the polyplexes can be assayed. The polyplexes may be stable for up to 1 week, 2 weeks, 1 months, 2 months, 3 months, 4 months, 5 months, 6 months, 9 months, 12 months, 18 months, 2 years, or more. In a preferred embodiment the polyplexes are stable for at least to 1 week, 2 weeks, 1 months, 2 months, 3 months, 4 months, 5 months, 6 months, 9 months, 12 months, 18 months, 2 years, or more. In one embodiment, the polyplexes are stable for at least two months.

By stable we include the meaning of wherein at least 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99% or 100% of the PHMB or PHMB is associated with one or more CpG ODNs under imposed conditision for a given amount of time. The imposed conditions may be storage at room temperature or at a temperature above room temperature or at a temperature below room temperature. The given amount of time may be at least 1 hour, 12 hours, 24 hours, 1 week, 1 month, 6 months or 1 year. In another embodiment, at least 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99% or 100% of the CpG ODNs are associated with PHMB or PHMG under imposed conditision for a given amount of time. The assessment of the stability of a particular agent or composition is a routine procedure for the skilled person. The skilled person will readily identify the particular assays required, and conditions required, to identify a composition of, for example PHMB or PHMG and one or more CpG ODNs, with an acceptable level of stability. Detailed methods for the assessment of stability are given in Example 5.

The stability of the polyplex can be monitored through the use of, for example, isothermal titration calorimetry. In a preferred embodiment, the polyplexes are formed through the sequential binding between PHMB or PHMG and the CpG ODN.

It will be apparent that the stability of the polyplex depends on the charge of the molecules, for example the charge of the PHMB or PHMG and the immunomodulatory agent, for example the immunomodulatory nucleic acid, for example the CpG ODN, as well as environmental conditions, such as temperature, pH, buffer concentration and type.

The polyplexes may have any shape. In one embodiment, the polyplexes may be cylindrical in shape. In another embodiment the polyplexes may be rod-shaped. In a preferred embodiment, the polyplexes are spherical in shape. For example, in one embodiment between 20% and 100% of the polyplexes are spherical, for example between 30% and 98% of the polyplexes are spherical, for example between 40% and 95% of the polyplexes are spherical, for example between 50% and 90% of the polyplexes are spherical, for example between 60% and 80% of the polyplexes are spherical, for example between 70% and 75% of the polyplexes are spherical. In a preferred embodiment 100% of the polyplexes are spherical. Where the polyplex comprises PHMB and CpG, it is considered that about 90% or more of the polyplexes are spherical, for example more than 90% of the polyplexes are spherical.

The uptake into cells of the immunomodulatory agent, for example an immunomodulatory nucleic acid, for example CpG ODN, is considered to be improved by the formation of the polyplex with PHMB or PHMG. In one embodiment, the uptake of PHMB or PHMG is not affected by polyplex formation. Techniques to monitor uptake of the polyplex will be apparent to the skilled person, and include the use of flow cytometry and microscopy, as detailed in the examples.

In a preferred embodiment, the polyplex formation causes an increase in the amount of CpG ODN taken up by cells, for example by macrophages. An example of how this can be assayed is given in the examples. In one embodiment, the amount of CpG ODN taken in by cells, for example by macrophages, as part of a PHMB or PHMG:CpG ODN polypiex compared to free CpG ODN is increased between 2 and 50 fold, for example between 5 and 40 fold, for example between 10 and 30 fold, for example between 15 and 25 fold, for example 20 fold. In one embodiment, the amount of CpG ODN taken in by cells, for example by macrophages, as part of a PHMB or PHMG:CpG ODN polypiex compared to free CpG ODN is increased by 15 fold.

By the term "free" we include the meaning of, for example, an immunomodulatory agent, for example a CpG ODN in the absence of PHMB or PHMG. Likewise, free PHMB or PHMG is taken to include in its meaning PHMB or PHMG in the absence of, for example, an immunomodulatory agent, for example an immunomodulatory nucleic acid, for example in the absence of a CpG ODN. In a preferred embodiment, uptake of PHMB or PHMG as part of the polypiex is not enhanced, relative to the free form.

One embodiment provides a method of improving uptake of an immunomodulatory agent into a cell wherein the method comprises contacting the cell with an immunomodulatory agent and PHMB or PHMG. The immunomodulatory agent may be a CpG ODN or any of the immunomodulatory agents described herein. The cell may be any cell, for example may be a cancer cell or a cell of a subject with asthma or allergic diseases, or any other cell described herein. The method for improving uptake of an immunomodulatory agent into a cell results in cell taking in more immunomodulatory agent than is taken in by a cell in the absence of PHMB or PHMG. In one embodiment the PHMB or PHMG is in a complex with the immunomodulatory agent. Preferences for a complex, or polypiex, or PHMB or PHMG and an immunomodulatory agent as as described herein.

It is considered beneficial if the toxicity towards the host cell, for example the mammalian cell, for example the macrophage, of the polypiex is less than the toxicity of PHMB or PHMG in free form. Appropriate assays to determine the relative toxicity of the polypiex and free PHMB or PHMG will be apparent to the skilled person, and an example of such an assay is given in the methods. For example, the IC50 of each particular agent, for example PHMB, and a particular polypiex can be determined against any particular cell type, for example against bone derived macrophages and/or epithelial cells, for example 293T epithelial cells. It is preferred therefore that the IC50 of the polyplex is higher than the IC50 of the free PHMB or PHMG. For example, the IC50 of the polyplex may be between 2 times higher and 200 times higher, for example between 3.5 times higher and 150 times higher, for example between 7 times higher and 100 times higher, for example between 10 times higher and 50 times higher, for example between 12.5 times higher and 49 times higher than the IC50 of the free PHMB or PHMG.

The polyplexes of the invention are considered to show enhanced antipathogenic activity towards intracellular microorganisms relative to the activity of PHMB or PHMG alone. The skilled person will appreciate the relevant techniques to assess the anti-microorganism activity of the relevant agents, some of which are exemplified in the examples. In one embodiment the anti-microorganism activity towards intracellular microorganisms of the polyplex is monitored via assessment of the IC50. For example, in one embodiment the IC50 of the polyplex is between 1.25 and 10 times lower than the IC50 for free PHMB or PHMG, for example is between 1.4 and 9 times lower, for example between 2 and 8 times lower, for example between 3 and 7 times lower, for example between 3.57 and 7 times lower, for example between 4 and 6 times lower, for example 5 times lower than the IC50 for free PHMB or PHMG. In one embodiment, wherein the cell under investigation is a L. major amastigote, the IC50 of the polyplex is 4 times lower, or 3.33 times lower, or 1.4 times lower than the IC50 for free PHMB or PHMG.

It will be appreciated that in any given polyplex formulation, the relative amounts of PHMB or PHMG and the immunomodulatory agent, for example an immunomodulatory nucleic acid, for example a CpG ODN, can vary. In one embodiment the molar ratio of PHMB or PHMG to immunomodulatory agent, for example an immunomodulatory nucleic acid is between 5:1 and 1:5, for example between 4:1 and 1:4, for example between 3:1 and 1 :3, for example between 2:1 and 1:2, for example 1:1. In a preferred embodiment, the molar ratio is between 2:1 and 1.5:1. It will also be appreciated that the relative amounts of PHMB or PHMG and the immunomodulatory agent, for example an immunomodulatory nucleic acid, for example a CpG ODN influences the properties of the polyplex. For example, it is considered that the higher the amount of PHMB or PHMG in the polyplex, the higher the toxicity, towards both animal cells, for example mammalian cells, for example towards macrophages, and towards intracellular microorganisms, for example parasites, for example towards leishmania. Equally, as the proportion of immunomodulatory agent, for example an immunomodulatory nucleic acid, for example a CpG ODN increases, the toxicity is reduced. PHMB or PHMG are not considered to be particularly toxic compounds, and the inventors have found that PHMB or PHMG are far more toxic to intracellular microorganisms, for example intracellular parasites than they are to mammalian cells at equivalent concentrations. Thus, in the treatment of an infection by an intracellular microorganism, it is considered that polyplexes with a higher proportion of PHMB or PHMG relative to the immunomodulatory agent, for example an immunomodulatory nucleic acid are preferred. Therefore, in one embodiment, the invention provides a polyplex comprising PHMB or PHMG and an immunomodulatory agent, for example an immunomodulatory nucleic acid, for example a CpG ODN, wherein the ratio of PHMB or PHMG to immunomodulatory nucleic acid, for example a CpG ODN, is at least 10:1 , for example 8:1, for example between 5:1 and 1:1, for example between 4:1 and 1:1, for example between 3: 1 and 1:1, for example between 2:1 and 1:1.

The agents of the invention are believed to be useful for use in preventing a subject from being infected with an intracellular microorganism, for example an intracellular protozoa, or an intracellular bacteria, or an intracellular fungi. The agents, for example the compositions and polyplexes disclosed herein may be administered a subject who does not have an infection by an intracellular microorganism, for example an intracellular protozoa, or an intracellular bacteria, or an intracellular fungi. For example, the agents may be administered to a subject who is deemed to be at particular risk from infection by an intracellular microorganism, for example an intracellular protozoa, or an intracellular bacteria, or an intracellular fungi, for example if they are immunocompromised, or if they are travelling to an area of the world in which infection is more probable. Thus the invention provides a composition comprising PHMB or PHMG and one or more immunomodulatory agents for use in preventing infection of a subject by an intracellular microorganism, for example an intracellular protozoa, or an intracellular bacteria, or an intracellular fungi. The invention also provides a polyplex comprising PHMB or PHMG and one or more immunomodulatory agents for use in preventing infection of a subject by an intracellular microorganism, for example an intracellular protozoa, or an intracellular bacteria, or an intracellular fungi.

It is also considered that a composition comprising PHMG or PHMG and one or more immunomodulatory agents enhances immune cell activation. For example the composition of the invention is considered to enhance activation of one or more of a macrophage, a dendritic cell, a plasmacytoid-dendritic cell or a tumour associated macrophage. Therefore, the invention also provides a composition comprising PHMB or PHMG for use in treating a subject infected with an intracellular microorganism, for example an intracellular protozoa, or an intracellular bacteria, or an intracellular fungiwherein the composition enhances immune cell activation. In one embodiment the invention also provides a composition comprising PHMB or PHMG for use in treating a subject infected with an intracellular microorganism, for example an intracellular protozoa, or an intracellular bacteria, or an intracellular fungiwherein the composition comprises one or more further therapeutic agents, and for example wherein at least one of the further therapeutic agents is an immunomodulatory agent, and for example, wherein at least one of the immunomodulatory agents is an unmethylated CpG oligodeoxynucleic acid, wherein the composition enhances immune cell activation, for example enhances activation of one or more of a macrophage, a dendritic cell, a plasmacytoid-dendritic cell or a tumour associated macrophage.

By enhancing immune cell activation we include the meaning of enhancing the activation of any immune cell, for example a dendritic cell, a plasmacytoid-dendritic cell or a tumour associated macrophage. By the phrase enhancing activation, we include the meaning of enhancing any activity of the cell that relates to its role in immunity. For example, methods and preferences described above in relation to identifying whether an agent is capable of stimulating the immune system apply equally here. Techniques to monitor the ability of an agent to enhance the activation of an immune cell are well known to the skilled person and are exemplified in the examples. For example, the concentrations of key cytokines can be measured, for example by ELISA, from the supernatants of cells, for example bone derived macrophages, cultured with the relevant agent, for example free immunomodulatory agent, for example CpG ODN and polyplexed immunomodulatory agent, for example CpG ODN. Key cytokines that may be monitored include IL6, IL10, IL4, TNFcc and IL12, amongst others.

The enhancement of immune cell activation may be carried out in vivo, i.e. it may be as part of a treatment regime in which the subject is administered the agent or composition of the invention. The enhancement of immune cell activation may also be carried out in vitro or ex vivo. For example, in one embodiment, the enhancement of immune cell activation is with the aim of stimulating the immune cell to make one or more particular proteins or factors, which may for example then be purified and used therapeutically. In another embodiment, the enhancement of immune cell activation may be carried out on immune cells, or other cells, taken from a subject, with the intention of placing the immune cells or other cells back into the subject. Thus the invention provides an in vitro method for the enhancement of immune cell activation wherein the immune cells are contacted with the agents or compositions of the invention. The invention also provides an ex vivo method for the enhancement of immune cell activation wherein the immune cells are contacted with the agents or compositions of the invention.

In a further embodiment, the composition stimulates the innate immune response.

In yet a further embodiment, the composition is formulated to further enhance uptake by immune cells, for example macrophages or dendritic cells. For example the composition, for example the polyplexes, may be "coated" with ligands that help target particles to particular cell types. For example, in one embodiment, the polyplexes are coated with Hyaluronic acid to enhance targeting to macrophage, a strategy which is well known to the skilled person. Similarly mannose receptors are only found on immune cells such as macrophages. Therefore, in one embodiment the composition is mannosylated. In another embodiment the composition further comprises mannose. The invention also provides a method of treating a subject infected with an intracellular microorganism, for example an intracellular protozoa, or an intracellular bacteria, or an intracellular fungicomprising administration of a composition comprising PHMB or PHMG.

Additionally, the invention provides the use of a composition comprising PHMB or PHMG in the manufacture of a medicament for treating a subject infected with an intracellular microorganism, for example an intracellular protozoa, or an intracellular bacteria, or an intracellular fungi.

It will be appreciated that situations may arise in which a subject is already being treated with one or more therapeutic agents, for example, is being treated with an anti- microorganism agent, for example an anti-protozoan agent, an antibacterial agent or an antifungal agent. Alternatively, the subject may be treated with the agents and compositions of the invention, with the intention that they will be later treated with another agent, for example another anti-microorganism agent, for example an anti-protozoan agent, an antibacterial agent or an antifungal agent. Thus the invention provides PHMB or PHMG for use in treating a subject infected with an intracellular microorganism, for example an intracellular protozoan, or an intracellular bacteria, or an intracellular fungi, wherein the subject has been, or will be, administered a further therapeutic agent, for example wherein the further therapeutic agent is an anti-microorganism agent, for example an anti-protozoan agent, an antibacterial agent or an antifungal agent. Also provided is a composition comprising PHMB or PHMG for use in treating a subject infected with an intracellular microorganism, for example an intracellular protozoan , or an intracellular bacteria, or an intracellular fungiwherein the composition comprises one or more further agents, for example one or more therapeutic agents, for example at least one immunomodulatory agent, for example a CpG ODN, wherein the subject has been, or will be, administered a further therapeutic agent, for example wherein the further therapeutic agent is an anti-microorganism agent, for example an anti-protozoan agent, an antibacterial agent or an antifungal agent. Also claimed is an anti-microorganism agent, for example an anti-protozoan agent, an antibacterial agent or an anti-fungal agent for use in the treatment of a subject infected by an intracellular microorganism, for example an intracellular protozoan, or an intracellular bacteria, or an intracellular fungi wherein the subject has been or will be administered PHMB or PHMG, or a composition according to any aspect or embodiment of the invention.

By an anti-microorganism agent, for example an anti-protozoan agent, an anti-bacterial agent or an anti-fungal agent we include the meaning of any agent used to treat an infection causes by a microorganism, for example by a protozoa, a bacteria or a fungi, whether intracellular or extracellular. Such agents will be well known to those in the art, and include paromomycin, miltefosine, pentamidine, pentavalent antimonials, fluconazole, itraconazole, or amphotericin B.

The subject may have been administered the anti-microorganism therapeutic at any time prior to administration of PHMB or PHMG, or a composition according to any aspect or embodiment of the invention. For example, the anti-microorganism therapeutic may have been administered between 1 month, 2 weeks, 1 weeks, 5 days, 4 days, 3 days, 2 days,

1 day, 12 hours, 10 hours, 8 hours, 6 hours, 4 hours, 2 hours, 1 hours or 30 minutes before administration of PHMB or PHMG, or a composition according to any aspect or embodiment of the invention. Alternatively, the anti-microorganism therapeutic may be administered to the subject at any time after the administration of an anti-pathogenic microorganism therapeutic, for example may have been administered between 1 month,

2 weeks, 1 weeks, 5 days, 4 days, 3 days, 2 days, 1 day, 12 hours, 10 hours, 8 hours, 6 hours, 4 hours, 2 hours, 1 hours and 30 minutes after administration of PHMB or PHMG, or a composition according to any aspect or embodiment of the invention.

The inventors have found that independently of the use of PHMB or PHMG in treating microorganism infections, the combination of PHMB or PHMG with immunomodulatory nucleic acids has surprising properties. These agents in combination form polyplexes, which significantly increases the amount of CpG taken into cells, whilst reducing the level of toxicity of the PH B or PHMG. The inventors have recognised that from these unexpected findings, the polyplexes, or composition comprising PHMB or PHMG have utility in a wide range of medical applications.

For example, immunomodulatory agents such as CpG ODNs are used in the treatment of cancer and asthma. CpG ODNs have been shown to provide protection against infectious diseases, allergy and cancer.

As discussed above, PHMB or PHMG form polyplexes with advantageous properties with immunomodulatory agents, such as immunomodulatory nucleic acids, such as CpG ODNs. Thus, in one aspect the invention provides a composition comprising PHMB or PHMG and one or more immunomodulatory agents.

Preferences for the composition and immunomodulatory agent are as described above for earlier aspects of the invention.

In a particular embodiment, the immunomodulatory agent is an unmethylated CpG oligodeoxynucleotides (ODNs), and therefore the invention provides a composition comprising PHMB or PHMG and one or more unmethylated CpG oligodeoxynucleotides (ODNs).

In a preferred embodiment, the PHMB or PHMG binds to the unmethylated CpG ODN and forms a polyplex. Thus, the invention provides a polyplex comprising PHMB or PHMG and one or more unmethylated CpG ODNs.

Preferences for the polyplexes and the CpG ODNs are discussed above in relation to earlier aspects of the invention.

It will be appreciated that the composition comprising PHMB or PHMG and one or more immunomodulatory agents, and the polyplex comprising PHMB or PHMG and one or more immunomodulatory agents may further comprise: a therapeutic agent, and/or

one or more pharmaceutically acceptable excipients, and/or

an adjuvant. In a further aspect the invention provides a composition comprising PHMB or PHMG and one or more immunomodulatory agents for use in treating a subject infected with an intracellular microorganism, for example an intracellular protozoa, or an intracellular bacteria, or an intracellular fungi.

In yet another aspect the invention also provides a polyplex comprising PHMB or PHMG and one or more immunomodulatory agents for use in treating a subject infected with an intracellular microorganism, for example an intracellular protozoa, or an intracellular bacteria, or an intracellular fungi.

Preferences for these aspects of the invention are as described above in relation to earlier aspects and embodiments of the invention. The novel finding that PHMB or PHMG can kill intracellular parasites, in combination with the stimulation of the innate immune system by an immunomodulatory agent, for example a CpG ODN has significant implications for the treatment of subjects infected by intracellular microorganisms, for example an intracellular protozoa, or an intracellular bacteria, or an intracellular fungi, in particular those wherein the infection is in the skin, or causes a wound, as immunomodulatory agents such as CpG ODN are capable of accelerating wound repair as well as stimulating the innate immune system for leishmaniacidal activity (Yamamoto ef al 2010, Gerit ef al 2007).

Sato et al show that CpG ODNs applied to a wound site causes an influx of macrophages to the site and wound closure and a reduction in total wound area of more than 40%."K" type CpG ODNs rather than "D" type CpG ODNs were implicated in accelerated tissue repair in Macaques. Activation of TLR4 is also implicated in accelerated tissue repair (Yamomoto ef al). In such cases the microorganism is considered to be killed via several routes: 1) directly by PHMB or PHMG; 2) by the enhanced action of the immune system due to stimulation by the CpG ODN, which itself will be enhanced by polyplex formation with the PHMB or PHMG (i.e. PHMB or PHMG enhances delivery of the CpG ODN to the macrophage); and 3) the wound closure will be accelerated, reducing the likelihood of further opportunistic infection. Thus, in one embodiment, the invention provides agents and compositions, for example PHMB or PHMG and one or more immunomodulatory agents, for example a CpG ODN, for example in a polyplex, for use in healing a wound, or treating a wound, or aiding in wound repair.

By wound we include the meaning of any wound anywhere in the body. For example the wound may be in the skin, the nose, the mouth, the ear, the vagina or the eye, and for example the intracellular microorganism may be an intracellular parasite and may be Leishmania major, or the intracellular microorganism may be an intracellular bacteria and may be Staphylococcus aureus for example MRSA. In such instances, it is preferable if the composition which comprises PHMB or PHMG and one or more immunomodulatory agents is applied topically to the skin the nose, the mouth, the ear, the vagina or the eye. In addition the composition may be applied locally by "instillation" which is useful for example wherein the composition is administered to the bladder or the lung. It is even more preferred if the composition comprises a CpG ODN or lipopolysaccharide (LPS) from Gram-negative bacteria.

Therefore, in one embodiment, where the intracellular microorganism causes a wound, the immunomodulatory agent is a CpG ODN. Preferably where the intracellular microorganism causes a wound, the CpG ODN is a K type rather than a D type. In another embodiment, where the intracellular microorganism causes a wound, the immunomodulatory agent activates the TLR4 receptor, for example the immunomodulatory agent is lipopolysaccharide (LPS) from Gram-negative bacteria. In a further embodiment, where the intracellular microorganism causes a wound in the skin, the composition comprising PHMB or PHMG and one or more further agents, for example one or more immunomodulatory agents, for example one or more CpG ODNs is suitable for topical administration and is directly applied to the wound. The invention therefore also provides a composition comprising PHMB or PHMG and one or more immunomodulatory agents, for example one or more immunomodulatory nucleic acids, for example one or more CpG ODNs for use in treating cutaneous Leishmaniasis or Staphylococcus aureus for example MRSA.

In a further aspect, the invention provides a composition comprising PHMB or PHMG and one or more immunomodulatory agents for use in wound repair, independently of the presence or absence of intracellular microorganisms. In any of these embodiments relating to a skin wound, the composition may also comprise other agents known to accelerate wound closure, for example may comprise Imiquimod.

It will be appreciated that due to the nature of the composition comprising PHMB or PHMG and one or more immunomodulatory agents and the polyplex comprising PHMB or PHMG and one or more immunomodulatory agents, these agents have utility in any disease or condition in which the immune system requires stimulation. The inventors have shown that the polyplex comprising PHMB or PHMG and one or more immunomodulatory agents, for example CpG ODN delivers more of the immunomodulatory agent, for example CpG ODN into cells, for example into macrophages, than when CpG ODN is administered alone.

This surprising finding therefore results in a novel composition or polyplex which has the advantage of increased delivery of immunomodulatory agents.

Immunomodulatory agents such as the PAMPs and DAMPs are also considered to have utility in treating cancer. The innate immune system is involved in the growth of tumours and the presence of macrophages in the tumor milieu is believed to be a major contributor to the chronic inflammation that renders an immune suppressive environment benefiting tumor growth (Liu et al).

Some drugs are also believed to induce immune activation and indirectly produce DAMPs or potentially PAMPs. For example anticancer drugs such as bleomycin, cyclophosphamide, doxorubicin, mitoxantrone, oxaliplatin, daunorubicin, docetaxel, TNP- 470 and paclitaxel induces immunogenic cell death. These dead cells are used to activate immune cells for effective immunotherapy. In parasites, such immunogenically dead pathogens can be used as vaccination or immunotherapy. Similarly, most of the antileishmanial drugs fully or partially depend on immune system. Macrophages express both activating and inhibitory Fc y R simultaneously. Activating Fc y R stimulate cytotoxicity to tumor cells. In contrast, Fc y RUB is the only inhibitory receptor on macrophages in mice, which is responsible for inhibitory effects on macrophage including inhibition of phagocytosis, decreased cytokine release, superoxide production, and blocking Toll-like receptor 4 (TLR4) signaling pathway (Liu ef af). Targeting the TLR receptors is one strategy for the development of cancer therapeutics. So far, TLR agonists approved by the FDA for clinical use in cancer treatment consist of the classic Bacillus Calmette-Guein (mycobacterium mixture) targeting TLR2, TLR4, and TLR9 for bladder cancer, Imiquimod (small-molecule single-stranded RNA) targeting TLR7 for superficial basal cell carcinoma, and the AS04 adjuvant system (detoxified lipid A on aluminium hydroxide) targeting TLR4 for human papillomavirus as a prophylactic cervical cancer vaccine. Several other TLR agonists, such as CpG oligodeoxynucleotides and polyriboinsinic-polyribocytidylic acid targeting TLR9, and flagellin-protein fusions targeting TLR5 are being actively evaluated as adjuvants in multiple cancer indications. For example, a small single stranded RNA molecule based TLR7 agonist, 852A, stimulates immature DC to produce multiple cytokines including IFN a in vitro and in vivo. It is now being evaluated in a Phase II clinical trial for treatment of inoperable melanoma. There are also numerous efforts to discover new TLR agonists with low toxicities and improved systemic anti-tumor effects from natural product extracts analysis and structural modifications.

All of the applications for the above molecules are considered to be enhanced by improved uptake of the immunomodulatory agent. Thus, the invention provides a composition or a polyplex comprising PHMB or PHMG and one or more immunomodulatory agents, for use in treating cancer. Preferences for the one or more immunomodulatory agents are as defined above in relation to earlier aspects of the invention. In particular where the composition is for use in treating cancer in addition to the PAMPs and DAMPs described above, the immunomodulatory agent may be any one or more of Bacillus Calmette-Guein, Imiquimod, AS04 adjuvant system, flagellin- protein fusions, or 852A.

The anti-tumour effect of CpG ODNs in weakly immunogenic tumours are mainly mediated by macrophages, as opposed to T cells (Lin et al 2013). CpG ODNs can directly inhibit the immunosuppressive functions of myeloid derived suppressor cells ( DSCs) and cause them to differentiate into macrophages with anti-tumour activity. CpG ODNs can also indirectly stimulate plasmacytoid dendritic cells to produce interferon alpha which in turn promotes MDSC differentiation. In particular, it is preferred if the immunomodulatory agent is a TLR9 agonist, for example a CpG ODN.

By a subject with cancer we include the meaning of subjects who have received a positive diagnosis of cancer, for example from a physician. The cancer may be benign or metastatic, it may be a primary cancer or a secondary cancer. The cancer may be a solid tumour or a blood borne tumour. The cancer may relate to diseases of skin tissues, organs, blood, and vessels, such as cancers of the bladder, bone, blood, brain, breast, cervix, chest, colon, endometrium, oesophagus, eye, gastrointestinal tract, head, kidney, liver, lymph nodes, lung, mouth, neck, ovaries, pancreas, prostate, rectum, stomach, testis, throat, and uterus.

In certain embodiments the cancer is a blood borne cancer. The blood borne cancer may be metastatic. Examples of blood borne cancers include Hodgkin's and Non-Hodgkin's Lymphoma, Burkitt's lymphoma, myeloma or lymphomas, Leukemia and plasma cell neoplasm. Chromosome 17p genetic diseases also include blood borne cancers such as promyelocytic leukaemia which has a translocation at 17p.

In other embodiments, the cancer is a solid tumour. The solid tumour may be metastatic. An example of a solid tumour includes inflammatory breast cancer, neuroblastoma, uterine corpus, mature b-cell neoplasm, endocervical carcinoma, endocervicitis, sinus cancer, sclerosing adenosis of breast, maxillary sinus cancer, bronchiolo-alveolar adenocarcinoma, vulva basal cell carcinoma, diffuse large b-cell lymphoma of the central nervous system, chromosome 17p deletion diseases, cerebral primitive neuroectodermal tumor, medullomyoblastoma, large-cell, immunoblastic, primitive neuroectodermal tumor, osteosarcoma, somatic childhood medulloblastoma, plasma cell neoplasm, hepatic angiomyolipoma, Retinoblastoma, melanoma, small cell lung cancer and lung cancer myeloma. In particular examples the cancer is basal cell carcinoma, bladder cancer cell or cervical cancer.

In one embodiment, the cancer is metastatic colorectal carcinoma and the immunomodulatory agent is a dSLIM.

It is preferred if where the cancer is skin cancer, the composition or polyplex is formulated to be suitable for topical application, for example as a cream, gel or serum.

It will be appreciated that the composition or polyplex may be administered with one or more further agents, for example further anticancer agents, such as dacarbazine, vinblastine, vincristine, vindesine, temozolomide, interferon, interleukin, bleomycin, cyclophosphamide, doxorubicin, mitoxantrone, oxaliplatin, daunorubicin, docetaxel, TNP- 470 and paclitaxel. The subject may be one that has already been treated with one or more other therapeutic agents, such as one or more other anti-cancer agents. Therefore the invention provides a composition comprising PHMB or PHMG and one or more immunomodulatory agents for use in treating a subject with cancer, wherein the subject has already been administered one or more therapeutic agents, for example one or more anti-cancer agents.

The subject may be administered the further therapeutic at any time prior to administration of the composition comprising PHMB or PHMG and one or more immunomodulatory agents. For example, the further therapeutic may be administered between 1 month, 2 weeks, 1 weeks, 5 days, 4 days, 3 days, 2 days, 1 day, 12 hours, 10 hours, 8 hours, 6 hours, 4 hours, 2 hours, 1 hours or 30 minutes prior to the administration of the composition comprising PHMB or PHMG and one or more immunomodulatory agents.

The invention also provides a polyplex comprising PHMB or PHMG and one or more immunomodulatory agents for use in treating a subject with cancer, wherein the subject has already been administered one or more therapeutic agents, for example one or more anti-cancer agents.

The subject may be administered the further therapeutic at any time prior to administration of the polyplex comprising PHMB or PHMG and one or more immunomodulatory agents. For example, the further therapeutic may be administered between 1 month, 2 weeks, 1 weeks, 5 days, 4 days, 3 days, 2 days, 1 day, 12 hours, 10 hours, 8 hours, 6 hours, 4 hours, 2 hours, 1 hours or 30 minutes prior to the administration of the polyplex comprising PHMB or PHMG and one or more immunomodulatory agents

The subject may be one that is going to be treated with one or more further therapeutic agents, such as one or more other anti-cancer agents. Therefore the invention provides a composition comprising PHMB or PHMG and one or more immunomodulatory agents for use in treating a subject with cancer, wherein the subject will be administered one or more therapeutic agents, for example one or more anti-cancer agents.

The subject may be administered the further therapeutic at any time following administration of the composition comprising PHMB or PHMG and one or more immunomodulatory agents. For example, the further therapeutic may be administered between 1 month, 2 weeks, 1 weeks, 5 days, 4 days, 3 days, 2 days, 1 day, 12 hours, 10 hours, 8 hours, 6 hours, 4 hours, 2 hours, 1 hours or 30 minutes after the administration of the composition comprising PHMB or PHMG and one or more immunomodulatory agents.

The invention also provides a polyplex comprising PHMB or PHMG and one or more immunomodulatory agents for use in treating a subject with cancer, wherein the subject has been administered one or more therapeutic agents, for example one or more anticancer agents.

The subject may be administered the further therapeutic at any time following administration of the polyplex comprising PHMB or PHMG and one or more immunomodulatory agents. For example, the further therapeutic may be administered between 1 month, 2 weeks, 1 weeks, 5 days, 4 days, 3 days, 2 days, 1 day, 12 hours, 10 hours, 8 hours, 6 hours, 4 hours, 2 hours, 1 hours or 30 minutes after the administration of the polyplex comprising PHMB or PHMG and one or more immunomodulatory agents.

The invention also provides a method of treating a subject with cancer wherein the method comprises administration of a composition comprising PHMB or PHMG and one or more immunomodulatory agents, for example a CpG ODN. The invention also provides a method of treating a subject with cancer wherein the method comprises administration of a polyplex comprising PHMB or PHMG and one or more immunomodulatory agents, for example a CpG ODN.

Further, the invention provides a composition comprising PHMB or PHMG and one or more immunomodulatory agents, for example a CpG ODN for use in the manufacture of a medicament for treating cancer. In addition, herein is provided a polyplex comprising PHMB or PHMG and one or more immunomodulatory agents, for example a CpG ODN for use in the manufacture of a medicament for treating cancer.

It will be appreciated that the preferred mode of administration will depend on the nature of the cancer. For blood-borne cancers, it is preferable if the compositions or polyplexes of the invention are administered systemically, for example directly into the blood stream. Where the tumour is a solid tumour, it is preferable if the compositions and polyplexes of the invention are injected intratumourally. Where the cancer is a skin cancer, it is preferable if the compositions and polyplexes of the invention are administered topically, for example as a cream, gel or serum. TLR agonists are also considered to be useful as adjuvants in cancer vaccines based on their ability to induce maturation of antigen presenting cells. Thus, in one aspect, the invention provides a composition or a polyplex comprising PHMB or PHMG and one or more immunomodulatory agents, for use in preventing cancer, for example for use as a cancer vaccine. Preferences for the one or more immunomodulatory agents are as defined above. They can also combine with chemotherapy, radiotherapy or monoclonal antibodies to improve efficacy (Liu et al).

Immunomodulatory agents such as PAMPs and DAMPs are also proposed as a therapeutic for the treatment of diseases characterized by inappropriate levels of inflammation, such as allergic diseases, asthma and HIV. Enhanced delivery of these agents into cells, for example macrophages, is considered to improve the immune response of the subject and result in alleviation of disease and/or symptoms. There are several subtypes of adult asthma 1 ) early onsef a/lergic asthma with specific IgE and Th2 cytokine dominance (atopic asthma); 2) eosinophil! type of adult onset showing corticosteroid refractory, less allergic tendency but still high IL-5 concentration; m3) exercise-induced mild intermittent type of Th2 dominancy and mast cell activation; 4) obesity-related adult onset without evidence of Th2 activation; and 5) neutophilic types with low forced expiratory volume. Types 4 and 5 are considered to probably involve activation of the inflammasome.

Asthma has been linked with reduced early-life exposure to microbes and microbial products. It is considered that early exposure to antigens prevents asthma and allergies by skewing the immune response away from Th2 cytokines (Lee et al 2014). Although bacterial infections are associated with worsening of airflow obstruction in chronic obstructive pulmonary disease and cystic fibrosis, exposure to microbes can actually be preventative against asthma due to activation of the immune system. T lymphocytes are a major source of cytokines. These cells bear antigen specific receptors on their cell surface to allow recognition of foreign pathogens. They can also recognise normal tissue during episodes of autoimmune diseases. There are two main subsets of T lymphocytes, distinguished by the presence of cell surface molecules known as CD4 and CD8. T lymphocytes expressing CD4 (helper T cells) are regarded as being the most prolific cytokine producers. This subset can be further subdivided into Th1 and Th2, and the cytokines they produce are known as Th1-type cytokines and Th2-type cytokines (Berger et al BMJ 2000; 321 doi: http://dx.doi.org/10.1136/bmj.321.7258.424 (Published 12 August 2000) Cite this as: BMJ 2000;321:424).

Th1-type cytokines tend to produce the proinflammatory responses responsible for killing intracellular parasites and for perpetuating autoimmune responses. Interferon gamma is the main Th1 cytokine. Excessive proinflammatory responses can lead to uncontrolled tissue damage, so there needs to be a mechanism to counteract this. The Th2-type cytokines include interleukins 4, 5, and 13, which are associated with the promotion of IgE and eosinophilic responses in atopy, and also interleukin-10, which has more of an anti- inflammatory response. (Berger et al BMJ 2000; 321 doi: http://dx.doi.Org/10.1136/bmj.321.7258.424 (Published 12 August 2000) Cite this as: BMJ 2000;321 :424).

Atopic disorders are associated with a Th2 pattern of immune responses, characterized by elaboration of the cytokines IL-4, IL-5, and IL-13 amongst others (Kline ef al 2007). These cytokines directly induce many of the manifestations of atopic inflammation, such as B-cell isotype switching to IgE production, eosinophil chemotaxis and activation and airway-specific responses such as increased bronchial hyperreactivity. It is considered that redirecting allergic Th2 responses in favour of Th1 responses is beneficial in reducing the incidence of atopy (Berger ef al BMJ 2000; 321 doi: http://dx.doi.Org/10.1136/bmj.321.7258.424 (Published 12 August 2000) Cite this as: BMJ 2000;321 :424).

Therefore one embodiment provides a composition or polyplex comprising PHMB or PHMG and one or more immunomodulatory agents, for use in driving the allergic Th2 response in favour of the Th1 response. Such immunomodulatory agents will be apparent to the skilled person and include those described herein. The skilled person is equipped to determine which agents are suitable for use, for example by conducting a simply ELISA to assess the cytokine profile produced upon application of the composition, of by assessing the mRNA produced and detected by, for example, PCR. Based on the type of IL produced, the skilled person will easily be able to determine whether a TH1 or a TH2 response is induced.

For example, the immunomodulatory agent may be any immunomodulatory agent as described above in relation to earlier aspects of the invention. For example, the immunomodulatory agent may be an immunomodulatory nucleic acid, for example may be a CpG ODN. The invention also provides a composition or polyplex comprising PHMB or PHMG and one or more immunomodulatory agents for use in treating a disease characterized by inappropriate levels of inflammation, for example an atopic disease, for example asthma or HIV.

By a disease characterised by inappropriate levels of inflammation we include the meaning of subjects who have received a positive diagnosis of asthma, allergic rhinitis, allergy or HIV. (Kline 2007, Poonia B (2013) Immunotherapy in HIV Infection. J Infect Dis Ther 1 :102. doi: 10.4172/2332-0877.1000102). Administration of immunomodulatory agents, such as CpG ODNs at the same time as particular antigens markedly suppressed subsequent development of allergen-induced eosinophilic airway inflammation, bronchial hyperresponsiveness and serum IgE elevation (Kline et al). Sensitisation to an allergen in the presence of a CpG ODN also reduced airway remodeling upon subsequent exposure. Further, administration of a combination of a CpG and the allergen in subjects that were already hypersensitive markedly reduced the inflammatory and physiological effects upon re-challenge.

Conjugation of ragweed pollen allergen (Amb a1) with a CpG ODN induces a Th1 response from peripheral blood mononuclear cells or ragweed allergic patients, whereas Amb a 1 alone stimulated a Th2 response. Protective antibody responses were directly proportional to the number of oligonucleotides conjugated to the allergen. (Kline et al) Injections of the combination improved peak-season rhinitis and daily nasal symptom scores.

It will therefore be appreciated that in some circumstances it is beneficial to administer additional agents, such as antigens to which subjects become allergic, such as ragweed antigens, such as Amb a1 , with the composition or polyplex of the invention. These agents may themselves be complexed with PHMB or PHMG. Thus the invention provides a composition or polyplex comprising PHMB or PHMB and one or more immunomodulatory agents, for example immunomodulatory nucleic acids, for example CpG ODN, and one or more further antigens, for example a ragweed antigen, for example Amb a1. The invention also provides a composition or polyplex comprising PHMB or PHMG and one or more immunomodulatory agents, for example immunomodulatory nucleic acids, for example CpG ODN, and one or more further antigens, for example a ragweed antigen, for example Amb a1 for use in treating or preventing asthma. In one embodiment the molar ratio of PHMB or PHMG to immunomodulatory agent, for example an immunomodulatory nucleic acid is between 5:1 and 1 :5, for example between 4:1 and 1 :4, for example between 3:1 and 1 :3, for example between 2:1 and 1:2, for example 1 :1. In one embodiment the molar ratio of immunomodulatory agent to antigen is between 4:1 and 1 :4, for example between 3:1 and 1:3, for example between 2:1 and 1 :2, for example 1:1.

In one embodiment the molar ratio of PHMB or PHMG to antigen is between 5:1 and 1 :5, for example between 4:1 and 1:4, for example between 3:1 and 1 :3, for example between 2:1 and 1 :2, for example 1 :1.

Moreover, treatment with a CpG ODN and one allergen has been shown to reduce inflammation and physiological changes upon exposure to a second, unrelated allergen. It will therefore be appreciated that enhanced delivery of the immunomodulatory agent, such as an immunomodulatory nucleic acid, such as a CpG ODN, by the use of PHMB or PHMG will enhance this effect, and such a composition can be used, in conjunction with an antigen, to treat unrelated atopic diseases. Thus the invention provides a composition or polyplex comprising PHMB or PHMB and one or more immunomodulatory agents, for example immunomodulatory nucleic acids, for example CpG ODN, and one or more further antigens, for example a ragweed antigen, for use in treating or preventing atopic disease. In addition, it is considered that PHMB or PHMG will enhance delivery of the antigen. Therefore, the invention provides a composition or polyplex comprising PHMB or PHMG and one or more antigens. The invention also provides a composition or polyplex comprising PHMB or PHMG and one or more antigens for use in a vaccine against atopic disease.

Antigens are also considered to be important in cancer vaccines. Therefore in one embodiment the invention provides a composition or polyplex comprising PHMB or PHMG and one or more antigens for use in a cancer vaccine. Another embodiment provides a composition or polyplex comprising PHMB or PHMB and one or more immunomodulatory agents, for example immunomodulatory nucleic acids, for example CpG ODN, and one or more further antigens, for use in treating or preventing cancer. It will be appreciated that the composition or polyplex may be administered with one or more further agents, for example further anti-inflammatory agents, or for example further allergens. The subject may be one that has already been treated with one or more other therapeutic agents, such as one or more other anti-inflammatory agents. Therefore the invention provides a composition or polyplex comprising PH B or PHMG and one or more immunomodulatory agents for use in treating a subject with a disease characterised by inappropriate levels of inflammation, wherein the subject has already been administered one or more therapeutic agents, for example one or more anti-inflammatory agents. The invention also provides a composition or polyplex comprising PHMB or PHMG and one or more immunomodulatory agents, for example immunomodulatory nucleic acids, for example CpG ODN, and one or more further antigens, for example a ragweed antigen, for example Amb alfor use in treating a subject with a disease characterised by inappropriate levels of inflammation, wherein the subject has already been administered one or more therapeutic agents, for example one or more anti-inflammatory agents.

The subject may be administered the further therapeutic at any time prior to administration of the composition or polyplex comprising PHMB or PHMG and one or more immunomodulatory agents, or the composition or polyplex comprising PHMB or PHMG and one or more immunomodulatory agents and one or more further antigens. For example, the further therapeutic may be administered between 1 month, 2 weeks, 1 weeks, 5 days, 4 days, 3 days, 2 days, 1 day, 12 hours, 10 hours, 8 hours, 6 hours, 4 hours, 2 hours, 1 hours or 30 minutes prior to the administration of the composition or polyplex comprising PHMB or PHMG and one or more immunomodulatory agents, or the composition or polyplex comprising PHMB or PHMG and one or more immunomodulatory agents and one or more further antigens.

The subject may be one that is going to be treated with one or more further therapeutic agents, such as one or more other anti-inflammatory agents. Therefore the invention provides a composition or polyplex comprising PHMB or PHMG and one or more immunomodulatory agents, or a composition or polyplex comprising PHMB or PHMG and one or more immunomodulatory agents and one or more further antigens, for use in treating a subject with a disease characterised by inappropriate levels of inflammation, wherein the subject will be administered one or more therapeutic agents, for example one or more anti-inflammatory agents. The subject may be administered the further therapeutic at any time following administration of the composition comprising PHMB or PHMG and one or more immunomodulatory agents, or the composition or polyplex comprising PHMB or PHMG and one or more immunomodulatory agents and one or more further antigens. For example, the further therapeutic may be administered between 1 month, 2 weeks, 1 weeks, 5 days, 4 days, 3 days, 2 days, 1 day, 12 hours, 10 hours, 8 hours, 6 hours, 4 hours, 2 hours, 1 hours or 30 minutes after the administration of the composition comprising PHMB or PHMG and one or more immunomodulatory agents, or the composition or polyplex comprising PHMB or PHMG and one or more immunomodulatory agents and one or more further antigens.

The invention also provides a method of treating a subject with a disease characterised by inappropriate levels of inflammation wherein the method comprises administration of a composition or polyplex comprising PHMB or PHMG and one or more immunomodulatory agents, or comprising PHMB or PHMG and one or more immunomodulatory agents and one or more further antigens, for example wherein the immunomodulatory agent is a CpG ODN.

Further, the invention provides a composition comprising PHMB or PHMG and one or more immunomodulatory agents, for example a CpG ODN for use in the manufacture of a medicament for treating a disease characterised by inappropriate levels of inflammation. Also, the invention provides a composition comprising PHMB or PHMG and one or more immunomodulatory agents, for example a CpG ODN, and one or more further antigens for use in the manufacture of a medicament for treating a disease characterised by inappropriate levels of inflammation.

Where the composition or polyplex is for use in treating a disease characterised by inappropriate levels of inflammation, it is preferred if the mode of administration results in direct contact of the composition of polyplex with the inappropriately inflamed site. For example, where the disease is asthma, it is preferred if the composition or polyplex is formulated for inhalation. In addition, intravenous injection is also considered beneficial in the treatment of asthma. Where the inappropriate inflammation is located in the skin, it is preferred if the composition or polyplex is for topical administration. As discussed above, the agents of the invention are considered to be useful in vaccination against a variety of diseases and conditions. Therefore, one aspect provides a composition as defined in any of the preceding embodiments for use as a vaccination, for example for use as a vaccination against intracellular parasites, cancer or a disease characterised by inappropriate levels of inflammation. In one embodiment the subject is exposed to the composition prior to exposure to one or more relevant antigens. For example, the subject may be administered a composition comprising PHMB or PHMG and one or more CpG ODNs prior to administration of an antigen, for example a cancer specific antigen, or prior to administration of an allergen, for example Amb a1.

It will be apparent that any agent which is for administration to a subject may be supplied as part of a kit. For example, the invention provides a kit of parts comprising PHMB or PHMG and one or more further agents, for example an endocytosis stimulator, an antimicrobial agent, for example an anti-parasitic agent, an anti-bacterial agent, an anti-fungal agent, an anti-cancer agent, an anti-inflammatory, an agent for treating asthma, an agent for treating allergic disease or an antigen. It will be appreciated that a more robust immune response may be achieved when more than one immunomodulatory agent is administered to a subject. This applies for any of the applications of such agents described above, for example in enhancing an immune response, activating an immune cell, treating a subject infected with an intracellular pathogen, treating cancer and treating a disease characterised by inappropriate levels of inflammation. Therefore the invention also provides a composition comprising more than one composition or polyplex as defined herein. For example, the composition may comprise between 1 and 50 different polyplexes, for example wherein the polyplex comprise PHMB or PHMG and one or more different agents, for example one or more immunomodulatory agents. For example the composition may comprise between 2 and 45 different polyplexes, for example between 3 and 40 different polyplexes, for example between 3 and 40 different polyplexes, for example between 4 and 35 different polyplexes, for example between 5 and 30 different polyplexes, for example between 6 and 25 different polyplexes, for example between 7 and 20 different polyplexes, for example between 8 and 19 different polyplexes, for example between 9 and 18 different polyplexes, for example between 10 and 17 different polyplexes, for example between 11 and 16 different polyplexes, for example between 12 and 5 different polyplexes, for example between 13 and 14 different polyplexes. Preferably the composition may comprise 1 , 2, 3, 4, 5, 6, 7, 8, 9 or 10 different polyplexes. The invention also provides the composition according to this embodiment of the invention for use in enhancing an immune response, activating an immune cell, treating a subject infected with an intracellular microorganism, preventing infection with an intracellular microorganism, treating or preventing cancer and treating or preventing a disease characterised by inappropriate levels of inflammation.

The invention also provides a further kit of parts comprising PHMB or PHMG and one or more immunomodulatory agents, for example an immunomodulatory nucleic acid, for example a CpG ODN.

A further kit of parts is provided which comprises a polyplex comprising PHMB or PHMG and one or more immunomodulatory agents, for example one or more immunomodulatory nucleic acids, for example one or more CpD ODNs, and one or more further agents such as an endocytosis stimulator, an anti- microbial agent, for example an anti-protozoan agent, an anti-bacterial agent, an anti-fungal agent, an anti-cancer agent, an antiinflammatory agent, an agent for treating asthma, an agent for treating allergic disease or an antigen.

Any of the kit of parts herein described may comprise one or more further therapeutic agents, for example an endocytosis stimulator an anti- microbial agent, for example an anti-protozoan agent, an anti-bacterial agent, an anti-fungal agent, an anti-cancer agent, and anti-inflammatory, an agent for treating asthma, or an agent for treating allergic disease.

It will be appreciated that any of the agents may be administered separately. The term composition covers separable agents which may be provided in a single form, i.e. mixed together and administered together, or may be provided in individual units for separate administration.

For example, in a further embodiment the invention provides for PHMB or PHMG and one or more immunomodulatory agents for use in treating a subject infected with an intracellular microorganism, for example an intracellular protozoa or an intracellular bacteria or an intracellular fungi, preventing infection with an intracellular microorganism for example an intracellular protozoa or an intracellular bacteria or an intracellular fungi, treating or preventing cancer, treating or preventing a disease characterised by inappropriate levels of inflammation. In this embodiment the PHMB or PHMG may be administered separately to the immunomodulatory agent. For example the PHMB or PHMG and the immunomodulatory agent may be provided in individual vials in a kit for separate administration. The PHMB or PHMG and the immunomodulatory agent may be administered sequentially or simultaneously. The PHMB or PHMG may be administered before the immunomodulatory agent or the immunomodulatory agent may be administered before the PHMB or PHMG. The time between administration of PHMG or PHMB and the immunomodulatory agent can be any period of time, for example 1 minute apart, 5 minutes apart, 10 minutes apart, 30 minutes apart, 1 hour apart, 2 hours apart, 3 hours apart, 5 hours apart, 12 hours apart, 24 hours apart, 2 days apart, 7 days apart, 2 weeks apart, 1 month apart or 2 months.

Alternatively, the PHMB or PHMG and the immunomodulatory agent are part of the same composition and the PHMB or PHMG and the immunomodulatory agent are administered at the same time. The composition may comprise equal amounts of PHMB or PHMG and immunomodulatory agent, or may comprise more PHMB or PHMG than immunomodulatory agent, or less PHMB or PHMG than immunomodulatory agent. For example the composition may comprise between 1x and 100x more PHMB or PHMG than immunomodulatory agent, for example between 1.5X and 90X, or between 2 X and 80x, or between 10X and 50X more PHMB or PHMG than immunomodulatory agent. Alternatively, the composition may comprise between 1x and 100x more immunomodulatory agent than PHMG or PHMB, for example between 1.5X and 90X, or between 2 X and 80x, or between 10X and 50X more immunomodulatory agent than PHMG or PHMB.

The agents (for example PHMB or PHMG; a composition comprising PHMG or PHMG; a composition comprising PHMG or PHMG and one or more immunomodulatory agents; a composition comprising PHMG or PHMG and one or more immunomodulatory agents and one or more antigens; a polyplex comprising PHMB or PHMG; a polyplex comprising PHMB or PHMG and an immunomodulatory agents; and a polyplex comprising PHMB or PHMG and an immunomodulatory agent and one or more antigens) of the invention will normally be administered in a manner most suitable to the desired result. For example where the intracellular microorganism, cancer, or disease characterised by inappropriate levels of inflammation are in the skin, for example, the agents are applied topically.

For application topically to the skin, the agents (for example PHMB or PHMG; a composition comprising PHMG or PHMG; a composition comprising PHMG or PHMG and one or more immunomodulatory agents; a composition comprising PHMG or PHMG and one or more immunomodulatory agents and one or more antigens; a polyplex comprising PHMB or PHMG; a polyplex comprising PHMB or PHMG and an immunomodulatory agents; and a polyplex comprising PHMB or PHMG and an immunomodulatory agent and one or more antigens) can be formulated as a suitable ointment containing the active compound suspended or dissolved in, for example, a mixture with one or more of the following: mineral oil, liquid petrolatum, white petrolatum, propylene glycol, polyoxyethylene polyoxypropylene compound, emulsifying wax and water. Alternatively, they can be formulated as a suitable lotion or cream, suspended or dissolved in, for example, a mixture of one or more of the following: mineral oil, sorbitan monostearate, a polyethylene glycol, liquid paraffin, polysorbate 60, cetyl esters wax, cetearyl alcohol, 2- octyldodecanol, benzyl alcohol and water.

Formulations suitable for topical administration in the mouth include lozenges comprising the active ingredient in a flavoured basis, usually sucrose and acacia or tragacanth; pastilles comprising the active ingredient in an inert basis such as gelatin and glycerin, or sucrose and acacia; and mouth-washes comprising the active ingredient in a suitable liquid carrier.

Generally, in humans, oral or topical administration of the agents (for example PHMB or PHMG; a composition comprising PHMG or PHMG; a composition comprising PHMG or PHMG and one or more immunomodulatory agents; a composition comprising PHMG or PHMG and one or more immunomodulatory agents and one or more antigens; a polyplex comprising PHMB or PHMG; a polyplex comprising PHMB or PHMG and an immunomodulatory agents; and a polyplex comprising PHMB or PHMG and an immunomodulatory agent and one or more antigens) is the preferred route, being the most convenient. In circumstances where the recipient suffers from a swallowing disorder or from impairment of drug absorption after oral administration, the drug may be administered parenterally, eg sublingually or buccally. Alternatively, the agents (for example PHMB or PHMG; a composition comprising PHMG or PHMG; a composition comprising PHMG or PHMG and one or more immunomodulatory agents; a composition comprising PHMG or PHMG and one or more immunomodulatory agents and one or more antigens; a polyplex comprising PHMB or PHMG; a polyplex comprising PHMB or PHMG and an immunomodulatory agents; and a polyplex comprising PHMB or PHMG and an immunomodulatory agent and one or more antigens) can be administered in the form of a suppository or pessary, or they may be applied topically in the form of a lotion, solution, cream, ointment or dusting powder. The compounds of the invention may also be transdermal^ administered, for example, by the use of a skin patch. They may also be administered by the ocular route, particularly for treating diseases of the eye. Where the subject is infected with an intracellular parasite and the intracellular parasite infects cells located towards the surface of the skin, or a depth through which topically applied agents can penetrate, it is preferred if the compositions or polyplexes of the invention are applied topically, for example as a cream, gel or serum. For example, where the disease is cutaneous leishmaniasis, the mode of application is preferably topical.

For ophthalmic use, the agents (for example PHMB or PH G; a composition comprising PHMG or PHMG; a composition comprising PHMG or PHMG and one or more immunomodulatory agents; a composition comprising PHMG or PHMG and one or more immunomodulatory agents and one or more antigens; a polyplex comprising PHMB or PHMG; a polyplex comprising PHMB or PHMG and an immunomodulatory agents; and a polyplex comprising PHMB or PHMG and an immunomodulatory agent and one or more antigens) can be formulated as micronised suspensions in isotonic, pH adjusted, sterile saline, or, preferably, as solutions in isotonic, pH adjusted, sterile saline, optionally in combination with a preservative such as a benzylalkonium chloride. Alternatively, they may be formulated in an ointment such as petrolatum.

Preferably, the formulation is a unit dosage containing a daily dose or unit, daily sub-dose or an appropriate fraction thereof, of the agent or active ingredient.

In human therapy, the agents (for example PHMB or PHMG; a composition comprising PHMG or PHMG; a composition comprising PHMG or PHMG and one or more immunomodulatory agents; a composition comprising PHMG or PHMG and one or more immunomodulatory agents and one or more antigens; a polyplex comprising PHMB or PHMG; a polyplex comprising PHMB or PHMG and an immunomodulatory agents; and a polyplex comprising PHMB or PHMG and an immunomodulatory agent and one or more antigens) can be administered alone but will generally be administered in admixture with a suitable pharmaceutical excipient diluent or carrier selected with regard to the intended route of administration and standard pharmaceutical practice.

For example, the agents can be administered orally, buccally or sublingually in the form of tablets, capsules, ovules, elixirs, solutions or suspensions, which may contain flavouring or colouring agents, for immediate-, delayed- or controlled-release applications. The compounds of invention may also be administered via intracavernosal injection.

Such tablets may contain excipients such as microcrystalline cellulose, lactose, sodium citrate, calcium carbonate, dibasic calcium phosphate and glycine, disintegrants such as starch (preferably com, potato or tapioca starch), sodium starch glycollate, croscarmellose sodium and certain complex silicates, and granulation binders such as polyvinylpyrrolidone, hydroxypropylmethylcellulose (HPMC), hydroxy-propylcellulose (HPC), sucrose, gelatin and acacia. Additionally, lubricating agents such as magnesium stearate, stearic acid, glyceryl behenate and talc may be included. Capsules or tablets may also be enteric coated to enhance gastric stability.

Solid compositions of a similar type may also be employed as fillers in gelatin capsules. Preferred excipients in this regard include lactose, starch, a cellulose, milk sugar or high molecular weight polyethylene glycols. For aqueous suspensions and/or elixirs, the compounds of the invention may be combined with various sweetening or flavouring agents, colouring matter or dyes, with emulsifying and/or suspending agents and with diluents such as water, ethanol, propylene glycol and glycerin, and combinations thereof. The agents (for example PHMB or PHMG; a composition comprising PHMG or PHMG; a composition comprising PHMG or PHMG and one or more immunomodulatory agents; a composition comprising PHMG or PHMG and one or more immunomodulatory agents and one or more antigens; a polyplex comprising PHMB or PHMG; a polyplex comprising PHMB or PHMG and an immunomodulatory agents; and a polyplex comprising PHMB or PHMG and an immunomodulatory agent and one or more antigens) can also be administered parenterally, for example, intravenously, intra-arterially, intraperitoneally, intrathecally, intraventricularly, intrasternally, intracranially, intra-muscularly or subcutaneously, or they may be administered by infusion techniques. They are best used in the form of a sterile aqueous solution which may contain other substances, for example, enough salts or glucose to make the solution isotonic with blood. The aqueous solutions should be suitably buffered (preferably to a pH of from 3 to 9), if necessary. The preparation of suitable parenteral Formulations under sterile conditions is readily accomplished by standard pharmaceutical techniques well-known to those skilled in the art.

Formulations suitable for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the Formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents. The Formulations may be presented in unit-dose or multi-dose containers, for example sealed ampoules and vials, and may be stored in a freeze-dried (lyophilised) condition requiring only the addition of the sterile liquid carrier, for example water for injections, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets of the kind previously described.

For oral and parenteral administration to human subjects, the daily dosage level of the agents (for example PHMB or PHMG; a composition comprising PHMG or PHMG; a composition comprising PHMG or PHMG and one or more immunomodulatory agents; a composition comprising PHMG or PHMG and one or more immunomodulatory agents and one or more antigens; a polyplex comprising PHMB or PHMG; a polyplex comprising PHMB or PHMG and an immunomodulatory agents; and a polyplex comprising PHMB or PHMG and an immunomodulatory agent and one or more antigens) will usually be from 1 to 5000 mg per adult, administered in single or divided doses.

Thus, for example, the tablets or capsules of the compound of the invention may contain from 1 mg to 1000 mg (/^'e from about 60-120 mg/m²) of active compound for administration singly or two or more at a time, as appropriate. The physician in any event will determine the actual dosage which will be most suitable for any individual subject and it will vary with the age, weight and response of the particular subject. The above dosages are exemplary of the average case. There can, of course, be individual instances where higher or lower dosage ranges are merited and such are within the scope of this invention.

The agents (for example PHMB or PHMG; a composition comprising PHMG or PHMG; a composition comprising PHMG or PHMG and one or more immunomodulatory agents; a composition comprising PHMG or PHMG and one or more immunomodulatory agents and one or more antigens; a polyplex comprising PHMB or PHMG; a polyplex comprising PHMB or PHMG and an immunomodulatory agents; and a polyplex comprising PHMB or PHMG and an immunomodulatory agent and one or more antigens) can also be administered intranasally or by inhalation and are conveniently delivered in the form of a dry powder inhaler or an aerosol spray presentation from a pressurised container, pump, spray or nebuliser with the use of a suitable propellant, eg dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoro-ethane, a hydrofluoroalkane such as 1 ,1 ,1 ,2- tetrafluoroethane (HFA 134A3 or 1 ,1 ,1 , 2,3,3,3-heptafluoropropane (HFA 227EA3), carbon dioxide or other suitable gas. In the case of a pressurised aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount. The pressurised container, pump, spray or nebuliser may contain a solution or suspension of the active compound, eg using a mixture of ethanol and the propellant as the solvent, which may additionally contain a lubricant, eg sorbitan trioleate. Capsules and cartridges (made, for example, from gelatin) for use in an inhaler or insufflator may be Formulated to contain a powder mix of a compound of the invention and a suitable powder base such as lactose or starch.

Aerosol or dry powder formulations are preferably arranged so that each metered dose or "puff' contains at least 1 mg of an agent (for example PHMB or PHMG; a composition comprising PHMG or PHMG; a composition comprising PHMG or PHMG and one or more immunomodulatory agents; a composition comprising PHMG or PHMG and one or more immunomodulatory agents and one or more antigens; a polyplex comprising PHMB or PHMG; a polyplex comprising PHMB or PHMG and an immunomodulatory agents; and a polyplex comprising PHMB or PHMG and an immunomodulatory agent and one or more antigens) for delivery to the subject. It will be appreciated that he overall daily dose with an aerosol will vary from subject to subject, and may be administered in a single dose or, more usually, in divided doses throughout the day. For veterinary use, the agent (for example PHMB or PHMG; a composition comprising PHMG or PHMG; a composition comprising PHMG or PHMG and one or more immunomodulatory agents; a composition comprising PHMG or PHMG and one or more immunomodulatory agents and one or more antigens; a polyplex comprising PHMB or PHMG; a polyplex comprising PHMB or PHMG and an immunomodulatory agents; and a polyplex comprising PHMB or PHMG and an immunomodulatory agent and one or more antigens) is administered as a suitably acceptable formulation in accordance with normal veterinary practice and the veterinary surgeon will determine the dosing regimen and route of administration which will be most appropriate for a particular animal. Conveniently, the formulation is a pharmaceutical formulation. The formulation may be a veterinary formulation.

It will be appreciated that the term administration is not restricted to a one time administration. The term administration is taken to cover all of, but not limited to, a single dose administration, multiple administrations over a period of time, variable dosage administrations over a period of time, variable means of administration over a period of time, administration in conjunction with one or more further therapeutic agents. Administration can be by any means known in the art and includes, but is not limited to, oral, intravenous, topically direct to the tumour, sublingually or suppository.

Preferences and options for a given aspect, feature or parameter of the invention should, unless the context indicates otherwise, be regarded as having been disclosed in combination with any and all preferences and options for all other aspects, features and parameters of the invention.

References 1. Allen MJ, Morby AP, White GF (2004) Cooperativity in the binding of the cationic biocide polyhexamethylene biguanide to nucleic acids. Biochem Biophys Res Commun 318(2):397^04.

2. Allen MJ, White GF, Morby AP (2006) The response of Escherichia coli to exposure to the biocide polyhexamethylene biguanide. Microbiology 152(Pt 4):989-1000.

3. Alvar, J. ef al. Leishmaniasis worldwide and global estimates of its incidence. PLoS One 7, e35671 (2012).

4. Amoils S (2004) Bacterial physiology: Under attack! SOS! Nat Rev Microbiol 2(11):852-852.

5. Barry CE, Hayes SF, Hackstadt T (1992) Nucleoid condensation in Escherichia coli that express a chlamydial histone homolog. Science 256(5055):377-9.

6. Ben Salah, A. et al. (2013) Topical paromomycin with or without gentamicin for cutaneous leishmaniasis. N. Engl. J. Med. 368, 524-32.

7. Boberek JM, Stach J, Good L (2010) Genetic Evidence for Inhibition of Bacterial Division Protein FtsZ by Berberine. PLoS One 5(10):e13745.

8. Bringmann, G. et al. (2013) A novel Leishmania major amastigote assay in 96-well format for rapid drug screening and its use for discovery and evaluation of a new class of leishmanicidal quinolinium salts. Antimicrob. Agents Chemother. 57, 3003-11.

9. Broxton P, Woodcock PM, Gilbert P (1984) Binding of some polyhexamethylene biguanides to the cell envelope of Escherichia coli ATCC 8739. Microbios 41 (163): 15-22. 10. Broxton P, Woodcock PM, Heatley F, Gilbert P (1984) Interaction of some polyhexamethylene biguanides and membrane phospholipids in Escherichia coli. J Appl Bacteriol 57(1): 115-124.

11. Carmona-Ribeiro, A. M. & de Melo Carrasco, L. D. (2013) Cationic antimicrobial polymers and their assemblies. Int. J. Mol. Sci. 14, 9906-46.

12. Carneiro, G. ef al. (2010) Topical delivery and in vivo antileishmanial activity of paromomycin-loaded liposomes for treatment of cutaneous leishmaniasis. J. Liposome Res. 20, 16-23. 13. Carneiro, G., Aguiar, M. G., Fernandes, A. P. & Ferreira, L A. M. (2012). Drug delivery systems for the topical treatment of cutaneous leishmaniasis. Expert Opin. Drug Deliv. 9, 1083-97

14. Castillo, B. ef al. (2012) Intracellular Delivery of siRNA by Polycationic Superparamagnetic Nanoparticles. J. Drug Deliv. 2012, 218940.

15. Chekeni, F. B. et al. (2010) Pannexin 1 channels mediate "find-me" signal release and membrane permeability during apoptosis. Nature 467, 863-7.

16. Choi, C. M. & Lerner, E. A. (2001) Leishmaniasis as an emerging infection. J. Investig. Dermatol. Symp. Proc. 6, 175-82.

17. Creppy EE, Diallo A, Moukha S, Eklu-Gadegbeku C, Cros D (2014) Study of Epigenetic Properties of Poly(HexaMethylene Biguanide) Hydrochloride (PHMB). Int J Environ Res Public Health 11 (8):8069-92.

18. Das, S. ef al. (2014) TLR9 and MyD88 are crucial for the maturation and activation of dendritic cells by paromomycin-miltefosine combination therapy in visceral leishmaniasis. Br. J. Pharmacol. 171 , 1260-74.

19. Datta, N., Mukherjee, S., Das, L. & Das, P. K. (2003) Targeting of immunostimulatory DNA cures experimental visceral leishmaniasis through nitric oxide up- regulation and T cell activation. Eur. J. Immunol. 33, 1508-18.

20. De Vries R (2010) DNA condensation in bacteria: Interplay between macromolecular crowding and nucleoid proteins. Biochimie 92(12): 715-21.

21. Dryselius R, Nekhotiaeva N, Good L (2005) Antimicrobial synergy between mRNA- and protein-level inhibitors. J Antimicrob Chemother 56(1):97-103.

22. Dwyer DJ, Camacho DM, Kohanski MA, Callura JM, Collins J J (2012) Antibiotic- induced bacterial cell death exhibits physiological and biochemical hallmarks of apoptosis. Mol Cell 46(5):561-72.

23. Erbacher P, Roche AC, Monsigny M, Midoux P (1996) Putative role of chloroquine in gene transfer into a human hepatoma cell line by DNA/lactosylated polylysine complexes. Exp Cell Res 225(1):186-94.

24. Firdessa, R., Oelschlaeger, T. A. & Moll, H. (2014) Identification of multiple cellular uptake pathways of polystyrene nanoparticles and factors affecting the uptake: Relevance for drug delivery systems. Eur. J. Cell Biol. 93, 323-37.

25. Gentile A, Gerli S, Di Renzo GC (2012) A new non-invasive approach based on polyhexamethylene biguanide increases the regression rate of HPV infection. BMC Clin Pathol 12:17.

26. Gerit D. Mulder, Joseph P. Cavorsi, D. K. L. (2007) Polyhexamethylene Biguanide (PHMB): An Addendum to Current Topical Antimicrobials. Wounds, 19, 173-182. 27. Ghosh, M., Roy, K. & Roy, S. (2013) Immunomodulatory effects of antileishmanial drugs. J. Antimicrob. Chemother. 68, 2834-8.

28. Goh S, Boberek JM, Nakashima N, Stach J, Good L (2009) Concurrent growth rate and transcript analyses reveal essential gene stringency in Escherichia coli. PLoS One 4(6):e6061.

29. Gonzalez-Leal, I. J. ei al. (2014) Cathepsin B in Antigen-Presenting Cells Controls Mediators of the Th1 Immune Response during Leishmania major Infection. PLoS Negl. Trap. Dis. 8, e3194.

30. Good L, Awasthi SK, Dryselius R, Larsson O, Nielsen PE (2001) Bactericidal antisense effects of peptide-PNA conjugates. Nat Biotech 19(4):360-364.

31. Gordon GS, Wright A (2000) DNA segregation in bacteria. Annu Rev Microbiol 54:681-708.

32. Gupta, S., Sane, S. A., Shakya, N., Vishwakarma, P. & Haq, W. (2011) CpG oligodeoxynucleotide 2006 and miltefosine, a potential combination for treatment of experimental visceral leishmaniasis. Antimicrob. Agents Chemother. 55, 3461-4.

33. Hartley, M.-A., Drexler, S., Ronet, C, Beverley, S. M. & Fasel, N. (2014) The immunological, environmental, and phylogenetic perpetrators of metastatic leishmaniasis. Trends Parasitol. 30(8):412-22.

34. Hirsch, T. ei al. (2009) [A comparative in vitro study of cell toxicity of clinically used antiseptics]. Hautarzt. 60, 984-91.

35. Hurdayal, R. & Brombacher, F. (2014) The role of IL-4 and IL-13 in cutaneous Leishmaniasis. Immunol. Lett. 161 (2): 179-83.

36. Ikeda T, Ledwith A, Bamford CH, Hann RA (1984) Interaction of a polymeric biguanide biocide with phospholipid membranes. Biochim Biophys Acta 769(1 ):57-66. 37. Ikeda T, Tazuke S, Watanabe M (1983) Interaction of biologically active molecules with phospholipid membranes. I. Fluorescence depolarization studies on the effect of polymeric biocide bearing biguanide groups in the main chain. Biochim Biophys Acta 735(3):380-386.

38. Ikeda, T., Tazuke, S. & Watanabe, M. Interaction of biologically active molecules with phospholipid membranes. I. Fluorescence depolarization studies on the effect of polymeric biocide bearing biguanide groups in the main chain. Biochim. Biophys. Acta 735, 380-6 (1983).

39. Jabbour, M. N. et al. (2014) The immune microenvironment in cutaneous leishmaniasis. J. Eur. Acad. Dermatol. Venereol. 29(6): 1170-9..

40. Jebran, A. F. et al. (2014) Rapid healing of cutaneous leishmaniasis by high- frequency electrocauterization and hydrogel wound care with or without DAC N-055: a randomized controlled phase Ha trial in Kabul. PLoS Negl. Trop. Dis. 8, e2694. 41. Kaehn, K. (2010) Polihexanide: a safe and highly effective biocide. Skin Pharmacol. Physiol. 23 Suppl, 7-16.

42. Kapp ef al Molecular Therapy - Nucleic Acids 3: e170

43. Kline ef al 2007 Proc Am Thorac Soc 4: 283-288

44. Kohanski MA, Dwyer DJ, Collins JJ (2010) How antibiotics kill bacteria: from targets to networks. Nat Rev Microbiol 8(6):423-35.

45. Kornberg T, Lockwood A, Worcel A (1974) Replication of the Escherichia coli chromosome with a soluble enzyme system. Proc Natl Acad Sci U S A 71 (8):3189-93.

46. Lang, T., Goyard, S., Lebastard, M. & Milon, G. (2005) Bioluminescent Leishmania expressing luciferase for rapid and high throughput screening of drugs acting on amastigote-harbouring macrophages and for quantitative real-time monitoring of parasitism features in living mice. Cell. Microbiol. 7, 383-92.

47. Lima-Junior, D. S. et al. (2013) Inflammasome-derived IL-1 β production induces nitric oxide-mediated resistance to Leishmania. Nat. Med. 19, 909-15.

48. Lockwood, D. (2004) Soldiers battle "Baghdad boil." Nat. Med. 10, 110-110.

49. Manuja ef al 2013 lmmunopharmacology and Immunotoxicology 5: 535-544

50. Marcus M, Nattenberg A, Goitein R, Nielsen K, Gropp A (1979) Inhibition of condensation of human Y chromosome by the fluorochrome Hoechst 33258 in a mouse- human cell hybrid. Hum Genet 46(2): 193-8.

51. McCall, L.-l. & McKerrow, J. H. (2014) Determinants of disease phenotype in trypanosomatid parasites. Trends Parasitol. 30(7):342-9.

52. McCool JD, ef al. (2004) Measurement of SOS expression in individual Escherichia coli K-12 cells using fluorescence microscopy. Mol Microbiol 53(5): 1343-57.

53. Messick CR, et al. (1999) ln-vitro activity of polyhexamethylene biguanide (PHMB) against fungal isolates associated with infective keratitis. J Antimicrob Chemother

44(2):297-298.

54. Momeni, A. A. et al. Development of liposomes loaded with anti-leishmanial drugs for the treatment of cutaneous leishmaniasis. J. Liposome Res. 23, 134-44 (2013).

55. Mondhe M, Chessher A, Goh S, Good L, Stach JEM (2014) Species-selective killing of bacteria by antimicrobial peptide-PNAs. PLoS One 9(2):e89082.

56. Moreno, E. et al. (2014) Nanoparticles as multifunctional devices for the topical treatment of cutaneous leishmaniasis. Expert Opin. Drug Deliv. 11 , 579-97.

57. Muller G, Kramer A (2008) Biocompatibility index of antiseptic agents by parallel assessment of antimicrobial activity and cellular cytotoxicity. J Antimicrob Chemother 61 (6):1281-1287. 58. Muller, G., Koburger, T. & Kramer, A. (2013) Interaction of polyhexamethylene biguanide hydrochloride (PHMB) with phosphatidylcholine containing o/w emulsion and consequences for microbicidal efficacy and cytotoxicity. Chem. Biol. Interact. 201, 58-64.

59. Murphy F, Powers S, Cantor CR (1984) Endosome pH measured in single cells by dual fluorescence flow cytometry: rapid acidification of insulin to pH 6. J Cell Biol

98(5): 1757-62.

60. Nekhotiaeva N, et al. (2004) Cell entry and antimicrobial properties of eukaryotic cell-penetrating peptides. FASEB J 18(2):394-6.

61. Novo, L. et al. (2014) Decationized polyplexes as stable and safe carrier systems for improved biodistribution in systemic gene therapy. J. Control. Release 195:162-75.

62. O'Grady FW (1971) Mode of action of antibacterial agents. Proc R Soc Med 64(5):529-33.

63. O'Malley LP, Hassan KZ, Brittan H, Johnson N, Collins AN (2006) Characterization of the biocide polyhexamethylene biguanide by matrix-assisted laser desorption ionization time-of-flight mass spectrometry. J Appl Polym Sci 102(5):4928- 936.

64. Ponte-Sucre, A. et al. (2009) Structure-activity relationship and studies on the molecular mechanism of leishmanicidal N,C-coupled arylisoquinolinium salts. J. Med. Chem. 52, 626-36.

65. Ramirez-Pineda, J. R., Frohlich, A., Berberich, C. & Moll, H. (2004) Dendritic cells (DC) activated by CpG DNA ex vivo are potent inducers of host resistance to an intracellular microorganism that is independent of IL-12 derived from the immunizing DC. J. Immunol. 172, 6281-9.

66. Samal, S. K. et al. (2012) Cationic polymers and their therapeutic potential. Chem. Soc. Rev. 41, 7147-94.

67. Sato, T., Yamamoto, M., Shimosato, T. & Klinman, D. M. (2010) Accelerated wound healing mediated by activation of Toll-like receptor 9. Wound Repair Regen. 18, 586-93. 68. Schamber-Reis, B. L. F. et al. (2013) UNC93B1 and nucleic acid-sensing Toll-like receptors mediate host resistance to infection with Leishmania major. J. Biol. Chem. 288, 7127-36.

69. Scita, G. & Di Fiore, P. P. (2010) The endocytic matrix. Nature 463, 464-73.

70. Spellberg B, Powers JH, Brass EP, Miller LG, Edwards JE (2004) Trends in antimicrobial drug development: implications for the future. Clin Infect Dis 38(9): 1279-86.

71. Spurio R, et al. ( 992) Lethal overproduction of the Escherichia coli nucleoid protein H-NS: ultramicroscopic and molecular autopsy. Mol Gen Genet 231 (2):201-11.

72. Sundar, S. & Chakravarty, J. Leishmaniasis: an update of current pharmacotherapy. Expert Opin. Pharmacother. 14, 53-63 (2013). 73. Teif VB, Bohine K (2011) Condensed DNA: condensing the concepts. Prog Biophys Mol Biol 105(3):208-22.

74. Walls, G., Noonan, L, Wilson, E., Holland, D. & Briggs, S. (2013) Successful use of locally applied polyhexamethylene biguanide as an adjunct to the treatment of fungal osteomyelitis. Can. J. Infect. Dis. Med. Microbiol. 24, 109-12.

75. Wessels S, Ingmer H (2013) Modes of action of three disinfectant active substances: A review. Regul Toxicol Pharmacol 67(3):456- 67.

76. World Health Organization. (2010) Technical Report Series on control of the leishmaniases. Geneva, 22-26 March 949, 1-187.

77. Yamamoto, M., Sato, T., Beren, J., Verthelyi, D. & Klinman, D. M. (2011) The acceleration of wound healing in primates by the local administration of immunostimulatory CpG oligonucleotides. Biomaterials 32, 4238-42.

78. Yin, H. et al. (2014) Non-viral vectors for gene-based therapy. Nat. Rev. Genet. 15(8):541 -55.

79. The Scientific Committee on Consumer Safety of the European Commission. Opinion on the safety of poly(hexamethylene) biguanide hydrochloride (PHMB). Eur. Union, SCCS/1535/14 ISSN 1831-, 1-72 (2014).

80. Thompson et al 2004 Journal of Clinical Oncolog 22: 4644

81. Walker et al 2014

82. Hennessey et al Nat Rev Drug Discov. 2010 Apr; 9 (4): 293-307. doi: 10.1038/nrd3203

83. Rassmussen et al 2009 APMIS 1 17: 323-337

84. Scita et al 2010 Nature 463: 464-473 The invention will now be described with the aid of the following figures and examples. Figure Legends

Fig. 1. Effects of PHMB on L major morphology and behavior, (a-d) TEM images of L mayor promastigotes (right) showing morphological changes such as shrinkage, extensive cytoplasmic vacuolization (V), marked loss of cytosolic contents and condensed nucleus (N). Images b and d were taken after treatment with 2 μΜ PHMB for 48 and 24 h, respectively. The untreated controls (left) show normal elongated morphology of promastigotes with intact and clear distinct kinetoplast (kDNA), N, mitochondrion (M), lipid vacuoles (LV) and glycosome (G). (e-h) Light microscopy images showing morphological and behavioral changes (no more clamp formation as indicated by arrowheads) after treatment with 2 μΜ PHMB for 24 h. Scale bars = (a) 1.1 m, (b) 0.6 μηη, (c and d) 0.25 m, (e and f) 7.5 μπι and (g and h) 25 μηη.

Fig. 2. Proposed mechanism(s) of action of PHMB on L. major protozoan parasites. PHMB disrupts membrane integrity and condenses DNA materials of L major promastigotes. Representative FACS dot plots of (a) propidium iodide (PI) and (b) YO-PRO^®-1dye staining of promastigotes after treatment with 2 μΜ PHMB for indicated time points, showing time- dependent effect of PHMB on the membrane. Amphotericin B at 2 μΜ concentration was used as positive control. For detailed FACS data, see Fig. 8 a and b. (c) Fluorescent microscopy analysis showing condensed and damaged DNA materials of L. major promastigotes after treatment with PHMB at 2 μΜ for 48 h as compared to the mock control (distilled water). Scale bars = 5 μητι.

Fig. 3. PHMB/DNA interactions and their physicochemical characterization. Formation of PHMB/DNA polyplexes confirmed by 1% agarose gel, TEM and color change, (a) PHMB/gDNA polyplexes, (b) TEM picture showing PHMB/CpG ODN polyplex nanoparticles formation at 2:1 ratio, (c) PHMB/CpG ODN polyplexes, (d) temporary color change during PHMB/CpG ODN complexation, (e) PHMB/CpG-R polyplexes and (f) the same gel (e) with fluorescence measurement of CpG-R. With the exceptions of negative control and PHMB alone, all wells contained equal amounts (weight) of DNA with various concentrations of PHMB. M represents 2-Log DNA ladder (0.1-10.0 kb, New England Biolabs) and N represents water for negative control. All indicated PHMB/DNA ratios are in (w/w). ^®lndicates two month old PHMB/CpG ODN polyplexes. Scale bar = 300 nm. Fig. 4. Cell localization of PHMB-FITC in BMDM and promastigotes. Fluorescence images showing uptake of PHMB-FITC by BMDM (upper) and promastagotes (lower). Note apparent nuclear exclusion in BMDM cells but not parasites, scale bars = 10 pm.

Fig. 5. Physicochemical characterization of PHMB/DNA polyplex nanoparticles. (a) overlay of three measurements for particle size and zeta potential determination by using dynamic light scattering (DLS) and electrophoretic light scattering (ELS) with their polydispersity index (PDI) are shown. The table shows result summary of three independent measurements, (b) quantitative measurements of the strength of interaction between CpG ODN and PHMB with the corresponding thermodynamic parameters: binding affinity ( _a), enthalpy changes (ΔΗ) and entropy changes (Δβ). Fig. 6. Anti-leishmania and cytotoxicity effects of PHMB and PHMB/DNA polyplexes. The tables show (a) anti-leishmanial efficacy and selectivity, and (b) cytotoxicity of the compounds. The IC50 values and/or selectivity index (SI) of the compounds against promastigotes, amastigotes and/or mammalian cells as compared to standard anti- leishmanial drugs are shown. The tables are the average IC50 values of 3-6 independent experiments for each compound.

Fig. 7. Dose-dependent antileishmanial activity of PHMB against L major promastigotes. Growth and inhibition was determined in vitro using an AlamarBlue® assay. Miltefosine, pentamidine and amphotericin B were used as positive controls and distilled water was used as negative control (mock). The error bars show standard error of three independent experiments.

Fig. 8. Time-dependent effect of PHMB on membrane integrity of L. major promastigotes. Representative FACS data of (a) propidium iodide (PI) and (b) YO-PRO^®-1dye staining of promastigotes after treatment with 2 μΜ PHMB for indicated time points. Amphotericin B at 2 μΜ concentration and heat killed promastigotes (99°C for 1 hr in water bath) were used as positive controls. Fig. 9. Fluorescence microscopy images showing cellular uptake of PHMB-FITC and its nuclear exclusion in BMDM.

Fig. 10. Effects of PHMB, CpG ODN, PHMB/CpG ODN polyplexes on cytokines production by BMDM. The bar graphs show the level of (a-c) IL-6, (d-f) IL-10 and (g-i) IL-12 production after PHMB, CpG ODN or PHMB/CpG ODN polyplexes was added to BMDMs that were pre-activated with CpG ODN (15 g/ml) for 30 min and further incubated for 48 h. Controls show cytokines level for unactivated BMDM. The concentrations shown for the polyplexes represent the dose of PHMB and the concentrations of CpG ODN are half of the indicated doses. The error bars show standard error of three independent experiments.

Fig. 11. Time depended cellular uptake of PHMB-FITC and PHMB-FITC/CpG ODN polyplexes by BMDM. The representative flow cytometric data show uptake of (a) PHMB- FITC and (b) HMB-FITC/CpG ODN polyplexes into macrophages, and the histograms show the overlay of their uptake at 0 h, 30 min, 4 h and 12 h.

Fig. 12. Cellular uptake mechanisms of PHMB-FITC and PHMB-FITC/CpG ODN polyplexes based on effects of selective endocytosis inhibitors. The bar graphs show the effects of different inhibitors and temperature on cellular uptake of (a) PHMB-FITC, (b) PHMB-FITC/CpG ODN polyplexes, (c) dextran/FITC used as positive control to exclude the effect of FITC that might interfere with the cellular uptake mechanisms of PHMB and (d) alexa-448-labeled transferrin used as positive control for clathrin-dependent endocytosis. Normalized mean fluorescence intensity (MFI) values of three independent flow cytometry experiments are shown and the values are given as mean ± SE.

Fig. 13. ODN delivery into macrophages using PHMB. The cellular uptake potential of (a) PHMB/CpG-R and (b) PHMB-FITC/CpG ODN polyplexes, and inhibition with dynasore. Free PHMB-FITC, PHMB-FITC/CpG ODN and PHMB/CpG-R polyplexes were efficiently blocked by dynasore. Based on their MFI, the uptake of CpG-R was enhanced by about 15 folds as polyplex form compared to its free form.

Fig. 14. Dynasore rescues killing of L. major amastigotes inside macrophages. The table shows that dynasore inhibits killing of the intracellular L. major amastigotes and promastogotes by PHMB or PHMB/CpG ODN polyplexes through blocking their uptake into macrophages. The table shows summary result of two independent experiments and the values are given as mean ± SE. Fig 15. PHMB effects on cell membrane permeability and entry into bacteria. (A) Structure of polyhexamethylene biguanide (PHMB; CAS# 27083-27-8; alternative chemical names: polyhexanide, polyamino propylbiguanide; example trade names: Vantocil™, Cosmocil™, Baquacil™, Prontosan®. PHMB is composed of repeating basic biguanidine units connected by hexamethylene hydrocarbon chains, providing a cationic and amphipathic structure with a high capacity for hydrogen bonding, electrostatic and hydrophobic interactions. PHMB preparations typically comprise polymers of mixed length with amine, guanidine and cyanoguanidine end groups (eg. average n = 13.8, 3,035 g/mol(3)) (B) Effects of PHMB, heat, polymyxin B (positive control) and triclosan (negative control) on cell permeability to SYTOX®Green. (C) Fluorescence microscopy visualisation of PHMB- FITC entry into diverse bacteria. PHMB-FITC (2 pg/ml) was added to bacteria and counter stained with DAPI; bars = 5 Mm. (D) Confocal image showing localisation of PHMB-FITC (green) in B. megaterium; bacteria were counterstained with the membrane localising probe wheat germ agglutinin (WGA) conjugated to Alexa Fluor-555 (red) and visualized as live (top) and fixed (bottom) cells; Bar = 5 μιτι. (E), Fluorescence intensity profile plot analysis of cellular localisation of PHMB-FITC and WGA fluorescence (corresponding to white line in e). Fig 16. PHMB-mediated cell elongation and chromosome condensation in bacteria. (A) E. coli was treated with PHMB for 90 minutes and examined by bright field microscopy. (B) Mean cell lengths as a function of PHMB concentration. MIC (arrow) and error bars (S.D.) are indicated. (C) Pattern of chromosome distribution in cells following PHMB-FITC exposure. E. coli, strain K-12, was treated with PHMB-FITC, counter stained with DAPI and examined using fluorescence microscopy. Chromosomes appear as condensed DAPI-stained foci; more apparent in the enlarged image. (D) Pattern of chromosome distribution in filamentous/multinucleated E. coli following PHMB exposure Cell division was arrested by silencing of ftsZ expression, and cells were then treated with PHMB, stained with DAPI and examined by fluorescence microscopy. Scale bars are 5 μιη.

Fig 17. Effect of PHMB on bacterial SOS response. The SOS reporter E. coli strain SS996 carrying a chromosomal sulAp-gfp fusion was untreated or treated with PHMB, mitomycin C, a known SOS inducer, or triclosan, which does not induce an SOS response. (A) SOS response reporter expression, quantified by fluorimetry. (B) Chromosome condensation £. coli strain SS996 treated with PHMB for 2 hours and DAPI stained.

Fig 18. New PHMB MoA model and suppression of growth inhibition by a DNA binding ligand. (A), Proposed antibacterial MoA of PHMB. (B), Pairwise growth inhibition interactions (FICI) between PHMB and Hoechst 33258 and non-DNA-binding ligands (triclosan and trimethoprim) in diverse bacteria. See Figure 26 for species list and inhibition values. (C) Relationship between bacterial genome AT-content and antibacterial interactions with PHMB. Plot of pairwise growth inhibition interactions as a function of genomic AT-content. Values are fractional inhibitory concentration indicies (FICI) between PHMB and Hoechst 33258 or non-DNA-binding ligands (trimethoprim and triclosan) in diverse bacteria. See Figure 26 for list of species list and inhibition values. (D) Suppression of Bacillus megaterium growth inhibition by PHMB using Hoechst 33258 (blue lines).

Fig 19. PHMB entry into mammalian cells. (A) Primary fibroblasts were treated with PHMB- FITC (3.5 Mg/ml), counter stained with Hoechst 33258 and observed by fluorescence microscopy. (B) Flow cytometry analyses of a panel of mammalian cells treated with PHMB-FITC. Inset: a representative example of flow cytometry histogram of HeLa cells that were untreated (purple population) or treated with PHMB-FITC (1 μΜ) (green population).

Fig 20. S. aureus invasion of keratinocytes. (a-c) Colony forming units following gentamicin protection assay. After gentamicin treatment, lysis of keratinocytes released approximately 10³ cfu/ml of S. aureus RN4420, 10⁵ cfu/ml of EMRSA-15 and 10⁴ cfu/ml of USA 300. (d&e) Invasion of EMRSA-15 in keratinocytes visualised using confocal microscopy. Prior to imaging, keratinocytes were stained with DAPI (blue) for keratinocytes and EMRSA-15 chromosome staining and WGA (red) for membrane staining. Confocal microscopy z-stack projection was set up moving through 139 slices across the keratinocytes. (d) Horizontal cross-section of keratinocytes (e) Verticle cross-section of keratinocytes. The small blue dots are EMRSA-15 that localised inside keratinocytes, indicating invasion. White scale bar is 7.5 pm.

Fig 21. Bactericidal activity of nadifloxacin and PHMB against intracellular EMRSA-15 and USA 300. Keratinocytes infected with EMRSA-15 and USA 300 were either untreated or treated with increasing concentrations of nadifloxacin or PHMB. Experiments were performed in triplicate. Comparison was made between treated and non-treated group using one-way ANOVA followed by Tukey test. Untreated cultures were used to establish the CFU values corresponding to 0% killing. Error bars represent standard deviations. *(P ≤0.05), **** (P≤ 0.0001).

Fig 22. PHMB-FITC uptake, retention and colocalisation with EMRSA-15 in keratinocytes. (a) PHMB-FITC localisation was visualised by confocal microscopy. Free FITC serves as control. White scale bar is 25 μιτι. (b) PHMB-FITC uptake was quantified by flow cytometry. The overlay histogram image represents the uptake efficiency of PHMB-FITC into keratinocytes. The red histogram (1) illustrates the population of keratinocytes treated with FITC and serves as negative control. The green histogram (2) is the population of keratinocytes treated with PHMB-FITC. Uptake of PHMB-FITC was observed in > 99% keratinocytes. With respect to the x-axis, the peak to the left indicates a cell population that exibits low levels of green fluorescence. The peak to the right indicates a population with high levels of green fluorescence. The polymer is tagged with a green fluoraphore. The population at the right exibits higher levels of green fluorescence, indicating cell uptake of the fluoraphore.

(c) Image of keratinocytes following treatment with PHMB-FITC and five hours after rinsing to remove extracellular PHMB-FITC. (d) Mean fluorescencent intensity (MFI) of PHMB-FITC before rinse and after five hours rinse, (e-f) Co-localisation of PHMB-FITC and EMRSA-15 in keratinocytes. Keratinocytes were infected with EMRSA-15 followed by treatment with PHMB-FITC (green). Prior to microscopy, keratinocytes were labeled with DAPI (blue) for chromosome staining and for WGA (red) for membrane staining, (e) Panel of images viewed under different filter, (f) Enlarged and merged images clearly shows co- localisation between PHMB-FITC (green) and EMRSA-15 (blue). White scale bar is 25 Mm. Fig 23. Effects of dynasore on PHMB uptake into keratinocytes and killing of intracellular EMRSA-15. (a) PHMB-FITC uptake in keratinocytes that were pre-treated with dynasore, visualised by confocal microscopy. White scale bar is 25 Mm. (b) PHMB-FITC uptake in keratinocytes pre-treated with dynasore quantified by flow cytometry. Cells were treated with dynasore (in 0.5% DMSO) for 30 minutes before proceed with incubation with PHMB- FITC. Control were keratinocytes treated with PHMB-FITC alone in medium. Vehicle was keratinocytes treated with PHMB-FITC in medium solution containing 0.5% DMSO. Comparison was made between control and treated groups, (c) Effect of dynasore on PHMB intracellular activity. All experiments were performed in triplicate and statistical analysis was performed using one-way ANOVA. Error bars represent standard deviation of measurements in each condition, ns (not significant), *** (P≤ 0.001), **** (P≤ 0.0001).

Fig.24. PHMB use in home and medicine Fig. 25. MICs of PHMB and PHMB-FITC against bacteria

Fig.26 MIC and FICI values in diverse bacteria

Fig.27. PHMB-FITC synthesis scheme and conjugate uptake into bacteria, (a) Terminal amino groups in PHMB were chemically conjugated with FITC. (b) Formation of a thiourea bond (C=S) between PHMB and FITC was confirmed by infrared spectroscopy, (c) Overnight cultures of E. coli K-12 and S. enterica serovar Typhimurium NK262C were untreated or treated with PHMB-FITC (2 pg/ml) for 90 minutes. The number of cells scoring positive for cell-associated fluorescence was quantified by flow cytometry. ****P < 0.0001. (c) Cultures of E. coli K-12 (10⁸ CFU/ml) were treated with PHMB-FITC (0 - 6 pg/ml) at 4°C or 37°C and cell associated fluorescence was measured by fluorimetry (**** P < 0.0001).

Fig.28. Motility of E. coli treated with PHMB. Cultures of E. coli K-12 (10⁸ CFU/ml) were treated with PHMB (4 Mg/ml) at 37 °C for 90 minute, stained with DAPI and observed by using epifluorescence microscopy. Cell movement over time (green circle) is apparent relative to a fixed location (red circle).

Fig.29. PHMB binding to bacterial genomic DNA in vitro, (a) PHMB or PHMB-FITC was mixed with genomic DNA from E. coli, strain K - 12 and samples were analysed by EMSA. (b) PHMB mediated exclusion of SYTOX®Green binding to E. coli genomic DNA. (c) Circular dichroism spectroscopy of PHMB £. coli genomic DNA mixtures, (d) Plot of ellipticity as a function of PHMB:DNA ratios.

Fig.30. PHMB-mediated chromosome nanoparticle formation in vitro, (a) Dynamic Light Scattering of PHMB at 2.5 pg/ml (red line) and a mixture of PHMB:DNA at 25 pg/ml:10 pg/ml (green line). The results indicate Z average values (< 100 nm, PDI 0.3). (b) Transmission electron microscopy images of PHMB:DNA nanoparticles. Scale bar = 100 nm. (c) PHMB: DNA particle characterization by epifluorescence microscopy. DNA:SYTOX®Green (left) and PHMB:DNA:SYTOX®Green (right) (PHMB:DNA 2.5 pg/ml: 1 pg/ml, 100 nM SYTOX®Green in PBS). Scale bars = 10 μηι.

Fig.31. PHMB effects on mammalian cells (a) Effects of PHMB on propidium iodide entry into mammalian cells. PHMB (0 - 4 Mg/ml) was added to HeLa cells and after 2 hours PI (2 pg/ml) was added and cell associated fluorescence was measured by flow cytometry. (b) Fluorescence of PHMB-FITC (3.5 pg/ml) in PBS (pH range 4.06 - 7.4), measured by fluorimetry (Excitation 490 nm; Emission 535 nm).

Fig. 32. Effect of PHMB and parasite killed by PHMB on host immune cells. Representative flow cytometry data of (a) BMDC plus isotope control, (b) BMDC without any stimulant, (c) BMDC plus 3 pg/ml PHMB, (d) BMDC plus promastigotes killed by 3 pg/ml PHMB, (e) BMDC plus live promastigotes, (f) BMDC plus heat killed (80°C for 30min) promastigotes, (g) BMDC plus CpG ODN (25 pg/ml) and (h) BMDC plus LPS (1 pg/ml).

Fig. 33. Effect of PHMB on parasite based on damage associated proteins (A) calreticulin, (B) HSP 90 and (C) HSP70. Representative flow cytometry data of (1 ) promastigotes plus isotope control, (2) live promastigotes alone, (3) heat killed (80°C for 30min) promastigotes, (4) promastigotes killed by 3 pg/ml pM PHMB for 4 h, (5) promastigotes killed by 1 pM amphotericin b for 4 h. Examples

Example 1 Antileishmanial effect of PHMB on extracellular parasites

Despite its widespread use in wound management and dermatology, there have been no attempts to evaluate PHMB as treatment for CL. To investigate PHMB's potential use as topical therapeutic agent against CL, the extracellular form of L. major (promastigotes) and its cytotoxicity was assessed based on AlamarBlue cell viability assay (Ponte-Sucre et al 2009). The results showed that PHMB can effectively kill the promastigotes at sub- micromolar concentrations in a dose-dependent manner (Fig. 7). Determination of the 50% inhibitory concentration (ICso) confirmed PHMB's activity (ICso = 0.41 μΜ) against L. major promastigotes in vitro, with higher potency than the current standard antileishmanial drugs used in clinics (Fig. 6). PHMB is about 69 or 39 fold more potent than miltefosine or pentamidine, respectively. Surprisingly, it is more than 1 ,000 fold more potent than paromomycin, the currently recommended drug for topical treatment of CL Moreover, our visual examinations by light microscopy and transmission electron microscopy (TEM) clearly showed morphological and behavioral changes in PHMB-treated promastigotes as compared to untreated parasites (Fig. 1).

Example 2 - PHMB selectively targets bone derived macrophages over epithelial cells

To determine the level of host/pathogen selectivity of PHMB, we measured its cytotoxicity against primary bone marrow-derived macrophages (BMDM) and 293T epithelial cells using an AlamarBlue assay. The ICso value obtained indicate that PHMB is about 6.5 fold more toxic against BMDM (ICso = 4 μΜ) than 293T epithelial cells (ICso = 26 μΜ), resulting in selectivity indexes (SI) of 9.75 and 63.4 against these cell types, respectively (Fig. 6).

Example 3 - PHMB disrupts the cell membrane of parasites and condenses the genomic DNA

Encouraged by the potency and selectivity of PHMB against L. major promastigotes, we investigated the underlying mechanism of action. Literature mining suggested that PHMB's microbe-selective toxicity is due to preferential disruption of microbial membranes rather than mammalian membranes (Ikeda et al 1983, Rusciano ef a/ 2013). We hypothesized that PHMB kills L. major parasites by this mechanism, and tested the effects of PHMB on the membrane integrity of the promastigotes by using propidium iodide (PI), a dye that can enter the parasite and stain DNA only after loss of membrane integrity. After incubating the promastigotes with 2 μΜ PHMB for only 30 min, more than 20% of the parasite population was stained by PI and staining increased at later time points (Fig. 2a). We repeated the dye exclusion assay using YO-PRO^®-1 dye according to the manufacturer's instructions, the results similarly showed time-dependent permeabilisation (Fig. 2b). The results clearly show that PHMB damages the membrane integrity of the parasite in a time- dependent manner and permeabilized parasites can be observed within 30 minutes, supporting the hypothesis that PHMB disrupts parasite membranes. During our TEM ultrastructure analysis, we also consistently observed condensation of parasite nuclei after incubation with 2 μΜ PHMB for 24-48 h (Fig. 1). Moreover, PHMB's mechanism of bactericidal action was associated with its strong and cooperative interaction with nucleic acids in vitro (Allen et al 2004). These led us to further investigate whether PHMB also targets DNA inside parasites. Promastigotes were treated with 2 μΜ PHMB for 48 h, cellular DNA was stained with Hoechst 33342 and then the treated parasites were examined by confocal and fluorescence microscopy. The results indicate that PHMB condenses and disrupts chromosome structures in the parasites (Fig. 2c). If these cellular effects are correct, PHMB should also bind isolated parasite genomic DNA (gDNA). Electrophoretic mobility shift assay (EMS A) confirmed that PHMB has binding affinity towards isolated genomic DNA and forms PHMB/gDNA polyplexes at relative weight ratios≥ 0.25, confirming that PHMB can bind gDNA from parasites, and, thus, may also bind chromosomal DNA within parasites (Fig. 3). Example 4 - PHMB is located in the parasitic nucleus but exclusively localized to the mammalian cytoplasm

We next considered how PHMB selectively condenses or disrupts parasites chromosomes without affecting the DNA of the mammalian host cells. To investigate the cellular localization(s) of PHMB, we used a fluorescent version of PHMB, which was produced by covalent conjugation with fluorescein isothiocyanate (FITC). BMDM cells were incubated with 1 μΜ fluorescent PHMB, counter stained with Hoechst 33342, and internalization was investigated using fluorescence and confocal microscopy. The data show that PHMB is readily internalized by BMDM but exclusively localized in the cytoplasm without entering nuclei in mammalian cells, indicating failure to transit across the nuclear envelope (Fig. 4a and Fig. 9). Similarly, the L. major promastigotes were incubated with 0.35 μΜ fluorescent PHMB (sub-ICso). Our results confirm that parasites take up fluorescent PHMB, without apparent exclusion from their nucleus (Fig. 4b). Therefore, intracellular localisation of PHMB appears to differ in BMDM and parasites, with PHMB gaining access to parasite chromosomes.

Example 5- PHMB and CpG ODN form stable polyplex nanoparticles

Nucleic acids hold great promise for a significant improvement in therapy against many diseases, as they can mediate RNA silencing, vaccination and immune modulation. However, medical applications are severely hindered by their large size and polyanionic charge, which results in poor cellular uptake (Yin et al 2014). To test whether nucleic acid delivery into a host cell could be improved using PHMB, CpG ODN was selected as a model DNA molecule. CpG ODN is a potent immune modulator that activates macrophages and dendritic cells to kill intracellular L major parasites (Ramirez-Pineda et al 2004). Thus, based on the findings disclosed herein, combinations of PHMB and CpG ODN could kill parasites directly through parasite membrane and chromosome disruption and indirectly through modulation of host immunity. Potentially, this could provide potent and synergistic therapy for parasitic infections, such as Leishmania infections, without the toxicities associated with currently used drugs. In this context, a range of PHMB/CpG ODN polyplex formulations were prepared and characterized, and their bioactivities were evaluated and compared to the free components.

Before evaluating the potential use of PHMB as a safe and effective carrier for nucleic acids, we first wanted to confirm whether PHMB binds DNA (CpG ODN) to form stable nanostructures. Following addition of an excess PHMB to CpG ODN, we observed an instant reaction that converted colorless PHMB and CpG ODN in solution to a temporal milk color, suggesting interaction of PHMB polymers and the nucleic acids (Fig. 3d). EMSA experiments showed that PHMB forms polyplexes with CpG ODN at relative weight ratios of≥ 0.25 as confirmed by clearly retarded electrophoretic mobility of CpG ODN (Fig. 3c). To clearly show the retention of CpG ODN in the wells, the same CpG ODN was labeled with rhodamine red at 3' termini (CpG-R), and the results confirmed retarded electrophoretic mobility and retention of CpG ODN in the wells (Fig. 3e and f). To further characterize the particle size and zeta potential of the polyplexes, dynamic light scattering (DLS) and electrophoretic light scattering (ELS) were applied. The results showed that the polyplexes have highly reproducible sizes ranging from 193.6 ±20.0 to 310.9 ± 30.5 nm based on the type of solvent and ratio used (Fig. 5a). The polydispersity index (PDI) values of the polyplexes were shown to be less than 0.3, confirming their monodispersity. Moreover, to predict the long-term stability of the polyplex nanoparticles, their zeta potential was measured by ELS. The zeta potential was found to be positive or negative, depending on the ratio of PHMB/CpG ODN and the type of solvent used (Fig. 5a). To further evaluate the stability of the polyplex nanoparticles, PHMB/CpG ODN polyplexes were prepared and kept in the fridge for two months before their physicochemical nature was again characterized by TEM and EMSA. Similar results were obtained and confirmed an excellent stability of polyplex nanoparticles between PHMB and CpG ODN (Fig. 3 indicated by ^®). In addition, the TEM results suggest predominantly spherical morpholog for the polyplex nanoparticles, rather than cylindrical or rod forms. To quantify the stability and specificity of the interaction between the two molecules, we used isothermal titration calorimetry (ITC). The results show that PHMB can strongly bind CpG ODN to form polyplexes, confirming its binding affinity towards DNA. The detailed thermodynamic parameters indicate sequential binding between PHMB and CpG ODN (Fig. 5b). Taken together, the results confirmed that there is strong interaction between PHMB and CpG ODN that can lead to formation of stable polyplex nanoparticles. We next tested the potential to use PHMB as safe and effective delivery vehicle for CpG ODN. We characterized the polyplexes by measuring uptake efficiency, cytotoxicity, antiparasitic efficacy and its immune modulating ability as compared to the free components. The uptake efficiency of CpG-R in the polyplex form was enhanced by about 15 fold relative to the free form; while, the uptake of PHMB as a polyplex was not enhanced, confirming that PHMB can deliver DNA into macrophages. Because PHMB and CpG incorporation into polyplex particles may quench the mean fluorescence of PHMB-FITC or CpG-R, the uptake measurements may underestimate the delivery. The uptake efficiencies and mechanisms of PHMB, CpG ODN or their polyplexes were studied and the results are summarized in (Fig. 11-14). Surprisingly, the toxicity of PHMB/CpG ODN polyplexes showed a much higher IC₅o value against BMDM and 293T epithelial cells than PHMB alone (Fig. 6). The results indicate that the polyplexes possess drastically reduced toxic effects relative to free PHMB. Similarly, we checked the cytotoxicity of the polyplexes against L. major promastigotes and the results showed relatively lower efficacy as compared to free PHMB, and CpG ODN alone did not show activity (Fig. 6). The toxicities of the polyplexes against BMDM and 293T cells were enhanced as the relative weight ratio of PHMB:CpG ODN was increased (Fig. 6). These results are consistent with our zeta potential data showing that the higher the PHMB/CpG ODN ratio, the more positive the relative zeta potential of the polyplexes (Fig. 5b). The cationic nature of polymers (higher positive zeta potential) is typically associated with toxicity against host cells and decationizing is expected to reduce toxicity (Novo er al 2014).

We next designed an appropriate in vitro assay to determine the combined leishmanicidal effects of PHMB and CpG ODNA in polyplex and free forms. The IC50 values against intracellular parasites (amastigotes) were determined using BMDMs infected with the luciferase-transgenic L. major strain. The polyplexes showed enhanced anti-leishmanial activity against intracellular amastigotes while increasing selectivity by many folds (Fig. 6). PHMB-mediated killing of amastigotes was strongly reduced by inhibiting uptake of PHMB or PHMB/DNA polyplexes by using dynasore (Fig. 6). The results suggest that PHMB is an effective nucleic acid entry-promoting vehicle that can improve the activity of CpG ODN, and cell entry follows a dynamin-mediated pathway. Finally, we investigated immune modulation property of the polyplex compared to free CpG ODN or PHMB. The polyplexes showed higher or comparable immune stimulation capacity as compared to free CpG ODN or PHMB (Fig. 10). The detailed results on immunomodulation and safety are summarized and discussed in example 7.

Example 6 The cellular uptake mechanism of PHMB and polyplexes into macrophages

To improve its biomedical applications, it is important to learn how PHMB affects parasites and host cells. The uptake mechanism regulates the entry into the cell and, consequently, controls the type of threat a particle poses on the host cells and how a cell responds to it (Firdessa et al, Scjta ef al). First we investigated its uptake properties into L major and macrophages. Flow cytometry and confocal microscopy results showed that PHMB is readily taken up by L. major (Fig. 4). Similarly, it is taken up by macrophages in a time dependent manner (Fig. 11). However, when the PHMB was incubated with BMDM at 4°C under equivalent cell culture conditions, uptake was strongly reduced (87%) (Fig. 12), indicating that the predominant uptake mechanism of PHMB by BMDM is an energy- dependent cellular process or endocytosis.

To specify the endocytosis pathway(s) involved, a wide range of selective endocytosis inhibitors were employed, as recently described (Firdessa era/). Briefly: wortmannin (12.85 Mg/ml), a potent inhibitor of phosphatidylinositol kinase (PI3K) that commonly used as inhibitor of macropinocytosis, cytochalasin D (5 Mg/ml) which blocks the actin polymerization that is commonly used as inhibitor of phagocytosis, dynasore (25.8 pg/ml), a cell-permeable small molecule that inhibits dynamin GTPase activity needed for dynamin-dependent endocytosis, chlorpromazine hydrochloride (10 pg/ml) that inhibits a Rho GTPase which is essential for the formation of clathrin-coated vesicles in clathrin- dependent endocytosis and ikarugamycin (1 μΜ), an inhibitor of clathrin coated pit- mediated endocytosis were used under stringent controls. Cells were pre-incubated with specific endocytosis inhibitors for 30 min before exposure to PHMB-FITC, dextran or transferrin and followed by either incubation at 4°C or 37°C for 4 h. The results show that only dynasore effectively inhibited the uptake of PHMB-FITC (80% inhibition), showing that PHMB uptake mechanism is dynamin-cfependenr endocytosis (Fig. 12). Similar results were obtained for PHMB-FITC/CpG ODN and PHMB/CpG-R polyplexes (Fig. 12 and 13), suggesting the uptake pathways of PHMB by BMDM was not affected by a polyplex formation. The data shows that the uptake mechanism of PHMB is predominantly via dynamin-dependenf endocytosis rather than other endocytosis pathways or non- endocytosis pathways such as direct penetration or diffusions. We next hypothesized that dynasore-mediated inhibition of PHMB uptake should also suppress PHMB's intracellular killing of amastigotes. If true, the effect would confirm our earlier evidence for intracellular killing. We determined the efficacy of PHMB or the polyplexes against intracellular amastigotes and extracellular promastigotes in the presence/absence of dynasore (80 μΜ). The results show clearly that dynasore inhibits PHMB-mediated killing of amastigotes and promastigotes (Fig. 14). In other words, dynasore rescued the parasites from the anti-parasitic effects of PHMB by blocking polymer uptake into host cells or extracellular promastigotes. Taken together, for the first time, we described how mammalian cells internalize PHMB for its broad spectrum antimicrobial activity inside the cells.

Example 7 Immunomodulation and safety of PHMB

The most commonly used antileishmanial drugs have immunomodulatory properties, and activate macrophages and dendritic cells to remove the parasites from the host cells. To assess whether PHMB has immunomodulatory properties and the polyplex formation process has not affected the immunomodulatory properties of CpG ODN, the concentrations of several key cytokines were measured by enzyme-linked immunosorbent assays (ELISA) from supernatants of co-cultured BMDM.

The results showed that cytokines production by BMDM for CpG ODN was dose depended, whereas for the polyplxes, only IL-6 and IL-12 were increased by increasing the doses (Fig, 10). We were not able to obtain reliable measures of IL-4 and TNF-a in cells treated with polyplexes or the free components (data not shown). Moreover, based on the concentrations of IL-6, IL-12 and IL-10 measurements, the polyplexes showed higher immune stimulation capacity as compared to free CpG ODN (Fig. 10). This suggests that the components of the polyplexes are bioactive after delivery into BMDMs and PHMB releases the CpG ODN from the polyplexes inside BMDMs. In summary, similar to several currently used antileishmanial drugs; PHMB itself has a stimulatory effect on macrophages, and the overall immune stimulant activity of CpG ODN was enhanced after forming a polyplex with PHMB. We also observed that PHMB itself stimulated the production of proinflammatory cytokines, example IL-6, IL-10, IL-12 by activating macrophages (Fig. 10), further supporting its use as a therapeutic agent against Leishmania infections.

PHMB has an excellent safety record topically and is widely used as preservative and an antimicrobial agent in clinics, homes and industry for many years worldwide. Whereas it's therapeutic applications in vivo have not been successful so far. Very recently, the safety of PHMB has been thoroughly reviewed by the Scientific Committee on Consumer Safety of the European Commission. Acute toxicity assessment was reported between 500 to 1000 mg/kg body weight and a NOAEL of 54 mg/kg bw from a dietary 12-months study in beagle dogs characterized by liver impairment, histopathological findings in the skin and liver among others⁴⁷. In female rat, the systemic toxicity values have been reported to be 1-2000 mg/kg³. We hypothesized that PHMB toxicity may be effectively counteracted when interacting with negatively charged ODN as a result of effective charge shielding upon complexation. To test this hypothesis, different polyplex formulations of various PHMB to CpG ODN ratios were prepared and tested against BMDM and 293T epithelial cells. The results show that polyplex formation process considerably reduces the toxicity of PHMB. Moreover, it indicates that relative toxicity of PHMB/CpG ODN polyplexes increases with increasing the ratio of PHMB to CpG ODN (Fig. 6). This finding was further supported by zeta potential determination, and the results similarly show that the higher the ratio of PHMB to CpG ODN, the more positive relative zeta potential of the polyplexes (Fig. 5b). Taken together, we speculate that the relative toxicity of PHMB can be further downsized by complexation/shielding of its positive charges with ODN and then may also suit for in vivo applications or other applications beyond the initial objectives of this study. Example 8 Methods for work relating to Example 1 to Example 7

Cell culture

BMDM were generated from bone marrow of BALB/c mice (Charles River Breeding Laboratories, Sulzfeld, Germany) and cultured for 6 days at 37°C and 5% CO2, as recently described (Firdessa et al). The primary BMDM were then harvested and maintained in phenol-free complete Roswell Park Memorial Institute (RPMI) medium containing 10% fetal calf serum (heat-inactivated), 2 mM L-glutamine, 10 mM HEPES buffer, 0.05 mM β- mercaptoethanol solution, gentamicin (50 pg/ml) and penicillin G (100 u/ml) for all the experiments. The same media were used in L. major parasites experiments. 293T kidney epithelial cells (DSMZ-No ACC-635, Braunschweig, Germany) were cultivated and maintained in high glucose (4.5 g/l) DMEM without L-glutamine and phenol red but containing 10% fetal calf serum (heat-inactivated), 200 mM L-glutamine and sodium pyruvate. AlamarBlue assay

The cytotoxicity of the different compounds or formulations against mammalian cell (BMDM or 293T epithelial cells) and L. major promastigotes were determined using this assay as previously described (Ponte-Sucre er a/). Briefly, 4 * 10⁴ mammalian cells or 10 x 106 virulent L. major isolate promastigotes (MHOM/IL 81/FE/BNI strain) in the log phase of growth were added to each well of 96 well plates and cultured with five increasing concentrations of each compound at 37^DC or 27°C for 24 h, respectively. Standard antileishmanial drugs including amphotericin B (A2942), pentamidine isothionate (P0547) and paromomycin sulfate (P9297) from Sigma-Aldrich (Deisenhofen, Germany) and miltefosine (1- exadecylphosphorylcholine) (Cayman Chemical Company, Ann Arbor, Ml , USA) were used as positive controls. The AlamarBlue dye (Trinova Biochem GmbH, Giessen, Germany) was added to each well at 10% concentration and incubated for further 48 h. The optical density (OD) was then measured by using Multiskan Ascent ELISA reader at a wavelength 550 nm and 630 nm. The OD value or % dye reduction is proportional to viable cell/parasite number and was used for IC₅o calculation based on the intercept theorem. Luciferase reporter assay (Amastigote assay)

The assay is based on bioluminescence measurement of firefly luciferase enzyme that catalyzes the formation of light from ATP and luciferin. The virulent luciferase-transgenic (Luc-tg) L major strain containing the firefly luciferase reporter gene was maintained by continuous passage in female BALB/c mice and was grown in 96-well blood agar cultures at 27°C, 5% C0₂, and 95% humidity. A luciferase-transgenic L. major strain was used to infect BMDM according to our recently established protocol (Bringmann et al). Briefly: BMDM numbers were adjusted to 2* 10⁵ and pre-incubated for 4 h to allow adherence to the surface in 96-well plate before the supernatant was discarded and replaced with an equal volume of medium containing the promastigotes' suspension. The promastigote number was adjusted to 3 ^χ 10⁶ parasites per ml to achieve an infection rate of 1 : 15. After incubating the infected BMDM (37°C, 5% C0₂) for 24 h to allow full differentiation of the promastigotes into amastigotes, the medium containing the extracellular parasites was removed and the wells were washed three times with the same medium. Five serial dilutions of each substance (1 :5) in the same fresh medium were added to the infected BMDM in duplicate with the appropriate controls. After further 24 h of incubation at 37°C and 5% CC½, the infected BMDM were lysed with a luciferin-containing buffer (Britelite, PerkinElmer, Germany) and the luminescence was measured with a luminescence plate reader, Victor X Light 2030 luminometer (PerkinElmer). The IC₅₀ values of the compounds against intracellular amastigotes were calculated based on the intercept theorem, as previously described (Bringmann er al , Lang er al).

Flow cytometry PI and YO-PROO-1 dyes (Life Technologies, Darmstadt, Germany) uptake by the promastigotes was measured by MACS Quant Analyzer (Miltenyi Biotec, Bergisch Gladbach, Germany) ), and used to indicate membrane integrity (Chekeni et al 2010). YO- PRO®-1 dye selectively passes through the plasma membranes of apoptotic cells but it does not label living cells (Chekeni et al 2010). L major promastigotes were treated with 2 μΜ PHMB for indicated time points and then washed at 3,000 * g for 10 min. The samples were stained by incubating with PI or YO-PRO®-1 dyes for 15 min in the dark at RT according to manufacturer's instructions. The samples were then washed and a total of 100,000 total events were immediately acquired by the flow cytometry. Similarly, adherent BMDM cells were allowed to uptake fluorescent PHMB (PHMB-FITC conjugate) in the presence or absence of five different pharmacological inhibitors (cytochalasin D (C8273), wortmannin (W1628), chlorpromazine hydrochloride (C8138), ikarugamycin (SML0188) and dynasore (D7693), Sigma-Aldrich, Deisenhofen, Germany). PHMB (Poiyhexamethylene biguanide; CAS# 27083-27-8; alternative chemical names: polyhexanide, polyamino propylbiguanide, Mw = 2780 g/mol)45 was kindly provided by Liam Good, University of London, and Tecrea Ltd, London UK, at stock concentrations of 1 mg/ml and 200 mg/ml. Moreover, polyplexes were prepared between PHMB and 3' end rhodamine red labeled CpG ODN (CpG-R) (Mw = 6891 g/mol, sequence TCCATGACGTTCCTGATGCT, Eurofins MWG Operon, Germany) at 1:1 (w/w) ratio for uptake study. The poylplexes and CpG-R were incubated with BMDM in the absences/presence of the inhibitors for various time points. The BMDM were harvested, washed, diluted to 1 χ 10⁶ and a total of 20,000 events were acquired per sample by the flow cytometry. The data were analyzed using FlowJo software (Tree Star Inc., CA, USA). Fluorescence microscopy and confocal microscopy

The BMDM or promastigotes was co-cultured with indicated doses of fluorescent PHMB for 24 h or 48 h. The samples were transferred to 15-ml tubes, washed and fixed with 4% paraformaldehyde. The DNA material of L major promastigotes was counterstained with Hoechst 33342 (Life Technologies, H3570, Darmstadt, Germany). Finally, 10 μΙ of the solution containing the parasites or BMDM were added to slides and covered with cover slips for microscopic examinations. Images were obtained using live video fluorescence and confocal microscopy systems (Wetzlar, Germany).

Electrophoretic mobility shift assay (EMSA)

Genomic DNA was isolated from 1.5 χ 10⁹ L major promastigotes using Purelink® Genomic DNA kit (K1820-01 , Life Technologies, Germany) and was quantified by using a NanoDrop 2000 spectrophotometer (Thermo Scientific, Germany). PHMB/gDNA polyplex formulations were prepared by adding and mixing 4.5 g of gDNA with PHMB (0-54 μg) in a final volume of 30 μΙ water. Similarly, PHMB/CpG ODN or PHMB/CpG-R polyplexes were prepared by mixing 30 μg CpG ODN 1668 (Mw = 6058 g/mol, sequence TCCATGACGTTCCTGATGCT, Eurofins M VG Operon, Germany) or 15 g of CpG-R with PHMB (0-54 pg) in a final volume of 30 μΙ water, respectively. After thorough mixing by pipette, the polyplexes were left at room temperature for 2 h prior to analysis. The samples were then combined with 6* Blue/Orange loading dye (Promega, Germany) and loaded to 1% agarose gel containing SYBR® gold nucleic acid gel stain (S11494, Life Technologies, Germany) for electrophoresis.

Transmission electron microscopy

TEM was used to determine particle sizes, and characterize stability and morphology of PHMB/CpG ODN polyplexes. For stability testing, polyplexes were prepared by mixing PHMB and CpG ODN at a 2:1 (w/w) ratio and kept at 4°C for two months. The samples were then mounted on 300-mesh grids, stained with uranyl acetate and lead citrate, analyzed with transmission electron microscopy (JEOL JEM-2100, Germany) operated at 80 kV and 200 kV with TVIPS F416 4k x 4k and Olympus Veleta 2k x 2k camera systems and imaged at 4400 or 2,000 x magnification.

Dynamic light scattering (DLS) and electrophoretic light scattering (ELS)

The particle sizes and zeta potential of PHMB/CpG ODN polyplexes were measured by using a Beckman coulter Delsa Nano C (Beckman Coulter, refeld, Germany). The CONTIN analysis mode and the Smoluchowski equation were used to determine the size and the Zeta potential, respectively. The measurements were done in triplicates and reproduced at least twice. The size and zeta potential measurements were performed in clean disposable cuvettes containing 500 μΙ Millipore Water or ISA "ionic strength adjusted" water (KCI 0.15M) and PHMB/CpG ODN polyplexes at a ratio of 2:1 or 1 :1 (w/w). The average particle size distributions of the polyplexes with their PDI and zeta potential values were determined by DLS and ELS. All measurements were carried out at 25°C. Scattered light was detected in an angle of 165 ° (particle size) and 15 ⁰ (zeta potential).

Isothermal titration calorimetry (ITC)

Affinity and specificity of interactions between PHMB and CpG ODN were studied by directly measuring the heat released or absorbed during binding events with MicroCal™ iTC200 System (GE Healthcare Northampton, MA, USA). All the samples were diluted in Millipore Water and degassed by ultrasonication for 15 min prior to their use. A 40-μΙ microsyringe was filled with 0.3 mM PHMB and injected at a rate of 2 μΙ/injections into cell sample containing 200 μΙ of 0.03mM CpG ODN for a total of 20 individual injections. The titrant syringe functions as the stirrer with the speed of 400 rpm. The stabilization delay of the heat signal before the first injection was 3 min. The injection interval was 150 seconds and calibration power of 5+0.5 pcal/sec. The measurements were performed in triplicates at 25°C. The background heat was determined by titrating Millipore Water into CpG ODN and was subtracted from the main experiment. All data were automatically collected and analyzed using Origin® and SigmaPlot softwares to get the thermodynamic parameters. The binding isotherm (ΔΗ) was used for fitting to an appropriate model.

Determination of cytokine productions

BMDM were generated from female BALB/c mice as described above in cell culture. 1x10⁶ BMDM were seeded in a final volume of 0.5 ml in 24-weII plates, infected with L major promastigotes, washed and incubated at 37°C for 30 min in the presence/absence of CpG ODN (15 pg/ml). PHMB, CpG ODN or PHMB/CpG ODN polyplexes were added to the pre-activated or control cells and further incubated for 48 h. The supernatants were collected and IL-6, IL-10, IL-4 or TNF-a (BD Biosciences, Wiesbaden, Germany) concentrations were measured by sandwich ELISA while IL-12p70 was measured by using the IL-12p70 ELISA Ready-SET-Go kit from eBioscience according to the suppliers' instructions.

Statistical Analysis

Normalization and percentage calculations were based on MFI of the treated cells as compared to the control in flow cytometry data analyses. The values are given as mean ± standard error (SE). Statistical significance was determined by one sample t-test (Microsoft Excel Software).

Example 9 - Mode of action of PHMB

The broad-spectrum antimicrobial biocide polyhexamethylene biguanide (PHMB; polyhexanide) kills bacteria, fungi, parasites and certain viruses with high therapeutic ratios (Muller and Kramer 2008); it is widely used in clinics, homes and industry (Muller et al 2013) (Figure 24). PHMB is composed of repeating basic biguanidine units connected by hexamethylene hydrocarbon chains, providing a cationic and amphipathic structure. Despite extensive use over several decades, resistance to PHMB has not been reported (Wessels and Ingmer 2013). The prevailing model for PHMB's microbe-selective toxicity holds that PHMB disrupts microbial membranes preferentially without activity on mammalian membranes (Broxton et al 1984, Broxton et al 1984b, Ikeda et al 1984, Ikeda et al 1983, Rusciano et al 2013). However, this model relies on artificial membrane data and does not explain killing of diverse microbes with differing cell barrier compositions (Messick et al 1999, Gentile et al 2012) nor PH B-mediated induction of DNA repair pathways (Allen et al 2006). Here we subjected PHMB to cellular, molecular and biophysical analysis to re-examine its MoA. The results reveal that PHMB enters both bacteria and host cells, condenses bacterial chromosomes and is excluded from mammalian nuclei.

Example 10 - Antibacterial and membrane activities of PHMB

If PHMB (Fig. 15A) kills bacteria via membrane disruption (Broxton er al 1984, Broxton er al 1984b, Ikeda ef al 1984, Ikeda et al 1983, Rusciano et al 2013), it would be expected to permeabilise bacterial membranes at inhibitory and sub-inhibitory concentrations. To test this model, we first determined the minimal inhibitory concentrations (MIC) for PHMB against Escherichia coli K - 12, Salmonella enterica serovar Typhimurium NK262C and Staphylococcus aureus NCTC 6571 (Figure 25) and examined cells by microscopy. Unexpectedly, growth inhibitory PHMB concentrations did not result in visible cell lysis, as monitored by bright-field microscopy. To assess cell barrier damage that could be invisible to bright-field microscopy, E. coli K - 12 cultures were grown to mid-log phase, and treated with PHMB in the presence of the fluorescent membrane integrity probe SYTOX®Green. Cultures treated with PHMB showed less probe fluorescence than cultures treated with the known cell wall disruptor polymyxin B or heat treatment (Fig. 15B). Surprisingly, higher concentrations of PHMB reduced fluorescence to background levels. These permeabilisation assay results raised further doubt about the membrane disruption model. Example 11 - PHMB enters bacteria

If PHMB's primary target is not the membrane, it likely acts internally, and this would require cell entry. To test for bacterial entry, we synthesised a PHMB-FITC conjugate (Figure 25) and assessed uptake into Gram-positive (Staphylococcus aureus), Gram- negative (Escheriachia coli and Salmonella enterica serovar Typhimurium) and acid-fast (Mycobacterium smegmatis) bacteria using microscopy and flow cytometry. Strong cell associated green fluorescence was observed in all species (Fig. 15C; Figure 25). The large-sized bacterium Bacillus megaterium was treated with PHMB-FITC, counter-stained with membrane localizing wheat germ agglutinin (WGA-red), and examined by fluorescence microscopy (Fig. 15D). Cell entry was observed in both live and fixed cells, and a fluorescence intensity profile analysis shows that PHMB-FITC localized within the cell cytoplasm, without accumulation at the cell barrier (Fig. 15E). Also, during the uptake experiments motile bacteria were observed at several time points following PHMB treatment (Figure 30). Therefore, PHMB enters bacteria and entry appears to occur prior to killing.

Example 12 - PHMB arrests cell division and condenses bacterial chromosomes When examining E. coli by microscopy, we noted that PHMB treated cells often showed an elongated morphology, which is typical of cell division inhibition (Fig. 16A). To measure the effects of PHMB on cell length, we titrated PHMB into growing cultures of E. coli strain SS996 (vide infra) and measured cell lengths. At sub-growth inhibitory concentrations more than 80% of cells were elongated (Fig. 16B). Also, we observed that E. coli treated with growth inhibitory concentrations of PHMB or PHMB-FITC, and then DAPI-stained, displayed blue fluorescent foci near the cell centre (Fig. 16C), which resemble nucleoids (De Vries 2010). To ease visualisation, we generated filamentous/multinucleated populations of E. coli by RNA silencing of ftsZ (Goh ef a/ 2009). In the absence of PHMB, filamentous cells showed uniform DAPI staining, whereas PHMB treated cells displayed blue "strings of beads" (Fig. 16D), clearly showing that PHMB condenses chromosomes within bacteria.

Example 13 - PHMB induced bacterial cell elongation and chromosome condensation is SOS independent

Cell elongation and chromosome condensation are characteristic of the bacterial SOS response (Amoils 2004, Dwyer et al 2012). However, in the case of PHMB treatment, an SOS response seemed unlikely given the lack of evidence for PHMB-mediated genotoxic or epigenetic effects (Creppy et al 2014). To investigate whether PHMB-induced cell elongation is SOS dependent, E. coli SS996, a strain that is SOS response deficient (sulB103) and acts as a GFP-based SOS response reporter (sulAp-gfp) (McCool et al 2004, Boberek et al 2010), was treated with PHMB, mitomycin C or triclosan. Untreated cells were not elongated and expressed background levels of GFP. PHMB treatment at sub-MBC concentrations resulted in elongated cells, but increased GFP expression was not observed (Fig. 17A). As a positive control for SOS induction, mitomycin C was included and this treatment resulted in the appearance of elongated cells and increased GFP expression. As a negative control, cells were treated with triclosan, which did not increase cell elongation or GFP expression (Fig. 17A). GFP expression was also measured by fluorimetry (Fig. 17B) and the results reflect those from microscopy. Therefore, PHMB caused cell elongation but not SOS response induction in £ coli SS996. Cultures of £ coli SS996 in mid log phase were treated with PHMB, and then DAPI stained and observed under a fluorescence microscope to reveal DAPI staining patterns. PHMB treated and DAPI stained £ coli SS996 cells also displayed a "beaded" appearance, indicating that PHMB mediated DNA condensation in bacterial cells is SOS response independent (Fig. 17C). Consequently, the PHMB-mediated cell division and chromosome structure effects are independent of an SOS programmed response. Example 14 - PHMB condenses bacterial chromosomes in vitro

If PHMB condenses bacterial chromosomes inside cells, it should also bind isolated chromosomal DNA. The effects of PHMB on purified E. coli chromosomal DNA were examined using an electrophoretic mobility shift assay (EMSA), a dye exclusion assay and circular dichroism spectroscopy, all of which showed DNA binding (Figures. 29 and 30). Also, mixtures of E. coli chromosomal DNA and PHMB were examined by dynamic light scattering, transmission electron microscopy (TEM) and fluorescence microscopy, all of which identified PHMB: DNA nanoparticles (Figures. 29 and 30). These results confirm earlier reports that PHMB binds DNA and can directly condense bacterial chromosomes. Example 15 - The antibacterial effects of PHMB are suppressed by a dsDNA ligand

Our observations of PHMB's effects on bacteria cannot be reconciled with the membrane disruption model for PHMB's primary antibacterial mechanism of action. Rather they are consistent with a new model, where PHMB enters bacteria and then condenses chromosomes, as illustrated in Fig. 18A. If correct, the new model would also predict functional interactions between PHMB and other DNA ligands. For example, small molecular weight DNA ligands could suppress PHMB's antibacterial potency by competing for DNA binding sites within chromosomes. To test this possibility, pairwise combinations of PHMB and Hoechst 33258 were used in growth susceptibility assays. Hoeschst 33258 was selected as competitor, because it is a cell-permeable DNA ligand that decondenses chromatin (Marcus ef a/ 1979). Drug interactions were calculated as fractional inhibitory concentration index values (FICI) using a panel of diverged bacterial species. The FICI values for PHMB: Hoechst were significantly higher than for PHMB combined with either of two non-DNA ligand antibacterials (Fig. 18B), and the FICIs show a positive correlation with chromosome AT-content (Fig. 18C). In B. megaterium, growth inhibition by PHMB was suppressed using sub-inhibitory Hoeschst 33258 concentrations (Fig. 18D). In other words, the DNA ligand rescued bacteria from inhibitory concentrations of PHMB. These pairwise drug interactions show that PHMB has an antibacterial effect via targeting DNA in bacteria, consistent with our new model for PHMB activity. The competition results also explain the unexpected cell permeabilsation profile observed for PHMB (Fig. 15B).

Example 16 - PHMB enters mammalian cells but is excluded from nuclei

Given the unexpected bacterial cell entry properties of PHMB, we assessed its ability to enter mammalian cells. PHMB-FITC was added to a panel of mammalian cell lines and primary fibroblasts and found to enter into all tested cells types (Fig. 19A, B), without damaging membrane integrity (Figure 31). Inspection of the microscopy images reveals that PHMB-FITC was contained within vesicles and excluded from nuclei (Fig. 19A). Chloroquine-mediated dequenching of PHMB-FITC cellular fluorescence indicated endosome localisation. Therefore, PHMB efficiently enters mammalian cells, but is excluded from nuclei, in part due to endosome entrapment.

Example 17 - Discussion relating to Example 9 - Example 16 The arsenal of registered antimicrobial agents (antibiotics + biocides) exploits only a small number of defined mechanisms (Kohanski et al 2010). For PHMB, we demonstrate bacterial entry, cell elongation, chromosome structural alteration and drug interaction effects, which together reveal the first example of an antibacterial drug that kills via chromosome condensation. Indeed, this is the first example of any drug that condenses chromosomes. Although not previously reported as an antibacterial mechanism of action, the feasibility of using a cationic polymer to condense chromosomes in bacteria is suggested by prior findings: (i) Bacterial DNA condensation and decondensation is regulated via polyamine and basic protein binding (Teif et al 2011), and condensation aids chromosome partitioning during cell division (Gordon et al 2000), (ii) overexpression of histone-like proteins leads to nucleoid condensation and bacterial cell death (Barry ef al 1992, spurio ef al 1992), (iii) chromosomes in cell lysates are condensed by the addition of polylysine (Kornberg ef al 974), and (iv) certain cationic polymers enter bacteria (Good ef al 2001, mondhe ef al 2014). Therefore, earlier studies are consistent with our model (Fig. 18a).

Our model of bacterial killing (Fig. 18a) raises the question, how can chromosome condensation provide a selective antibacterial mechanism, given that all organisms have chromosomes? The data in Fig. 19a provides an answer by showing that PHMB enters mammalian cells but is excluded from nuclei. Therefore, PHMB's antibacterial selectivity involves differential target access, through drug partitioning inside cells, rather than the principles of target recognition and structure conservation (O'Grady et al 1971). Mammalian cell uptake and nuclear exclusion of PHMB is an unexpected observation; however, cationic antimicrobial peptides are central to innate immunity, and our observations may reflect mechanisms that evolved to protect host cells against endogenous cationic antimicrobial peptides. Insight into antimicrobial mechanisms can aid further drug development (Speliberg et al 2004), and PHMB's unexpected MoA could now inspire new strategies to selectively condense microbial chromosomes - a mechanism that evidently does not succumb to acquired resistance.

Example 18 - Materials and Methods relevant to Example 9 - Example 17

Synthesis of PHMB-FITC conjugates

Polyhexamethylene biguanide (PHMB) was obtained as a gift from Arch UK Biocides Limited (Vantocil™ 100; UK). Fluorescein isothiocyanate (FITC, 2 mg, Sigma-Aldrich, UK) was dissolved in 800 μΙ dimethyl formamide (Sigma-Aldrich, UK), containing 50 μΙ of N,N- diisopropylethylamine (Sigma-Aldrich, UK). The mixture was combined with 200 μΙ aqueous PHMB (50 mg), and shaken overnight at room temperature. The resulting solution was dialyzed using a molecular weight cut off membrane 3.5 kDa against 50% aqueous ethanol for 5 days with intermittent change of dialysate (10 times, 500 ml), lyophilised to obtain fluoresceinyl-PHMB (PHMB-FITC) and characterized by infrared spectroscopy, IR (Nujol), v (cm^-1): 756 cm^'1 (C=S stretching).

Determination of Minimal Inhibitory Concentrations (MIC), Minimal Bactericidal Concentrations (MBC) and Fractional Inhibitory Concentration Index (FICI)

E. coli K-12, S. enterica serovar Typhimurium NK262C and S. aureus NCTC 6571 were grown in Mueller Hinton broth (MHB, Fluka, Germany) at 37 °C overnight. MICs were determined by serial dilution of the antibacterial in 200 μΙ MHB containing 10⁵ CFU/ml using 96-well plates (Costar, UK). Plates were incubated for 18 hours at 37 °C in a BioTek Power-Wave X340I spectrophotometer with shaking for 5 seconds every 5 minutes followed by recording of the absorbance at 550 nm. The MIC was scored as the lowest concentration of compound at which no growth was observed. To determine the minimal bactericidal concentration (MBC; >10³ CFU/ml reduction) dilutions of treated and untreated samples were plated on LB agar plates and CFUs were counted after 18 hours of incubation at 37 °C. FICIs were determined using the checkerboard assay as described previously (Dryselius et al 2005), using Hoechst 33258 (Sigma-Aldrich, UK).

Bacteria cell membrane permeability assay

E. coli K-12 from mid log phase (10 μΙ of culture, ODeoo adjusted to 0.1) were transferred to 96-well plates containing PHMB, polymyxin C or triclosan (0 - 8 pg/ml) in 100 μΙ phosphate buffered saline (PBS), and incubated at 37 °C for 60 minutes in a BioTek Power-Wave X340I spectrophotometer with shaking for 5 seconds every 5 minutes. To generate cells with maximum permeability to SYTOX®Green, untreated cultures were incubated for 10 minutes in a heating block maintained at 70 °C. The dye SYTOX®Green (Invitrogen, UK) was added to a final concentration of 1 μΜ, and changes in fluorescence emission were monitored at 535 nm upon excitation at 485 nm using a Wallac Victor 1 20 Multi label counter (PerkinElmer, UK). SYTOX®Green fluoresces strongly upon binding to DNA, and fluorescence was measured as an indication of membrane permeabilisation (Nekhotiaeva et al 2004).

Electroohoretic mobility shift assay (EMSA)

Genomic DNA from overnight cultures of E. coli K-12 was isolated using GenElute™ bacterial genomic DNA isolation Kit (Sigma-Aldrich, UK) according to the manufacturer's instructions. Mixtures of genomic DNA and PHMB were prepared by titrating 0.5 pg of genomic DNA with PHMB (0 - 0.75 pg) in a final volume of 50 μΙ 1 x PBS followed by incubation at 37 °C for 30 minutes. The resulting samples were combined with 6 x Blue/Orange loading dye (Promega, UK) and analyzed using 0.8% agarose gels containing ethidium bromide.

Circular dichroism (CD) spectroscopy

CD spectra of genomic DNA (0.1 mg/ml) from E. coli K-12 were recorded from 190 to 320 nm in 10 mM phosphate buffer, pH 7.0 at 25 °C in a CD spectropolarimeter (JASCO, J- 810 model, Japan) using a 0.1 cm path length cuvette. Six scans (20 nm/minute) were taken and the results were averaged. PHMB:DNA interactions were monitored by titrating PHMB with genomic DNA (150 μΙ, 100 pg/ml) with PHMB (0.0025 - 100 pg/ml). A CD spectrum base line correction was made for each PHMB concentration. Structural changes in genomic DNA were monitored by plotting ellipticity at 260 nm (θ₂6ο) against PHMB concentration. The experiments were repeated independently three times.

Dye exclusion assay

PHMB (0 - 4 pg/ml) and genomic DNA isolated from E. coli K-12 (1 pg/ml) were mixed in 100 μΙ 1 x PBS in a 96-well plate and incubated at 37 °C for 30 minutes. Following incubation, SYTOX® Green was added to 100 nM, and the plates were further incubated for 10 minutes at 37 °C and fluorescence was measured as described in the bacteria cell membrane permeability assay; see above.

Dynamic light scattering

PHMB: DNA mixtures (25 pg/m!:10 pg/ml) were diluted with 900 μΙ of 0.2 pm filtered water and mean particle size was measured by dynamic light scattering in a Zetasizer Nano ZS instrument (Malvern instruments, UK). Mean size represents the average of 20 readings. Experiments were repeated independently three times.

Transmission electron microscopy

PHMB:DNA (25 g/ml:10 g/ml) mixtures were loaded onto carbon coated copper grids, stained with aqueous 1% uranyl acetate for 30 seconds, air dried and visualised under a transmission electron microscope operated at 200 kV and 6500 x magnification (Technai G2 30 U-twin, USA). Corresponding concentrations of PHMB alone were used as control. Epi-fluorescence microscopy of bacteria and particles

Overnight bacterial cultures of E. coli K - 12, S. enterica serovar Typhimurium NK262C, and S. aureus NCTC 6571 were diluted 1:50 in MHB and incubated for 2 hours to reach mid log phase. M. smegmatis MC2155 was grown in Middlebrook 7H9 broth with 10% OADC enrichment (BD Biosciences, UK) for 18 hours. Aliquots from mid log phase cultures were diluted in MHB (E. coli and S. enterica) or 7H9 broth (M. smegmatis) to 0.1 OD600, and 100 μΙ aliquots were transferred to 1.5 ml tubes, PHMB-FITC (0 - 8 pg/ml) was added and the cultures were incubated for 90 minutes. Following incubation, bacteria were washed 3 times using 200 μΙ 1 x PBS via centrifugation at 5000 rpm for 5 minute and removal of the supernatants. Bacteria pellets were resuspended in 100 μΙ of 1 μΜ DAPI (Invitrogen, UK) in 1 x PBS and incubated at room temperature for 10 minutes, then mounted on a glass slide and observed under a fluorescence microscope (Leica DM4000B microscope with Zeiss "AxioVision" software).

For particle analyses, PHMB.DNA mixtures were prepared as described above for the dye exclusion assay and loaded on an agarose bed (1.5% in 1 x PBS) prepared on a glass slide, overlaid with a glass coverslip and observed under an upright fluorescence microscope using a FITC filter set (400 x magnification, Leica DM4000B microscope, "AxioVision" software). Confocal microscopy of bacteria

To explore the spatial distribution of PHMB in live bacteria, one of the largest known gram positive bacteria, B. megaterium, was exposed to PHMB-FITC and counterstained with a fluorescent membrane marker. B. megaterium was cultured in LB broth overnight before dilution to 10⁸ CFU/ml in fresh broth containing a final concentration of 5 g ml of PHMB- FITC. Following incubation in a shaker for 120 minutes at 37 °C, the bacteria were washed and stained with DAPI as described above. Bacterial pellets were re-suspended in 1 x PBS and 80 μΙ of the suspection was centrifuged in a Shandon Cytospin 2 cytocentrifuge at 800 rpm (75 x g) for 5 minutes before circumscribing the slide-deposited bacteria with a hydrophobic barrier pen (ImmEdge pen, Vector Laboratories). Cells were fixed in 4% formaldehyde (Thermo Scientific, Fisher Scientific) in 1 x PBS at room temperature for 15 minutes. The formaldehyde was aspirated and the preparation were washed three times with 1 x PBS at 5 minute intervals. To label the bacterial cell membrane, the fixed bacteria were immersed in 100 μΙ of Hank's balanced salt solution (HBSS) minus phenol red (Invitrogen) containing 5 pg/ml wheat germ agglutinin (WGA) conjugated to Alexa Fluor- 555 (Invitrogen). Following 20 minute incubation at room temperature, the labeling solution was removed and the slides were washed twice at 5 minute intervals with fresh HBSS. The preparation was mounted with FluorSave reagent (Calbiochem) and a coverslip fixed in place with clear nail varnish. Slides were kept at -20°C. Laser scanning confocal microscopy was conducted using a Leica SP5 microscope (Leica Application Suite, Advanced Fluorescence 3.1.0 build 8587 Software). Sequential scan Z-stacks (115 slice 1024 x 1024) were compiled at a line average of 96. ImageJ 1.49r was used to produce, analyse and profile plot dual channel composite Z-stacks.

SOS response assay

Overnight cultures of E. coli strain SS996 (105 CFU/ml) were sub-cultured in the absence or presence of PHMB, mitomycin C (Roche, UK) or triclosan (Ciba AG, Switzerland) in HB for 18 hours in a 96-weil plate in a Bio-Tek PowerWave X340I spectrophotometer as described above, and SOS response was assessed as described previously (Boberek et al 2010). GFP expression was measured in a Wallac Victor2 1420 ulti label counter using 485 nm (excitation) and 535 nm (emission). Generation offilamented bacteria

Overnight cultures of E. coli TOP 10 carrying a plasmid expressing antisense for bacterial cell division ftsZ mRNA (anti-ffsZ) were grown in MHB for 18 hours in the presence of chloramphenicol (30 Mg/ml, Sigma-Aldrich, UK) to maintain the plasmid (Goh et al 2009). Overnight cultures were diluted 50-fold in MHB and IPTG (75 pm) was added to induce anti-ffsZ expression. Cultures were further incubated for 90 minutes in an orbital shaker at 37 °C in the presence or absence of PHMB. Following incubation, bacteria were washed and stained with DAPI as described above and observed under a fluorescence microscope (400 x magnification, Leica DM4000B microscope, Zeiss "AxioVision" software). Mammalian cell culture

HeLa, HEK 293, MDBK, equine primary fibroblasts, Saos-2, CHO, and J774.A1 cells were maintained in DMEM (Invitrogen) with 10% FBS (Invitrogen), Penicillin (100 units/ml, Invitrogen) and streptomycin (100 Mg/ml, Invitrogen). THP-1 monocytes were maintained in RPMl 1640 medium with 10% FBS. To sub-culture adherent cells, the growth medium was removed and cells were washed twice with Hank's buffered salt solution (Invitrogen, UK). To detach cells, 2 ml of 0.05% trypsin - EDTA (Invitrogen, UK) was added and the cells were incubated at 37 °C for 5 minutes. Detached cells were counted using 0.4% Trypan blue (Invitrogen, UK) and the cells were seeded into 12 well tissue culture plates (0.1 x 10⁶ cells/well) and 75 cm² tissue culture flask.

Epi-fluorescence microscopy of mammalian cells

Equine primary fibroblasts were grown to ~ 60% confluence and treated with PHMB-FITC (0 - 4 Mg/ml) or free FITC (0.389 μg /ml; 1 μΜ) in DMEM and incubated for 2 hours. Following incubation, nuclei were stained using 1 μΜ Hoechst 33342 (Invitrogen, UK) in DMEM by incubating cells at 37 °C for 30 minutes. Following nuclear staining, cells were washed 3 times with PBS, and the extracellular fluorescence was quenched with 0.04% trypan blue (Invitrogen, UK) in ice cold 1 x PBS for 10 minutes. Finally, cells were washed twice with 1 x PBS, mounted on glass slides with aqueous fluoromount (Sigma-Aldrich, UK) and observed under a fluorescence microscope (Leica DM4000B, "AxioVision" software). PHMB-FITC uptake was scored by flow cytometry using an FL1 filter set (FACSCalibur™, CellQuest™ software, BD Bioscience). Similarly, PHMB uptake was assessed in other adherent cell lines (HEK 293, MDBK, Saos-2, CHO and J774.A1). To investigate uptake into suspension cells, 5 x 10⁵ THP-1 monocytes were transferred to a 96-well plate containing PHMB-FITC (0 - 4 yg/ml) in a final volume of 100 μΙ RPMl 1640 and incubated at 37 °C for 2 hours. Following incubation, cells were rinsed twice with 1 x PBS and cellular uptake was quantified by flow cytometry. Free FITC (1 μΜ) and untreated cells were used as negative controls to set background fluorescence.

Flow cytometry

Cell associated fluorescence of PHMB-FITC treated or untreated cells was analysed by flow cytometry (FACSCalibur™; CellQuest™ software, BD Bioscience) using an FL1 filter set. Adherent mammalian cells were trypsinised and diluted to 10⁶ cells/ml prior to flow cytometry. Untreated cells were used to establish threshold for fluorescence negative cells. Results were analysed using Flowjo7.6.5 software.

Propidium idodide (PI) mammalian cell membrane integrity assay To assess membrane permeability, HeLa cells were grown in 12-well plates and treated with PHMB (0 - 4 Mg/ml) in DMEM for 2 hours. Following incubation, cells were rinsed twice with 1 x PBS and treated with propidium iodide (PI, 2 Mg/ml, Sigma-Aldrich, UK), for 15 minutes, PI uptake was analysed by flow cytometry.

Endosome release assay

PHMB-FITC (3.5 Mg/ml) was suspended in 1 x PBS solutions in the pH range 4.06 - 7.4 (pH adjusted with 0.1 M HCI). The solutions were incubated at room temperature for 10 minutes and fluorescence was measured by recording emission at 535 nm upon excitation at 485 nm in a fluorimeter. HeLa cells exposed to 3.5 Mg/ml PHMB-FITC were treated with chloroquine (0 - 150 pM, Sigma-Aldrich, UK) for 2 hours at 37 °C and fluorescence was quantified by flow cytometry. The number of cells positive for uptake and the geometric mean (GM) was recorded to assess the cell-associated fluorescence from three independent experiments.

Data analysis

Data are represented as mean ± standard deviation from three independent experiments each performed in triplicates. Data in SI Fig. 6B, 9 and 10 were analysed by one-way ANOVA and data in SI Fig. 2 and 3 were analysed by two-way ANOVA, followed by Tukey's Post test (Prism 6, GraphPad, Inc., San Diego, CA). P < 0.05 was considered as statistically significant (*).

Example 19 - Susceptibility of S. aureus to topically used antibiotics and PHMB

To determine susceptibilities of MSSA and MRSA to a range of topically used antibiotics and PHMB, we measured minimum inhibitory concentrations (MIC) values using laboratory (RN4420) and clinical (EMRSA-15 & USA 300) strains of S. aureus. As expected, for all six topical antibiotics tested, the MIC values were variable and higher for the clinical MRSA strain (EMRSA-15 & USA 300) than for the MSSA strain RN4420. In contrast, for PHMB, MIC values were highly reproducible and similar for all strains. Overall, gentamicin, nadifloxacin and PHMB displayed the lowest MIC values against EMRSA-15 and USA 300 (Table 1).

Table 1 - MIC of topical antibiotics in S. aureus RN4420, EMRSA-15 and USA 300

MIC (Mg/ml)

Antibiotic RN4420 EMRSA-15 USA 300

Mupirocin 0.125 32 2

Fusidic acid 0.25 32 0.5 Gentamicin 0.25 4 0.25

Nadifloxacin 0.125 2 2

Erythromycin 0.125 32 16

Bacitracin 16 >32 32

PHMB 1 1 1

Given the observations described above for nadifloxacin and PHMB, we chose to focus on these two compounds in further studies. Nadifloxacin is a topical antibiotic currently used for acne treatment and skin infections. There are no reports on its activity against intracellular bacteria. Gentamicin is an antibiotic that is active against extracellular bacteria, but not against intracellular bacteria due to its poor penetration into mammalian cells (Vaudaux and Waldvogel, 1979). Therefore, its activity against intracellular bacteria was not examined further. Example 20 - Intracellular invasion of keratinocytes by S. aureus

To determine the activities of nadifloxacin and PHMB against intracellular bacteria, we first established an in vitro intracellular infection assay in HaCaT cells (Edwards and Massey, 201 ). HaCaT is a well-established keratinocyte cell line that is often used as a model of S. aureus in vitro infection assays (Soong et al., 2012; Di Grazia et ai, 2014). To establish optimum conditions for S. aureus RN4420, EMRSA-15 and USA 300 invasion in keratinocytes, bacteria were incubated with keratinocytes, followed by co-incubation with 200 pg/ml of gentamicin, to kill extracellular bacteria. All strains were able to invade keratinocytes, as indicated by their ability to evade gentamicin treatment. Three hours of infection followed by three hours of gentamicin treatment resulted in reproducible infections (Figure 20 a, b & c). Killing of mainly extracellular bacteria was evident in the results of all graphs, where lysis of keratinocytes following gentamicin treatment released approximately 10³ cfu/ml of S. aureus RN4420, 0⁵ cfu/ml of EMRSA-15 and 10⁴ cfu/ml of USA 300. These colony counts presumably reflected S. aureus that were inside keratinocytes and thus protected from gentamicin extracellular antibacterial activities. As expected, clinical strains EMRSA-15 and USA 300 showed higher invasion levels than S. aureus RN4420.

We confirmed invasion of S. aureus in keratinocytes by visualisation using confocal microscopy. Keratinocytes were infected with EMRSA-15 and stained with 4',6-Diamidino- 2-Phenylindole (DAPI) to label both host and bacterial chromosomes and red fluorophore tagged wheat germ agglutinin (WGA) to label keratinocytes membranes. Using 3D analysis, we observed localisation of EMRSA-15 (blue dots) inside keratinocytes membranes (red) (Figure 20d & e), confirming invasion of EMRSA-15.

Example 21 - Susceptibility of intracellular EMRSA-15 and USA 300 to nadifloxacin and PHMB

To investigate the potential intracellular killing by nadifloxacin and PHMB, keratinocytes were infected with EMRSA-15 and USA 300, treated with gentamicin to kill extracellular bacteria, followed by treatment with nadifloxacin or PHMB at 1 , 2, 4, 6, 8, 10 g/ml. Figure 21 summarised the percentages of intracellular killing by nadifloxacin and PHMB relative to untreated infected cells (0% killing). Nadifloxacin killed 80% of intracellular EMRSA-15 at 10 g/ml but failed to kill USA 300. On the contrary, PHMB killed almost 100% of both strains at 4 g/ml. Therefore, while nadifloxacin displayed similar MIC values for both EMRSA-15 and USA 300; its activities were inconsistent against intracellular S. aureus. On the contrary, PHMB displayed consistent and potent killing for both intracellular EMRSA-15 and USA 300.

Example 22 - Nadifloxacin and PHMB toxicity in keratinocytes

In order to be beneficial in the clinics, drugs need to be effective and not introduce toxicity to the host. Resazurin assays were performed to determine toxicity of nadifloxacin and PHMB in keratinocytes. The results showed that half maximal inhibitory concentrations (IC₅o) for nadifloxacin and PHMB were 1428 ± 247 pg/ml and 19.7 + 10 ig/m\, respectively. These data showed that keratinocytes could tolerate to high concentrations of both compounds, which were far higher than the required dosage to kill intracellular S. aureus; nadifloxacin (10 pg/ml) and PHMB (4 pg/ml). Therefore both compounds can be used to kill intracellular S. aureus without compromising host cell viability.

Example 23 - Investigation of PHMB uptake into keratinocytes

Killing of intracellular S. aureus by an antimicrobial would require drug entry into host cells and subsequent contact with bacteria. To test whether or not PHMB can enter keratinocytes, we incubated fluorescein tagged PHMB (PHMB-FITC) with keratinocytes and tracked its intracellular localisation using confocal microscopy. As can be seen in Figure 22a, a mix of predominantly diffuse and small-punctuated spots of PHMB-FITC was observed, suggesting that the majority of PHMB-FITC molecules localised in the cytosol. To quantify PHMB entry into keratinocytes, we analysed treated cells using flow cytometry, following quenching of extracellular fluorescence. Consistent with the microscopy results, flow cytometry indicated that PHMB-FITC entered more than 99% of the treated cells (Figure 22b). Example 24 - Exocytosis of PHMB-FITC from keratinocytes

For an antimicrobial to achieve complete killing of intracellular microorganisms, host cell retention or delayed excretion may be necessary. To determine PHMB's cellular retention, we exposed keratinocytes to PHMB-FITC, rinsed the cells, added new medium and monitored cell-associated fluorescence for over five hours. We observed only a minor reduction in fluorescence: after five hours 90% of the fluorescence was still retained (Figure 22c & d). Therefore, majority of PHMB was not exocytosed from keratinocytes and retained in the cells following exposure, which may help to explain its potent killing of intracellular EMRSA-15 and USA 300.

Example 25 - Co-localisation of PHMB and EMRSA-15 in keratinocytes

The results above are most easily explained by direct killing of EMRSA-15 and USA 300 by PHMB inside keratinocytes; however, other killing mechanisms are possible. To further characterise the PHMB-mediated killing mechanism(s), keratinocytes were infected with EMRSA-15, treated with PHMB-FITC and stained with DAPI to reveal host cell nuclei and intracellular bacteria. WGA was used to stain membrane structures of keratinocytes. Co- localisation of blue-stained bacteria and green PHMB-FITC was apparent inside host cells, as shown in figure 22f; indeed, co-localisation of PHMB-FITC and EMRSA-15 in keratinocytes was observed for the majority of intracellular bacteria in all cells examined. Therefore, PHMB-FITC makes direct contact with intracellular EMRSA-15 inside keratinocytes.

Example 26 - Effect ofdynamin inhibition on PHMB uptake and antibacterial activity in keratinocytes

The uptake of molecules into mammalian cells can involve simple diffusion or through endocytic pathways, depending on physiochemical properties of the molecules. Recent work in our laboratory demonstrates that PHMB enters mammalian cells predominantly via a dynamin-dependent endocytic pathway (Firdessa ef a/.,). This pathway requires dynamin (a GTPase) to excise newly formed vesicle from the membrane (Kirchhause, Macia, and Pelish 2009). This uptake route could help explain co-localisation with intracellular bacteria in keratinocytes, as the bacteria are phagocytosed into the cells.

If PHMB killed intracellular S. aureus via cell entry and direct contact with bacteria, as suggested in the co-localisation results above, then inhibitors that block cell entry should both reduce PHMB uptake and reduce intracellular killing. To test the effect of dynamin inhibition on PHMB uptake, we pre-treated keratinocytes with a dynamin inhibitor, dynasore before addition of PHMB-FITC. Using confocal microscopy, we observed that dynasore reduced PHMB-FITC uptake (Figure 23a). Quantification using flow cytometer confirmed that dynasore reduced uptake of PHMB-FITC into keratinocytes by 85% (Figure 23b). Similarly, dynasore reduced PHMB-mediated killing of intracellular EMRSA-15 by approximately 50% (Figure 23c). These results suggest that PHMB entry and intracellular antibacterial activity in keratinocytes was predominantly through dynamin-dependent endocytic pathway.

Example 27 - Discussion relating to PHMB and Staphylococcus aureus MRS A

We investigated the antibacterial activities of a panel of topically used antibiotics and the antimicrobial polymer PHMB against MSSA and MRSA. Variable MICs were observed for all strains, with gentamicin, nadifloxacin and PHMB gave the lowest MIC for clinical strain EMRSA-15 and USA 300. Nadifloxacin was effective against both extracellular EMRSA- 15 and USA 300, but effective only against intracellular EMRSA-15. PHMB, on the contrary , was effective against both extracellular and intracellular EMRSA-15 and USA300. Both compounds were effective at very low concentrations, which were far below toxicity threshold for keratinocytes. Further investigation showed that PHMB entered keratinocytes, co-localised with intracellular EMRSA-15, and retained in keratinocytes for over five hours. Finally, keratinocytes cells uptake and killing of intracellular EMRSA-15 by PHMB were reduced by dynamin inhibition.

Unlike the other antibiotics tested, the MIC for nadifloxacin against EMRSA-15 and USA 300 was only slightly higher than its MIC against S. aureus RN4420. This result agrees with evidence that nadifloxacin is effective against MRSA strains that are resistance to ciprofloxacin (Alba et a/., 2009). Treatment of MRSA infections is particularly difficult due to resistance to beta-lactam antibiotics and other classes of antibiotics. However, PHMB displayed identical MIC values against MSSA and MRSA strains, showing that PHMB's antibacterial activity is not influenced by the MRSA phenotype. The result is consistent with the lack of evidence of PHMB resistance, despite its widespread use over several decades (Kaehn, 2010).

Intracellular bacteria are generally difficult to kill because they are shielded from host immune mechanisms and protected from antibiotics. Nadifloxacin-mediated killing of intracellular S. aureus is perhaps expected, because it belongs to the fluoroquinolone group, a class of antibiotic that can enter and accumulate within mammalian cells (van Bambeke et al., 2005). However, it is not understood why nadifloxacin displayed inconsistent activity, being effective only for EMRSA-15 but not USA300. On the contrary, the intracellular activity of PHMB was unexpected, because it is a relatively large molecule (average molecular weight around 3025 grams/mol) (De Paula et al., 2011) and only in this invention has it been discovered to enter mammalian cells. Nevertheless, our results clearly show that PHMB enters and retains in keratinocytes, and co-localises with intracellular EMRSA-15. Most importantly PHMB consistently kills both intracellular EMRSA-15 and USA 300. The potent intracellular killing activity of PHMB in keratinocytes could be due to cell entry pathways that transport PHMB and S. aureus to a common final destination in the cell, including endosomes and the cytosol, thus promoting drug/pathogen interactions. Intracellular microorganisms such as S. aureus enter mammalian cells through phagocytosis (one of endocytic pathway) via a zipper-uptake mechanism (Fraunholz and Sinha, 2012). Once inside endosomes, S. aureus can either be killed within a phagolysosome, replicate inside an endosome, or escape into the cytosol (Fraunholz and Sinha, 2012). Inhibition of dynamin, a GTPase which pinches-off newly formed vesicles from the membrane, (Kirchhause ef al., 2009) impeded both PHMB-FITC uptake and its intracellular killing activity. Therefore, PHMB uptake into keratinocytes cells is dynamin- dependent.

To summarise, for the first time, we are reporting two main findings from this study. First, both nadifloxacin and PHMB are effective against intracellular S. aureus with PHMB being more potent and consistent at a low dosage. Second, we have demonstrated that PHMB uptake and intracellular antibacterial activities in keratinocytes predominantly involve a dynamin-dependent mechanism. The present findings suggest that these antimicrobials specifically PHMB could be useful for skin infections caused by MRSA or other intracellular bacterial pathogens, therefore, support for continuous usage of PHMB in the clinics. Example 28 - Materials and methods relevant to Example 19 - Example 27

Bacterial strains and growth conditions

S. aureus strain RN4420 was obtained from Dr. Staffan Arvidson, Karolinska Institutet, Stockholm, Sweden. Strain EMRSA-15 was obtained from Dr. Sean Nair, University College London and USA 300 was obtained from Dr. Jonathan Otter, Kings College, London. All bacteria growth was carried-out in Mueller Hinton Broth (MHB, Sigma-Aldrich, UK) followed by incubation at 250 rpm (for liquid cultures), at 37°C for 18 hours.

Eukarvotic cell lines and growth conditions

The well-established human keratinocytes, human adult calcium treatment (HaCaT) cell line was used throughout this study. HaCaT was obtained from Dr. Amir Sharili, Queen Mary University of London. Cells were maintained in Dulbecco's Modified Eagle's Medium (DMEM, Sigma-Aldrich, UK) with 10% Fetal bovine serum (FBS, Sigma-Aldrich, UK) supplemented with 5% penicillin-streptomycin (Sigma-Aldrich, UK), and maintained at 37°C in 5% carbon dioxide.

Determination of minimum inhibitory concentration (MIC)

All antibiotics were purchased from Sigma-Aldrich, UK, except for nadifloxacin, was from Santa Cruz Biotechnology, UK. All antibiotics were prepared in stock solution at 10 mg/ml. PHMB (Vantocil™, Arch UK Biocides) was prepared in stock solution at 1 mg/ml. Fusidic acid, gentamicin, bacitracin and PHMB were dissolved in sterile distilled water; mupirocin was dissolved in methanol; erythromycin was dissolved in ethanol; nadifloxacin was dissolved in 0.1 M sodium hydroxide solution.

The MICs were determined using the broth microdilution method (CLSI. 2007). Briefly, a range concentrations of antimicrobials were prepared in a 96 well microplate, followed by inoculation of bacteria culture to yield ~5x10⁵cfu/ml in a 250 μΙ final volume. The plate was then incubated at 37°C for 18 hours. The lowest concentration of antimicrobial that inhibited growth of bacteria was scored as the MIC.

Intracellular infection of keratinocytes by S. aureus

Intracellular infection of keratinocytes by S. aureus RN4420, EMRSA-15 and USA 300 were conducted using the gentamicin protection assay (Edwards and Massey, 2011). Keratinocytes were seeded at 1.2 x 10⁵ cells/well in a 12 well plate and cultured overnight in DMEM with 10% FBS, without antibiotic. In parallel, all S. aureus strains were cultured overnight in MHB at 37°C in incubator shaker. One ml of overnight bacterial culture was centrifuged at 8000 rpm for three minutes and pellet was re-suspended in phosphate buffer solution (PBS) (Sigma-Aldrich, UK). These processes were repeated for three times to remove bacterial toxin. Bacteria were diluted to a final concentration of approximately 10⁷ cfu/ml in DMEM with 10% FBS, without antibiotic. One ml of bacteria was added into each well containing keratinocytes after the original medium was removed. Bacteria were co- incubated with keratinocytes for three hours. 200 Mg/ml of gentamicin diluted in medium was added and incubated for another three hours. The medium containing bacteria and gentamicin were removed and cells were washed with PBS, which were serially diluted and plated on nutrient agar to determine the number of extracellular bacteria. One ml of 0.5% Triton X-100 prepared in PBS was added to each well to lyse cells. Cells were serially diluted in PBS and plated on nutrient agar (Sigma-Aldrich, UK) for enumeration of intracellular bacteria. Uninfected cells were put through the same lysis procedure to confirm sterility of nutrient agar used. Visualisation of S. aureus invasion in keratinocytes

Keratinocytes were grown on glass cover slips in a 12 well plates followed by EMRSA-15 infection as described above. Following gentamicin treatment to kill extracellular bacteria, cells were washed with PBS and fixed with 4% paraformaldehyde (Santa Cruz Biotechnology, UK). Cells were stained with 5 pg/ml 4',6-Diamidino-2-Phenylindole (DAPI, Life technologies, UK) for chromosome staining and 5 pg/ml of Wheat Germ Agglutinin- conjugated Alexa Fluor 555 (WGA, Life technologies, UK) for membrane staining. Cover slips were mounted onto glass slides with FluorSave™ (Calbiochem, UK). Images were visualised by Leica SP5 confocal microscope using Leica Application Suite, Advanced Fluorescence Software (Leica Microsystems, Milton Keynes, UK). Sequential scan Z- stacks (139 slices 1024 x 1024) were compiled at a line average of 96. Volocity® 3D Image Analysis Software was used to analyse and produce 3D images.

Intracellular killing activity of EMRSA-15 and USA 300 bv nadifloxacin and PHMB

Keratinocytes were infected by EMRSA-15 and USA 300 followed by the gentamicin protection assay as described above. Following gentamicin treatment, keratinocytes were washed with PBS, and antimicrobials (nadifloxacin and PHMB in medium) were added to wells containing cells. Plates were incubated for another three hours to kill intracellular bacteria. Following this period, antibiotic solutions were removed; cells were washed and lysed. Lysed cells were serially diluted and plated on nutrient agar. For each experiment, non-gentamicin treated keratinocytes and gentamicin treated (without nadifloxacin or PHMB) were used as controls.

Resazurin assay

Keratinocytes (4 ^χ 10⁴ cells/well) were added to a 96-well plate and cultured with increasing concentrations of nadifloxacin or PHMB at 37°C for 24 hours. Non-treated cells and medium only were used as controls. The resazurin sodium salt (Sigma-Aldrich, UK) prepared earlier as a stock solution at 440 μΜ in PBS was added to each well at 10% concentration and plates was incubated for additional 48 hours. The optical density (OD) was then measured using a Tecan Infinite plate reader (Tecan group Ltd, Switzerland) at a wavelength 550 nm and 630 nm. The OD value or % dye reduction is proportional to viable cell number and was used for IC₅₀ calculation based on the intercept theorem.

Visualisation and quantification of PHMB uptake in keratinocvtes

Keratinocytes were grown on glass cover slips in 12 well plates. 4 g/ml of PHMB labeled with fluorescein isothiocyanate (PHMB-FITC) in DMEM was added to the cells for three hours. Cells were washed with PBS and stained as described above before visualised using confocal microscopy. To quantify PHMB uptake into keratinocytes, cells were incubated with 4 g/ml PHMB-FITC in medium for three hours and washed with PBS. Cells were incubated with 0.04% Trypan blue (Invitrogen, UK) in PBS for 15 minutes to quench membrane-bounded PHMB-FITC. Flow cytometry was performed using a FACSBD (FACSBD machine and BDFACSDiva™ software, BD Bioscience) using the FITC filter set. For each sample, 10000 gated cells were analysed.

Exocvtosis of PHMB from keratinocvtes

Keratinocytes were seeded in a 35 mm tissue culture treated dishes (Griener Bio-One, Austria). Keratinocytes were incubated with 4 \ig/m\ of PHMB-FITC in medium for 3 hours. Following incubation, new medium containing 5 pg/ml WGA was added to label cells' membrane. Fluorescent quenching test was performed before live cell imaging. The test was carried for five hours using confocal microscopy. Images were taken for every 15 minutes for five hours. Mean fluorescent intensity (MFI) was calculated at the beginning of experiment and after five hours to assess retention of PHMB-FITC in the cells.

Co-localisation of PHMB and EMRSA-15 in keratinocvtes

Co-localisation was performed as described above (intracellular killing activity by PHMB), except for the last stage of antibiotic treatment, PHMB was replaced by PHMB-FITC. Following three hours of incubation, cells were washed and stained with DAPI and WGA followed by imaging using confocal microscopy.

Statistical analysis

Statistical analysis was performed using one-way Analysis of Variance (ANOVA) followed by Tukey test using the statistical packages Prism 6, Version 6.0 (GraphPad Prism 6.0, San Diego, CA). All data presented as means ± standard deviations. Differences were considered to be statistically significant for P≤ 0.05. Example 29 - The agents and compositions of the invention have anti- Leishmaniacidal activity in vivo

Example 30

Supplementary methods and data for Examples 9-18

PHMB-FITC conjugates retain antibacterial activity

PHMB-FITC conjugates were prepared and confirmed by IR spectroscopy (Fig. 26a,b). Importantly, the conjugates retain antibacterial activity as determined by MIC analysis against E. coli K- 12, S. enterica serovarTyphimurium NK262C and S. aureus NCTC 6571 (Figure 25). Therefore, the results indicate that the PHMB-FITC conjugate is a suitable probe for tracking PHMB cell localisation. Notably, the conjugate entered a wide range of bacterial species that have diverse cell wall/membrane compositions (Figure 26c-e).

PHMB uptake into bacteria is reduced at 4°C

We examined cell populations treated with PHMG-FITC using flow cytometry and found that the polymer entered cells with high penetrance (Figure 26c). To investigate whether PHMB uptake into bacteria requires active energy metabolism, mid-log phase E. coli cultures were incubated at 37 °C or at 4 °C for 2 hours to reduce cellular ATP levels. Subsequently, cells were treated with PHMB-FITC (0 - 6 Mg/ml) and further incubated on ice for two hours. Cell-associated PHMB-FITC fluorescence was quantified by fluorimetry (Figure 26d). Cells held at 4 °C displayed reduced PHMB-FITC uptake relative to cells incubated at 37 °C, consistent with an energy dependent cell uptake process.

Motility of E. coli in the presence of growth inhibitory concentrations of PHMB

During microscopy experiments, we routinely observed cells that were motile after exposure to PHMB at concentrations that prevent growth. To record this observation, time laps images of E. coli treated with PHMB at MIC concentrations were acquired and compared to images for untreated cultures. The results indicate motile and non-motile cells within the population (Figure 30).

PHMB interacts with bacterial genomic DNA in vitro and forms nanoparticles

To characterise PHMB interactions with isolated bacterial genomic DNA, an electrophoretic mobility shift assay (EMSA) was used. PHMB was mixed with genomic DNA isolated from E. coli K - 12, and mixtures were fractionated in agarose TBE gels, followed by DNA staining with ethidium bromide. PHMB:DNA wt:wt ratios of ≥ 0.5 displayed clearly retarded electrophoretic mobility of DNA, as indicated by retention of DNA in the well (Figure 29a). Similar results were obtained for PHMB-FITC. Well retention is consistent with PHMB interactions with DNA. Reduced ethidium bromide fluorescence in the presence of PHMB or PHMB-FITC in EMSA suggests that ethidium bromide was prevented from binding to DNA due to formation of PHMB:DNA complexes. This observation was further investigated using the DNA binding dye SYTOXOGreen in a dye exclusion assay. In the absence of PHMB, SYTOX®Green bound isolated E. coli genomic DNA, as indicated by a large increase in fluorescence, relative to dye alone. However, prior addition of PHMB reduced (> 80%) fluorescence (Figure 29b). Therefore PHMB forms complexes with bacterial genomic DNA that retard electrophoretic mobility and mask DNA access to DNA ligands.

To test whether PHMB induces structural effects on genomic DNA, combinations of PHMB and isolated E. coli chromosomal DNA were examined by circular dichroism (CD) spectroscopy. PHMB alone does not show a characteristic CD spectrum, whereas genomic DNA showed a typical DNA spectrum with a positive maximum ellipticity around 260 nm, a negative cross over at 252 nm and a negative trough around 245 nm. Addition of PHMB induced structural changes in genomic DNA, indicated by reduced ellipticity at 260 nm (Figure 29c, d), consistent with DNA binding.

PHMB:genomic DNA mixtures were examined using dynamic light scattering (Figure 30a). Particles with Z average < 100 nm were observed. In contrast, PHMB alone showed amorphous aggregates averaging ~1 micron in size, with high polydispersity. To further characterise particles/aggregates, PHMB: DNA preparations were negatively stained with uranyl acetate and visualised under a transmission electron microscope and nanoparticle aggregates were observed (Figure 30b). PHMB.DNA mixtures were stained with SYTOX®Green and examined by fluorescence microscope (Figure 30c). Mixtures of DNA and SYTOX®Green dye alone displayed background fluorescence. The addition of PHMB resulted in the appearance of small fluorescent particles and the number of particles increased with increasing PHMB concentrations. These results reveal that PHMB bind isolated bacterial genomic DNA leading to nanoparticle formation.

PHMB enters HeLa cells without increasing permeability to propidium iodide

To test whether PHMB damages mammalian cell membrane integrity, we used HeLa cells and a propidium iodide (PI) uptake assay. Treatment of cells with PHMB (0 - 4 pg/ml) did not increase HeLa cell staining by PI. Indeed, flow cytometry indicated >99.8% of cells excluded PI (Figure 31a). Therefore, PHMB does not permeabiiise mammalian cell membranes to PI at and above MIC concentrations in bacteria (Figure 25).

PHMB-FITC fluorescence is pH responsive

To investigate apparent vesicle entrapment of PHMB-FITC and possible localisation within endosomes (see Fig. 19a), we exploited the pH responsive fluorescent properties of FITC, which has a of pKa 6.4 and its fluorescence drops when pH is below its pKal We measured the pH effects on PHMB-FITC fluorescence (3.5 pg/ml) by varying the pH from 4 - 7.4. Fluorescence dropped dramatically at reduced pH, confirming quenching of PHMB- FITC at low pH (Fig. 31b).

Example 31 - PHMB induces immunogenic cell death and activates immune cells We have shown that PHMB alone can also activate immune cells to produce DAMPs. PHMB induced the production of cytokines, example IL-6, IL-10, IL-12 in BMDM. In order to determine whether PHMB has immunostimulatory effect on bone morrow-derived dendritic cells (BMDC), the expressions of maturation markers such as CD 86 and MHC II were determined. Flow cytometric analysis showed that PHMB (3 Mg/ml) enhanced the mean percentage of CD86 from a baseline control of 64.84% to 73.72% as compared to 82.6% by LPS (1 Mg/ml) and 81.6% by CpG ODN (25pg/ml) in BMDC. Similarly, it increased the MHC II positive cells from untreated BMDC of 36.3% to 48.37% as compared to 46.61% by LPS and 43.21% by CpG ODN in BMDC (Fig. 32). On the other hand, we investigated whether PHMB induces the expression of dead cell- associated antigens on the surface of parasite killed by PHMB so that the dying parasite can sufficiently mount an adaptive immune response system. To address the question, BMDC were treated with parasites that were killed by amphotericin B or PHMB at equal 1 μΜ concentrations for 4 h. Then, the parasites were stained with antibodies and pathogen associated molecular patterns (PAMPs) such as calreticulin (CRT), heat shock protein (HSP) 70 and 90 were quantified by flow cytometry. The results clearly showed that PHMB induced immunogenic cell death in Leishmania parasites. PHMB highly induced membrane translocation of calreticulin (CRT) and HSP70 and HSP 90 (Fig. 33). We then studied whether this dying/killed parasite has an immunostimulatory activity in BMDC. The results showed that parasites killed by PHMB induced significantly higher expression of BMDC maturation marker such as CD 86 and MHC II and CD 40 co-stimulatory molecule as compared to heat killed or live parasites (Fig 32). Methods

BMDC were generated in similar manner as BMDM except they were cultured in complete RPMI medium in the presence of recombinant murine granulocyte-macrophage colony- stimulating factor (GM-CSF, 0.04 Mg/ml; Invitrogen). Moreover, 5 ml of the same complete RPMI medium supplemented with GM-CSF were added on days 3 and 6. At day 8, the non-adherent cells were collected, washed with complete RPMI medium and seeded at 1 *10⁶ cells/ml in 24 well plates. The cells were stimulated with parasite killed by PHMB, live parasite, heat killed parasite (5:1 parasite to BMDC ratio), CpG ODN (25 pg/ml) or LPS (1 Mg/ml). The BMDC were then fixed with 4% PFA and resuspended in FACS buffer containing the following antibodies: anti-CD He-Pacific Blue (BD Biosciences, Heidelberg, Germany) (1 :50 dilution), fluorescein isothiocyanate (FITC)-conjugated anti-CD40 (Biolegend, San Diego, USA) (1:200 dilution), Phycoerythrin (PE)-conjugated anti-CD86 (1:200 dilution) and allophycocyanin (APC)-conjugated anti-MHC class II (Miltenyi, Bergisch Gladbach, Germany) (1 :200 dilution) at 4 °C in the dark for 45 minutes. A total of 45,000 events were captured by the flow cytometry for each sample and were similarly analyzed.

Claims

Claims

1. A composition comprising PHMB or PHMG for use in treating a subject infected with an intracellular microorganism, optionally wherein the composition is a pharmaceutical composition.

2. The composition for use according to claim 1 wherein the intracellular microorganism is a protozoan or a bacteria or a fungus.

3. The composition for use according to any of claims 1 and 2 wherein the intracellular microorganism is an obligate or facultative intracellular microorganism.

4. The composition for use according to any of claims 1 to 3 wherein:

The intracellular microorganism is a protozoan and is selected from the group consisting of Apicomplexans, optionally Plasmodium spp., Toxoplasma gondii and Cryptosporidium parvum; Trypanosomatids optionally Leishmania spp. and Trypanosoma cruzi; or the intracellular microorganism is a bacteria and is selected from the group consisting of Staphylococcus spp. including S. aureus MRSA, Pseudomonas spp, facultative or obligate E. coli, Bordetella pertussis, Brucella spp., Campylobacter spp., Group B Streptococcus, Leigonella spp., Listeria monocytogenes, Neisseria gonorrhoeae (meningitides), Salmonella spp., Shigella spp, Yersinia spp., Chlamydia spp., Mycobacterium leprae, Rickettsia spp; or the intracellular microorganism is a fungus and is selected from the group consisting of Blastomyces dermatitidis, Candida albicans, Coccidioides immitis, Histoplasma capsulatum, Cryptococcus neoformans, Pneumocystis jirovecii.

5. The composition for use according, to any of claims 1 to 4 wherein the intracellular microorganism is a mesoparasite.

6. The composition for use according to any of claims 1 to 5 wherein the intracellular microorganism causes a disease, optionally wherein the disease is Leishmaniasis such as Cutaneous Leishmaniasis, Mucocutaneous Leishmaniasis or Visceral Leishmaniasis; Malaria; Toxoplasmosis; cryptosporidiosis; or Chagas disease.

7. The composition for use according to any of claims 1 to 6 wherein the intracellular microorganism is a skin microorganism.

8. The composition for use according to any of claims 1 to 7 wherein the intracellular microorganism is located intracellulary within the subject for only part of the life-cycle of the microorganism, optionally wherein the intracellular microorganism is located in a macrophage for at least part of its lifecycle.

9. The composition for use according to any of claims 1-8 wherein the subject is a mammal, optionally a human, a mouse, a sheep, a horse or a cow, or wherein the subject is a bird, optionally a chicken, or wherein the subject is a fish, or wherein the subject is a plant or an arthropod.

10. The composition for use according to any of claims 1 -9 wherein the composition further comprises one or more agents, optionally wherein at least one of the agents is a therapeutic agent,

optionally wherein at least one of the one or more therapeutic agents is an antimicrobial agent, optionally wherein the anti-microbial agent is an anti-protozoan agent, an anti-fungal agent or an anti-bacterial agent;

optionally wherein at least one of the one or more therapeutic agents is an anticancer agent;

optionally wherein at least one of the one or more therapeutic agents is an anti- asthma agent;

optionally wherein at least one of the one or more therapeutic agents is an anti- allergy agent.

11. The composition for use according to claim 10 wherein at least one of the one or more agents is one or more immunomodulatory agents.

12. The composition for use according to claim 12 wherein at least one of the one or more immunomodulatory agents is a nucleic acid, optionally wherein the nucleic acid is selected from the group of:

unmethylated CpG oligodeoxynucleic acid, optionally CPG 7909, CPG ODN PF- 3512676, ODN 1585, ODN 2216, ODN 2243, ODN 1668, ODN 2006 ; or a a double-stranded RNA;

13. The composition for use according to claim 11 or 12 wherein at least one of the immunomodulatory agents is a pathogen-associated molecular pattern (PAMP), optionally selected from the group consisting of: iipopolysaccharide (LPS) from Gram-negative bacteria; components from Gram- positive bacteria, including lipoteichoic acid (LTA); triacylated lipopeptides, such as the synthetic ligand Pam3CSK4; diacylated lipopeptides such as MALP-2; flagellin orflagellin fusion proteins; double stranded RNA, for example as produced by replicating viruses; the synthetic ligand polyriboinosinic polyribocytidylic acid (poly l:C); single stranded RNA such as that from viruses; synthetic single stranded RNA, such as R-848 and imiquimod; unmethylated CpG islands such as those found in bacterial and viral DNA; hemozoin; Imiquimod; the AS04 adjuvant system; polyriboinsinic-polyribocytidylic acid; 852A; or interferons.

14. The composition for use according to claim 11 or 12 wherein at least one of the immunomodulatory molecule is a damage-associated molecular pattern (DAMP), optionally selected from the group of: a HSP; HMGB1; ATP; calreticulin, mitochondrial formyl peptides; mitochondrial DNA; uric acid; NY-ESO-1 ; Hyaluron; heparan sulfate fragments; S100 family proteins, optionally S100A8 (MRP8, calgranulin A) and S100A9 (MRP14, calgranulin B); fibronectin; surfactant protein A; biglycan; versican; mitochondrial DNA; and Serum amyloid A (SAA).

15. The composition for use according to any of claims 11 to 14 wherein at least one of the immunomodulatory agents activates one or more Pattern Recognition Receptors; optionally wherein at least one of the immunomodulatory agents activates TLR9, optionally activates TLR9 receptors on plasmacytoid-dendritic cells.

16. The composition for use according to any of claims 11 to 15 wherein the immunomodulatory agent enhances immune cell activation, optionally activation of one or more of a macrophage, a dendritic cell, a plasmacytoid-dendritic cell or a tumour associated macrophage.

17. The composition for use according to any of claims 1-16 wherein the composition stimulates the release of cytokines from bone marrow derived macrophages, optionally wherein the cytokines are selected from the group consisting of IL-6, IL-10, inducible nitric oxide synthase, CD80/86, MHCII, CD40, CXCL9, CXCL10, CXCL11, G-CSF, GM-CSF, IFN , IL-1a, IL-Ι β, IL-8, IL-12, p40 & p70, IL-18, IL-23, IL-27, M-CSF, MIP-2a (CXCL2), RANTES (CCL5), TNFa.

18. The composition for use according to any of claims 11-17 wherein the composition stimulates the innate immune response, optionally wherein the immunomodulatory agent stimulates the release of cytokines from bone marrow derived macrophages, optionally wherein the cytokines are IL-6, IL-10 and/or IL-12.

19. The composition for use according to any of claims 1- 8 wherein when the disease is leishmaniasis the composition further comprises a CpG ODN.

20. The composition for use according to any of claims 1-19 wherein the composition further comprises an adjuvant and/or a pharmaceutically acceptable excipient.

21. The composition for use according to any of claims 1-20 wherein the composition is for topical administration.

22. The composition for use according to any of claims 1-21 wherein the composition is for local administration, or topical administration, or is administered by injection, inhalation or orally.

23. The composition for use according to any of claims 1-22 wherein the composition is for administration once, or more than once.

24. The composition for use according to any of claims 1-23 wherein the composition comprises PHMB or PHMG and one or more immunomodulatory agents, optionally one or more immunomodulatory nucleic acids, optionally one or more CpG ODNs, and wherein the PHMB or PHMG and the one or more immunomodulatory agents forms a polyplex.

25. The composition for use according to claim 24 wherein the polyplexes have a size of between 170-342nm.

26. The composition for use according to any of claims 24 and 25 wherein the polyplex has a polydispersity index of less than 0.3, optionally wherein the size range is from about 1 to about 1000 nm.

27. The composition for use according to any of claims 24-26 wherein the polyplexes are predominantly spherical.

28. The composition for use according to any of claims 24-27 wherein the uptake by macrophages of the polyplex is elevated compared to the uptake by macrophages of the immunomodulatory agent, optionally the immunomodulatory nucleic acid, optionally the CpG in the absence of PHMB or PHMG, optionally wherein the uptake is elevated by 15 fold.

29. The composition for use according to any of claims 24-28 wherein the toxicity of the polyplex towards epithelial cells, optionally 293T cells, and bone marrow derived macrophages, is less than the toxicity of free PHMB or PHMG towards epithelial cells, optionally 293T cells, and bone marrow derived macrophages.

30. The composition of any of claims 11-29 wherein the PHMB or PHMG binds to the one or more immunomodulatory agents, optionally one or more immunomodulatory nucleic acids, optionally a CpG ODN.

31. PHMB or PHMG for use in treating a subject infected with an intracellular microorganism, optionally wherein the microorganism is a protozoan, or a bacteria or a fungus.

32. A composition comprising PHMB or PHMG and one or immunomodulatory agents, optionally one or more immunomodulatory nucleic acids, optionally one or more CpG ODNs, wherein the composition is as defined in any of the preceding claims.

33. PHMB or PHMG for use in preventing infection of a subject with an intracellular microorganism.

34. A composition comprising PHMB or PHMG for use in preventing infection of a subject with an intracellular microorganism wherein the composition is as defined in any of the preceding claims.

35. A method of treating a subject infected with an intracellular microorganism comprising administering PHMB or PHMG.

36. A method of treating a subject infected with an intracellular microorganism comprising administrating a composition comprising PHMB or PHMG, wherein the composition is as defined in any of the preceding claims.

37. A method of preventing infection of a subject with an intracellular microorganism comprising administering PHMB or PHMG.

38. A method of preventing infection of a subject with an intracellular microorganism comprising administrating a composition comprising PHMB or PHMG, wherein the composition is as defined in any of the preceding claims.

39. Use of PHMB or PHMG in the manufacture of a medicament for treating a subject infected with an intracellular microorganism or for preventing infection of a subject with an intracellular microorganism.

40. An anti-microorganism therapeutic for use in treating a subject infected with an intracellular microorganism or preventing infection of a subject with an intracellular microorganism, wherein the subject has been or will be administered PHMB or PHMG.

41. An anti-microorganism therapeutic for use in treating a subject infected with an intracellular microorganism or preventing infection of a subject with an intracellular microorganism, wherein the subject has been or will be administered a composition comprising PHMB or PHMG, optionally wherein the composition is as defined in any of the preceding claims.

42. A composition as defined in any of the preceding claims, optionally comprising one or more immunomodulatory agents, optionally one or more immunomodulatory nucleic acids, optionally one or more CpG ODNs, for use in treating cancer, wherein the composition is as defined according to any of the preceding claims, optionally wherein the composition is a polyplex.

43. The composition for use according to claim 42 wherein the composition further comprises an anti-cancer agent or immunotherapeutic, optionally dacarbazine, vinblastine, vincristine, vindesine, temozolomide, interferon, interleukin.

44. The composition for use according to any of claims 42 and 43 wherein the cancer is a basal cell carcinoma cell, a bladder cancer cell or a cervical cancer cell.

45. A method of treating cancer comprising administering a composition as defined in any of the preceding claims.

46. Use of a composition as defined in any of the preceding claims, in the manufacture of a medicament for treating cancer.

47. A composition as defined in any of the preceding claims for use in treating a disease characterised by inappropriate levels of inflammation.

48. The composition for use according to claim 47 wherein the disease is selected from the group consisting of asthma, allergic rhinitis, allergy and HIV.

49. The composition according to any of claims 47 and 48 wherein the composition further comprises an allergen, optionally ragweed pollen allergen Amb a1.

50. The composition according to any of claims 47-49 wherein the composition further comprises an anti-allergy agent, or an anti-asthma agent.

51. A method of treating a disease characterised by inappropriate levels of inflammation comprising administration of a composition as defined in any of the preceding claims.

52. Use of a composition as defined in any of the preceding claims in the manufacture of a medicament for treating asthma and/or allergic disease.

53. The composition for use according to any of claims 42-52 wherein the subject has been or will be administered a further therapeutic agent, optionally wherein the further therapeutic agent is an anti-microbial agent, optionally an anti-protozoan agent an antibacterial agent or an anti-fungal agent, or an anti-cancer agent, an anti-asthma agent, or anti-allergy agent.

54. A composition comprising PHMB or PHMG and one or more immunomodulatory agents for use in enhancing immune cell activation, optionally for enhancing the activation of one or more of a macrophage, a dendritic cell, a plasmacytoid-dendritic cell or a tumour associated macrophage.

55. A composition as defined in any of the preceding claims for use in wound healing.

56. A composition as defined in any of the preceding claims for use as a vaccination, optionally for use as a vaccination against intracellular parasites, cancer or a disease characterised by inappropriate levels of inflammation, optionally wherein the subject is exposed to the composition prior to exposure to one or more relevant antigens.

57. The composition for use according to claim 56 wherein the composition further comprises one or more antigens.

58. A composition comprising more than one polyplex as defined in any of the preceding claims.

59. The composition according to claim 58 for use in enhancing an immune response; activating an immune cell; treating a subject infected with an intracellular microorganism, optionally infected with an intracellular parasite an intracellular bacteria or an intracellular fungus; preventing infection with an intracellular microorganism, optionally infected with an intracellular parasite an intracellular bacteria or an intracellular fungus; treating or preventing cancer; or treating or preventing a disease characterised by inappropriate levels of inflammation.

60. A kit of parts comprising PHMB or PHMG and one or more further agents selected from the group comprising an anti-microbial agent, an anti-protozoan, an antibacterial, an antifungal, an anti-cancer agent, and anti-inflammatory, an agent for treating asthma, an agent for treating allergic disease, an immunomodulatory agent or an endocytosis stimulator.

61. A kit of parts comprising a polyplex of PHMB or PHMG and one or more immunomodulatory agents, for example one or more immunomodulatory nucleic acids, for example one or more CpD ODNs, wherein the kit further comprises one or more further agents, optionally selected from the group comprising an anti-microbial agent, an anti- protozoan, an antibacterial, an antifungal, an anti-cancer agent, and anti-inflammatory, an agent for treating asthma, an agent for treating allergic disease or an endocytosis stimulator.

62. A method of reducing or preventing the presence of intracellular microorganisms in cells in culture, the method comprising contacting a composition comprising PHMB or PHMG according to any of claims 1-61 with the cells, optionally wherein the cells are cultured mammalian cells.

63. An anti-cancer agent for use in treating a subject with cancer, wherein the subject will be, or has been administered a composition according to any of the preceding claims.

64. An anti-asthma agent for use in treating a subject with asthma, wherein the subject will be, or has been administered a composition according to any of the preceding claims.

65. An anti-allergy agent for use in treating a subject with an allergic disease, wherein the subject will be, or has been administered a composition according to any of the preceding claims.

66. The composition of any of the preceding claims wherein the immune modulator acts inside cells or within cellular vesicles or within organelles.

67. PHMB or PHMG for use in enhancing the immune response or in stimulating the immune response.

68. PHMB or PHMG for use in host-directed therapy, optionally immunotherapy and/or vaccination.