KR101208732B1 - Kits for Detecting Genetically Modified Corn MON863 and MON810 - Google Patents

Abstract

The present invention provides a kit for detecting (a) genetically modified corn MON810, MON863 and a kit for detecting genetically modified corn MON863 and MON810; And (b) a kit for detecting genetically modified corn MON810 and MON863 and a microarray for detecting genetically modified corn MON863 and MON810. The present invention is a kit for detecting genetically modified corn MON810, MON863, and a kit and microarray with greatly improved accuracy and reliability in detecting genetically modified corn MON863 and MON810. In addition, the present invention can simultaneously and economically detect the genetically modified corn MON863 and MON810, as well as a single, as well as complex, thereby reducing the time and process of detecting and identifying the genetically modified corn as well as economical in terms of cost. Has an advantage.

Description

Kits for Detecting Genetically Modified Corn MON863 and MON810}

The present invention relates to a kit for detecting genetically modified corn MON863 and MON810.

GMO (Genetically Modified Organisms) refers to genetically modified foods. Genetic engineering or genetic engineering refers to the technology of obtaining a gene from one species and inserting it into another species, and living organisms created in this way are called GMOs. In 1994, Caljin's unripened tomatoes were first marketed with approval from the US Food and Drug Administration (FDA), and in 1966 Monsanto's genetically engineered soybeans began to be commercially grown on a large scale.

GMO is resistant to diseases and has the advantage of solving food shortages due to its high yield, but it has not been clearly verified that it is harmless to humans even when ingesting GMO foods for a long period of time, and environmental disasters such as disturbance of the ecosystem due to GMO varieties occur. There is a risk that it may be. Viewing GMO foods differs greatly between the United States and Western Europe. In the United States, where genetic technology is advanced, more than half of the food sold in supermarkets contains GMOs, and the vast majority of Americans trust that GMO foods are safe. However, environmental groups in Western European countries call GMO grains “Frankenstein food” and the general public is avoiding it.

Currently, there are about 50 GM0 items distributed worldwide, including soybeans, corn, and potatoes, and 39 GM0 items are distributed in Korea. In particular, with the announcement that 82% of the tofu marketed in Korea is made of raw materials mixed with genetically modified soybeans, the issue of the harmfulness of genetic foods has been a problem in Korea. For example, there was a case where it was discovered that GMO soybeans made by putting some genes of Brazil nut in soybeans cause allergies, and the development was stopped.

Currently, the most representative foreign genes introduced into genetically modified organisms are EPSPS (enolpyruvylshikimate-3-phophate synthase), PAT (Phosphinothricin acetyl transferase), and BT (Bacillus thuringiensis) cry (crystal protein) family genes. The EPSPS gene is a gene that makes it resistant to a herbicide called glyphosate, the PAT gene is a gene that makes it resistant to a herbicide called gluphosinate, and the cry family gene is a gene that makes it resistant to pests (Harrison et al., The Journal of Nutrition 126:728-740 (1996); Crickmore et al., Microbiology and molecular biology reviews . Sept p.807-813 (1998)). Genetically modified organisms containing the gene include glyphosate/pest-resistant corn (Agrobacterium sp. species CP4 EPSPS gene + Ochrobactrum anthropi glyphosphate oxidoreductase gene, Monsanto), glyphosate-resistant cotton thread (Agrobacterium spp. CP4 EPSPS gene included) ), glyphosate-resistant canola (including Agrobacterium spp.CP4 EPSPS gene), glufosite-resistant corn (including the phophinothricin acetyl hydrolase gene from Streptomyces hygroscopicus, Dekalb Genetics Corp.), glufosinate-resistant canola (including the PAT gene from Streptomyces virodochromogenes) , Agevo Inc.), glofosinate-resistant corn (including the PAT gene of Streptomyces virdochromogenes), pest-resistant corn (including the cryIA(b) gene, Monsanto), pest-resistant potatoes (including the cryIII A gene, Monsanto), pest resistance Corn (including cryIA(b) gene, Northrup King), pest-resistant corn (including cryIA(b) gene, Ciba-Geigy Corp.), and the like.

GMO tests, which are currently widely used, can be broadly divided into enzyme immunological methods (ELISA) and PCR methods (Rolf et al., Food Control 10; 391-399 (1999)). Alternatively, in the case of genetically modified crops, a biological assay method by treatment with herbicides can also be applied. The enzyme immunological method is a method of diagnosing using an antibody that specifically recognizes a protein produced by a gene introduced into a genetically modified crop. However, in the case of an organ that does not express the introduced gene, diagnosis is not possible and sensitivity of detection Is inferior to the PCR assay, and has limitations in detection in foods where protein denaturation may occur due to heat treatment or the like.

The PCR assay is a technology that specifically amplifies the gene regulatory region or fragment of the introduced gene introduced into GMO. It can be assayed not only in raw agricultural products but also in processed products, and up to 0.01% can be assayed. Primarily, a single test for a gene using PCR (polymerization chain condensation reaction) is tested by PCR with a promoter or a specific primer for the transcriptional termination part that controls the expression of foreign genes introduced into the GMO. In this case, a method using real time PCR (Real time PCR) is used to check whether or not more accurate GMO is included in the second phase (Wurz et al., Food Control 10; 385-389 (1999); Farid et al., Detection of genetically modified organisms in foods. Trends in Biotechnology Vol. 20 No5; 215-223 (2002)). However, this method requires a large amount of sample genes and manpower, etc., as each tube must be reacted using each probe to identify each GMO gene and confirmed on a gel. In order to distinguish the amplified gene product, there is a limitation that the size of the gene product must be distinguished.

However, a method capable of specifically and accurately detecting MON863 and MON810, which are genetically modified corns among GMOs, has not yet been reported, and accordingly, a novel detection method capable of detecting MON863 and MON810, which are genetically modified corns. The necessity of this is emerging.

The present inventors have made diligent efforts to develop a kit capable of specifically detecting genetically modified corn MON863 and MON810 individually or simultaneously. As a result, each of the oligonucleotides including the terminal portion of the Cry1Ab gene introduced into MON810 and the flanking gene of the corn genome, and a portion of the whsp 17 gene introduced into MON863 and the oligonucleotide including the flanking gene of the corn genome were specific. After each amplification by polymerase chain reaction using a suitable primer, it was found that genetically modified corn MON863 and MON810 can be specifically detected individually or at the same time by hybridizing each specific probe to the amplified polymerase chain reaction product. By doing so, the present invention has been completed.

Accordingly, an object of the present invention is to provide a kit for detecting genetically modified corn MON810.

Another object of the present invention is to provide a kit for detecting genetically modified corn MON863.

Another object of the present invention is to provide a kit for detecting genetically modified corn MON863 and MON810.

Another object of the present invention is to provide a microarray for detection of genetically modified corn MON810.

Another object of the present invention is to provide a microarray for detection of genetically modified corn MON863.

Another object of the present invention is to provide a microarray for detecting genetically modified corn MON863 and MON810.

Other objects and advantages of the present invention will become more apparent by the following detailed description, claims and drawings.

According to one aspect of the present invention, the present invention is a forward primer and reverse primer consisting of an oligonucleotide sequence comprising 10-100 of the nucleotide sequence of Sequence Listing 1 or 10-100 of the oligonucleotide sequence complementary thereto. A kit for detecting genetically modified maize MON810 comprising a primer set consisting of primers is provided.

According to another aspect of the present invention, the present invention is a forward primer and reverse primer consisting of an oligonucleotide sequence comprising 10-100 of the nucleotide sequence of SEQ ID NO: 2 or 10-100 of the oligonucleotide sequence complementary thereto. It provides a kit for detecting genetically modified corn MON863 comprising a primer set consisting of primers.

According to another aspect of the present invention, the present invention comprises (a) an oligonucleotide sequence comprising 10-100 of the nucleotide sequence of SEQ ID NO: 1 or 10-100 of the oligonucleotide sequence complementary thereto. A first primer set consisting of a forward primer and a reverse primer; And (b) a second primer set consisting of a forward primer and a reverse primer consisting of an oligonucleotide sequence comprising 10-100 of the nucleotide sequence of SEQ ID NO: 2 or 10-100 of the oligonucleotide sequence complementary thereto. It provides a multiplex kit for detecting MON863 and MON810, including.

The present inventors have made diligent efforts to develop a kit that can specifically detect genetically modified corn MON863 and MON810 individually or at the same time, and as a result, including the terminal portion of the Cry1Ab gene introduced into MON810 and the flanking gene of the corn genome. The oligonucleotide and a portion of the tahsp 17 gene introduced in MON863 and the oligonucleotide containing the flanking gene of the corn genome were amplified by polymerase chain reaction using specific primers, respectively, and then the amplified polymerase chain reaction product was used. By hybridizing each specific probe, it was found that genetically modified maize MON863 and MON810 can be specifically detected individually or simultaneously.

The expression “corn MON810” in the specification of the present invention refers to genetically modified corn into which the Cry1Ab gene producing Cry1Ab protein, which is a Bt protein that is toxic to pests derived from Bacillus thuringiensis (Bt), has been introduced, It is a genetically modified corn developed by Monsanto and traded under the trade name YieldGard.

In addition, the expression “corn MON863” in the specification of the present invention is corn having pest resistance, and Bacillus is a soil microorganism. Turingiensis subsp. It refers to genetically modified corn that can kill corn rootworms that cause enormous damage to corn by introducing the Cry3Bb1 gene, which produces the delta endotoxin Cry3Bb1 protein, which is an insecticidal protein specific to the coleoptera from Kumamotoensis.

In the specification of the present invention, the expression "post-cross breeding event corn" refers to corn that has been re-crossed between genetically modified corns.

The term “complementary or complementary” is meant to encompass not only 100% complementary, but also incomplete complementarity sufficient to inhibit the expression of the target gene through an RNA interference mechanism, and preferably 90%. It means complementarity, more preferably 98% complementarity, and most preferably 100% complementarity. In the present specification, when expressing 100% complementarity, it is specifically described as “completely complementary”.

Other components may be additionally included in the kit of the present invention. For example, reagents necessary for PCR amplification, such as buffers, DNA polymerases (e.g., Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis, or heat obtained from Pyrococcus furiosus (Pfu) Stable DNA polymerase), DNA polymerase cofactors, and dNTPs.

In the present specification, the term "complementary" means having a degree of complementarity to hybridize perfectly complementary to the nucleotide sequence described above under certain hybridization or annealing conditions.

The term “primer” as used herein refers to a single template that can serve as an initiation point for template-directed DNA synthesis under suitable conditions (ie, four different nucleoside triphosphates and polymerases) in a suitable buffer at a suitable temperature. -It means a stranded oligonucleotide.

The term “amplification” as used herein refers to a reaction that amplifies an oligonucleotide molecule. Various amplification reactions have been reported in the art, including polymerase chain reaction (PCR) (U.S. Patent Nos. 4,683,195, 4,683,202, and 4,800,159), reverse transcription-polymerase chain reaction (RT-PCR) (Sambrook et al., Molecular Cloning. A Laboratory Manual, 3rd ed.Cold Spring Harbor Press (2001)), Miller, HI (WO 89/06700) and Davey, C. et al. (EP 329,822), ligase chain reaction (LCR) ( 17, 18), Gap-LCR (WO 90/01069), repair chain reaction (EP 439,182), transcription-mediated amplification (TMA, WO 88/10315), self-maintaining sequence replication (self sustained sequence replication, WO 90/06995), selective amplification of target polynucleotide sequences (US Patent No. 6,410,276), consensus sequence primed polymerase chain reaction ( CP-PCR), U.S. Patent No. 4,437,975), Arbitrarily Primed Polymerase Chain Reaction (AP-PCR), U.S. Patent Nos. 5,413,909 and 5,861,245), oligonucleotide sequence-based amplification (nucleic acid) sequence based amplification (NASBA), U.S. Patent Nos. 5,130,238, 5,409,818, 5,554,517, and 6,063,603), strand displacement amplification n) (21, 22) and loop-mediated isothermal amplification; LAMP) 23, but is not limited thereto. Other amplification methods that can be used are described in U.S. Patent Nos. 5,242,794, 5,494,810, 4,988,617 and U.S. Patent No. 09/854,317.

PCR is the most well-known oligonucleotide amplification method, and its many modifications and applications have been developed. For example, touchdown PCR, hot start PCR, nested PCR and booster PCR have been developed by modifying traditional PCR procedures to enhance the specificity or sensitivity of PCR. In addition, real-time PCR, differential display PCR (DD-PCR), rapid amplification of cDNA ends (RACE), multiplex PCR, inverse polymerase chain reaction chain reaction (IPCR), vectorette PCR and TAIL-PCR (thermal asymmetric interlaced PCR) have been developed for specific applications. For more information on PCR, see McPherson, M.J., and Moller, S.G. PCR. BIOS Scientific Publishers, Springer-Verlag New York Berlin Heidelberg, N.Y. (2000), the teachings of which are incorporated herein by reference.

According to a preferred embodiment of the present invention, the kit for detecting genetically modified corn MON863 and MON810 of the present invention uses a multiplex PCR method.

The primer used in the present invention is hybridized or annealed at one site of the template to form a double-chain structure. Conditions for oligonucleotide hybridization suitable for forming such a double-chain structure are Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001) and Haymes, BD, et al., Nucleic Acid. Hybridization, A Practical Approach, IRL Press, Washington, DC (1985).

When carrying out the polymerization reaction, it is preferable to provide the reaction vessel with the components necessary for the reaction in excess. The excessive amount of components required for the amplification reaction means an amount such that the amplification reaction is not substantially limited to the concentration of the component. To provide joinja, dATP, dCTP, dGTP and dTTP, such as Mg ^{+ 2} to the reaction mixtures to have a desired degree of amplification can be achieved is required. All enzymes used in the amplification reaction may be active under the same reaction conditions. In fact, the buffer allows all enzymes to approach optimal reaction conditions. Therefore, the amplification process of the present invention can be carried out in a single reactant without changing conditions such as addition of reactants.

According to a preferred embodiment of the present invention, the kit for detecting genetically modified MON810 of the present invention is an oligonucleotide comprising 10-100 sequences of the nucleotide sequence of the first sequence of Sequence Listing or 10-100 of the oligonucleotide sequences complementary thereto. It further includes a probe consisting of a sequence.

According to a preferred embodiment of the present invention, the kit for detecting genetically modified MON863 of the present invention is an oligonucleotide comprising 10-100 sequences of the nucleotide sequence of SEQ ID NO: 2 or 10-100 of the oligonucleotide sequences complementary thereto. It further includes a probe consisting of a sequence.

According to a preferred embodiment of the present invention, the present invention MON810 detection kit, MON863 detection kit, and MON863 and MON810 detection multiplex kit are (a) 10-100 sequences of the nucleotide sequence of SEQ ID NO: 3 or complementary thereto. A third primer set consisting of a forward primer and a reverse primer consisting of an oligonucleotide sequence comprising 10-100 of the typical oligonucleotide sequences; (b) a fourth primer set consisting of a forward primer and a reverse primer consisting of an oligonucleotide sequence comprising 10-100 of the nucleotide sequence of SEQ ID NO: 4 or 10-100 of the oligonucleotide sequence complementary thereto; And (c) a fifth primer set consisting of a forward primer and a reverse primer consisting of an oligonucleotide sequence comprising 10-100 of the nucleotide sequence of SEQ ID NO: 5 or 10-100 of the oligonucleotide sequence complementary thereto. Further comprising, more preferably, a third primer set to a fifth primer set, and (a) 10-100 of the nucleotide sequence of SEQ ID NO: 3 or 10-100 of the oligonucleotide sequence complementary thereto A probe consisting of an oligonucleotide sequence comprising a sequence; (b) a probe consisting of an oligonucleotide sequence comprising 10-100 of the nucleotide sequence of SEQ ID NO: 4 or 10-100 of the oligonucleotide sequence complementary thereto; And (c) a probe consisting of an oligonucleotide sequence comprising 10-100 of the nucleotide sequence of SEQ ID NO: 5 or 10-100 of the oligonucleotide sequence complementary thereto.

The suitable length of the primer and probe used in the present invention may vary depending on various factors, such as temperature and the application of the primer. Preferably, the length of the primers used in the present invention is 10-50, more preferably 10-40, and even more preferably 15-30.

The term “probe” as used herein refers to a linear oligomer of natural or modified monomers or linkages, including deoxyribonucleotides and ribonucleotides, and capable of specifically hybridizing to a target nucleotide sequence, and naturally It exists or is artificially synthesized. The probe of the present invention is preferably single-chain and is an oligodeoxyribonucleotide.

The above-described probe is used as a hybridizable array element and is immobilized on a substrate. Preferred gases are suitable rigid or semi-rigid supports, including, for example, membranes, filters, chips, slides, wafers, fibers, magnetic or non-magnetic beads, gels, tubing, plates, polymers, microparticles and capillaries. The hybridization array element described above is arranged and immobilized on the substrate. Such immobilization is carried out by a chemical bonding method or a covalent bonding method such as UV. For example, the hybridization array element can be bonded to a glass surface modified to contain an epoxy compound or an aldehyde group, and can also be bonded to a polylysine coated surface by UV. In addition, the hybridization array element may be bonded to the gas through a linker (eg, ethylene glycol oligomer and diamine).

The label of the probe can provide a signal to detect hybridization, which can be linked to an oligonucleotide. Suitable labels include fluorophores (e.g., fluorescein, phycoerythrin, rhodamine, lissamine, and Cy3 and Cy5 (Pharmacia)), chromophores, chemiluminescent groups, magnetic particles, radioactive isotopes. Elements (P32 and S35), mass labels, electron condensing particles, enzymes (alkaline phosphatase or horseradish peroxidase), cofactors, substrates for enzymes, heavy metals (e.g. gold) and antibodies, streptavidin, biotin , Digoxigenin and a hapten having a specific binding partner such as a chelating group, but are not limited thereto. Labeling can be performed by various methods commonly practiced in the art, such as nick translation method, random priming method (Multiprime DNA labeling systems booklet, "Amersham" (1989)) and kineation method (Maxam & Gilbert, Methods in Enzymology , 65:499 (1986)). The label provides a signal that can be detected by fluorescence, radioactivity, colorimetric measurement, gravimetric measurement, X-ray diffraction or absorption, magnetic, enzymatic activity, mass analysis, binding affinity, high frequency hybridization, and nanocrystals.

According to another aspect of the present invention, the present invention includes a probe consisting of an oligonucleotide sequence comprising 10-100 of the nucleotide sequence of SEQ ID NO: 1 or 10-100 of the oligonucleotide sequence complementary thereto. It provides a microarray for detecting the MON810.

According to another aspect of the present invention, the present invention includes a probe consisting of an oligonucleotide sequence comprising 10-100 of the nucleotide sequence of SEQ ID NO: 2 or 10-100 of the oligonucleotide sequence complementary thereto. It provides a microarray for detecting the MON863.

According to another aspect of the present invention, the present invention comprises (a) an oligonucleotide sequence comprising 10-100 of the nucleotide sequence of SEQ ID NO: 1 or 10-100 of the oligonucleotide sequence complementary thereto. Probe; And (b) MON810 and MON863 detection multiplex comprising a probe consisting of an oligonucleotide sequence comprising 10-100 of the nucleotide sequence of SEQ ID NO: 2 or 10-100 of the oligonucleotide sequence complementary thereto. Microarray is provided.

In the microarray of the present invention, the probe is used as a hybridizable array element and is immobilized on a substrate.

Substrates usable in the present invention include various substrates known in the art. The shape, size and chemical composition of the substrate surface are not particularly limited. Solid substrates suitable for the present invention are, for example, silicone wafers, glass, quartz, fused silica, metals such as gold, plastics and polymers (e.g., cycloolefin copolymers, poly(methyl methacrylate), polystyrene, polyethylene and poly Propylene], but is not limited thereto.

The hybridization array element described above is arranged and immobilized on the substrate. Such immobilization is carried out by a chemical bonding method or a covalent bonding method such as UV. For example, the hybridization array element can be bonded to a glass surface modified to contain an epoxy compound or an aldehyde group, and can also be bonded to a polylysine coated surface by UV. In addition, the hybridization array element may be bonded to the gas through a linker (eg, ethylene glycol oligomer and diamine).

Meanwhile, the sample DNA applied to the microarray of the present invention may be labeled and hybridized with the array element on the microarray. Hybridization conditions can be varied. The detection and analysis of the degree of hybridization may be performed in various ways depending on the labeling material.

The label of the probe can provide a signal to detect hybridization, which can be linked to an oligonucleotide. Suitable labels include fluorophores (e.g., fluorescein, phycoerythrin, rhodamine, lissamine, and Cy3 and Cy5 (Pharmacia)), chromophores, chemiluminescent groups, magnetic particles, radioactive isotopes. Elements (P32 and S35), mass labels, electron condensing particles, enzymes (alkaline phosphatase or horseradish peroxidase), cofactors, substrates for enzymes, heavy metals (e.g. gold) and antibodies, streptavidin, biotin , Digoxigenin and a hapten having a specific binding partner such as a chelating group, but are not limited thereto. Labeling can be performed by various methods commonly practiced in the art, such as nick translation method, random priming method (Multiprime DNA labeling systems booklet, "Amersham" (1989)) and kineation method (Maxam & Gilbert, Methods in Enzymology , 65:499 (1986)). The label provides a signal that can be detected by fluorescence, radioactivity, colorimetric measurement, gravimetric measurement, X-ray diffraction or absorption, magnetic, enzymatic activity, mass analysis, binding affinity, high frequency hybridization, and nanocrystals.

When using a probe, the probe is hybridized with a DNA molecule amplified with the primers used in the present invention. In the present invention, suitable hybridization conditions can be determined in a series of processes by an optimization procedure. This procedure is performed as a series of procedures by a person skilled in the art to establish a protocol for use in the laboratory. For example, conditions such as temperature, concentration of components, hybridization and washing times, buffer components, and their pH and ionic strength depend on various factors such as the length of the probe and the amount of GC and the target nucleotide sequence. Detailed conditions for hybridization include Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); And MLM Anderson, Nucleic Acid Hybridization, Springer-Verlag New York Inc. It can be found in NY (1999). For example, among the stringent conditions, high stringency conditions were _{hybridized in 0.5 M NaHPO 4} , 7% sodium dodecyl sulfate (SDS), 1 mM EDTA at 65°C, and 0.1 x SSC (standard saline citrate)/0.1% SDS. It means washing under the condition of 68°C. Alternatively, high stringency conditions mean washing at 48°C in 6 x SSC/0.05% sodium pyrophosphate. Low stringency means, for example, washing at 42° C. in 0.2 x SSC/0.1% SDS.

After the hybridization reaction, a hybridization signal generated through the hybridization reaction is detected. The hybridization signal can be performed in various ways depending on the type of label bound to the probe, for example. For example, when a probe is labeled with an enzyme, it is possible to confirm whether or not hybridization has occurred by reacting a substrate of this enzyme with a result of a hybridization reaction. Combinations of enzymes/substrates that may be used include peroxidase (e.g. horseradish peroxidase) and chloronaphthol, aminoethylcarbazole, diaminobenzidine, D-luciferin, lucigenin (bis-N-methylacridinium Nitrate), resorupine benzyl ether, luminol, Amplex Red reagent (10-acetyl-3,7-dihydroxyphenoxazine), HYR (p-phenylenediamine-HCl and pyrocatechol), TMB (tetramethylbenzidine), ABTS (2 ,2'-Azine-di[3-ethyl benzthiazoline sulfonate]), o-phenylenediamine (OPD) and naphthol/pyronine; Alkaline phosphatase and bromochloroindolyl phosphate (BCIP), nitro blue tetrazolium (NBT), naphthol-AS-B1-phosphate and ECF substrate; Glucose oxidase, t-NBT (nitroblue tetrazolium) and m-PMS (phenzaine methosulfate). When the probe is labeled with gold particles, it can be detected by a silver staining method using silver nitrate.

A general description that can be applied to the biochip of the present invention is U.S. Patent Nos. 5,143,854, 5,242,974, 5,252,743, 5,324,633, 5,384,261, 5,405,783, 5,412,087, 5,424,186, 5,451,683, 5,482,867, 5,491,074, 5,550,527,5,78,839, 5,527,5,681, 839, 5,639,527,5,681, 839 , 5,631,734, 5,795,716, 5.83107 million, 5,837,832, 5,856,101, 5,858,659, 5,889,165, 5,936,324, 5,959,098, 5.96874 million, 5,974,164, 5,981,185, 5,981,956, 6,025,601, 6.03386 million, 6,040,193, 6,090,555, 6,136,269, 6,147,205, 6,262,216, 6,269,846, 6,310,189 and 6,428,752 hoge specifically described Has been.

For general information applicable to the biosensor of the present invention, Myska, J. Mol. Recognit, 12:279-284 (1999); J. Dubendorfer et al. Journal of Biomedical Optics, 2(4):391-400(1997); And O'Brien et al. Biosensors & Bioelectronics, 14:145-154 (1999).

According to a preferred embodiment of the present invention, the present invention is a liquid bead multiplex microarray.

According to a preferred embodiment of the present invention, the present invention comprises (a) an oligonucleotide sequence comprising 10-100 of the nucleotide sequence of SEQ ID NO: 3 or 10-100 of the oligonucleotide sequence complementary thereto. A probe, (b) a probe consisting of an oligonucleotide sequence comprising 10-100 of the nucleotide sequence of Sequence Listing 4 or 10-100 of the oligonucleotide sequence complementary thereto, and (c) Sequence Listing 5 It further includes a probe consisting of an oligonucleotide sequence comprising 10-100 of the nucleotide sequence of the sequence or 10-100 of the oligonucleotide sequence complementary thereto.

The features and advantages of the present invention are summarized as follows:

(I) The present invention includes (a) a kit for detecting genetically modified corn MON810, MON863, and a kit for detecting genetically modified corn MON863 and MON810; And (b) a kit for detecting genetically modified corn MON810 and MON863, and a microarray for detecting genetically modified corn MON863 and MON810.

(Ii) The present invention is a kit for detecting genetically modified corn MON810 and MON863, and a kit and microarray with greatly improved accuracy and reliability in detecting genetically modified corn MON863 and MON810.

(Iii) In addition, the present invention not only shortens the time and process of detecting and identifying the presence of genetically modified corn, but also provides economical effects in terms of cost by simultaneously detecting genetically modified corn MON863 and MON810 not only single but also complexly. It has the advantage of being able to reap.

1 is a schematic diagram of transgenes transformed into genetically modified maize MON863 and MON810 and shows the regions of oligonucleotides of the first and second sequences of the sequence list. Panel (a) is a schematic diagram of the transgene transformed into transgenic maize MON810, and panel (b) is a schematic diagram of the transformed transgene.
2 is a result of a multiplex polymerase chain reaction for gene detection for genetically modified corn. Each sample (distilled water, non-genetically modified corn genomic DNA, MON810 event DNA, MON863 genomic DNA, posterior hybridization event MON863 x MON810 genomic DNA) was used as a template, and 5 types of primer sets were added to multiplex (PCR) was carried out. No bands were detected in the experimental group containing water as a negative control. Only a band capable of detecting the zein gene, a maize endogenous gene, was identified in the untransformed corn experimental zone. In the MON810 event maize experiment, the zein gene, 35S and MON810, which are the maize endogenous genes, were identified. In the MON863 event maize experimental zone, the zein gene, 35S NOSt, and MON863 unique nucleotide sequences were detected. Posterior hybridization event In the maize MON863 x MON810 test group, the zein gene, 35S, NOSt, and MON810 and MON863 unique nucleotide sequences were detected, respectively. M is a marker; 1 is a negative control; 2, non-genetically modified corn; 3, genetically modified corn MON810; 4, genetically modified maize MON863; 5 is genetically modified maize MON863 x MON810.
3 is a result of performing a multiplex liquid bead array for gene detection for genetically modified corn MON863 x MON810. Each sample (distilled water, non-genetically modified maize genomic DNA, MON810 event DNA, MON863 genomic DNA, posterior hybridization event MON863 x MON810 genomic DNA) was used as a template, and 5 kinds of primer sets were added to After performing the flex PCR, secondary PCR was performed using the tagged probe and biotin-labeled dCTP. After hybridization with five kinds of anti-tagging microspheres (beads), fluorescence through the reaction with biotin-streptavidin was measured. By estimating a tag with a unique spectral address, the number of beads, that is, the type of probe, can be identified, and the MFI value was calculated and graphed to the extent that streptavidin was expressed. The cut-off value of MFI was between 100-150, and values less than 100 were judged not to react. No beads (probes) and fluorescence of any kind were detected in the experimental group containing water as a negative control. In the untransformed maize experimental zone, only probes capable of detecting the zein gene, an endogenous maize gene, were reacted. In the MON810 event maize experimental zone, the zein gene, 35S and MON810, a unique sequence of maize endogenous genes were detected. In the MON863 event maize experimental zone, the zein gene, 35S NOSt, and MON863 unique nucleotide sequences were detected. Posterior hybridization event In the maize MON863 x MON810 test group, the zein gene, 35S, NOSt, and MON810 and MON863 unique nucleotide sequences were detected, respectively.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for describing the present invention in more detail, and that the scope of the present invention is not limited by these examples according to the gist of the present invention for those of ordinary skill in the art to which the present invention pertains. It will be self-evident.

Example

Experimental materials and test methods

* 1. Probe sequence preparation

The probes for the 35S promoter, NOS terminator, MON810 and MON 863 event-specific nucleotide sequences, and five types of zein , an intrinsic gene of corn, were prepared. In order to prepare the nucleotide sequence of these probes, after obtaining the possible nucleotide sequence information from the gene database of NCBI (National Center for Biotechnology Information), designing the probe nucleotide sequence for each target gene by determining the part with high homology between them. (Table 1). Table 1 shows the nucleotide sequence of the probe for GM corn assay.

To perform a liquid bead array, a tag sequence, which is a unique 24 base sequence, was linked to the 5'end of the base sequence shown in Table 1 (http://www.luminexcorp.com). /support/protocols/xtag_protocols.htm). This nucleotide sequence is a tag sequence complementary to 24 unique anti-tag sequences attached to microbeads used to perform a liquid micro array, and this sequence is probed. It was connected to the 5'end and used in a liquid bead array. The nucleotide sequence corresponding to the tag shows specific complementarity to a total of 100 bead anti-tags (www.luminexcorp.com). Using this, the PCR product reacting with the probe and the bead hybridization reaction occurred. Can be judged (Wilson et al., 2005; Dunbar, 2006).

Probe Base sequence (5'->3') Tag sequence Tags and Anti -Tag set number MON810
(SEQ ID NO: 16) GAAAGTCCTCGTTCAGGTCG CTTTTACAATACTTCAATACAATC 20 MON863
(SEQ ID NO: 17) TCCGGTCTCCCTATAGAGCA CTACAAACAAACAAACATTATCAA 28 35S
(SEQ ID NO: 18) TTGCTTTGAAGACGTGGTG CTTTAATCTCAATCAATACAAATC One NOS
(SEQ ID NO: 19) CCTAGTTTGCGCGCTATA TCAACAATCTTTTACAATCAAATC 6 zein
(SEQ ID NO: 20) CCCTGATGCTGCAGCAACTG TCAAAATCTCAAATACTCAAATCA 18

2. GM Genome from corn DNA extraction

Non-genetically modified corn (ERMBF417A, Sigma-Alfrich, USA), MON810 event corn (ERMBF413F, Sigma-Alfrich, USA), MON863 event corn using a wizard genomic DNA purification kit (Promega, USA) Genomic DNA was extracted from (ERMBF416D, Sigma-Alfrich, USA) and posterior hybridization event MON863 x MON810 corn (ERMBF417D, Sigma-Alfrich, USA), respectively. The method of extracting genomic DNA from each corn using the kit is as follows.

First, 100 mg of corn kernel powder was put in a 1.5 ml tube and ground using liquid nitrogen. After adding 600 µl of a nucleic acid lysing solution to the ground corn containing tube, the mixture was reacted at 65° C. for 15 minutes. Then, 200 µl protein precipitation solution was added to the tube containing the reactant, voltexed for 20 seconds, and then centrifuged at 12000 rpm for 10 minutes. After centrifugation, 600 µl of the separated supernatant was transferred to a fresh 1.5 ml tube, mixed with the same amount of isopropanol, and centrifuged for 5 minutes at 12000 rpm. The supernatant was removed, leaving only the pellet remaining on the bottom of the tube, and 500 µl of 100% ethanol was added, followed by centrifugation at 12000 rpm for 5 minutes. Then, after removing the supernatant leaving only the pellet, it was air-dried at room temperature for 10 minutes. 100 µl of the DNA hydration solution was added to the dried tube, incubated at 65° C. for 30 minutes, and then the supernatant separated by spinning was stored for use as a sample for this study.

3. Liquid Bead Array system Of the probe Validity test

After simultaneously amplifying the assay target genes using multiplex PCR, a liquid bead array assay was performed using a probe having the nucleotide sequence shown in Table 1 and having 24 unique tag nucleotide sequences at the 5'end.

3.1. Multiplex Enzyme Chain Reaction ( Polymerase Chain Reaction : PCR )

Multiplex PCR was performed to simultaneously test the target gene for two types of GM corn and their progeny hybrid stack event. The primer of MON810 is designed to amplify including the terminal portion of the introduced Cry1Ab gene and the flanking gene of the corn genome, and the primer of MON863 is a part of T-tahsp17, the transcription termination signal of the introduced gene. It was constructed to enable event-specific detection including flanking genes in the and corn genome (Shrestha et al., 2005). As the target gene derived from the vector for transformation, the cauliflower mosaic virus 35S promoter and the agrobacterium tumefaciens 3'NOS terminator gene were used, and the zein gene was used as the crop endogenous gene (Table 2). ; Shrestha et al. (2008), Accession No. AB303064), the nucleotide sequence of the primer used is as follows. PCR composition was composed of 25 μl of 2 x Max Taq Hot start master mix (BioQuest, Korea), 10 pmoles of each 5 sets of primers, 20 ng of template and 3rd distilled water to final 50 μl.

primer Base sequence (5'->3') Product size ( bp ) MON810 F
(SEQ ID NO: 6) CACCACAGCCACCACTTCT 150 MON810 R
(SEQ ID NO: 7) AGGAAAAGCTATTGTAAAGCCAAA MON863 F
(SEQ ID NO: 8) GTAATCGGCTAATCGCCAAC 224 MON863 R
(SEQ ID NO: 9) GCCAGTTCATTGCGAGTACA 35S F
(SEQ ID NO: 10) GACAGTGGTCCCAAAGATGGAC 115 35S R
(SEQ ID NO: 11) CCTTACGTCAGTGGAGATATC NOS F
(SEQ ID NO: 12) CTGTTGCCGGTCTTGCGATG 185 NOS R
(SEQ ID NO: 13) GCGCGATAATTTATCCTAGTTTG zein F
(SEQ ID NO: 14) GCTTGCGGAGCTTGATGGCGT 72 zein R
(SEQ ID NO: 15) GGCATCGTCTGAAGCGGTAAGG

PCR was performed using a thermal cycler (MyCycler, BioRad, USA), and the multiplex PCR conditions were pre-treatment at 95°C for 15 minutes, followed by 35 cycles at 94°C for 30 seconds, 60°C for 1 minute, and 72°C for 1 minute. , Post-treatment was performed at 72°C for 10 minutes. Subsequently, the PCR product was reacted with the probe through secondary PCR and used for linear amplifiation with biotin-labeled dCTP.

3.2 liquid Bead Array manufacturing

3.2.1 Bead pharmacy

^{For reaction with 24 anti-tag coupled beads, 40 µl (4-5 x 10 5} beads/µl) after uniformly mixing the beads to be reacted (FlexMAP beads, Tm Bioscience, Toronto, Canada) ) Took each. 20 µl of 0.1 M MES (N-morpholino-ethanesulfonic acid; pH 4.5 Sigma-Aldrich, USA) was mixed with each bead, and 2 µl of the prepared anti-tag was dropped and mixed with the beads, and then 10 ml/ml EDC (Ethylcarbodiimide). hydrochloride; Sigma-Aldrich, USA) 1 µl of a solution was added and reacted. Since the bead is very sensitive to light, it was reacted for about 30 minutes in a dark place while stirring well, and 1 µl of the newly made 10 ml/ml EDC solution was added and reacted for about 20 minutes. Then, 500 µl of 0.02% Tween-20 solution was added to each tube and mixed well. The bead of each tube was centrifuged to remove the supernatant, and then mixed well with 500 µl of 0.1% SDS solution. The beads of each tube were centrifuged again to remove the supernatant, and then dissolved in 150 µl of TE (pH 8.0) buffer, mixed well, and stored in a dark room at 4°C or immediately used for experiments.

3.2.2 Secondary single strand PCR And biotin dCTP Using Single-stranded formation

In the second single-stranded PCR, a PCR product of GM corn made in the multiplex PCR step was used as a template, and biotin-dCTP was added as a synthetic substrate to perform linear amplification. 1 μl of the PCR product was used for labeling, 0.5 probe, 50 uM dATP, dGTP and dTTP mix (Invitrogen), 20 uM biotin-dCTP (Invitrogen), 7.5 mM Tris HCl (pH 9.0), 0.2 mM MgCl ₂ , 5 mM KCl, 2 mM (NH ₄ ) ₂ SO ₄ And Taq polymerase (Ultratools, Spain) 1 U single-stranded linear amplification was performed. The second single-stranded PCR reaction was denatured at 95°C for 5 minutes, followed by 35 cycles at 94°C for 30 seconds, 58°C for 30 seconds, and 72°C for 1 minute.

2.2.3 Hybridization reaction

The product after the secondary chain polymerization reaction was dissolved in 2X TM (0.4M NaCl, 0.2M Tris, 0.16% Triton X-100, pH 8.0) hybridization buffer, followed by hybridization reaction with beads at 95° C. for 5 minutes and 37 It was carried out at °C for 30 minutes. Thereafter, the reaction was transferred to a 96-well 2 micron filter plate (Millipore, Bedford, USA), washed with a vacuum manifold, and dissolved in 1X TM buffer. After two washing steps, the sample adsorbed on the filter was finally dissolved in 1X TM containing 2 μg/ml streptavidin-R-phycoerythrin (Sigma-Aldrich, USA). Then, it was reacted at room temperature for 15 minutes. Subsequently, beads were read for each well using a Luminex 200 cytometer processor (Luminex Corp., Austin, USA). The Luminex 200 uses two lasers, one with a bead number (type of gene) with a unique spectral address of the bead, and the other with the amount of phycoerythrin reacted (amount contained). It is calculated and expressed as a number. These values are represented by MFI (mean fluorescence intensity) values of beads representing each introduced gene, and through this, the type and degree of inclusion of the gene to be assayed in corn was to be determined.

Experiment result

One. GM Liquid corn Bead Gene detection using an array

It is possible to discriminate the gene to be tested by targeting GM maize (MON863 x MON810) and MON810 and MON863 events in which each gene was introduced as a single gene. I tried to check if it worked. In addition, it was attempted to confirm whether the result of a single event in the posterior hybrid MON863 x MON810 event was consistent with the result.

1.1. GM Multiplex in corn PCR practice

As a result of electrophoresis on agarose gel, the amplified product could not be found in the negative control (sample containing only distilled water), and only the SPS gene as an endogenous gene was amplified in non-GMO corn. MON810 possesses the 35S gene, but does not possess the NOS terminator, and the PCR results also showed the same result. MON863 was not amplified with 810 event-specific primers, but was amplified only with MON863-specific primers. It was confirmed that both Bt genes were amplified at the same time using MON863 and MON810 primers in the posterior hybrid event line in which the two Bt genes were integrated (FIG. 2). With this multiplex PCR product, a liquid microarray was performed using each probe.

1.2. Single and posterior hybrid event GM crop validation test using multiplex liquid bead array system

Table 3 and FIG. 3 show the luminex results of MON810 and MON863, respectively, and the luminex results of MON863 x MON810 posterior hybridization event corn as an average of the results of a total of three experiments. The cut-off value, which is the minimum significance of the numerical value, was designated as 150. As a result of reacting with the maize species specific gene zein beads, it was confirmed that all samples except the negative control were reacted, and the reaction with 35S detection beads was detected in all GM maize except the negative control and non-GM. Was confirmed. Reactions with NOS terminator beads were detected in GM maize, except for MON810, in MON863 and MON863 x MON810 posterior hybrid events. The results of the multiplex liquid bead array of Table 3 are shown in a table for MFI values, and a graph using this value is shown in FIG. 3.

Sample name Zein 35S NOS MON810 MON863 Voice control 65 31 61 84 75 ratio GM corn 4340 36 89 44 45 MON810 3789 5804 37 4392 33 MON863 4124 5571 5022 23 4725 MON863 x MON810 3990 6571 4975 4772 4325

Review

A liquid bead array assay probe was developed for the GM maize MON810, MON863, and the posterior hybrid event GM event MON863 x MON810 to test the introduced foreign genes. There were a total of 5 assay probes, for the 35S promoter and the NOS terminator, which are vector construct-specific probes, and for zein , which is an endogenous gene specific to corn species, and event-specific probes for each of MON810 and MON863 were prepared. Using the prepared probes, the multiplex PCR product was subjected to hybridization reaction with the microsphere beads prepared by reacting the second PCR product with the probe as a material, and then the fluorescence was checked in a Luminex processor to quantify the MFI value.

In conclusion, the probes produced by the researchers reacted specifically to the gene of interest, and other probes did not show cross-reaction. In addition, the resultant reactions were consistent with the single assay results and the simultaneous multiple assay results, and if used for Taq-Man probe synthesis, it could be used for quantitative detection of MON863 and MON810 corn by real-time PCR.

references

1.Dunbar SA (2006) Application of LuminexxMAP ^TM technology for rapid, high-throughput multiplexed nucleic acid detection. Clin Chim Acta 363, 71-82.

2.Shrestha HK, Hwu KK, Wang SJ, Liu LF, and Chang MC (2008) Simultaneous detection of eight genetically modified maize lines using a combination of event- and construct-specific multiplex-PCR technique. J Agric Food Chem 56, 8962-8968.

3.Wilson WJ, Erler AM, Nasarabadi SL, Skowronski EW, and Imbro PM (2005) A multiplex PCR-coupled liquid bead array for the simultaneous detection of four biothreat agents Mol Cell Probes 19, 137-144.

As described above, specific parts of the present invention have been described in detail, and it is obvious that these specific techniques are only preferred embodiments, and the scope of the present invention is not limited thereto for those of ordinary skill in the art. Accordingly, it will be said that the substantial scope of the present invention is defined by the appended claims and their equivalents.

Attach electronic file of sequence list

Claims (10)

Genetically modified corn comprising a primer set consisting of a forward primer and a reverse primer consisting of an oligonucleotide sequence comprising 10-100 sequences of the nucleotide sequence of SEQ ID NO: 2 or an oligonucleotide sequence complementary thereto MON863 detection kit.
The method of claim 1, wherein the kit further comprises a probe consisting of an oligonucleotide sequence comprising 10-100 sequences of the nucleotide sequence of SEQ ID NO: 2 or 10-100 of the oligonucleotide sequence complementary thereto Genetically modified corn MON863 detection kit.
MON863 comprising a first primer set consisting of a forward primer and a reverse primer consisting of an oligonucleotide sequence comprising 10-100 sequences of the nucleotide sequence of SEQ ID NO: 2 or an oligonucleotide sequence complementary thereto Detection multiplex kit.
4. The kit of claim 3, wherein the kit further comprises a first probe comprising an oligonucleotide sequence comprising 10-100 sequences of the nucleotide sequences of SEQ ID NO: 2 or an oligonucleotide sequence complementary thereto. Kit characterized in that.
The kit according to any one of claims 1 to 4, wherein the kit comprises (a) 10-100 sequences of the nucleotide sequences of SEQ ID NO: 3 or 10-100 sequences of the oligonucleotide sequences complementary thereto. A second primer set consisting of a forward primer and a reverse primer consisting of an oligonucleotide sequence; (b) a third primer set consisting of a forward primer and a reverse primer consisting of an oligonucleotide sequence comprising 10-100 sequences of the nucleotide sequence of SEQ ID NO: 4 or an oligonucleotide sequence complementary thereto; And (c) a fourth primer set consisting of a forward primer and a reverse primer consisting of an oligonucleotide sequence comprising 10-100 sequences of the nucleotide sequences of SEQ ID NO: 5 or 10-100 sequences of oligonucleotide sequences complementary thereto Kit characterized in that it further comprises.
The second probe of claim 5, wherein the kit comprises (a) an oligonucleotide sequence comprising 10-100 sequences of the nucleotide sequences of SEQ ID NO: 3 or an oligonucleotide sequence complementary thereto. ; (b) a third probe consisting of an oligonucleotide sequence comprising 10-100 sequences of the nucleotide sequences of SEQ ID NO: 4 or an oligonucleotide sequence complementary thereto; And (c) a fourth probe consisting of an oligonucleotide sequence comprising 10-100 sequences of the nucleotide sequences of SEQ ID NO: 5 or 10-100 sequences of oligonucleotide sequences complementary thereto. Kit.
A MON863 detection microarray comprising a probe comprising an oligonucleotide sequence comprising 10-100 sequences of the nucleotide sequence of SEQ ID NO: 2 or an oligonucleotide sequence complementary thereto.
A multiplex microarray for detecting MON863 comprising a first probe consisting of an oligonucleotide sequence comprising 10-100 sequences of the nucleotide sequence of SEQ ID NO: 2 or an oligonucleotide sequence complementary thereto.
The microarray of claim 7 or 8, wherein the microarray is a liquid bead multiplex microarray.
9. The oligonucleotide sequence of claim 7 or 8, wherein the microarray comprises (a) 10-100 sequences of nucleotide sequences of SEQ ID NO: 3 or 10-100 sequences of complementary oligonucleotide sequences. A second probe consisting of (b) a third probe consisting of an oligonucleotide sequence comprising 10-100 sequences of the nucleotide sequences of SEQ ID NO: 4 or an oligonucleotide sequence complementary thereto, and ( c) an additional probe comprising a fourth probe consisting of an oligonucleotide sequence comprising 10-100 sequences of the nucleotide sequence of SEQ ID NO: 5 or an oligonucleotide sequence complementary thereto; Microarray.

Images