KR20120056249A - Kits for Detecting Genetically Modified Corn MON863 and MON810 - Google Patents

Kits for Detecting Genetically Modified Corn MON863 and MON810 Download PDF

Info

Publication number
KR20120056249A
KR20120056249A KR1020120052021A KR20120052021A KR20120056249A KR 20120056249 A KR20120056249 A KR 20120056249A KR 1020120052021 A KR1020120052021 A KR 1020120052021A KR 20120052021 A KR20120052021 A KR 20120052021A KR 20120056249 A KR20120056249 A KR 20120056249A
Authority
KR
South Korea
Prior art keywords
sequences
mon863
oligonucleotide sequence
mon810
seq
Prior art date
Application number
KR1020120052021A
Other languages
Korean (ko)
Other versions
KR101208732B1 (en
Inventor
최선희
오용택
한병돈
류기현
Original Assignee
서울여자대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 서울여자대학교 산학협력단 filed Critical 서울여자대학교 산학협력단
Priority to KR1020120052021A priority Critical patent/KR101208732B1/en
Publication of KR20120056249A publication Critical patent/KR20120056249A/en
Application granted granted Critical
Publication of KR101208732B1 publication Critical patent/KR101208732B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6834Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C12Q1/6837Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/13Plant traits

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

PURPOSE: A kit for detecting genetically modified corn, MON810 and MON863, is provided to simultaneously detect MON863 and MON810 and to reduce time and process. CONSTITUTION: A kit for detecting genetically modified corn MON863 contains a primer set having a forward primer having an oligonucleotide having 10-100 sequences in a nucleotide of sequence number 2 or 10-100 sequences among complementary oligonucleotide sequences thereof. A multiplex kit for detecting MON863 contain a first primer set having a forward primer and a reverse primer having an oligonucleotide sequence with 10-100 sequences.

Description

유전자 변형 옥수수 MON863 및 MON810 검출용 키트{Kits for Detecting Genetically Modified Corn MON863 and MON810}Kits for Detecting Genetically Modified Corn MON863 and MON810}

본 발명은 유전자 변형 옥수수 MON863 및 MON810 검출용 키트에 관한 것이다.
The present invention relates to a kit for detecting genetically modified corn MON863 and MON810.

GMO(Genetically Modified Organisms)란 유전자 변형 식품을 뜻한다. 유전 공학 또는 유전자 조작(genetic engineering)이란 한 종으로부터 유전자를 얻은 후에 이를 다른 종에 삽입하는 기술을 뜻하는 것으로 이러한 방식으로 만들어진 생명체를 GMO라고 한다. 1994년 칼진사의 무르지 않는 토마토가 최초로 미국 식품 의약청(FDA)의 승인을 얻어 시판된 이후, 1966년 몬산토사의 유전자 조작 콩이 상업적으로 대규모 재배되기 시작하였다. GMO (Genetically Modified Organisms) refers to genetically modified foods. Genetic engineering or genetic engineering refers to the technology of obtaining a gene from one species and inserting it into another species, and living organisms created in this way are called GMOs. In 1994, Caljin's unripened tomatoes were first marketed with approval from the US Food and Drug Administration (FDA), and in 1966 Monsanto's genetically engineered soybeans began to be commercially grown on a large scale.

GMO는 질병에 강하고 소출량이 많아 식량난을 해소할 수 있다는 장점이 있으나 GMO 식품을 장기간 섭취할 경우에도 인간에 무해하다는 점이 분명하게 검증된 바가 없으며, GMO 품종으로 인해 생태계가 교란되는 등 환경재앙이 발생할 수도 있다는 위험성을 안고 있다. GMO 식품을 보는 시각은 미국과 서유럽 간에 크게 다르다. 유전자 기술이 앞선 미국의 경우 슈퍼마켓에서 팔리는 식품의 절반 이상이 GMO를 함유하고 있으며, 미국 국민들의 절대 다수는 GMO 식품이 안전하다고 신뢰한다. 그러나 서유럽 국가의 환경단체들은 GMO 곡물을 ‘프랑켄슈타인 식품’이라고 부르며 일반 대중도 이를 기피하고 있는 실정이다.GMO is resistant to diseases and has the advantage of solving food shortages due to its high yield, but it has not been clearly verified that it is harmless to humans even when ingesting GMO foods for a long period of time, and environmental disasters such as disturbance of the ecosystem due to GMO varieties occur. There is a risk that it may be. Viewing GMO foods differs greatly between the United States and Western Europe. In the United States, where genetic technology is advanced, more than half of the food sold in supermarkets contains GMOs, and the vast majority of Americans trust that GMO foods are safe. However, environmental groups in Western European countries call GMO grains “Frankenstein food” and the general public is avoiding it.

현재 전 세계적으로 유통되고 있는 GM0는 콩, 옥수수, 감자 등 약 50여 개 품목이며, 국내 유통 중인 GM0도 39개 품목이다. 특히 국내에서 시판되고 있는 두부의 82%가 유전자변형 콩이 섞인 원료로 만들어졌다는 발표로 국내에서도 유전자식품의 유해성 여부가 문제가 되었다. 예컨대, 브라질너트(Brazil nut)의 일부 유전자를 콩에 넣어 만든 GMO콩이 알레르기를 일으킨다는 사실이 밝혀져 개발이 중단된 사례가 있었다. Currently, there are about 50 GM0 items distributed worldwide, including soybeans, corn, and potatoes, and 39 GM0 items are distributed in Korea. In particular, with the announcement that 82% of the tofu marketed in Korea is made of raw materials mixed with genetically modified soybeans, the issue of the harmfulness of genetic foods has been a problem in Korea. For example, there was a case where it was discovered that GMO soybeans made by putting some genes of Brazil nut in soybeans cause allergies, and the development was stopped.

현재 유전자 변형 생물체에 도입된 외부 유전자로는 EPSPS(enolpyruvylshikimate-3-phophate synthase), PAT(Phosphinothricin acetyl transferase) 및 BT(Bacillus thuringiensis)의 cry(crystal 단백질) 계열의 유전자 등이 가장 대표적이다. EPSPS 유전자는 글리포세이트(glyphosate)라는 제초제에, PAT 유전자는 글루포시네이트(gluphosinate)라는 제초제에 내성을 갖도록 하는 유전자이며, cry 계열 유전자는 해충 저항성을 갖도록 하는 유전자이다(Harrison et al., The Journal of Nutrition 126:728-740(1996); Crickmore et al., Microbiology and molecular biology reviews . Sept p.807-813(1998)). 상기 유전자를 포함하는 유전자 변형 생물체에는 글리포세이트/해충 내성 옥수수(Agrobacterium sp. 종 CP4 EPSPS 유전자 + Ochrobactrum anthropi의 glyphosphate oxidoreductase 유전자 포함, 몬산토사), 글리포세이트 내성 면실(Agrobacterium spp. CP4 EPSPS 유전자 포함), 글리포세이트 내성 캐놀라(Agrobacterium spp. CP4 EPSPS 유전자 포함), 글루포시테이트 내성 옥수수(Streptomyces hygroscopicus의 phophinothricin acetyl hydrolase 유전자 포함, Dekalb Genetics Corp.), 글루포시네이트 내성 캐놀라(Streptomyces virodochromogenes의 PAT 유전자 포함, Agevo Inc.), 글로포시네이트 내성 옥수수(Streptomyces virdochromogenes의 PAT 유전자 포함), 해충 내성 옥수수(cryIA(b) 유전자 포함, 몬산토사), 해충 내성 감자(cryIII A 유전자 포함, 몬산토사), 해충 내성 옥수수(cryIA(b) 유전자 포함, Northrup King), 해충 내성 옥수수(cryIA(b) 유전자 포함, Ciba-Geigy Corp.) 등이 있다.Currently, the most representative foreign genes introduced into genetically modified organisms are EPSPS (enolpyruvylshikimate-3-phophate synthase), PAT (Phosphinothricin acetyl transferase), and BT (Bacillus thuringiensis) cry (crystal protein) family genes. The EPSPS gene is a gene that makes it resistant to a herbicide called glyphosate, the PAT gene is a gene that makes it resistant to a herbicide called gluphosinate, and the cry family gene is a gene that makes it resistant to pests (Harrison et al., The Journal of Nutrition 126:728-740 (1996); Crickmore et al., Microbiology and molecular biology reviews . Sept p.807-813 (1998)). Genetically modified organisms containing the gene include glyphosate/pest-resistant corn (Agrobacterium sp. species CP4 EPSPS gene + Ochrobactrum anthropi glyphosphate oxidoreductase gene, Monsanto), glyphosate-resistant cotton thread (Agrobacterium spp. CP4 EPSPS gene included) ), glyphosate-resistant canola (including Agrobacterium spp.CP4 EPSPS gene), glufosite-resistant corn (including the phophinothricin acetyl hydrolase gene from Streptomyces hygroscopicus, Dekalb Genetics Corp.), glufosinate-resistant canola (including the PAT gene from Streptomyces virodochromogenes) , Agevo Inc.), glofosinate-resistant corn (including the PAT gene of Streptomyces virdochromogenes), pest-resistant corn (including the cryIA(b) gene, Monsanto), pest-resistant potatoes (including the cryIII A gene, Monsanto), pest resistance Corn (including cryIA(b) gene, Northrup King), pest-resistant corn (including cryIA(b) gene, Ciba-Geigy Corp.), and the like.

현재 많이 사용하고 있는 GMO 검사는 효소면역학적 방법(ELISA)과 PCR법으로 크게 나눌 수 있다(Rolf et al., Food Control 10; 391-399(1999)). 또는 유전자 변형 농작물의 경우에는 제초제 처리 등에 의한 생물학적 검정방법도 적용할 수 있다. 효소면역학적 방법은 유전자 변형 작물에 도입된 유전자에 의해 생산되는 단백질을 특이적으로 인지하는 항체를 이용하여 진단하는 방법이나, 도입된 유전자가 발현되지 않는 기관의 경우에는 진단이 불가능하며, 검출감도가 PCR 검정법에 비해 떨어지고, 열처리 등으로 단백질의 변성이 생길 수 있는 식품류에서의 검출에는 한계를 가지고 있다.GMO tests, which are currently widely used, can be broadly divided into enzyme immunological methods (ELISA) and PCR methods (Rolf et al., Food Control 10; 391-399 (1999)). Alternatively, in the case of genetically modified crops, a biological assay method by treatment with herbicides can also be applied. The enzyme immunological method is a method of diagnosing using an antibody that specifically recognizes a protein produced by a gene introduced into a genetically modified crop. However, in the case of an organ that does not express the introduced gene, diagnosis is not possible and sensitivity of detection Is inferior to the PCR assay, and has limitations in detection in foods where protein denaturation may occur due to heat treatment or the like.

PCR 검정법은 GMO에 도입된 유전자 조절부위 또는 도입 유전자의 단편을 특이적으로 증폭하는 기술로 원료 농산물은 물론 가공품에서도 검정이 가능하며 0.01%까지 검정이 가능하다. 1차적으로 PCR(중합연쇄축합반응)을 이용한 유전자의 단일 검사로서 GMO에 도입된 외부 유전자의 발현을 조절하는 프로모터나 전사종결부에 대한 특이 프라이머로 PCR하여 검정하고 있으며, 1차에서 검출이 된 경우, 2차에서 좀 더 정확한 GMO 포함여부를 확인하기 위해 실시간 PCR(Real time PCR)을 이용한 방법을 사용한다(Wurz et al., Food Control 10; 385-389(1999); Farid et al., Detection of genetically modified organisms in foods. Trends in Biotechnology Vol.20 No5; 215-223(2002)). 그러나, 이 방법은 각각의 GMO 유전자를 확인하기 위해 각각의 탐침을 이용하여 각각의 튜브에서 반응을 시키고 겔 상에서 확인해야 하므로, 많은 양의 검체 유전자와 인력 등이 필요하며, PCR 반응 완료 후 겔 상에서 증폭된 유전자 산물을 구별하기 위해서는 유전자 산물의 크기가 각각 구별되어야 하는 제약이 있다.The PCR assay is a technology that specifically amplifies the gene regulatory region or fragment of the introduced gene introduced into GMO. It can be assayed not only in raw agricultural products but also in processed products, and up to 0.01% can be assayed. Primarily, a single test for a gene using PCR (polymerization chain condensation reaction) is tested by PCR with a promoter or a specific primer for the transcriptional termination part that controls the expression of foreign genes introduced into the GMO. In this case, a method using real time PCR (Real time PCR) is used to check whether or not more accurate GMO is included in the second phase (Wurz et al., Food Control 10; 385-389 (1999); Farid et al., Detection of genetically modified organisms in foods. Trends in Biotechnology Vol. 20 No5; 215-223 (2002)). However, this method requires a large amount of sample genes and manpower, etc., as each tube must be reacted using each probe to identify each GMO gene and confirmed on a gel. In order to distinguish the amplified gene product, there is a limitation that the size of the gene product must be distinguished.

그러나, GMO 중 유전자 변형 옥수수인 MON863 및 MON810을 각각 또는 동시에 특이적이고 정확하게 검출할 수 있는 있는 방법은 아직까지 보고된 바가 없으며, 이에 따라 유전자 변형 옥수수인 MON863 및 MON810을 검출할 수 있는 신규한 검출 방법의 필요성이 대두되고 있다.
However, a method capable of specifically and accurately detecting MON863 and MON810, which are genetically modified corns among GMOs, has not yet been reported, and accordingly, a novel detection method capable of detecting MON863 and MON810, which are genetically modified corns. The necessity of this is emerging.

본 발명자들은 유전자 변형 옥수수 MON863 및 MON810을 각각 또는 동시에 특이적으로 검출할 수 있는 키트를 개발하고자 예의 노력하였다. 그 결과, MON810에 도입된 Cry1Ab 유전자의 말단 부분과 옥수수 유전체의 플랭킹 유전자를 포함하는 올리고뉴클레오타이드와 MON863에 도입된 whsp 17 유전자의 일부분과 옥수수 유전체의 플랭킹 유전자를 포함하는 올리고뉴클레오타이드에 각각의 특이적인 프라이머를 사용하여 중합효소연쇄반응으로 각각 증폭시킨 후 증폭된 중합효소연쇄반응 산물에 각각의 특이적인 프로브를 혼성화를 통하여 유전자 변형 옥수수 MON863 및 MON810을 각각 또는 동시에 특이적으로 검출할 수 있음을 규명함으로써, 본 발명을 완성하게 되었다.The present inventors have made diligent efforts to develop a kit capable of specifically detecting genetically modified corn MON863 and MON810 individually or simultaneously. As a result, each of the oligonucleotides including the terminal portion of the Cry1Ab gene introduced into MON810 and the flanking gene of the corn genome, and a portion of the whsp 17 gene introduced into MON863 and the oligonucleotide including the flanking gene of the corn genome were specific. After each amplification by polymerase chain reaction using a suitable primer, it was found that genetically modified corn MON863 and MON810 can be specifically detected individually or at the same time by hybridizing each specific probe to the amplified polymerase chain reaction product. By doing so, the present invention has been completed.

따라서, 본 발명의 목적은 유전자 변형 옥수수 MON810 검출용 키트를 제공하는데 있다.Accordingly, an object of the present invention is to provide a kit for detecting genetically modified corn MON810.

본 발명의 다른 목적은 유전자 변형 옥수수 MON863 검출용 키트를 제공하는데 있다.Another object of the present invention is to provide a kit for detecting genetically modified corn MON863.

본 발명의 또 다른 목적은 유전자 변형 옥수수 MON863 및 MON810 검출용 키트를 제공하는데 있다.Another object of the present invention is to provide a kit for detecting genetically modified corn MON863 and MON810.

본 발명의 또 다른 목적은 유전자 변형 옥수수 MON810 검출용 마이크로어레이를 제공하는데 있다.Another object of the present invention is to provide a microarray for detection of genetically modified corn MON810.

본 발명의 다른 목적은 유전자 변형 옥수수 MON863 검출용 마이크로어레이를 제공하는데 있다.Another object of the present invention is to provide a microarray for detection of genetically modified corn MON863.

본 발명의 또 다른 목적은 유전자 변형 옥수수 MON863 및 MON810 검출용 마이크로어레이를 제공하는데 있다.
Another object of the present invention is to provide a microarray for detecting genetically modified corn MON863 and MON810.

본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 설명, 청구범위 및 도면에 의해 보다 명확하게 된다.
Other objects and advantages of the present invention will become more apparent by the following detailed description, claims and drawings.

본 발명의 일 양태에 따르면, 본 발명은 서열목록 제1서열의 뉴클레오타이드 서열 중 10-100개 서열 또는 이에 상보적인 올리고뉴클레오타이드 서열 중 10-100개 서열을 포함하는 올리고뉴클레오타이드 서열로 이루어진 정방향 프라이머 및 역방향 프라이머로 구성된 프라이머 세트를 포함하는 유전자 변형(genetically modified) 옥수수 MON810 검출용 키트를 제공한다.
According to one aspect of the present invention, the present invention is a forward primer and reverse primer consisting of an oligonucleotide sequence comprising 10-100 of the nucleotide sequence of Sequence Listing 1 or 10-100 of the oligonucleotide sequence complementary thereto. A kit for detecting genetically modified maize MON810 comprising a primer set consisting of primers is provided.

본 발명의 다른 양태에 따르면, 본 발명은 서열목록 제2서열의 뉴클레오타이드 서열 중 10-100개 서열 또는 이에 상보적인 올리고뉴클레오타이드 서열 중 10-100개 서열을 포함하는 올리고뉴클레오타이드 서열로 이루어진 정방향 프라이머 및 역방향 프라이머로 구성된 프라이머 세트를 포함하는 유전자 변형 옥수수 MON863 검출용 키트를 제공한다.
According to another aspect of the present invention, the present invention is a forward primer and reverse primer consisting of an oligonucleotide sequence comprising 10-100 of the nucleotide sequence of SEQ ID NO: 2 or 10-100 of the oligonucleotide sequence complementary thereto. It provides a kit for detecting genetically modified corn MON863 comprising a primer set consisting of primers.

본 발명의 또 다른 양태에 따르면, 본 발명은 (a) 서열목록 제1서열의 뉴클레오타이드 서열 중 10-100개 서열 또는 이에 상보적인 올리고뉴클레오타이드 서열 중 10-100개 서열을 포함하는 올리고뉴클레오타이드 서열로 이루어진 정방향 프라이머 및 역방향 프라이머로 구성된 제1프라이머 세트; 및 (b)서열목록 제2서열의 뉴클레오타이드 서열 중 10-100개 서열 또는 이에 상보적인 올리고뉴클레오타이드 서열 중 10-100개 서열을 포함하는 올리고뉴클레오타이드 서열로 이루어진 정방향 프라이머 및 역방향 프라이머로 구성된 제2프라이머 세트를 포함하는 MON863 및 MON810 검출용 멀티플렉스 키트를 제공한다.
According to another aspect of the present invention, the present invention comprises (a) an oligonucleotide sequence comprising 10-100 of the nucleotide sequence of SEQ ID NO: 1 or 10-100 of the oligonucleotide sequence complementary thereto. A first primer set consisting of a forward primer and a reverse primer; And (b) a second primer set consisting of a forward primer and a reverse primer consisting of an oligonucleotide sequence comprising 10-100 of the nucleotide sequence of SEQ ID NO: 2 or 10-100 of the oligonucleotide sequence complementary thereto. It provides a multiplex kit for detecting MON863 and MON810, including.

본 발명자들은 유전자 변형 옥수수 MON863 및 MON810을 각각 또는 동시에 특이적으로 검출할 수 있는 키트를 개발하고자 예의 노력하였으며, 그 결과, MON810에 도입된 Cry1Ab 유전자의 말단 부분과 옥수수 유전체의 플랭킹 유전자를 포함하는 올리고뉴클레오타이드와 MON863에 도입된 tahsp 17 유전자의 일부분과 옥수수 유전체의 플랭킹 유전자를 포함하는 올리고뉴클레오타이드에 각각의 특이적인 프라이머를 사용하여 중합효소연쇄반응으로 각각 증폭시킨 후 증폭된 중합효소연쇄반응 산물에 각각의 특이적인 프로브를 혼성화를 통하여 유전자 변형 옥수수 MON863 및 MON810을 각각 또는 동시에 특이적으로 검출할 수 있음을 규명하였다.The present inventors have made diligent efforts to develop a kit that can specifically detect genetically modified corn MON863 and MON810 individually or at the same time, and as a result, including the terminal portion of the Cry1Ab gene introduced into MON810 and the flanking gene of the corn genome. The oligonucleotide and a portion of the tahsp 17 gene introduced in MON863 and the oligonucleotide containing the flanking gene of the corn genome were amplified by polymerase chain reaction using specific primers, respectively, and then the amplified polymerase chain reaction product was used. By hybridizing each specific probe, it was found that genetically modified maize MON863 and MON810 can be specifically detected individually or simultaneously.

본 발명의 명세서에서의 표현 “옥수수 MON810”은 바실러스 투린기엔시스(Bacillus thuringiensis: Bt)으로부터 유래된 해충에 독성을 나타내는 Bt 단백질인 Cry1Ab 단백질을 생산하는 Cry1Ab 유전자가 도입된 유전자 변형 옥수수를 의미하며, 몬산토사에 의하여 개발되어 YieldGard라는 상표명으로 거래되고 있는 유전자 변형 옥수수이다.The expression “corn MON810” in the specification of the present invention refers to genetically modified corn into which the Cry1Ab gene producing Cry1Ab protein, which is a Bt protein that is toxic to pests derived from Bacillus thuringiensis (Bt), has been introduced, It is a genetically modified corn developed by Monsanto and traded under the trade name YieldGard.

또한, 본 발명의 명세서에서의 표현 “옥수수 MON863”은 해충 저항성을 갖는 옥수수로서, 토양 미생물인 바실러스 투린기엔시스 subsp. 쿠마모토엔시스로부터 딱정벌레목에 특이적인 살충 단백질 델타 내독소 Cry3Bb1 단백질을 생산하는 Cry3Bb1 유전자를 도입하여 옥수수에 막대한 피해를 입히는 옥수수 뿌리 벌레를 치사케 할 수 있는 유전자 변형 옥수수를 의미한다.In addition, the expression “corn MON863” in the specification of the present invention is corn having pest resistance, and Bacillus is a soil microorganism. Turingiensis subsp. It refers to genetically modified corn that can kill corn rootworms that cause enormous damage to corn by introducing the Cry3Bb1 gene, which produces the delta endotoxin Cry3Bb1 protein, which is an insecticidal protein specific to the coleoptera from Kumamotoensis.

본 발명의 명세서에 표현 “후배교배종 이벤트 옥수수”는 유전자 변형된 옥수수들끼리 재교배한 옥수수를 의미한다. In the specification of the present invention, the expression "post-cross breeding event corn" refers to corn that has been re-crossed between genetically modified corns.

용어 “상보적 또는 상보적인”은 100% 상보적인 경우뿐만 아니라, RNA 방해 (interference) 기전을 통해 타겟 유전자의 발현을 억제할 수 있을 정도의 불완전한 상보성도 포괄하는 의미이며, 바람직하게는 90%의 상보성, 보다 바람직하게는 98%의 상보성, 가장 바람직하게는 100%의 상보성을 의미한다. 본 명세서에서 100% 상보성을 표현하는 경우에는 “완전 상보적 (completely complementary)"으로 특별하게 기재된다.The term “complementary or complementary” is meant to encompass not only 100% complementary, but also incomplete complementarity sufficient to inhibit the expression of the target gene through an RNA interference mechanism, and preferably 90%. It means complementarity, more preferably 98% complementarity, and most preferably 100% complementarity. In the present specification, when expressing 100% complementarity, it is specifically described as “completely complementary”.

본 발명의 키트에는 다른 성분들을 추가적으로 포함할 수 있다. 예를 들어, PCR 증폭에 필요한 시약, 예컨대, 완충액, DNA 중합효소 (예컨대, Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis 또는 Pyrococcus furiosus (Pfu)로부터 수득한 열 안정성 DNA 중합효소), DNA 중합 효소 조인자 및 dNTPs를 포함할 수 있다.Other components may be additionally included in the kit of the present invention. For example, reagents necessary for PCR amplification, such as buffers, DNA polymerases (e.g., Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis, or heat obtained from Pyrococcus furiosus (Pfu) Stable DNA polymerase), DNA polymerase cofactors, and dNTPs.

본 명세서에서 용어“상보적(complementary)”은 어떤 특정한 혼성화(hybridization) 또는 어닐링 조건 하에서 상술한 뉴클레오티드 서열에 완전 상보적(perfectly complementary)으로 혼성화할 수 있을 정도의 상보성을 갖는 것을 의미한다.In the present specification, the term "complementary" means having a degree of complementarity to hybridize perfectly complementary to the nucleotide sequence described above under certain hybridization or annealing conditions.

본 명세서에서 사용되는 용어 “프라이머”는 적합한 온도에서 적합한 완충액 내에서 적합한 조건 (즉, 4종의 다른 뉴클레오사이드 트리포스페이트 및 중합반응 효소) 하에서 주형-지시 DNA 합성의 개시점으로 작용할 수 있는 단일-가닥 올리고뉴클레오타이드를 의미한다.The term “primer” as used herein refers to a single template that can serve as an initiation point for template-directed DNA synthesis under suitable conditions (ie, four different nucleoside triphosphates and polymerases) in a suitable buffer at a suitable temperature. -It means a stranded oligonucleotide.

본 명세서에 기재된 용어“증폭”은 올리고뉴클레오타이드 분자를 증폭하는 반응을 의미한다. 다양한 증폭 반응들이 당업계에 보고되어 있으며, 이는 중합효소 연쇄반응(PCR)(미국 특허 제4,683,195, 4,683,202, 및 4,800,159호), 역전사-중합효소 연쇄반응(RT-PCR)(Sambrook 등, Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press(2001)), Miller, H. I.(WO 89/06700) 및 Davey, C. 등(EP 329,822)의 방법, 리가아제 연쇄 반응(ligase chain reaction; LCR)(17, 18), Gap-LCR(WO 90/01069), 복구 연쇄 반응(repair chain reaction; EP 439,182), 전사-매개 증폭(transcription-mediated amplification; TMA, WO 88/10315), 자가 유지 염기서열 복제(self sustained sequence replication, WO 90/06995), 타깃 폴리뉴클레오티드 염기서열의 선택적 증폭(selective amplification of target polynucleotide sequences, 미국 특허 제6,410,276호), 컨센서스 서열 프라이밍 중합효소 연쇄 반응(consensus sequence primed polymerase chain reaction(CP-PCR), 미국 특허 제4,437,975호), 임의적 프라이밍 중합효소 연쇄 반응(arbitrarily primed polymerase chain reaction(AP-PCR), 미국 특허 제5,413,909호 및 제5,861,245호), 올리고뉴클레오타이드 염기서열 기반 증폭(nucleic acid sequence based amplification(NASBA), 미국 특허 제5,130,238호, 제5,409,818호, 제5,554,517호, 및 제6,063,603호), 가닥 치환 증폭(strand displacement amplification)(21, 22) 및 고리-중재 항온성 증폭(loop-mediated isothermal amplification; LAMP)(23)를 포함하나, 이에 한정되지는 않는다. 사용 가능한 다른 증폭 방법들은 미국특허 제5,242,794, 5,494,810, 4,988,617호 및 미국 특허 제09/854,317호에 기술되어 있다.The term “amplification” as used herein refers to a reaction that amplifies an oligonucleotide molecule. Various amplification reactions have been reported in the art, including polymerase chain reaction (PCR) (U.S. Patent Nos. 4,683,195, 4,683,202, and 4,800,159), reverse transcription-polymerase chain reaction (RT-PCR) (Sambrook et al., Molecular Cloning. A Laboratory Manual, 3rd ed.Cold Spring Harbor Press (2001)), Miller, HI (WO 89/06700) and Davey, C. et al. (EP 329,822), ligase chain reaction (LCR) ( 17, 18), Gap-LCR (WO 90/01069), repair chain reaction (EP 439,182), transcription-mediated amplification (TMA, WO 88/10315), self-maintaining sequence replication (self sustained sequence replication, WO 90/06995), selective amplification of target polynucleotide sequences (US Patent No. 6,410,276), consensus sequence primed polymerase chain reaction ( CP-PCR), U.S. Patent No. 4,437,975), Arbitrarily Primed Polymerase Chain Reaction (AP-PCR), U.S. Patent Nos. 5,413,909 and 5,861,245), oligonucleotide sequence-based amplification (nucleic acid) sequence based amplification (NASBA), U.S. Patent Nos. 5,130,238, 5,409,818, 5,554,517, and 6,063,603), strand displacement amplification n) (21, 22) and loop-mediated isothermal amplification; LAMP) 23, but is not limited thereto. Other amplification methods that can be used are described in U.S. Patent Nos. 5,242,794, 5,494,810, 4,988,617 and U.S. Patent No. 09/854,317.

PCR은 가장 잘 알려진 올리고뉴클레오타이드 증폭 방법으로, 그의 많은 변형과 응용들이 개발되어 있다. 예를 들어, PCR의 특이성 또는 민감성을 증진시키기 위해 전통적인 PCR 절차를 변형시켜 터치다운(touchdown) PCR, 핫 스타트(hot start) PCR, 네스티드(nested) PCR 및 부스터(booster) PCR이 개발되었다. 또한, 실시간(real-time) PCR, 분별 디스플레이 PCR(differential display PCR: DD-PCR), cDNA 말단의 신속 증폭(rapid amplification of cDNA ends: RACE), 멀티플렉스 PCR, 인버스 중합효소 연쇄반응(inverse polymerase chain reaction: IPCR), 벡토레트(vectorette) PCR 및 TAIL-PCR(thermal asymmetric interlaced PCR)이 특정한 응용을 위해 개발되었다. PCR에 대한 자세한 내용은 McPherson, M.J., 및 Moller, S.G. PCR. BIOS Scientific Publishers, Springer-Verlag New York Berlin Heidelberg, N.Y. (2000)에 기재되어 있으며, 그의 교시사항은 본 명세서에 참조로 삽입된다.PCR is the most well-known oligonucleotide amplification method, and its many modifications and applications have been developed. For example, touchdown PCR, hot start PCR, nested PCR and booster PCR have been developed by modifying traditional PCR procedures to enhance the specificity or sensitivity of PCR. In addition, real-time PCR, differential display PCR (DD-PCR), rapid amplification of cDNA ends (RACE), multiplex PCR, inverse polymerase chain reaction chain reaction (IPCR), vectorette PCR and TAIL-PCR (thermal asymmetric interlaced PCR) have been developed for specific applications. For more information on PCR, see McPherson, M.J., and Moller, S.G. PCR. BIOS Scientific Publishers, Springer-Verlag New York Berlin Heidelberg, N.Y. (2000), the teachings of which are incorporated herein by reference.

본 발명의 바람직한 구현예에 따르면, 본 발명 유전자 변형 옥수수 MON863 및 MON810 검출용 키트는 멀티플렉스 PCR 방법을 이용한다.According to a preferred embodiment of the present invention, the kit for detecting genetically modified corn MON863 and MON810 of the present invention uses a multiplex PCR method.

본 발명에 이용되는 프라이머는 주형의 한 부위에 혼성화 또는 어닐링되어, 이중쇄 구조를 형성한다. 이러한 이중쇄 구조를 형성하는 데 적합한 올리고뉴클레오타이드 혼성화의 조건은 Joseph Sambrook, 등, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.(2001) 및 Haymes, B. D., 등, Nucleic Acid Hybridization, A Practical Approach, IRL Press, Washington, D.C. (1985)에 개시되어 있다.The primer used in the present invention is hybridized or annealed at one site of the template to form a double-chain structure. Conditions for oligonucleotide hybridization suitable for forming such a double-chain structure are Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001) and Haymes, BD, et al., Nucleic Acid. Hybridization, A Practical Approach, IRL Press, Washington, DC (1985).

중합 반응을 실시할 때, 반응 용기에 반응에 필요한 성분들을 과량으로 제공하는 것이 바람직하다. 증폭 반응에 필요한 성분들의 과량은, 증폭반응이 성분의 농도에 실질적으로 제한되지 않는 정도의 양을 의미한다. Mg2 +와 같은 조인자, dATP, dCTP, dGTP 및 dTTP를 원하는 증폭 정도가 달성될 수 있을 정도로 반응 혼합물에 제공하는 것이 요구된다. 증폭 반응에 이용되는 모든 효소들은 동일한 반응 조건에서 활성 상태일 수 있다. 사실, 완충액은 모든 효소들이 최적의 반응 조건에 근접하도록 한다. 따라서 본 발명의 증폭 과정은 반응물의 첨가와 같은 조건의 변화 없이 단일 반응물에서 실시될 수 있다.When carrying out the polymerization reaction, it is preferable to provide the reaction vessel with the components necessary for the reaction in excess. The excessive amount of components required for the amplification reaction means an amount such that the amplification reaction is not substantially limited to the concentration of the component. To provide joinja, dATP, dCTP, dGTP and dTTP, such as Mg + 2 to the reaction mixtures to have a desired degree of amplification can be achieved is required. All enzymes used in the amplification reaction may be active under the same reaction conditions. In fact, the buffer allows all enzymes to approach optimal reaction conditions. Therefore, the amplification process of the present invention can be carried out in a single reactant without changing conditions such as addition of reactants.

본 발명의 바람직한 구현예에 따르면, 본 발명 유전자 변형 MON810 검출용 키트는 서열목록 제1서열의 뉴클레오타이드 서열 중 10-100개 서열 또는 이에 상보적인 올리고뉴클레오타이드 서열 중 10-100개 서열을 포함하는 올리고뉴클레오타이드 서열로 이루어진 프로브를 추가적으로 포함한다.According to a preferred embodiment of the present invention, the kit for detecting genetically modified MON810 of the present invention is an oligonucleotide comprising 10-100 sequences of the nucleotide sequence of the first sequence of Sequence Listing or 10-100 of the oligonucleotide sequences complementary thereto. It further includes a probe consisting of a sequence.

본 발명의 바람직한 구현예에 따르면, 본 발명 유전자 변형 MON863 검출용 키트는 서열목록 제2서열의 뉴클레오타이드 서열 중 10-100개 서열 또는 이에 상보적인 올리고뉴클레오타이드 서열 중 10-100개 서열을 포함하는 올리고뉴클레오타이드 서열로 이루어진 프로브를 추가적으로 포함한다.According to a preferred embodiment of the present invention, the kit for detecting genetically modified MON863 of the present invention is an oligonucleotide comprising 10-100 sequences of the nucleotide sequence of SEQ ID NO: 2 or 10-100 of the oligonucleotide sequences complementary thereto. It further includes a probe consisting of a sequence.

본 발명의 바람직한 구현예에 따르면, 본 발명 MON810 검출용 키트, MON863 검출용 키트 및 MON863 및 MON810 검출용 멀티플렉스 키트는 (a) 서열목록 제3서열의 뉴클레오타이드 서열 중 10-100개 서열 또는 이에 상보적인 올리고뉴클레오타이드 서열 중 10-100개 서열을 포함하는 올리고뉴클레오타이드 서열로 이루어진 정방향 프라이머 및 역방향 프라이머로 구성된 제3프라이머 세트; (b) 서열목록 제4서열의 뉴클레오타이드 서열 중 10-100개 서열 또는 이에 상보적인 올리고뉴클레오타이드 서열 중 10-100개 서열을 포함하는 올리고뉴클레오타이드 서열로 이루어진 정방향 프라이머 및 역방향 프라이머로 구성된 제4프라이머 세트; 및 (c) 서열목록 제5서열의 뉴클레오타이드 서열 중 10-100개 서열 또는 이에 상보적인 올리고뉴클레오타이드 서열 중 10-100개 서열을 포함하는 올리고뉴클레오타이드 서열로 이루어진 정방향 프라이머 및 역방향 프라이머로 구성된 제5프라이머 세트를 추가적으로 포함하며, 보다 바람직하게는, 제3프라이머 세트 내지 제5프라이머 세트, 그리고 (a) 서열목록 제3서열의 뉴클레오타이드 서열 중 10-100개 서열 또는 이에 상보적인 올리고뉴클레오타이드 서열 중 10-100개 서열을 포함하는 올리고뉴클레오타이드 서열로 이루어진 프로브; (b) 서열목록 제4서열의 뉴클레오타이드 서열 중 10-100개 서열 또는 이에 상보적인 올리고뉴클레오타이드 서열 중 10-100개 서열을 포함하는 올리고뉴클레오타이드 서열로 이루어진 프로브; 및 (c) 서열목록 제5서열의 뉴클레오타이드 서열 중 10-100개 서열 또는 이에 상보적인 올리고뉴클레오타이드 서열 중 10-100개 서열을 포함하는 올리고뉴클레오타이드 서열로 이루어진 프로브를 추가적으로 포함한다.According to a preferred embodiment of the present invention, the present invention MON810 detection kit, MON863 detection kit, and MON863 and MON810 detection multiplex kit are (a) 10-100 sequences of the nucleotide sequence of SEQ ID NO: 3 or complementary thereto. A third primer set consisting of a forward primer and a reverse primer consisting of an oligonucleotide sequence comprising 10-100 of the typical oligonucleotide sequences; (b) a fourth primer set consisting of a forward primer and a reverse primer consisting of an oligonucleotide sequence comprising 10-100 of the nucleotide sequence of SEQ ID NO: 4 or 10-100 of the oligonucleotide sequence complementary thereto; And (c) a fifth primer set consisting of a forward primer and a reverse primer consisting of an oligonucleotide sequence comprising 10-100 of the nucleotide sequence of SEQ ID NO: 5 or 10-100 of the oligonucleotide sequence complementary thereto. Further comprising, more preferably, a third primer set to a fifth primer set, and (a) 10-100 of the nucleotide sequence of SEQ ID NO: 3 or 10-100 of the oligonucleotide sequence complementary thereto A probe consisting of an oligonucleotide sequence comprising a sequence; (b) a probe consisting of an oligonucleotide sequence comprising 10-100 of the nucleotide sequence of SEQ ID NO: 4 or 10-100 of the oligonucleotide sequence complementary thereto; And (c) a probe consisting of an oligonucleotide sequence comprising 10-100 of the nucleotide sequence of SEQ ID NO: 5 or 10-100 of the oligonucleotide sequence complementary thereto.

본 발명에서 이용하는 프라이머 및 프로브의 적합한 길이는 다양한 요소, 예컨대, 온도와 프라이머의 용도에 따라 변화가 될 수 있다. 바람직하게는, 본 발명에서 이용하는 프라이머의 길이는 10-50개이며, 보다 바람직하게는 10-40개이고, 보다 더 바람직하게는 15-30개이다.The suitable length of the primer and probe used in the present invention may vary depending on various factors, such as temperature and the application of the primer. Preferably, the length of the primers used in the present invention is 10-50, more preferably 10-40, and even more preferably 15-30.

본 명세서에서 사용된 용어 “프로브”는 자연의 또는 변형된 모노머 또는 연쇄 (linkages)의 선형 올리고머를 의미하며, 디옥시리보뉴클레오타이드 및 리보뉴클레오타이드를 포함하고 타깃 뉴클레오타이드 서열에 특이적으로 혼성화 할 수 있으며, 자연적으로 존재하거나 또는 인위적으로 합성된 것이다. 본 발명의 프로브는 바람직하게는 단일쇄이며, 올리고디옥시리보뉴클레오타이드이다.The term “probe” as used herein refers to a linear oligomer of natural or modified monomers or linkages, including deoxyribonucleotides and ribonucleotides, and capable of specifically hybridizing to a target nucleotide sequence, and naturally It exists or is artificially synthesized. The probe of the present invention is preferably single-chain and is an oligodeoxyribonucleotide.

상기한 프로브는 혼성화 어레이 요소(hybridizable array element)로서 이용되며, 기체(substrate) 상에 고정화된다. 바람직한 기체는 적합한 견고성 또는 반-견고성 지지체로서, 예컨대, 막, 필터, 칩, 슬라이드, 웨이퍼, 파이버, 자기성 비드 또는 비자기성 비드, 겔, 튜빙, 플레이트, 고분자, 미소입자 및 모세관을 포함한다. 상기한 혼성화 어레이 요소는 상기의 기체 상에 배열되고 고정화 된다. 이와 같은 고정화는 화학적 결합 방법 또는 UV와 같은 공유 결합적 방법에 의해 실시된다. 예를 들어, 상기 혼성화 어레이 요소는 에폭시 화합물 또는 알데히드기를 포함하도록 변형된 글래스 표면에 결합될 수 있고, 또한 폴리라이신 코팅 표면에서 UV에 의해 결합될 수 있다. 또한, 상기 혼성화 어레이 요소는 링커(예: 에틸렌 글리콜 올리고머 및 디아민)를 통해 기체에 결합될 수 있다.The above-described probe is used as a hybridizable array element and is immobilized on a substrate. Preferred gases are suitable rigid or semi-rigid supports, including, for example, membranes, filters, chips, slides, wafers, fibers, magnetic or non-magnetic beads, gels, tubing, plates, polymers, microparticles and capillaries. The hybridization array element described above is arranged and immobilized on the substrate. Such immobilization is carried out by a chemical bonding method or a covalent bonding method such as UV. For example, the hybridization array element can be bonded to a glass surface modified to contain an epoxy compound or an aldehyde group, and can also be bonded to a polylysine coated surface by UV. In addition, the hybridization array element may be bonded to the gas through a linker (eg, ethylene glycol oligomer and diamine).

프로브의 표지는 혼성화 여부를 검출케 하는 시그널을 제공할 수 있으며, 이는 올리고뉴클레오타이드에 연결될 수 있다. 적합한 표지는 형광단 (예컨대, 플루오리신 (fluorescein), 피코에리트린 (phycoerythrin), 로다민, 리사민 (lissamine), 그리고 Cy3와 Cy5 (Pharmacia)), 발색단, 화학발광단, 자기입자, 방사능동위원소(P32 및 S35), 매스 표지, 전자밀집입자, 효소(알칼린 포스파타아제 또는 호스래디쉬 퍼옥시다아제), 조인자, 효소에 대한 기질, 중금속(예컨대, 금) 그리고 항체, 스트렙타비딘, 바이오틴, 디곡시게닌과 킬레이팅기와 같은 특정 결합 파트너를 갖는 햅텐을 포함하나, 이에 한정되는 것은 아니다. 표지는 당업계에서 통상적으로 실시되는 다양한 방법, 예컨대, 닉 트랜스레이션 (nick translation) 방법, 무작위 프라이밍 방법 (Multiprime DNA labelling systems booklet, "Amersham"(1989)) 및 카이네이션 방법 (Maxam & Gilbert, Methods in Enzymology, 65:499(1986))을 통해 실시될 수 있다. 표지는 형광, 방사능, 발색 측정, 중량 측정, X-선 회절 또는 흡수, 자기, 효소적 활성, 매스 분석, 결합 친화도, 혼성화 고주파, 나노크리스탈에 의하여 검출할 수 있는 시그널을 제공한다.
The label of the probe can provide a signal to detect hybridization, which can be linked to an oligonucleotide. Suitable labels include fluorophores (e.g., fluorescein, phycoerythrin, rhodamine, lissamine, and Cy3 and Cy5 (Pharmacia)), chromophores, chemiluminescent groups, magnetic particles, radioactive isotopes. Elements (P32 and S35), mass labels, electron condensing particles, enzymes (alkaline phosphatase or horseradish peroxidase), cofactors, substrates for enzymes, heavy metals (e.g. gold) and antibodies, streptavidin, biotin , Digoxigenin and a hapten having a specific binding partner such as a chelating group, but are not limited thereto. Labeling can be performed by various methods commonly practiced in the art, such as nick translation method, random priming method (Multiprime DNA labeling systems booklet, "Amersham" (1989)) and kineation method (Maxam & Gilbert, Methods in Enzymology , 65:499 (1986)). The label provides a signal that can be detected by fluorescence, radioactivity, colorimetric measurement, gravimetric measurement, X-ray diffraction or absorption, magnetic, enzymatic activity, mass analysis, binding affinity, high frequency hybridization, and nanocrystals.

본 발명의 또 다른 양태에 따르면, 본 발명은 서열목록 제1서열의 뉴클레오타이드 서열 중 10-100개 서열 또는 이에 상보적인 올리고뉴클레오타이드 서열 중 10-100개 서열을 포함하는 올리고뉴클레오타이드 서열로 이루어진 프로브를 포함하는 MON810 검출용 마이크로어레이를 제공한다.
According to another aspect of the present invention, the present invention includes a probe consisting of an oligonucleotide sequence comprising 10-100 of the nucleotide sequence of SEQ ID NO: 1 or 10-100 of the oligonucleotide sequence complementary thereto. It provides a microarray for detecting the MON810.

본 발명의 또 다른 양태에 따르면, 본 발명은 서열목록 제2서열의 뉴클레오타이드 서열 중 10-100개 서열 또는 이에 상보적인 올리고뉴클레오타이드 서열 중 10-100개 서열을 포함하는 올리고뉴클레오타이드 서열로 이루어진 프로브를 포함하는 MON863 검출용 마이크로어레이를 제공한다.
According to another aspect of the present invention, the present invention includes a probe consisting of an oligonucleotide sequence comprising 10-100 of the nucleotide sequence of SEQ ID NO: 2 or 10-100 of the oligonucleotide sequence complementary thereto. It provides a microarray for detecting the MON863.

본 발명의 또 다른 양태에 따르면, 본 발명은 (a) 서열목록 제1서열의 뉴클레오타이드 서열 중 10-100개 서열 또는 이에 상보적인 올리고뉴클레오타이드 서열 중 10-100개 서열을 포함하는 올리고뉴클레오타이드 서열로 이루어진 프로브; 및 (b) 서열목록 제2서열의 뉴클레오타이드 서열 중 10-100개 서열 또는 이에 상보적인 올리고뉴클레오타이드 서열 중 10-100개 서열을 포함하는 올리고뉴클레오타이드 서열로 이루어진 프로브를 포함하는 MON810 및 MON863 검출용 멀티플렉스 마이크로어레이를 제공한다.
According to another aspect of the present invention, the present invention comprises (a) an oligonucleotide sequence comprising 10-100 of the nucleotide sequence of SEQ ID NO: 1 or 10-100 of the oligonucleotide sequence complementary thereto. Probe; And (b) MON810 and MON863 detection multiplex comprising a probe consisting of an oligonucleotide sequence comprising 10-100 of the nucleotide sequence of SEQ ID NO: 2 or 10-100 of the oligonucleotide sequence complementary thereto. Microarray is provided.

본 발명 마이크로어레이에 있어서, 프로브는 혼성화 어레이 요소(hybridizable array element)로서 이용되며, 기질(substrate) 상에 고정화된다.In the microarray of the present invention, the probe is used as a hybridizable array element and is immobilized on a substrate.

본 발명에서 이용 가능한 기질은 당업계에 공지된 다양한 기질을 포함한다. 기질 표면의 형상, 크기 및 화학적 조성은 특별히 제한되지 않는다. 본 발명에 적합한 고체 기질은 예를 들어, 실리콘 와퍼, 유리, 석영, 융합 실리카, 금과 같은 금속, 플라스틱 및 중합체[예컨대, 사이클로올레핀 공중합체, 폴리(메틸 메타크릴레이트), 폴리스틸렌, 폴리에틸렌 및 폴리프로필렌]를 포함하나, 이에 한정되는 것은 아니다. Substrates usable in the present invention include various substrates known in the art. The shape, size and chemical composition of the substrate surface are not particularly limited. Solid substrates suitable for the present invention are, for example, silicone wafers, glass, quartz, fused silica, metals such as gold, plastics and polymers (e.g., cycloolefin copolymers, poly(methyl methacrylate), polystyrene, polyethylene and poly Propylene], but is not limited thereto.

상기한 혼성화 어레이 요소는 상기의 기체 상에 배열되고 고정화 된다. 이와 같은 고정화는 화학적 결합 방법 또는 UV와 같은 공유 결합적 방법에 의해 실시된다. 예를 들어, 상기 혼성화 어레이 요소는 에폭시 화합물 또는 알데히드기를 포함하도록 변형된 글래스 표면에 결합될 수 있고, 또한 폴리라이신 코팅 표면에서 UV에 의해 결합될 수 있다. 또한, 상기 혼성화 어레이 요소는 링커(예: 에틸렌 글리콜 올리고머 및 디아민)를 통해 기체에 결합될 수 있다.The hybridization array element described above is arranged and immobilized on the substrate. Such immobilization is carried out by a chemical bonding method or a covalent bonding method such as UV. For example, the hybridization array element can be bonded to a glass surface modified to contain an epoxy compound or an aldehyde group, and can also be bonded to a polylysine coated surface by UV. In addition, the hybridization array element may be bonded to the gas through a linker (eg, ethylene glycol oligomer and diamine).

한편, 본 발명 마이크로어레이에 적용되는 시료 DNA는 표지(labeling)될 수 있고, 마이크로어레이상의 어레이 요소와 혼성화된다. 혼성화 조건은 다양하게 할 수 있다. 혼성화 정도의 검출 및 분석은 표지 물질에 따라 다양하게 실시될 수 있다.Meanwhile, the sample DNA applied to the microarray of the present invention may be labeled and hybridized with the array element on the microarray. Hybridization conditions can be varied. The detection and analysis of the degree of hybridization may be performed in various ways depending on the labeling material.

프로브의 표지는 혼성화 여부를 검출케 하는 시그널을 제공할 수 있으며, 이는 올리고뉴클레오타이드에 연결될 수 있다. 적합한 표지는 형광단 (예컨대, 플루오리신 (fluorescein), 피코에리트린 (phycoerythrin), 로다민, 리사민 (lissamine), 그리고 Cy3와 Cy5 (Pharmacia)), 발색단, 화학발광단, 자기입자, 방사능동위원소(P32 및 S35), 매스 표지, 전자밀집입자, 효소(알칼린 포스파타아제 또는 호스래디쉬 퍼옥시다아제), 조인자, 효소에 대한 기질, 중금속(예컨대, 금) 그리고 항체, 스트렙타비딘, 바이오틴, 디곡시게닌과 킬레이팅기와 같은 특정 결합 파트너를 갖는 햅텐을 포함하나, 이에 한정되는 것은 아니다. 표지는 당업계에서 통상적으로 실시되는 다양한 방법, 예컨대, 닉 트랜스레이션 (nick translation) 방법, 무작위 프라이밍 방법 (Multiprime DNA labelling systems booklet, "Amersham"(1989)) 및 카이네이션 방법 (Maxam & Gilbert, Methods in Enzymology, 65:499(1986))을 통해 실시될 수 있다. 표지는 형광, 방사능, 발색 측정, 중량 측정, X-선 회절 또는 흡수, 자기, 효소적 활성, 매스 분석, 결합 친화도, 혼성화 고주파, 나노크리스탈에 의하여 검출할 수 있는 시그널을 제공한다.The label of the probe can provide a signal to detect hybridization, which can be linked to an oligonucleotide. Suitable labels include fluorophores (e.g., fluorescein, phycoerythrin, rhodamine, lissamine, and Cy3 and Cy5 (Pharmacia)), chromophores, chemiluminescent groups, magnetic particles, radioactive isotopes. Elements (P32 and S35), mass labels, electron condensing particles, enzymes (alkaline phosphatase or horseradish peroxidase), cofactors, substrates for enzymes, heavy metals (e.g. gold) and antibodies, streptavidin, biotin , Digoxigenin and a hapten having a specific binding partner such as a chelating group, but are not limited thereto. Labeling can be performed by various methods commonly practiced in the art, such as nick translation method, random priming method (Multiprime DNA labeling systems booklet, "Amersham" (1989)) and kineation method (Maxam & Gilbert, Methods in Enzymology , 65:499 (1986)). The label provides a signal that can be detected by fluorescence, radioactivity, colorimetric measurement, gravimetric measurement, X-ray diffraction or absorption, magnetic, enzymatic activity, mass analysis, binding affinity, high frequency hybridization, and nanocrystals.

프로브를 이용하는 경우, 프로브를 본 발명에서 이용하는 프라이머로 증폭된 DNA 분자와 혼성화시킨다. 본 발명에서, 적합한 혼성화 조건은 최적화 절차에 의하여 일련의 과정으로 결정될 수 있다. 이런 절차는 연구실에서 사용을 위한 프로토콜을 수립하기 위하여 당업자에 의하여 일련의 과정으로 실시된다. 예를 들어, 온도, 성분의 농도, 혼성화 및 세척 시간, 완충액 성분 및 이들의 pH 및 이온세기 등의 조건은 프로브의 길이 및 GC 양 및 타깃 뉴클레오타이드 서열 등의 다양한 인자에 의존한다. 혼성화를 위한 상세한 조건은 Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.(2001); 및 M.L.M. Anderson, Nucleic Acid Hybridization, Springer-Verlag New York Inc. N.Y.(1999)에서 확인할 수 있다. 예를 들어, 상기 엄격조건 중에서 고 엄격조건은 0.5 M NaHPO4, 7% SDS(sodium dodecyl sulfate), 1 mM EDTA에서 65℃ 조건으로 혼성화하고, 0.1 x SSC(standard saline citrate)/0.1% SDS에서 68℃ 조건으로 세척하는 것을 의미한다. 또는, 고 엄격조건은 6 x SSC/0.05% 소듐 파이로포스페이트에서 48℃ 조건으로 세척하는 것을 의미한다. 저 엄격조건은 예를 들어, 0.2 x SSC/0.1% SDS에서 42℃ 조건으로 세척하는 것을 의미한다.When using a probe, the probe is hybridized with a DNA molecule amplified with the primers used in the present invention. In the present invention, suitable hybridization conditions can be determined in a series of processes by an optimization procedure. This procedure is performed as a series of procedures by a person skilled in the art to establish a protocol for use in the laboratory. For example, conditions such as temperature, concentration of components, hybridization and washing times, buffer components, and their pH and ionic strength depend on various factors such as the length of the probe and the amount of GC and the target nucleotide sequence. Detailed conditions for hybridization include Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); And MLM Anderson, Nucleic Acid Hybridization, Springer-Verlag New York Inc. It can be found in NY (1999). For example, among the stringent conditions, high stringency conditions were hybridized in 0.5 M NaHPO 4 , 7% sodium dodecyl sulfate (SDS), 1 mM EDTA at 65°C, and 0.1 x SSC (standard saline citrate)/0.1% SDS. It means washing under the condition of 68°C. Alternatively, high stringency conditions mean washing at 48°C in 6 x SSC/0.05% sodium pyrophosphate. Low stringency means, for example, washing at 42° C. in 0.2 x SSC/0.1% SDS.

혼성화 반응 이후에, 혼성화 반응을 통하여 나오는 혼성화 시그널을 검출한다. 혼성화 시그널은 예컨대, 프로브에 결합된 표지의 종류에 따라 다양한 방법으로 실시할 수 있다. 예를 들어, 프로브가 효소에 의해 표지된 경우, 이 효소의 기질을 혼성화 반응 결과물과 반응시켜 혼성화 여부를 확인할 수 있다. 이용될 수 있는 효소/기질의 조합은, 퍼옥시다아제 (예컨대, 호스래디쉬 퍼옥시다아제)와 클로로나프톨, 아미노에틸카바졸, 디아미노벤지딘, D-루시페린, 루시게닌 (비스-N-메틸아크리디늄 니트레이트), 레소루핀 벤질 에테르, 루미놀, 암플렉스 레드 시약 (10-아세틸-3,7-디하이드록시페녹사진), HYR (p-phenylenediamine-HCl and pyrocatechol), TMB (tetramethylbenzidine), ABTS (2,2‘-Azine-di[3-ethyl benzthiazoline sulfonate]), o-페닐렌디아민(OPD) 및 나프톨/파이로닌; 알칼린 포스파타아제와 브로모클로로인돌일 포스페이트(BCIP), 니트로 블루 테트라졸리움(NBT), 나프톨-AS-B1-포스페이트 (naphthol-AS-B1-phosphate) 및 ECF 기질; 글루코스 옥시다아제와 t-NBT (nitroblue tetrazolium) 및 m-PMS (phenzaine methosulfate) 등이다. 프로브가 금 입자로 표지된 경우에는 실버 나이트레이트를 이용하여 실버 염색 방법으로 검출할 수 있다.After the hybridization reaction, a hybridization signal generated through the hybridization reaction is detected. The hybridization signal can be performed in various ways depending on the type of label bound to the probe, for example. For example, when a probe is labeled with an enzyme, it is possible to confirm whether or not hybridization has occurred by reacting a substrate of this enzyme with a result of a hybridization reaction. Combinations of enzymes/substrates that may be used include peroxidase (e.g. horseradish peroxidase) and chloronaphthol, aminoethylcarbazole, diaminobenzidine, D-luciferin, lucigenin (bis-N-methylacridinium Nitrate), resorupine benzyl ether, luminol, Amplex Red reagent (10-acetyl-3,7-dihydroxyphenoxazine), HYR (p-phenylenediamine-HCl and pyrocatechol), TMB (tetramethylbenzidine), ABTS (2 ,2'-Azine-di[3-ethyl benzthiazoline sulfonate]), o-phenylenediamine (OPD) and naphthol/pyronine; Alkaline phosphatase and bromochloroindolyl phosphate (BCIP), nitro blue tetrazolium (NBT), naphthol-AS-B1-phosphate and ECF substrate; Glucose oxidase, t-NBT (nitroblue tetrazolium) and m-PMS (phenzaine methosulfate). When the probe is labeled with gold particles, it can be detected by a silver staining method using silver nitrate.

본 발명의 바이오칩에 적용될 수 있는 일반적인 설명은, 미국 특허 제5,143,854, 5,242,974, 5,252,743, 5,324,633, 5,384,261, 5,405,783, 5,412,087, 5,424,186, 5,451,683, 5,482,867, 5,491,074, 5,527,681, 5,550,215, 5,571,639, 5,578,832, 5,593,839, 5,599,695, 5,624,711, 5,631,734, 5,795,716, 5,831,070, 5,837,832, 5,856,101, 5,858,659, 5,889,165, 5,936,324, 5,959,098, 5,968,740, 5,974,164, 5,981,185, 5,981,956, 6,025,601, 6,033,860, 6,040,193, 6,090,555, 6,136,269, 6,147,205, 6,262,216, 6,269,846, 6,310,189 및 6,428,752호게 상세하게 기재되어 있다.A general description that can be applied to the biochip of the present invention is U.S. Patent Nos. 5,143,854, 5,242,974, 5,252,743, 5,324,633, 5,384,261, 5,405,783, 5,412,087, 5,424,186, 5,451,683, 5,482,867, 5,491,074, 5,550,527,5,78,839, 5,527,5,681, 839, 5,639,527,5,681, 839 , 5,631,734, 5,795,716, 5.83107 million, 5,837,832, 5,856,101, 5,858,659, 5,889,165, 5,936,324, 5,959,098, 5.96874 million, 5,974,164, 5,981,185, 5,981,956, 6,025,601, 6.03386 million, 6,040,193, 6,090,555, 6,136,269, 6,147,205, 6,262,216, 6,269,846, 6,310,189 and 6,428,752 hoge specifically described Has been.

본 발명의 바이오센서에 적용될 수 있는 일반적인 내용은, Myska, J. Mol. Recognit, 12:279-284(1999); J. Dubendorfer et al. Journal of Biomedical Optics, 2(4):391-400(1997); 및 O'Brien et al. Biosensors & Bioelectronics, 14:145-154(1999)에 기재되어 있다.For general information applicable to the biosensor of the present invention, Myska, J. Mol. Recognit, 12:279-284 (1999); J. Dubendorfer et al. Journal of Biomedical Optics, 2(4):391-400(1997); And O'Brien et al. Biosensors & Bioelectronics, 14:145-154 (1999).

본 발명의 바람직한 구현예에 따르면, 본 발명은 액상 비드 멀티플렉스 마이크로어레이이다.According to a preferred embodiment of the present invention, the present invention is a liquid bead multiplex microarray.

본 발명의 바람직한 구현예에 따르면, 본 발명은 (a) 서열목록 제3서열의 뉴클레오타이드 서열 중 10-100개 서열 또는 이에 상보적인 올리고뉴클레오타이드 서열 중 10-100개 서열을 포함하는 올리고뉴클레오타이드 서열로 이루어진 프로브, (b) 서열목록 제4서열의 뉴클레오타이드 서열 중 10-100개 서열 또는 이에 상보적인 올리고뉴클레오타이드 서열 중 10-100개 서열을 포함하는 올리고뉴클레오타이드 서열로 이루어진 프로브, 및 (c) 서열목록 제5서열의 뉴클레오타이드 서열 중 10-100개 서열 또는 이에 상보적인 올리고뉴클레오타이드 서열 중 10-100개 서열을 포함하는 올리고뉴클레오타이드 서열로 이루어진 프로브를 포함하는 추가적으로 포함한다.
According to a preferred embodiment of the present invention, the present invention comprises (a) an oligonucleotide sequence comprising 10-100 of the nucleotide sequence of SEQ ID NO: 3 or 10-100 of the oligonucleotide sequence complementary thereto. A probe, (b) a probe consisting of an oligonucleotide sequence comprising 10-100 of the nucleotide sequence of Sequence Listing 4 or 10-100 of the oligonucleotide sequence complementary thereto, and (c) Sequence Listing 5 It further includes a probe consisting of an oligonucleotide sequence comprising 10-100 of the nucleotide sequence of the sequence or 10-100 of the oligonucleotide sequence complementary thereto.

본 발명의 특징 및 이점을 요약하면 다음과 같다:The features and advantages of the present invention are summarized as follows:

(ⅰ) 본 발명은 (a) 유전자 변형 옥수수 MON810, MON863 검출용 키트 및 유전자 변형 옥수수 MON863 및 MON810 검출용 키트; 및 (b) 유전자 변형 옥수수 MON810, MON863 검출용 키트 및 유전자 변형 옥수수 MON863 및 MON810 검출용 마이크로어레이를 제공한다.(I) The present invention includes (a) a kit for detecting genetically modified corn MON810, MON863, and a kit for detecting genetically modified corn MON863 and MON810; And (b) a kit for detecting genetically modified corn MON810 and MON863, and a microarray for detecting genetically modified corn MON863 and MON810.

(ⅱ) 본 발명은 유전자 변형 옥수수 MON810, MON863 검출용 키트 및 유전자 변형 옥수수 MON863 및 MON810 검출을 하는데 있어서 정확성 및 신뢰도가 크게 개선된 키트 및 마이크로어레이이다.(Ii) The present invention is a kit for detecting genetically modified corn MON810 and MON863, and a kit and microarray with greatly improved accuracy and reliability in detecting genetically modified corn MON863 and MON810.

(ⅲ) 또한, 본 발명은 단일 뿐 만 아니라 복합적으로 유전자 변형 옥수수 MON863 및 MON810을 동시에 검출함으로써, 유전자 변형 옥수수 여부의 검출 및 동정하는 시간 및 공정을 줄여줄 뿐 만 아니라 비용 면에서 경제적인 효과를 거둘수 있는 장점을 가진다.
(Iii) In addition, the present invention not only shortens the time and process of detecting and identifying the presence of genetically modified corn, but also provides economical effects in terms of cost by simultaneously detecting genetically modified corn MON863 and MON810 not only single but also complexly. It has the advantage of being able to reap.

도 1은 유전자변형 옥수수 MON863 및 MON810에 형질 전환된 도입유전자에 대한 모식도와 서열목록 제1서열 및 제2서열의 올리고뉴클레오타이드의 영역을 나타낸 것이다. 패널 (a)는 유전자변형 옥수수 MON810에 형질 전환된 도입유전자에 대한 모식도이며, 패널 (b)는 형질 전환된 도입유전자에 대한 모식도를 나타낸 것이다.
도 2는 유전자변형 옥수수에 대한 유전자 검출용 멀티플렉스 중합효소연쇄반응을 실시한 결과이다. 각각의 시료(증류수, 비유전자변형 옥수수 지노믹 DNA, MON810 이벤트 DNA, MON863 지노믹 DNA, 후배교배종 이벤트 MON863 x MON810 지노믹 DNA)들를 주형으로 사용하고, 5가지 종류의 프라이머 세트를 첨가하여 멀티플렉스(PCR)을 실시하였다. 음성적 대조구로 물이 들어간 실험구에서는 어떠한 밴드도 검출되지 않았다. 비형질전환 옥수수 실험구에서는 옥수수 내재유전자인 zein 유전자를 검출할 수 있는 밴드만 확인되었다. MON810 이벤트 옥수수 실험구에서는 옥수수 내재유전자인 zein 유전자, 35S 및 MON810 고유의 염기서열이 확인되었다. MON863 이벤트 옥수수 실험구에서는 옥수수 내재유전자인 zein 유전자, 35S NOSt, 및 MON863 고유의 염기서열이 검출되었다. 후대교배종 이벤트 옥수수 MON863 x MON810 실험구에서는 옥수수 내재유전자인 zein 유전자, 35S, NOSt, 및 MON810과 MON863 고유의 염기서열이 각각 검출되었다. M은 마커; 1은 음성대조구; 2는 비유전자변형 옥수수; 3은 유전자변형 옥수수 MON810; 4는 유전자변형 옥수수 MON863; 5는 유전자변형 옥수수 MON863 x MON810.
도 3은 유전자변형 옥수수 MON863 x MON810에 대한 유전자 검출용 멀티플렉스 액상 비드 어레이를 실시한 결과이다. 각각의 시료(증류수, 비유전자변형 옥수수 지노믹 DNA, MON810 이벤트 DNA, MON863 지노믹 DNA, 후배교배종 이벤트 MON863 x MON810 지노믹 DNA)들를 주형으로 사용하고, 5가지 종류의 프라이머 세트를 첨가하여, 멀티플렉스 PCR을 실시한 후, 태그가 첨가된 프로브와 비오틴 표지된 dCTP를 이용하여 2차 PCR을 실시하였다. 5종류의 안티태깅 마이크로 스피어(비드)와 혼성화 시킨 후, 비오틴-스트렙타비딘과의 반응을 통한 형광을 측정하였다. 고유한 스펙트럼 어드레스(spectral address)를 가진 태그를 추정하여, 비드의 번호, 즉, 프로브의 종류를 파악할 수 있고, 스트렙타비딘이 발현된 정도로 MFI 수치를 계산하여 그래프화 하였다. MFI의 cut -off 값은 100-150 사이하였으며, 100이하의 값은 반응하지 않은 것으로 판단하였다. 음성적 대조구로 물이 들어간 실험구에서는 어떠한 종류의 비드(프로브)와 형광도 검출되지 않았다. 비형질전환 옥수수 실험구에서는 옥수수 내재유전자인 zein 유전자를 검출할 수 있는 프로브만 반응하였다. MON810 이벤트 옥수수 실험구에서는 옥수수 내재유전자인 zein 유전자, 35S 및 MON810 고유의 염기서열이 검출되었다. MON863 이벤트 옥수수 실험구에서는 옥수수 내재유전자인 zein 유전자, 35S NOSt, 및 MON863 고유의 염기서열이 검출되었다. 후대교배종 이벤트 옥수수 MON863 x MON810 실험구에서는 옥수수 내재유전자인 zein 유전자, 35S, NOSt, 및 MON810과 MON863 고유의 염기서열이 각각 검출되었다.
1 is a schematic diagram of transgenes transformed into genetically modified maize MON863 and MON810 and shows the regions of oligonucleotides of the first and second sequences of the sequence list. Panel (a) is a schematic diagram of the transgene transformed into transgenic maize MON810, and panel (b) is a schematic diagram of the transformed transgene.
2 is a result of a multiplex polymerase chain reaction for gene detection for genetically modified corn. Each sample (distilled water, non-genetically modified corn genomic DNA, MON810 event DNA, MON863 genomic DNA, posterior hybridization event MON863 x MON810 genomic DNA) was used as a template, and 5 types of primer sets were added to multiplex (PCR) was carried out. No bands were detected in the experimental group containing water as a negative control. Only a band capable of detecting the zein gene, a maize endogenous gene, was identified in the untransformed corn experimental zone. In the MON810 event maize experiment, the zein gene, 35S and MON810, which are the maize endogenous genes, were identified. In the MON863 event maize experimental zone, the zein gene, 35S NOSt, and MON863 unique nucleotide sequences were detected. Posterior hybridization event In the maize MON863 x MON810 test group, the zein gene, 35S, NOSt, and MON810 and MON863 unique nucleotide sequences were detected, respectively. M is a marker; 1 is a negative control; 2, non-genetically modified corn; 3, genetically modified corn MON810; 4, genetically modified maize MON863; 5 is genetically modified maize MON863 x MON810.
3 is a result of performing a multiplex liquid bead array for gene detection for genetically modified corn MON863 x MON810. Each sample (distilled water, non-genetically modified maize genomic DNA, MON810 event DNA, MON863 genomic DNA, posterior hybridization event MON863 x MON810 genomic DNA) was used as a template, and 5 kinds of primer sets were added to After performing the flex PCR, secondary PCR was performed using the tagged probe and biotin-labeled dCTP. After hybridization with five kinds of anti-tagging microspheres (beads), fluorescence through the reaction with biotin-streptavidin was measured. By estimating a tag with a unique spectral address, the number of beads, that is, the type of probe, can be identified, and the MFI value was calculated and graphed to the extent that streptavidin was expressed. The cut-off value of MFI was between 100-150, and values less than 100 were judged not to react. No beads (probes) and fluorescence of any kind were detected in the experimental group containing water as a negative control. In the untransformed maize experimental zone, only probes capable of detecting the zein gene, an endogenous maize gene, were reacted. In the MON810 event maize experimental zone, the zein gene, 35S and MON810, a unique sequence of maize endogenous genes were detected. In the MON863 event maize experimental zone, the zein gene, 35S NOSt, and MON863 unique nucleotide sequences were detected. Posterior hybridization event In the maize MON863 x MON810 test group, the zein gene, 35S, NOSt, and MON810 and MON863 unique nucleotide sequences were detected, respectively.

이하, 실시예를 통하여 본 발명을 더욱 상세히 설명 하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 요지 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
Hereinafter, the present invention will be described in more detail through examples. These examples are only for describing the present invention in more detail, and that the scope of the present invention is not limited by these examples according to the gist of the present invention for those of ordinary skill in the art to which the present invention pertains. It will be self-evident.

실시예Example

실험재료 및 실험방법Experimental materials and test methods

*1. 프로브 염기서열 제작 * 1. Probe sequence preparation

GM(Genetically modified) 작물의 제작에 통상적으로 사용되는 35S 프로모터, NOS 터미네이터, MON810 및 MON 863 이벤트 특이적인 염기서열 부분 및 옥수수의 내재 유전자인 zein의 5종류에 대한 프로브를 제작하였다. 이들 프로브의 염기서열을 제작하기 위해, NCBI(National Center for Biotechnology Information)의 유전자 데이터베이스에서 가능한 염기서열 정보를 얻은 후, 그들 간에 높은 상동성을 가지는 부분을 정하여 각각 목표 유전자에 대한 프로브 염기서열을 디자인하였다(표 1). 표 1은 GM 옥수수 검정용 프로브의 염기서열을 나타낸 것이다.The probes for the 35S promoter, NOS terminator, MON810 and MON 863 event-specific nucleotide sequences, and five types of zein , an intrinsic gene of corn, were prepared. In order to prepare the nucleotide sequence of these probes, after obtaining the possible nucleotide sequence information from the gene database of NCBI (National Center for Biotechnology Information), designing the probe nucleotide sequence for each target gene by determining the part with high homology between them. (Table 1). Table 1 shows the nucleotide sequence of the probe for GM corn assay.

액상 비드 어레이(Liquid bead array)를 실시하기 위하여, 표 1에 제시된 염기서열의 5’ 말단에 고유한 24 개의 염기서열인 태그(tag) 염기서열을 연결하였다(http://www.luminexcorp.com/support/protocols/xtag_protocols.htm). 이 염기서열은 액체 마이크로어레이(liquid micro array)를 수행하기 위하여 사용되는 마이크로비드에 부착된 24개의 고유한 안티-태그 염기서열(anti-tag sequence)에 상보적인 태그 염기서열로서, 이 서열을 프로브 5’말단 부분에 연결하여 액체 비드 어레이에 사용하였다. 태그에 해당하는 염기서열은 총 100개의 비드 안티-태그에 특이적 상보성을 보이는 것(www.luminexcorp.com)으로 이를 이용해 프로브와 반응하는 PCR 산물과 비드와의 혼성화(hybridization) 반응이 일어났는지를 판단할 수 있다(Wilson et al., 2005; Dunbar, 2006).To perform a liquid bead array, a tag sequence, which is a unique 24 base sequence, was linked to the 5'end of the base sequence shown in Table 1 (http://www.luminexcorp.com). /support/protocols/xtag_protocols.htm). This nucleotide sequence is a tag sequence complementary to 24 unique anti-tag sequences attached to microbeads used to perform a liquid micro array, and this sequence is probed. It was connected to the 5'end and used in a liquid bead array. The nucleotide sequence corresponding to the tag shows specific complementarity to a total of 100 bead anti-tags (www.luminexcorp.com). Using this, the PCR product reacting with the probe and the bead hybridization reaction occurred. Can be judged (Wilson et al., 2005; Dunbar, 2006).

프로브Probe 염기서열(5’->3’)Base sequence (5'->3') 태그 염기서열Tag sequence 태그 및 Tags and 안티Anti -태그 세트 번호-Tag set number MON810MON810
(서열번호 16)(SEQ ID NO: 16)
GAAAGTCCTCGTTCAGGTCGGAAAGTCCTCGTTCAGGTCG CTTTTACAATACTTCAATACAATCCTTTTACAATACTTCAATACAATC 2020
MON863MON863
(서열번호 17)(SEQ ID NO: 17)
TCCGGTCTCCCTATAGAGCATCCGGTCTCCCTATAGAGCA CTACAAACAAACAAACATTATCAACTACAAACAAACAAACATTATCAA 2828
35S35S
(서열번호 18)(SEQ ID NO: 18)
TTGCTTTGAAGACGTGGTGTTGCTTTGAAGACGTGGTG CTTTAATCTCAATCAATACAAATCCTTTAATCTCAATCAATACAAATC 1One
NOSNOS
(서열번호 19)(SEQ ID NO: 19)
CCTAGTTTGCGCGCTATACCTAGTTTGCGCGCTATA TCAACAATCTTTTACAATCAAATCTCAACAATCTTTTACAATCAAATC 66
zeinzein
(서열번호 20)(SEQ ID NO: 20)
CCCTGATGCTGCAGCAACTGCCCTGATGCTGCAGCAACTG TCAAAATCTCAAATACTCAAATCATCAAAATCTCAAATACTCAAATCA 1818

2. 2. GMGM 옥수수로부터 지놈 Genome from corn DNADNA 추출 extraction

위자드 지노믹 DNA 정제 키트(wizard genomic DNA purification kit; Promega, 미국)를 이용하여 비유전자변형 옥수수(ERMBF417A, Sigma-Alfrich, 미국), MON810 이벤트 옥수수(ERMBF413F, Sigma-Alfrich, 미국), MON863 이벤트 옥수수(ERMBF416D, Sigma-Alfrich, 미국) 및 후대교배종 이벤트 MON863 x MON810 옥수수(ERMBF417D, Sigma-Alfrich, 미국)로부터 지놈 DNA를 각각 추출하였다. 키트를 이용하여 각각의 옥수수로부터 지노믹 DNA를 추출하는 방법은 다음과 같다.Non-genetically modified corn (ERMBF417A, Sigma-Alfrich, USA), MON810 event corn (ERMBF413F, Sigma-Alfrich, USA), MON863 event corn using a wizard genomic DNA purification kit (Promega, USA) Genomic DNA was extracted from (ERMBF416D, Sigma-Alfrich, USA) and posterior hybridization event MON863 x MON810 corn (ERMBF417D, Sigma-Alfrich, USA), respectively. The method of extracting genomic DNA from each corn using the kit is as follows.

우선, 1.5 ㎖ 튜브에 옥수수 커넬 파우더 100 mg을 넣고 액체질소를 이용하여 그라인딩하였다. 그라인딩된 옥수수 포함가 튜브에 600 ㎕ 핵산 라이시스 용액을 첨가한 후 65℃에서 15분 동안 반응시켰다. 그 다음, 반응물이 포함된 튜브에 200 ㎕ 단백질 침전 용액을 첨가하고 20초간 볼택싱(voltexing)한 후 12000 rpm으로 10분간 원심분리하였다. 원심분리한 후 분리된 상층액 600 ㎕을 프래쉬한 1.5 ㎖ 튜브에 옮긴 후, 동량의 이소프로판놀로 혼합하고 12000 rpm으로 5분간 원심분리하였다. 튜브 바닥에 잔존하는 펠릿(pellet)만을 남기고 상층액을 제거하고 100% 에탄올 500 ㎕을 첨가한 후 12000 rpm으로 5분간 원심분리하였다. 그 다음, 펠릿만 남기고 상층액을 제거한 후 실온에서 10동안 에어 드라이(air dry)를 하였다. 건조된 튜브에 DNA 수화 용액 100 ㎕을 넣어준 후 65℃에서 30분 동안 인큐베이션 시킨 후 스핀(spin)하여 분리된 상층액을 본 연구를 위한 시료로 이용하기 위하여 보관하였다.
First, 100 mg of corn kernel powder was put in a 1.5 ml tube and ground using liquid nitrogen. After adding 600 µl of a nucleic acid lysing solution to the ground corn containing tube, the mixture was reacted at 65° C. for 15 minutes. Then, 200 µl protein precipitation solution was added to the tube containing the reactant, voltexed for 20 seconds, and then centrifuged at 12000 rpm for 10 minutes. After centrifugation, 600 µl of the separated supernatant was transferred to a fresh 1.5 ml tube, mixed with the same amount of isopropanol, and centrifuged for 5 minutes at 12000 rpm. The supernatant was removed, leaving only the pellet remaining on the bottom of the tube, and 500 µl of 100% ethanol was added, followed by centrifugation at 12000 rpm for 5 minutes. Then, after removing the supernatant leaving only the pellet, it was air-dried at room temperature for 10 minutes. 100 µl of the DNA hydration solution was added to the dried tube, incubated at 65° C. for 30 minutes, and then the supernatant separated by spinning was stored for use as a sample for this study.

3. 액상 3. Liquid 비드Bead 어레이 시스템을 이용한 Array system 프로브의Of the probe 유효성 검정 Validity test

검정 목표 유전자를 멀티플렉스 PCR을 이용해 동시에 증폭한 후, 표 1의 염기서열을 가지며 5’말단에 고유한 24개의 태그 염기서열을 가지는 프로브를 이용하여 액체 비드 어레이 검정을 실시하였다.
After simultaneously amplifying the assay target genes using multiplex PCR, a liquid bead array assay was performed using a probe having the nucleotide sequence shown in Table 1 and having 24 unique tag nucleotide sequences at the 5'end.

3.1. 멀티플렉스 증합효소연쇄반응(3.1. Multiplex Enzyme Chain Reaction ( PolymerasePolymerase ChainChain ReactionReaction : : PCRPCR ))

GM 옥수수 두 종류와 그들의 후대교배종 스택 이벤트(stack event)를 대상으로 대상 유전자를 동시에 검정하는 멀티플렉스 PCR을 실시하였다. MON810의 프라이머는 도입된 Cry1Ab 유전자의 말단 부분과 옥수수 유전체의 플랭킹(flanking) 유전자를 포함하여 증폭하도록 디자인되었으며, MON863의 프라이머는 도입된 유전자의 전사 종결 신호(terminator signal)인 T-tahsp17의 일부분과 옥수수 유전체의 플랭킹 유전자를 포함하여 이벤트 특이적 검출이 가능하도록 제작하였다(Shrestha et al., 2005). 형질전환용 벡터 유래 대상 유전자로서는 콜리플라워(cauliflower) 모자이크 바이러스 35S 프로모터와 아그로박테리움 투메파시언스(agrobacterium tumefaciens) 3’NOS 터미네이터 유전자를 이용하였으며, 작물 내재 유전자로 zein 유전자를 이용하였고(표 2; Shrestha et al. (2008), 접근번호. AB303064), 사용된 프라이머의 염기서열은 다음과 같다. PCR 조성은 25 ㎕의 2 x Max Taq Hot start master mix (BioQuest, 대한민국), 10 pmole의 각각의 5세트 프라이머, 20 ng의 주형(template)과 3차 증류수를 최종 50 ㎕로 조성하였다.Multiplex PCR was performed to simultaneously test the target gene for two types of GM corn and their progeny hybrid stack event. The primer of MON810 is designed to amplify including the terminal portion of the introduced Cry1Ab gene and the flanking gene of the corn genome, and the primer of MON863 is a part of T-tahsp17, the transcription termination signal of the introduced gene. It was constructed to enable event-specific detection including flanking genes in the and corn genome (Shrestha et al., 2005). As the target gene derived from the vector for transformation, the cauliflower mosaic virus 35S promoter and the agrobacterium tumefaciens 3'NOS terminator gene were used, and the zein gene was used as the crop endogenous gene (Table 2). ; Shrestha et al. (2008), Accession No. AB303064), the nucleotide sequence of the primer used is as follows. PCR composition was composed of 25 μl of 2 x Max Taq Hot start master mix (BioQuest, Korea), 10 pmoles of each 5 sets of primers, 20 ng of template and 3rd distilled water to final 50 μl.

프라이머primer 염기서열(5'->3')Base sequence (5'->3') 산물 크기(Product size ( bpbp )) MON810MON810 F F
(서열번호 6)(SEQ ID NO: 6)
CACCACAGCCACCACTTCTCACCACAGCCACCACTTCT 150150
MON810MON810 R R
(서열번호 7)(SEQ ID NO: 7)
AGGAAAAGCTATTGTAAAGCCAAAAGGAAAAGCTATTGTAAAGCCAAA
MON863MON863 F F
(서열번호 8)(SEQ ID NO: 8)
GTAATCGGCTAATCGCCAACGTAATCGGCTAATCGCCAAC 224224
MON863MON863 R R
(서열번호 9)(SEQ ID NO: 9)
GCCAGTTCATTGCGAGTACAGCCAGTTCATTGCGAGTACA
35S F35S F
(서열번호 10)(SEQ ID NO: 10)
GACAGTGGTCCCAAAGATGGACGACAGTGGTCCCAAAGATGGAC 115115
35S R35S R
(서열번호 11)(SEQ ID NO: 11)
CCTTACGTCAGTGGAGATATCCCTTACGTCAGTGGAGATATC
NOSNOS F F
(서열번호 12)(SEQ ID NO: 12)
CTGTTGCCGGTCTTGCGATGCTGTTGCCGGTCTTGCGATG 185185
NOSNOS R R
(서열번호 13)(SEQ ID NO: 13)
GCGCGATAATTTATCCTAGTTTGGCGCGATAATTTATCCTAGTTTG
zeinzein F F
(서열번호 14)(SEQ ID NO: 14)
GCTTGCGGAGCTTGATGGCGTGCTTGCGGAGCTTGATGGCGT 7272
zeinzein R R
(서열번호 15)(SEQ ID NO: 15)
GGCATCGTCTGAAGCGGTAAGGGGCATCGTCTGAAGCGGTAAGG

PCR은 써멀 사이클러(thermal cycler; MyCycler, BioRad, USA)를 이용하였고, 멀티플렉스 PCR 조건은 95℃ 15분 전처리를 거쳐, 94℃ 30초, 60℃ 1분, 72℃ 1분으로 35 사이클링 하고, 72℃에서 10분간 후처리하였다. 이어 PCR 산물은, 2차 PCR을 통해 프로브와 반응하여 비오틴 표지된 dCTP로 선형 증폭(linear amplifiation)에 사용하였다.
PCR was performed using a thermal cycler (MyCycler, BioRad, USA), and the multiplex PCR conditions were pre-treatment at 95°C for 15 minutes, followed by 35 cycles at 94°C for 30 seconds, 60°C for 1 minute, and 72°C for 1 minute. , Post-treatment was performed at 72°C for 10 minutes. Subsequently, the PCR product was reacted with the probe through secondary PCR and used for linear amplifiation with biotin-labeled dCTP.

3.2 액체 3.2 liquid 비드Bead 어레이 제조 Array manufacturing

3.2.1 3.2.1 비드Bead 조제 pharmacy

24개 안티-태그가 커플링된 비드와의 반응을 위하여, 반응시키고자 하는 비드(FlexMAP beads, Tm Bioscience, Toronto, Canada)를 균일하게 혼합한 후 40 ㎕ (4-5 x 105 beads/㎕) 씩을 취하였다. 각각의 비드에 0.1 M MES (N-morpholino-ethanesulfonic acid; pH 4.5 Sigma-Aldrich, 미국) 20 ㎕를 혼합하고 준비된 안티-태그를 2 ㎕씩 덜어서 비드와 섞어 준 후, 10 ㎖/㎖ EDC (Ethylcarbodiimide hydrochloride; Sigma-Aldrich, 미국) 용액 1 ㎕를 넣고 반응시켰다. 비드는 빛에 매우 민감하므로, 어두운 곳에서 약 30분간을 잘 교반하면서 반응시켰고, 다시 새로 만든 10 ㎖/㎖ EDC 용액을 추가로 1 ㎕ 넣고 약 20분간 반응시켰다. 이후 각 튜브에 500 ㎕의 0.02% Tween-20 용액을 넣어서 잘 섞어 주었으며, 각 튜브의 비드를 원심 분리하여 상층액을 제거하고, 다시 500 ㎕의 0.1% SDS 용액으로 잘 혼합하였다. 각 튜브의 비드를 다시 원심 분리하여 상층액을 걷어주고, 이후 150 ㎕의 TE(pH 8.0) 버퍼에 녹여 잘 섞은 후, 4℃ 암실에서 보관 또는 즉시 실험에 사용하였다.
For reaction with 24 anti-tag coupled beads, 40 µl (4-5 x 10 5 beads/µl) after uniformly mixing the beads to be reacted (FlexMAP beads, Tm Bioscience, Toronto, Canada) ) Took each. 20 µl of 0.1 M MES (N-morpholino-ethanesulfonic acid; pH 4.5 Sigma-Aldrich, USA) was mixed with each bead, and 2 µl of the prepared anti-tag was dropped and mixed with the beads, and then 10 ml/ml EDC (Ethylcarbodiimide). hydrochloride; Sigma-Aldrich, USA) 1 µl of a solution was added and reacted. Since the bead is very sensitive to light, it was reacted for about 30 minutes in a dark place while stirring well, and 1 µl of the newly made 10 ml/ml EDC solution was added and reacted for about 20 minutes. Then, 500 µl of 0.02% Tween-20 solution was added to each tube and mixed well. The bead of each tube was centrifuged to remove the supernatant, and then mixed well with 500 µl of 0.1% SDS solution. The beads of each tube were centrifuged again to remove the supernatant, and then dissolved in 150 µl of TE (pH 8.0) buffer, mixed well, and stored in a dark room at 4°C or immediately used for experiments.

3.2.2 2차 단일 가닥 3.2.2 Secondary single strand PCRPCR 과 비오틴 And biotin dCTPdCTP 를 이용한 Using 단일가닥의Single-stranded 형성 formation

2차 단일 가닥 PCR은 멀티플렉스 PCR 단계에서 만들어진 GM 옥수수의 PCR 산물을 주형으로 사용하여, 바이오틴(biotin)-dCTP를 합성기질로 넣어 선형 증폭을 수행하였다. 표지를 위해 PCR 산물 1 ㎕를 사용하였고, 0.5 프로브, 50 uM dATP, dGTP 및 dTTP 믹스(Invitrogen), 20 uM 바이오틴-dCTP (Invitrogen), 7.5 mM Tris HCl(pH 9.0), 0.2 mM MgCl2, 5 mM KCl, 2 mM (NH4)2SO4 및 Taq 폴리머라아제(Ultratools, 스페인) 1 U로 단일 가닥 선형 증폭을 수행하였다. 2차 단일 가닥 PCR 반응은 95℃에서 5분 동안 변성시킨 후 94℃ 에서 30 초, 58℃ 에서 30 초 및 72℃ 에서 1분으로 35 사이클을 수행하였다.
In the second single-stranded PCR, a PCR product of GM corn made in the multiplex PCR step was used as a template, and biotin-dCTP was added as a synthetic substrate to perform linear amplification. 1 μl of the PCR product was used for labeling, 0.5 probe, 50 uM dATP, dGTP and dTTP mix (Invitrogen), 20 uM biotin-dCTP (Invitrogen), 7.5 mM Tris HCl (pH 9.0), 0.2 mM MgCl 2 , 5 mM KCl, 2 mM (NH 4 ) 2 SO 4 And Taq polymerase (Ultratools, Spain) 1 U single-stranded linear amplification was performed. The second single-stranded PCR reaction was denatured at 95°C for 5 minutes, followed by 35 cycles at 94°C for 30 seconds, 58°C for 30 seconds, and 72°C for 1 minute.

2.2.3 2.2.3 혼성화Hybridization 반응 reaction

2차 연쇄 중합 반응을 마친 산물은 2X TM (0.4M NaCl, 0.2M Tris, 0.16% Triton X-100, pH 8.0) 혼성화 버퍼에 용해시킨 후, 비드와의 혼성화 반응을 95℃ 에서 5분 및 37℃에서 30분 동안 실시하였다. 이 후, 반응물을 96-웰 2 마이크론 필터 플레이트(Millipore, Bedford, USA)에 옮기고, 진공 매니폴드(vacuum manifold)를 이용해 세척한 후, 1X TM 버퍼에 용해시켰다. 2번의 세척 단계를 거친 후, 필터에 흡착된 샘플은 최종적으로 2 ㎍/㎖ 스트렙타아비딘-R-피코에리트린(streptavidin-R-phycoerythrin; Sigma-Aldrich, USA)을 함유한 1X TM에 용해시킨 후 상온에서 15분간 반응시켰다. 이어서, 루미넥스 200 사이토메터 프로세서(Luminex Corp., Austin, USA)를 이용하여 각 웰 별로 비드를 읽었다. 루미넥스 200은 2개의 레이저를 이용하는데, 한 개는 비드 고유의 스펙트럼 어드레스(spectral address)를 가지는 비드 번호(유전자의 종류)를 다른 한 개는 반응된 피코에리트린의 양(포함된 양)을 계산하여 수치로 나타낸다. 이들 수치는 각각의 도입된 유전자를 대표하는 비드의 MFI (mean fluorescence intensity) 값으로 대변되고, 이를 통해 옥수수의 검정하고자 하는 유전자 등의 종류와 포함 정도를 판정하고자 하였다.
The product after the secondary chain polymerization reaction was dissolved in 2X TM (0.4M NaCl, 0.2M Tris, 0.16% Triton X-100, pH 8.0) hybridization buffer, followed by hybridization reaction with beads at 95° C. for 5 minutes and 37 It was carried out at °C for 30 minutes. Thereafter, the reaction was transferred to a 96-well 2 micron filter plate (Millipore, Bedford, USA), washed with a vacuum manifold, and dissolved in 1X TM buffer. After two washing steps, the sample adsorbed on the filter was finally dissolved in 1X TM containing 2 μg/ml streptavidin-R-phycoerythrin (Sigma-Aldrich, USA). Then, it was reacted at room temperature for 15 minutes. Subsequently, beads were read for each well using a Luminex 200 cytometer processor (Luminex Corp., Austin, USA). The Luminex 200 uses two lasers, one with a bead number (type of gene) with a unique spectral address of the bead, and the other with the amount of phycoerythrin reacted (amount contained). It is calculated and expressed as a number. These values are represented by MFI (mean fluorescence intensity) values of beads representing each introduced gene, and through this, the type and degree of inclusion of the gene to be assayed in corn was to be determined.

실험결과Experiment result

1. One. GMGM 옥수수의 액상 Liquid corn 비드Bead 어레이를 이용한 유전자 검출 Gene detection using an array

두 가지 종류의 Bt(bacillus thuringiensis) 유전자(Cry1Ab 및 Cry3Bb1)를 가진 후대교배종 이벤트 GM 옥수수(MON863 x MON810)와 각각의 유전자가 단일로 도입된 MON810과 MON863 이벤트를 대상으로 검정하고자 하는 유전자가 판별이 되는지를 확인하고자 하였다. 또한, 후대교배종 MON863 x MON810 이벤트에서 단일 이벤트의 결과와 일치하는지를 확인하고자 하였다.It is possible to discriminate the gene to be tested by targeting GM maize (MON863 x MON810) and MON810 and MON863 events in which each gene was introduced as a single gene. I tried to check if it worked. In addition, it was attempted to confirm whether the result of a single event in the posterior hybrid MON863 x MON810 event was consistent with the result.

1.1. 1.1. GMGM 옥수수에서 멀티플렉스 Multiplex in corn PCRPCR 실시practice

아가로스 젤 상에서 전기 영동한 결과, 음성 대조구(negative control; 증류수만 포함된 시료)에서는 증폭된 산물을 발견할 수 없었으며, 비유전자변형 옥수수에서는 내재유전자로서 SPS 유전자만 증폭되었다. MON810은 35S 유전자를 보유하고 있는 반면, NOS 터미네이터는 보유하고 있지 않은데, PCR 결과에서도 상동의 결과를 보였다. MON863은 810 이벤트 특이적인 프라이머로는 증폭이 되지 않았고, MON863 이번트 특이적인 프라이머로만 증폭이 되었다. 두 가지 Bt 유전자가 집적된 후대교배종 이벤트 라인에서는 MON863 및 MON810 프라이머를 사용해서 모두 동시에 증폭이 됨을 확인하였다(도 2). 이 멀티플렉스 PCR 산물을 가지고, 각각의 프로브를 이용하여 액체 마이크로어레이를 실시하였다.
As a result of electrophoresis on agarose gel, the amplified product could not be found in the negative control (sample containing only distilled water), and only the SPS gene as an endogenous gene was amplified in non-GMO corn. MON810 possesses the 35S gene, but does not possess the NOS terminator, and the PCR results also showed the same result. MON863 was not amplified with 810 event-specific primers, but was amplified only with MON863-specific primers. It was confirmed that both Bt genes were amplified at the same time using MON863 and MON810 primers in the posterior hybrid event line in which the two Bt genes were integrated (FIG. 2). With this multiplex PCR product, a liquid microarray was performed using each probe.

1.2. 멀티플렉스 액체 비드 어레이 시스템을 이용한 단일 및 후대교배종 이벤트 GM 작물 검정시험 1.2. Single and posterior hybrid event GM crop validation test using multiplex liquid bead array system

총 3번의 실험 결과의 평균으로서의 MON810과 MON863 각각의 루미넥스 결과와 MON863 x MON810 후대교배종 이벤트 옥수수의 루미넥스 결과를 표 3과 도 3에 나타내었다. 수치의 유의성 최소치인 컷-오프 값은 150으로 지정하였다. 옥수수 종 특이 유전자 zein 비드와의 반응을 시킨 결과, 음성 대조군을 제외하고는 모든 샘플에서 반응을 하였음을 확인하였고, 35S 검출 비드와의 반응은 음성대조군과 비 GM을 제외하고는 GM 옥수수 모두에서 검출되었음을 확인하였다. NOS 터미네이터 비드와의 반응은 GM 옥수수에서 MON810을 제외하고는 MON863과 MON863 x MON810 후대교배종 이벤트 GM 옥수수에서 검출되었다. 표 3의 멀티플렉스 액체 비드 어레이의 결과를 MFI 값에 대한 표로 나타낸 것이며, 이 값을 이용한 그래프는 도 3에 나타내었다. Table 3 and FIG. 3 show the luminex results of MON810 and MON863, respectively, and the luminex results of MON863 x MON810 posterior hybridization event corn as an average of the results of a total of three experiments. The cut-off value, which is the minimum significance of the numerical value, was designated as 150. As a result of reacting with the maize species specific gene zein beads, it was confirmed that all samples except the negative control were reacted, and the reaction with 35S detection beads was detected in all GM maize except the negative control and non-GM. Was confirmed. Reactions with NOS terminator beads were detected in GM maize, except for MON810, in MON863 and MON863 x MON810 posterior hybrid events. The results of the multiplex liquid bead array of Table 3 are shown in a table for MFI values, and a graph using this value is shown in FIG. 3.

시료명Sample name ZeinZein 35S35S NOSNOS MON810MON810 MON863MON863 음성대조구Voice control 6565 3131 6161 8484 7575 ratio GMGM 옥수수 corn 43404340 3636 8989 4444 4545 MON810MON810 37893789 58045804 3737 43924392 3333 MON863MON863 41244124 55715571 50225022 2323 47254725 MON863MON863 x x MON810MON810 39903990 65716571 49754975 47724772 43254325

검토Review

GM 옥수수 MON810, MON863 및 후대교배종인 후대교배종 이벤트 GM 이벤트 MON863 x MON810을 대상으로, 도입된 외래 유전자를 검정하고자 액상 비드 어레이 검정용 프로브를 개발 하였다. 검정용 프로브는 총 5개로 벡터 콘스트럭트 특이적 프로브인 35S 프로모터용과 NOS 터미네이터용, 그리고 옥수수 종에 특이적인 내재유전자인 zein용이 있으며, MON810과 MON863 각각에 대한 이벤트 특이적 프로브를 제조하였다. 제조된 프로브들을 이용하여, 멀티플렉스 PCR 산물을 재료로 프로브와 반응한 2차 PCR 산물을 제조한 마이크로스피어 비드와 혼성화 반응을 시킨 후, 루미넥스 프로세서에서 형광을 체크하여 MFI 값으로 수치화하였다.A liquid bead array assay probe was developed for the GM maize MON810, MON863, and the posterior hybrid event GM event MON863 x MON810 to test the introduced foreign genes. There were a total of 5 assay probes, for the 35S promoter and the NOS terminator, which are vector construct-specific probes, and for zein , which is an endogenous gene specific to corn species, and event-specific probes for each of MON810 and MON863 were prepared. Using the prepared probes, the multiplex PCR product was subjected to hybridization reaction with the microsphere beads prepared by reacting the second PCR product with the probe as a material, and then the fluorescence was checked in a Luminex processor to quantify the MFI value.

결론적으로 본 연구자들에 의하여 제작된 프로브들은 목적하는 유전자에 특이적으로 반응하였으며, 그 외는 크로스 반응을 나타내지 아니하였다. 또한, 단일 검정 결과와 동시다중 검정 결과에서도 결과 반응이 일치하였으며, Taq-맨 프로브 합성에도 이용된다면 실시간(real-time) PCR로 MON863 및 MON810 옥수수의 정량적 검출시 사용될 수 있을 것이다.
In conclusion, the probes produced by the researchers reacted specifically to the gene of interest, and other probes did not show cross-reaction. In addition, the resultant reactions were consistent with the single assay results and the simultaneous multiple assay results, and if used for Taq-Man probe synthesis, it could be used for quantitative detection of MON863 and MON810 corn by real-time PCR.

참고문헌references

1. Dunbar SA (2006) Application of LuminexxMAPTM technology for rapid, high-throughput multiplexed nucleic acid detection. Clin Chim Acta 363, 71-82.1.Dunbar SA (2006) Application of LuminexxMAP TM technology for rapid, high-throughput multiplexed nucleic acid detection. Clin Chim Acta 363, 71-82.

2. Shrestha HK, Hwu KK, Wang SJ, Liu LF, and Chang MC (2008) Simultaneous detection of eight genetically modified maize lines using a combination of event- and construct-specific multiplex-PCR technique. J Agric Food Chem 56, 8962-8968.2.Shrestha HK, Hwu KK, Wang SJ, Liu LF, and Chang MC (2008) Simultaneous detection of eight genetically modified maize lines using a combination of event- and construct-specific multiplex-PCR technique. J Agric Food Chem 56, 8962-8968.

3. Wilson WJ, Erler AM, Nasarabadi SL, Skowronski EW, and Imbro PM (2005) A multiplex PCR-coupled liquid bead array for the simultaneous detection of four biothreat agents Mol Cell Probes 19, 137-144.
3.Wilson WJ, Erler AM, Nasarabadi SL, Skowronski EW, and Imbro PM (2005) A multiplex PCR-coupled liquid bead array for the simultaneous detection of four biothreat agents Mol Cell Probes 19, 137-144.

이상으로 본 발명의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.As described above, specific parts of the present invention have been described in detail, and it is obvious that these specific techniques are only preferred embodiments, and the scope of the present invention is not limited thereto for those of ordinary skill in the art. Accordingly, it will be said that the substantial scope of the present invention is defined by the appended claims and their equivalents.

<110> Seoul Women's University Industry-University Cooperation Foundation <120> Kits for Detecting Genetically Modified Corn MON863 and MON810 <160> 20 <170> KopatentIn 1.71 <210> 1 <211> 150 <212> DNA <213> Artificial Sequence <220> <223> MON810 <400> 1 caccacagcc accacttctc cttggacatc gatgtgggct gcaccgacct gaacgaggac 60 tttcggtagc cttctttcat ttccgaattt gcttgcgagc agtcaggtcc ttttgattca 120 tctgagtttg gctttacaat agcttttcct 150 <210> 2 <211> 224 <212> DNA <213> Artificial Sequence <220> <223> MON863 <400> 2 gtaatcggct aatcgccaac agattcggcg atgaataaat gagaaataaa ttgttctgat 60 tttgagtgca aaaaaaaagg aattagatct gtgtgtgttt tttggatccc cggggcggcc 120 gcggggaatc cggtctccct atagagcaga gcatagtgac aaaagttcca tttagatatg 180 gttgtatcat atgtatataa agaatgtact cgcaatgaac tggc 224 <210> 3 <211> 114 <212> DNA <213> Artificial Sequence <220> <223> 35S <400> 3 gacagtggtc ccaaagatgg acccccaccc acgaggagca tcgtggaaaa agaagacgtt 60 ccaaccacgt cttcaaagca agtggattga tgtgatatct ccactgacgt aagg 114 <210> 4 <211> 185 <212> DNA <213> Artificial Sequence <220> <223> NOSt <400> 4 ctgttgccgg tcttgcgatg attatcatat aatttctgtt gaattacgtt aagcatgtaa 60 taattaacat gtaatgcatg acgttattta tgagatgggt ttttatgatt agagtcccgc 120 aattatacat ttaatacgcg atagaaaaca aaatatagcg cgcaaactag gataaattat 180 cgcgc 185 <210> 5 <211> 73 <212> DNA <213> Maize <400> 5 gcttgcggag cttgatggcg tgtccgtccc tgatgctgca gcaactgttg gccttaccgc 60 ttcagacgat gcc 73 <210> 6 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> MON810 F Primer <400> 6 caccacagcc accacttct 19 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> MON810 R Primer <400> 7 aggaaaagct attgtaaagc caaa 24 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MON863 F Primer <400> 8 gtaatcggct aatcgccaac 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MON863 R Primer <400> 9 gccagttcat tgcgagtaca 20 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 35S F Primer <400> 10 gacagtggtc ccaaagatgg ac 22 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 35S R Primer <400> 11 ccttacgtca gtggagatat c 21 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NOS F Primer <400> 12 ctgttgccgg tcttgcgatg 20 <210> 13 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> NOS R Primer <400> 13 gcgcgataat ttatcctagt ttg 23 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> zein F Primer <400> 14 gcttgcggag cttgatggcg t 21 <210> 15 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> zein R Primer <400> 15 ggcatcgtct gaagcggtaa gg 22 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MON810 Probe <400> 16 gaaagtcctc gttcaggtcg 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MON863 Probe <400> 17 tccggtctcc ctatagagca 20 <210> 18 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> 35S Probe <400> 18 ttgctttgaa gacgtggtg 19 <210> 19 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> NOS Probe <400> 19 cctagtttgc gcgctata 18 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> zein Probe <400> 20 ccctgatgct gcagcaactg 20 <110> Seoul Women's University Industry-University Cooperation Foundation <120> Kits for Detecting Genetically Modified Corn MON863 and MON810 <160> 20 <170> KopatentIn 1.71 <210> 1 <211> 150 <212> DNA <213> Artificial Sequence <220> <223> MON810 <400> 1 caccacagcc accacttctc cttggacatc gatgtgggct gcaccgacct gaacgaggac 60 tttcggtagc cttctttcat ttccgaattt gcttgcgagc agtcaggtcc ttttgattca 120 tctgagtttg gctttacaat agcttttcct 150 <210> 2 <211> 224 <212> DNA <213> Artificial Sequence <220> <223> MON863 <400> 2 gtaatcggct aatcgccaac agattcggcg atgaataaat gagaaataaa ttgttctgat 60 tttgagtgca aaaaaaaagg aattagatct gtgtgtgttt tttggatccc cggggcggcc 120 gcggggaatc cggtctccct atagagcaga gcatagtgac aaaagttcca tttagatatg 180 gttgtatcat atgtatataa agaatgtact cgcaatgaac tggc 224 <210> 3 <211> 114 <212> DNA <213> Artificial Sequence <220> <223> 35S <400> 3 gacagtggtc ccaaagatgg acccccaccc acgaggagca tcgtggaaaa agaagacgtt 60 ccaaccacgt cttcaaagca agtggattga tgtgatatct ccactgacgt aagg 114 <210> 4 <211> 185 <212> DNA <213> Artificial Sequence <220> <223> NOSt <400> 4 ctgttgccgg tcttgcgatg attatcatat aatttctgtt gaattacgtt aagcatgtaa 60 taattaacat gtaatgcatg acgttattta tgagatgggt ttttatgatt agagtcccgc 120 aattatacat ttaatacgcg atagaaaaca aaatatagcg cgcaaactag gataaattat 180 cgcgc 185 <210> 5 <211> 73 <212> DNA <213> Maize <400> 5 gcttgcggag cttgatggcg tgtccgtccc tgatgctgca gcaactgttg gccttaccgc 60 ttcagacgat gcc 73 <210> 6 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> MON810 F Primer <400> 6 caccacagcc accacttct 19 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> MON810 R Primer <400> 7 aggaaaagct attgtaaagc caaa 24 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MON863 F Primer <400> 8 gtaatcggct aatcgccaac 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MON863 R Primer <400> 9 gccagttcat tgcgagtaca 20 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 35S F Primer <400> 10 gacagtggtc ccaaagatgg ac 22 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 35S R Primer <400> 11 ccttacgtca gtggagatat c 21 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NOS F Primer <400> 12 ctgttgccgg tcttgcgatg 20 <210> 13 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> NOS R Primer <400> 13 gcgcgataat ttatcctagt ttg 23 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> zein F Primer <400> 14 gcttgcggag cttgatggcg t 21 <210> 15 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> zein R Primer <400> 15 ggcatcgtct gaagcggtaa gg 22 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MON810 Probe <400> 16 gaaagtcctc gttcaggtcg 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MON863 Probe <400> 17 tccggtctcc ctatagagca 20 <210> 18 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> 35S Probe <400> 18 ttgctttgaa gacgtggtg 19 <210> 19 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> NOS Probe <400> 19 cctagtttgc gcgctata 18 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> zein Probe <400> 20 ccctgatgct gcagcaactg 20

Claims (10)

서열목록 제2서열의 뉴클레오타이드 서열 중 10-100개 서열 또는 이에 상보적인 올리고뉴클레오타이드 서열 중 10-100개 서열을 포함하는 올리고뉴클레오타이드 서열로 이루어진 정방향 프라이머 및 역방향 프라이머로 구성된 프라이머 세트를 포함하는 유전자 변형 옥수수 MON863 검출용 키트.
Genetically modified corn comprising a primer set consisting of a forward primer and a reverse primer consisting of an oligonucleotide sequence comprising 10-100 sequences of the nucleotide sequence of SEQ ID NO: 2 or an oligonucleotide sequence complementary thereto MON863 detection kit.
제 1 항에 있어서, 상기 키트는 서열목록 제2서열의 뉴클레오타이드 서열 중 10-100개 서열 또는 이에 상보적인 올리고뉴클레오타이드 서열 중 10-100개 서열을 포함하는 올리고뉴클레오타이드 서열로 이루어진 프로브를 추가적으로 포함하는 것을 특징으로 하는 유전자 변형 옥수수 MON863 검출용 키트.
The method of claim 1, wherein the kit further comprises a probe consisting of an oligonucleotide sequence comprising 10-100 sequences of the nucleotide sequence of SEQ ID NO: 2 or 10-100 of the oligonucleotide sequence complementary thereto Genetically modified corn MON863 detection kit.
서열목록 제2서열의 뉴클레오타이드 서열 중 10-100개 서열 또는 이에 상보적인 올리고뉴클레오타이드 서열 중 10-100개 서열을 포함하는 올리고뉴클레오타이드 서열로 이루어진 정방향 프라이머 및 역방향 프라이머로 구성된 제1프라이머 세트를 포함하는 MON863 검출용 멀티플렉스 키트.
MON863 comprising a first primer set consisting of a forward primer and a reverse primer consisting of an oligonucleotide sequence comprising 10-100 sequences of the nucleotide sequence of SEQ ID NO: 2 or an oligonucleotide sequence complementary thereto Detection multiplex kit.
제 3 항에 있어서, 상기 키트는 서열목록 제2서열의 뉴클레오타이드 서열 중 10-100개 서열 또는 이에 상보적인 올리고뉴클레오타이드 서열 중 10-100개 서열을 포함하는 올리고뉴클레오타이드 서열로 이루어진 제1프로브를 추가적으로 포함하는 것을 특징으로 하는 키트.
4. The kit of claim 3, wherein the kit further comprises a first probe comprising an oligonucleotide sequence comprising 10-100 sequences of the nucleotide sequences of SEQ ID NO: 2 or an oligonucleotide sequence complementary thereto. Kit characterized in that.
제 1 항 내지 제 4 항에 있어서, 상기 키트는 (a) 서열목록 제3서열의 뉴클레오타이드 서열 중 10-100개 서열 또는 이에 상보적인 올리고뉴클레오타이드 서열 중 10-100개 서열을 포함하는 올리고뉴클레오타이드 서열로 이루어진 정방향 프라이머 및 역방향 프라이머로 구성된 제2프라이머 세트; (b) 서열목록 제4서열의 뉴클레오타이드 서열 중 10-100개 서열 또는 이에 상보적인 올리고뉴클레오타이드 서열 중 10-100개 서열을 포함하는 올리고뉴클레오타이드 서열로 이루어진 정방향 프라이머 및 역방향 프라이머로 구성된 제3프라이머 세트; 및 (c) 서열목록 제5서열의 뉴클레오타이드 서열 중 10-100개 서열 또는 이에 상보적인 올리고뉴클레오타이드 서열 중 10-100개 서열을 포함하는 올리고뉴클레오타이드 서열로 이루어진 정방향 프라이머 및 역방향 프라이머로 구성된 제4프라이머 세트를 추가적으로 포함하는 것을 특징으로 하는 키트.
The kit according to claim 1, wherein the kit comprises (a) an oligonucleotide sequence comprising 10-100 sequences of the nucleotide sequences of SEQ ID NO: 3 or an oligonucleotide sequence complementary thereto. A second primer set consisting of a forward primer and a reverse primer; (b) a third primer set consisting of a forward primer and a reverse primer consisting of an oligonucleotide sequence comprising 10-100 sequences of the nucleotide sequence of SEQ ID NO: 4 or an oligonucleotide sequence complementary thereto; And (c) a fourth primer set consisting of a forward primer and a reverse primer consisting of an oligonucleotide sequence comprising 10-100 sequences of the nucleotide sequences of SEQ ID NO: 5 or 10-100 sequences of oligonucleotide sequences complementary thereto Kit characterized in that it further comprises.
제 5 항에 있어서, 상기 키트는 (a) 서열목록 제3서열의 뉴클레오타이드 서열 중 10-100개 서열 또는 이에 상보적인 올리고뉴클레오타이드 서열 중 10-100개 서열을 포함하는 올리고뉴클레오타이드 서열로 이루어진 제2프로브; (b) 서열목록 제4서열의 뉴클레오타이드 서열 중 10-100개 서열 또는 이에 상보적인 올리고뉴클레오타이드 서열 중 10-100개 서열을 포함하는 올리고뉴클레오타이드 서열로 이루어진 제3프로브; 및 (c) 서열목록 제5서열의 뉴클레오타이드 서열 중 10-100개 서열 또는 이에 상보적인 올리고뉴클레오타이드 서열 중 10-100개 서열을 포함하는 올리고뉴클레오타이드 서열로 이루어진 제4프로브를 추가적으로 포함하는 것을 특징으로 하는 키트.
The second probe of claim 5, wherein the kit comprises (a) an oligonucleotide sequence comprising 10-100 sequences of the nucleotide sequences of SEQ ID NO: 3 or an oligonucleotide sequence complementary thereto. ; (b) a third probe consisting of an oligonucleotide sequence comprising 10-100 sequences of the nucleotide sequences of SEQ ID NO: 4 or an oligonucleotide sequence complementary thereto; And (c) a fourth probe consisting of an oligonucleotide sequence comprising 10-100 sequences of the nucleotide sequences of SEQ ID NO: 5 or 10-100 sequences of oligonucleotide sequences complementary thereto. Kit.
서열목록 제2서열의 뉴클레오타이드 서열 중 10-100개 서열 또는 이에 상보적인 올리고뉴클레오타이드 서열 중 10-100개 서열을 포함하는 올리고뉴클레오타이드 서열로 이루어진 프로브를 포함하는 MON863 검출용 마이크로어레이.
A MON863 detection microarray comprising a probe comprising an oligonucleotide sequence comprising 10-100 sequences of the nucleotide sequence of SEQ ID NO: 2 or an oligonucleotide sequence complementary thereto.
서열목록 제2서열의 뉴클레오타이드 서열 중 10-100개 서열 또는 이에 상보적인 올리고뉴클레오타이드 서열 중 10-100개 서열을 포함하는 올리고뉴클레오타이드 서열로 이루어진 제1프로브를 포함하는 MON863 검출용 멀티플렉스 마이크로어레이.
A multiplex microarray for detecting MON863 comprising a first probe consisting of an oligonucleotide sequence comprising 10-100 sequences of the nucleotide sequence of SEQ ID NO: 2 or an oligonucleotide sequence complementary thereto.
제 7 항 및 제 8 항에 있어서, 상기 마이크로어레이는 액상 비드 멀티플렉스 마이크로어레이인 것을 특징으로 하는 마이크로어레이.
The microarray of claim 7 or 8, wherein the microarray is a liquid bead multiplex microarray.
제 7 항 및 제 8 항에 있어서, 상기 마이크로어레이는 (a) 서열목록 제3서열의 뉴클레오타이드 서열 중 10-100개 서열 또는 이에 상보적인 올리고뉴클레오타이드 서열 중 10-100개 서열을 포함하는 올리고뉴클레오타이드 서열로 이루어진 제2프로브, (b) 서열목록 제4서열의 뉴클레오타이드 서열 중 10-100개 서열 또는 이에 상보적인 올리고뉴클레오타이드 서열 중 10-100개 서열을 포함하는 올리고뉴클레오타이드 서열로 이루어진 제3프로브, 및 (c) 서열목록 제5서열의 뉴클레오타이드 서열 중 10-100개 서열 또는 이에 상보적인 올리고뉴클레오타이드 서열 중 10-100개 서열을 포함하는 올리고뉴클레오타이드 서열로 이루어진 제4프로브를 포함하는 추가적으로 포함하는 것을 특징으로 하는 마이크로어레이.The oligonucleotide sequence of claim 7, wherein the microarray comprises (a) 10-100 sequences of the nucleotide sequences of SEQ ID NO: 3 or 10-100 sequences of the oligonucleotide sequences complementary thereto. A second probe consisting of (b) a third probe consisting of an oligonucleotide sequence comprising 10-100 sequences of the nucleotide sequences of SEQ ID NO: 4 or an oligonucleotide sequence complementary thereto, and ( c) an additional probe comprising a fourth probe consisting of an oligonucleotide sequence comprising 10-100 sequences of the nucleotide sequence of SEQ ID NO: 5 or an oligonucleotide sequence complementary thereto; Microarray.
KR1020120052021A 2012-05-16 2012-05-16 Kits for Detecting Genetically Modified Corn MON863 and MON810 KR101208732B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020120052021A KR101208732B1 (en) 2012-05-16 2012-05-16 Kits for Detecting Genetically Modified Corn MON863 and MON810

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020120052021A KR101208732B1 (en) 2012-05-16 2012-05-16 Kits for Detecting Genetically Modified Corn MON863 and MON810

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
KR1020100091732A Division KR101355918B1 (en) 2010-09-17 2010-09-17 Kits for Detecting Genetically Modified Corn MON863 and MON810

Publications (2)

Publication Number Publication Date
KR20120056249A true KR20120056249A (en) 2012-06-01
KR101208732B1 KR101208732B1 (en) 2012-12-07

Family

ID=46608475

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020120052021A KR101208732B1 (en) 2012-05-16 2012-05-16 Kits for Detecting Genetically Modified Corn MON863 and MON810

Country Status (1)

Country Link
KR (1) KR101208732B1 (en)

Also Published As

Publication number Publication date
KR101208732B1 (en) 2012-12-07

Similar Documents

Publication Publication Date Title
Marmiroli et al. Methods for detection of GMOs in food and feed
Webster et al. Diagnosis of plant viral pathogens
KR101378214B1 (en) Sample analysis method and assay kit for use in the method
CA2740917A1 (en) A method to identify disease resistant quantitative trait loci in soybean and compositions thereof
JP2006345855A (en) Method for identification and/or quantification of nucleotide sequence element specific to genetically modified plant on array
Von Götz See what you eat—broad GMO screening with microarrays
CA2619743C (en) Oligonucleotides, arrays thereof for detecting microorganisms, and an apparatus, a method and a kit for detecting microorganisms
CN108841990B (en) Detection kit and method for transgenic rape line
KR20140056432A (en) Kit for analysing exposure to abiotic stress in oryza sativa l. and method for analysing the same
KR101355918B1 (en) Kits for Detecting Genetically Modified Corn MON863 and MON810
KR101208732B1 (en) Kits for Detecting Genetically Modified Corn MON863 and MON810
Gürel et al. Recent molecular tools for detecting transgenic events in genetically modified (GM) crop products
CN101096709B (en) Method for detecting specific nucleotide sequence using visual film sensor chip
JP6880554B2 (en) Mold detection carrier, mold detection method, and mold detection kit
WO2017163546A1 (en) Genetically-modified crop detection method
RU2453605C2 (en) Differentiating and specific oligonucleotides for identification of dna sequences of transgene plants in foodstuff, method for identifying transgene products, biochip, combination of oligonucleotides (versions) and kit for implementing such method
WO2011092791A1 (en) Specific mould detection system, specific mould detection method, and pcr reaction liquid
JP5137443B2 (en) Probe set, probe fixing carrier, and genetic testing method
JP2022144656A (en) Rice plant with low amylose trait having sart-1 mutation
JP5121281B2 (en) Probe set, probe fixing carrier, and inspection method
JP5137441B2 (en) Probe set, probe fixing carrier, and inspection method
JP5137442B2 (en) Probe set, probe fixing carrier, and inspection method
CN103757128B (en) Paddy rice transgenic detection kit
JP5017947B2 (en) Identification method of multiple nucleotide polymorphisms
JP5089222B2 (en) Probe set, probe fixing carrier, and inspection method

Legal Events

Date Code Title Description
A107 Divisional application of patent
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20151002

Year of fee payment: 4

FPAY Annual fee payment

Payment date: 20160926

Year of fee payment: 5

FPAY Annual fee payment

Payment date: 20171026

Year of fee payment: 6

FPAY Annual fee payment

Payment date: 20181024

Year of fee payment: 7

FPAY Annual fee payment

Payment date: 20191014

Year of fee payment: 8