KR101188432B1 - Variant Microorganism Having Putrescine Producing Ability and Method for Preparing Putrescine Using the Same - Google Patents

Abstract

The present invention is a microorganism having a putrescine-producing metabolic pathway, a mutant microorganism having high putrescine high performance in which a gene involved in the degradation or use of putrescine is weakened or deleted and cultured under anaerobic conditions. The present invention relates to a method for producing putrescine in high yield. The mutant microorganism having high putrescine high performance according to the present invention is useful for producing putrescine which is widely used industrially in high yield.

Putrescine, mutation, microorganism, glucose

Description

Variant Microorganism Having Putrescine Producing Ability and Method for Preparing Putrescine Using the Same}

The present invention relates to a mutant microorganism having high putrescine performance and a method for producing putrescine using the same, and more specifically, a gene that is involved in the degradation or use of putrescine (putrescine) is weakened or deleted. The present invention relates to a mutant microorganism having high trecine high performance and a method for producing putrescine in high yield by culturing it under anaerobic conditions.

Putrescine (or 1,4 butanediamine) is an important raw material for the production of polyamides 4 and 6, including nylons 4 and 6, by acrylonitrile by the addition of hydrogen cyanide. Produced mainly on an industrial scale by hydrogenation of succinonitrile produced by Synthetic pathways for these chemicals require non-renewable petrochemical products as raw materials, and relatively high levels of expensive catalyst systems as well as multi-step, muti-reactor designs. Temperature and pressure are required. In addition, existing chemical synthesis pathways are not good for the environment because they are very toxic and flammable. Accordingly, there is a need to produce putrescine from renewable biomass-derived carbon sources as an alternative to the chemical production process.

Putrescine is a type of polyamine found in bacteria in a whole range of organisms, such as plants and animals. For example, putrescine plays an important role in cell proliferation and normal cell growth and is known to be an important substance in defense against oxidative stress (Tkachenko et al., Arch. Microbiol., 176: 155-157, 2001). ). Meanwhile, polyamine content in cells is finely controlled by biosynthesis, degradation, uptake and secretion (Igarashi and Kashiwagi et al. , J. Bacteriol. , 170 (7): 3131-3135, 1988). Putrescine concentration in E. coli has been known to be very high, about 2.8 g / l. Microorganisms also have potentially good resistance to high concentrations of polyamines. For example, Mimitsuka et al. Reported that Corynebacterium glutamicum can grow in the presence of cadaverine of more than 30 g / L. Therefore, research is continuously made to use microorganisms to produce industrially available high concentrations of polyamines (putrescine).

European Patent Publication (EP0726240A1) discloses a process for producing putrescine via fermentation using cheap industrial wastes or materials with proteins as a major member, but since the starting materials are very complex, it is possible to obtain putrescine and cadaverine production. There has been a problem that must go through many purification steps. In addition, European Patent Publication (EP1784496A1) discloses putrescine biochemical synthesis according to microbial growth in minimal salt medium with glucose added as a carbon source. This enhances the activity of ornithine decarboxylase by overexpressing speC or speF , a gene encoding ornithine decarboxylase, to enhance the transformation of ornithine to putrescine. I was. However, when putrescine content is increased with increasing ornithine decarboxylase activity, there is a problem of inhibiting putrescine biosynthesis and progressing the degradation inducing action of putrescine (Igarashi and Kashiwagi et al. , Biochem. J. , 347: 297-303, 2000).

Studies on putrescine degradation and utilization in microorganisms are as follows. Bowman et al. Reported that the speE gene product, spermidine synthase, promotes the biosynthesis of spermidine from putrescine in Escherichia coli (Bowman et al., J. Biol. Chem. , 248) . 2480-2486, 1973). Spermidine synthase (EC: 2.5.1.16) exists for the synthesis of spermidine in almost all cellular systems.

Haywood et al. Reported that yeast Candida boidinii acetylates putrescine to N- acetylputrescine by N- acetyltransferase. The spermidine acetyltransferase, a speG gene product in Escherichia coli, has a high homology with N- acetyltransferase in yeast and requires the possession of putrescine acetyltransferase (Haywood and Large, Eur. J. Biochem. , 148: 277-283, 1985). ).

Samsonova et al. Also described another putrescine degradation pathway in which putrescine is converted to γ-aminobutyric acid by the combined action of YgjG putrescine transaminase and YdcW dehydrogenase in γ-glutamylation (Samsonova et al., BMC Microbiol. , 3: 2, 2003; Samsonova et al., FEBS Lett. , 579: 4107-4112, 2005).

In addition, Kurihara et al., Dubbed the 'Puu pathway', clearly report that the putrescine degradation pathway is associated with γ-glutamylated metabolites in Escherichia coli. Γ-glutamylation of this pathway stabilizes the aldehyde intermediate γ-aminobutyraldehyde. γ-glutamylputrescine synthetase, a product of the puuA gene, promotes the first response of this pathway by transforming putrescine into γ-glutamyl-L-putrescine. The Puu catabolic pathway is also a major factor when E. coli grows in a medium containing putrescine as its sole nitrogen source. The putrescine importer, a product of the puuP gene, was also associated with the Puu catabolism pathway and the major putrescine importer (Kurihara et al., J. Biol. Chem ., 280: 4602-4608, 2005).

Therefore, the present inventors are directed to a gene encoding a spermidine synthase ( speE ), spermidine N-acetyltransferase, which is involved in the degradation or utilization pathway of putrescine in a microorganism producing putrescine. a gene encoding spermidine N-acetyltransferase ( speG ), a gene encoding ornithine carbamoyltransferase I ( argI ) and a gene encoding putrescine importer ( puuP ). As a result of preparing a mutant strain attenuated or deleted one or more selected from the group consisting of, and culturing it under anaerobic conditions, it was confirmed that putrescine can be produced in high yield and completed the present invention.

An object of the present invention is to provide a mutant microorganism having a weakened or deleted gene involved in the degradation or utilization pathway of putrescine, and having a high productivity of putrescine, and a method for producing the mutant microorganism.

Another object of the present invention is to provide a method for producing putrescine in high yield by culturing the mutant microorganisms under anaerobic conditions.

In order to achieve the above object, the present invention is a gene encoding the spermidine synthase ( speE ) involved in the degradation or use pathway of putrescine ( speE ), spermidine N-acetyltransferase (spermidine N Select from the group consisting of a gene encoding -acetyltransferase ( speG ), a gene encoding ornithine carbamoyltransferase I ( argI ), and a gene encoding putrescine importer ( puuP ). Provided is a mutant microorganism having a putrescine-producing ability, characterized in that at least one of which is weakened or deleted, and a method for producing the same.

The present invention also encodes a gene ( speE ), spermidine N-acetyltransferase, which encodes a spermidine synthase involved in the degradation or utilization pathway of putrescine. One or more selected from the group consisting of a gene ( speG ), a gene encoding ornithine carbamoyltransferase I ( argI ), and a gene encoding putrescine importer ( puuP ). Or deleted and gene encoding operon for arginine biosynthesis ( argECBH ), gene encoding acetylornithine amino transaminease ( argD ), and inducible ornithine decarboxylase and putrescine One or more genes selected from the group consisting of genes ( speF-potE ) encoding ornithine antiporters (putrescine / ornithine antiporter) It provides a mutant microorganism having a putrescine generating ability, characterized in that the promoter is substituted with a strong promoter and a method for producing the same.

The present invention also encodes a gene ( speE ), spermidine N-acetyltransferase, which encodes a spermidine synthase involved in the degradation or utilization pathway of putrescine. One or more selected from the group consisting of a gene ( speG ), a gene encoding ornithine carbamoyltransferase I ( argI ), and a gene encoding putrescine importer ( puuP ). Or deleted, a gene encoding operon for arginine biosynthesis ( argECBH ), a gene encoding acetylornithine amino transaminease ( argD ), and an inducible ornithine decarboxylase and putrescine / ornithine anti porter (putrescine / ornithine antiporter) at least one oil selected from the group consisting of a gene (speF-potE) encoding Promoter and substituted with a strong promoter, ornithine decarboxylase mutant having a putrescine producing ability, wherein the gene (speC) encoding the (ornithine decarboxylase) is introduced or amplified to provide a microorganism and a method .

The present invention also provides a method for producing putrescine, which comprises culturing the mutant microorganism to produce putrescine and recovering putrescine from the culture.

The present invention is useful for producing a high yield of putrescine, which is widely used in industry, by preparing a mutant microorganism having a putrescine-producing ability and using the same.

In the present invention, the term "attenuation" refers to a concept encompassing a mutation, substitution or deletion of some bases of a gene or introduction of some bases to reduce the activity of an enzyme expressed by the gene of interest. It includes everything that blocks some or much of the biosynthetic pathway.

In the present invention, the term 'deletion' is a concept encompassing a part or whole base of the gene, mutating, substituting or deleting, or introducing some base so that the gene is not expressed or does not exhibit enzymatic activity even when expressed. It includes everything that blocks the biosynthetic pathways involved in the enzymes of the gene.

In the present invention, "amplification" means that some bases of the gene are mutated, substituted or deleted, introduced into some bases, or introduced into a gene from another microorganism encoding the same enzyme to increase the activity of the corresponding enzyme. It is a concept that encompasses letting.

1 is a schematic diagram showing a synthetic route of putrescine from glucose. As shown in Figure 1, in the present invention, microorganisms having putrescine- producing ability , if attenuated or deleted genes ( speE, speG, argI, puuP ) involved in the degradation or utilization pathway of putrescine (putrescine) It was intended to confirm that tresine can be produced in high yield. The reduced activity of genes ( speE, speG, argI, puuP ) involved in the degradation or utilization pathway of putrescine was confirmed by reduced transcriptional and translational efficiency compared to the respective wild-type levels.

In one embodiment of the present invention, a gene encoding spermidine synthase ( speE ), spermidine N-acetyltransferase involved in the degradation or use pathway of putrescine One selected from the group consisting of a gene coding for ( speG ), a gene coding for ornithine carbamoyltransferase I ( argI ) and a gene coding for putrescine importer ( puuP ). It was confirmed that the mutant microorganism having the above deletion was prepared, and the putrescine-producing ability of the prepared mutant microorganism was improved.

Therefore, in one aspect, the present invention provides a gene encoding a spermidine synthase ( speE ), a spermidine N-acetyltransferase (spermidine N-), which is involved in the degradation or utilization pathway of putrescine. selected from the group consisting of a gene encoding acetyltransferase ( speG ), a gene encoding ornithine carbamoyltransferase I ( argI ) and a gene encoding putrescine importer ( puuP ). It relates to a mutant microorganism having a putrescine producing ability, characterized in that at least one is weakened or deleted and a method for producing the same.

In the present invention, the mutant microorganism is a gene encoding γ-glutamyl putrescine syntase ( puuA ), putrescine transamine involved in the degradation or utilization pathway of putrescine (putrescine) One or more selected from the group consisting of a gene encoding an oxidase (putrescine transaminase) ( ygjG ) and a gene encoding ornithine carbamoyltransferase F ( argF ) may be further weakened or deleted.

The gene encoding ornithine carbamoyltransferase F ( argF ) is an isoenzyme of the gene ( argI ) encoding ornithine carbamoyltransferase I, and the γ-glu The gene encoding pamil ( puuA ) is a neighboring gene of the gene encoding the putrescine importer ( puuP ), and putrescine transaminase Gene coding for ygjG is a gene involved in the degradation of putrescine.

In the present invention, the mutant microorganism may further be deleted the gene encoding lac operon repressor ( lacI ) so that the expression of the gene encoding the enzyme involved in putrescine biosynthesis is increased. Genes encoding the enzymes involved in putrescine biosynthesis may include gdhA, argA, argB, argC, argD, argE and the like.

In the present invention, the mutant microorganism may also be characterized in that the gene ( speC ) encoding ornithine decarboxylase is further introduced or amplified. The gene encoding the decarboxylase (ornithine decarboxylase) ( speC ) is characterized in that it is introduced in the form of an expression vector containing a strong promoter, the strong promoter is trc promoter, tac promoter, T7 promoter, lac promoter and trp It can be selected from the group consisting of promoters.

In the present invention, the microorganism may be used as long as it is a microorganism that produces putrescine from glucose, Bacillus sp. ( Bacillus sp.), Corynebacterium sp. ( Coynebacterium sp.), Escherichia sp. , Pichia sp., Pseudomonas sp., Saccharomyces sp.

In the present invention, also, putrescine in the mutant microorganism in a gene involved in God degradation or utilization pathway is deleted, the gene encoding an operon for arginine biosynthesis (argECBH), a gene encoding acetyl ornithine amino trans amine dehydratase (argD ) And genes selected from the group consisting of inducible ornithine decarboxylase and putrescine / ornithine antiporter ( speF-potE ). The substitution of the promoter was intended to confirm that putrescine can be produced in higher yield.

In one embodiment, putrescine with a gene (lacI) encoding a gene (speE, speG, argI, puuP ) and lac operon repressor involved in decomposition or the Flow deletion mutant microorganism of new (putrescine) of the present invention, arginine Mutant microorganism (XQ33) by replacing the promoter of argECBH encoding gene for biosynthesis with strong promoter trc, argECBH and inducible ornithine decarboxylase and putrescine / ornithine anti Of the mutant microorganism (XQ37), argECBH , speF-potE and the gene encoding acetylornithine amino transaminease ( argD ), in which the trc-substituted promoter of the gene ( speF-potE ) encoding a porter (putrescine / ornithine antiporter) which mutant microorganism (XQ39) replacing the promoter and the trc argECBH, speF-potE, argD, and ornithine decarboxylase (ornithine decarboxylase) the promoter of the gene (speC) encoding the trc Preparing a mutant microorganism in which substituted (XQ43) and putrescine producing ability of these mutant microorganism is confirmed to be increased sharply.

Accordingly, the present invention provides, in another aspect, a gene encoding the spermidine synthase involved in the degradation or utilization pathway of putrescine, spEE, spermidine N-acetyltransferase, and spermidine N. Select from the group consisting of a gene encoding -acetyltransferase ( speG ), a gene encoding ornithine carbamoyltransferase I ( argI ), and a gene encoding putrescine importer ( puuP ). At least one of which is attenuated or deleted, the gene encoding the operon for arginine biosynthesis ( argECBH ), the gene encoding acetylornithine amino transaminease ( argD ) and the inducible ornithine decarboxylase ) and and is selected from putrescine / ornithine group consisting of a gene (speF-potE) encoding an anti-porter (putrescine / ornithine antiporter) The above gene promoter relates to mutant microorganisms and a method having the putrescine producing ability, characterized in that substituted a strong promoter.

In the present invention, the gene encoding the operon for arginine biosynthesis ( argECBH ) is a co-regulatory operon, which includes two convergent promoters, argEp and argCBHp , on the side and an operator inside. Both promoters are inhibited by arginine (Charlier and Glansdorff, 2004). Thus, the substitution of the native promoter of the argECBH operon with a strong promoter can increase the metabolic flux to Ornithine. The argE is the gene encoding the N-acetylornithinase, argC is the gene encoding the N-acetylglutamylphosphate reductase, argB is a gene encoding N-acetylglutamate kinase, argH is a gene encoding a argininosuccinase.

In addition, genes coding for inducible ornithine decarboxylase and putrescine / ornithine antiporter ( speF-potE ) induced at low pH are inducible ornithine decarboxylase and putrescine / ornithine. Code an antiporter Therefore, when the native promoter of the speF-potE operon is replaced with a strong promoter, the speF-potE operon can be expressed at all times, thereby improving the production ability of putrescine.

In addition, the promoter of the gene ( argD ) encoding the acetylornithine amino transaminease is inhibited by arginine (Charlier and Glansdorff, 2004). Thus, replacing the native promoter of the argD operon with a strong promoter may increase the metabolic flux to Ornithine.

As described above, the mutant microorganism is a gene encoding γ-glutamylputrescine syntase ( puuA ), a gene encoding putrescine transaminase ( ygjG ), and One or more selected from the group consisting of ornithine carbamoyltransferase F encoding gene ( argF ) may be further weakened or deleted.

In addition, the mutant microorganism having the putrescine-producing ability may be further deleted by a gene encoding lac operon repressor ( lacI ) so that expression of a gene encoding an enzyme involved in putrescine biosynthesis is increased. have.

In the present invention, the gene ( speC ) encoding the ornithine decarboxylase is preferably introduced in the form of an expression vector containing a strong promoter.

In the present invention, the strong promoter associated with the substitution of the gene promoter and the introduction of a gene ( speC ) encoding ornithine decarboxylase is a trc promoter, tac promoter, T7 promoter, lac promoter and trp promoter It may be characterized in that it is selected from the group consisting of.

Thus, in the present invention, the most preferred examples are genes encoding spermidine synthase (speE), spermidine N-acetyltransferase (spermidine N) involved in the degradation or utilization pathway of putrescine. Select from the group consisting of a gene encoding -acetyltransferase ( speG ), a gene encoding ornithine carbamoyltransferase I ( argI ), and a gene encoding putrescine importer ( puuP ). At least one of which is attenuated or deleted, the gene encoding the operon for arginine biosynthesis ( argECBH ), the gene encoding acetylornithine amino transaminease ( argD ) and the inducible ornithine decarboxylase ) and putrescine / ornithine anti porter (from the group consisting of a gene (speF-potE) encoding putrescine / ornithine antiporter) At least one gene promoter is chosen that has been substituted with a strong promoter, ornithine decarboxylase be a mutant microorganism having putrescine producing ability, wherein the gene (speC) encoding the (ornithine decarboxylase) is introduced or amplified have.

In still another aspect, the present invention relates to a method for producing putrescine, which comprises culturing the mutant microorganism to produce putrescine and recovering putrescine from the culture solution.

In the present invention, the culturing of the mutant microorganism and the obtaining process of putrescine can be carried out using a culture method commonly known in the conventional fermentation process (batch culture, fed-batch culture) and separation and purification of putrescine.

In the present invention, biotechnological production of putrescine can be carried out intracellularly or extracellularly ( in vivo or in vitro ).

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are for further illustrating the present invention, and the scope of the present invention is not limited to these examples.

In particular, the following examples illustrate only Escherichia sp. Microorganisms, which are putrescine-producing microorganisms with specific vectors and host cells in order to remove the gene according to the present invention, but different types of vectors and putrescine are produced. The use of microorganisms will also be apparent to those skilled in the art.

Example 1: Preparation of Mutant Microorganisms Deleting Genes Involved in the Degradation or Utilization Path of Putrescine

In the present invention, deletion of genes on the chromosome ( puuA , puuP , ygjG, speE , speG , argF , argI ) was performed by double-crossover homologous recombination (Datsenko, KA, & Wanner, BL Proc. Natl. Acad. Sci., 97: 6640-6645, 2000). The lox71-chloramphenicol marker (Cm ^R ) -lox66 cassette was prepared by PCR using primers containing 50 nucleotides homologous to the upstream and downstream sequences of the target gene. pECmulox (Kim, JM, Lee, KH & Lee, SY, FEMS Microbiol. Lett ., 278: 78-85, 2008) comprising the lox71-Cm ^R- lox66 cassette was used as a template for PCR. The PCR products were transformed into electrocompetent cells containing λ recombinase. Colonies were Luria-Bertani (LB) agar (Sambrook, J., Fritsch EF, & Maniatis, T., Molecular cloning: a laboratory manual, 3rd edition, Cold Spring) containing chloroamphenicol (Cm; 34 μg / ml) Harbor Laboratory Press, 2000) plate. Successful gene replacement of Cm ^R was confirmed by direct colony PCR. The antibiotic marker was subsequently removed by a helper plasmid pJW168 containing a temperature-sensitive replication origin and IPTG-inducible cre recombinase (Palmeros et al. , Gene , 247 (1): 255-264, 2000).

1-1: Preparation of WL3110 Strain

PCR was performed using the primers of SEQ ID NOS: 1 and 2, and the plasmid pECmulox as a template to prepare a PCR product in which the lacI gene was deleted. Next, the purified PCR product was purified, and then electroporated to E. coli (W3110) containing λ recombinase to prepare WL3110 (W3110 Δ lacI ).

[SEQ ID NO 1]: 5'-GTGAAACCAGTAACGTTATACGATRTCGCAGAGTATGCCGGTGTCTCTTAGAT TGGCAGCATTACACGTCTTG-3 '

[SEQ ID NO 2]: 5'-TCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGCAC TTAACGGCTGACATGGG-3 '

1-2: Preparation of XQ08 Strain

PCR was performed using the primers of SEQ ID NOS: 3 and 4, pECmulox, a plasmid as a template, to prepare a PCR product lacking the speE gene. Next, the purified PCR product was purified, and then electroporated to the WL3110 strain prepared in 1-1 to prepare an XQ08 strain (W3110 Δ lacI Δ speE ).

[SEQ ID NO 3]: 5'-CGCCTGAATAATTTCGGTTGAGAGATGGCGTAAGGCGTCGTTATCTGTCG GACACTATAGAACGCGGCCG-3 '

[SEQ ID NO 4]: 5'-ATGTTGCGCCCTTTTTTTACGGGTGTTAACAAAGGAGGTATCAACCCATG CCGCATAGGCCACTAGTGGA-3 '

1-3: Preparation of XQ17 Strain

PCR was carried out using the plasmid pECmulox as a template, the primers of SEQ ID NOs: 5 and 6, to prepare a PCR product lacking the puuA gene. Next, the purified PCR product was purified, and then electroporated to the WL3110 strain prepared in 1-1 to prepare an XQ17 strain (W3110 Δ lacI Δ puuA ).

[SEQ ID NO 5]: 5'-GATGAAACAACCCCGCAAGGGGTATTACGCGTTTTTCAACATCCACTCAAGAC ACTATAGAACGCGGCCG-3 '

[SEQ ID NO: 6]: 5'-CGAGCGGAAAACAAACCAAAGGCGAAGAATCATGGAAACCAATATCGTTGCCGC ATAGGCCACTAGTGGA-3 '

1-4: Preparation of XQ22 Strain

PCR was carried out using the plasmid pECmulox as a template, the primers of SEQ ID NOs: 6 and 7, to prepare a PCR product lacking the puuP gene. Next, the purified PCR product was purified and then electroporated to the XQ17 strain (W3110 Δ lacI Δ puuA ) prepared in 1-3 to prepare an XQ22 strain (W3110 Δ lacI Δ puuP Δ puuA ).

[SEQ ID NO: 6]: 5'-CGAGCGGAAAACAAACCAAAGGCGAAGAATCATGGAAACCAATATCGTTGCCGC ATAGGCCACTAGTGGA-3 '

[SEQ ID NO: 7]: 5'-TCACCATCATACAACGGCACTTTGCGATAGCGGCGGATCAGATACCATAAGAC ACTATAGAACGCGGCCG-3 '

1-5: Preparation of XQ23 Strain

PCR was performed using the plasmid pECmulox as a template and primers of SEQ ID NOs: 8 and 9 to prepare a PCR product from which the speE gene was deleted. Next, the purified PCR product was purified and then electroporated to the WL3110 strain prepared in 1-1 to prepare an XQ23-1 strain (W3110 Δ lacI Δ speE ).

[SEQ ID NO: 8]: 5'-CGCCTGAATAATTTCGGTTGAGAGATGGCGTAAGGCGTCGTTATCTGTCG GACACTATAGAACGCGGCCG-3 '

[SEQ ID NO 9]: 5'-ATGTTGCGCCCTTTTTTTACGGGTGTTAACAAAGGAGGTATCAACCCATG CCGCATAGGCCACTAGTGGA-3 '

PCR was carried out using the plasmid pECmulox as a template, the primers of SEQ ID NOs: 10 and 11, to prepare a PCR product from which the speG gene was deleted. Next, the purified PCR product was purified, and then electroporated to the previously prepared XQ23-1 strain (W3110 Δ lacI Δ speE ) to prepare the XQ23-2 strain (W3110 Δ lacI Δ speE Δ speG ).

[SEQ ID NO 10]: 5'-GAATGTAAGGACACGTTATGCCAAGCGCCCACAGTGTTAAGCTACGCCCG GACACTATAGAACGCGGCCG-3 '

[SEQ ID NO 11]: 5'-CTATTGTGCGGTCGGCTTCAGGAGAGTCTGACCCGGTGTTTTGTGCTCTG CCGCATAGGCCACTAGTGGA-3 '

PCR was performed using the plasmid pECmulox as a template, the primers of SEQ ID NOs: 12 and 13, to prepare a PCR product that lacked the argI gene.

[SEQ ID NO 12]: 5'-TAATGTGATGCCGGGATGGTTTGTATTTCCCGGCATCTTTATAGCGATA GGACACTATAGAACGCGGCCG-3 '

[SEQ ID NO 13]: 5'-CCATATAAATTGAATTTTAATTCATTGAGGCGTTAGCCACAGGAGGGAT CCCGCATAGGCCACTAGTGGA-3 '

Next, the purified PCR product was purified and then used as a template, and PCR was performed using the primers of SEQ ID NOs: 14 and 15. After purification of the prepared PCR product, the XQ23 strain (W3110 Δ lacI Δ speE Δ speG Δ argI ) was prepared by electroporation to the previously prepared XQ23-2 strain (W3110 Δ lacI Δ speE Δ speG ).

[SEQ ID NO 14]: 5'-ATAGCAATAGAACACTTTGGGTGGAAGAATAGACCTATCACTGCATAAA ATAATGTGATGCCGGGATGGTT-3 '

[SEQ ID NO: 15]: 5'-CCACCTTTGTGACAAAGATTTATGCTTTAGACTTGCAAATGAATAATCAT CCATATAAATTGAATTTTAA-3 '

1-6: Preparation of XQ26 Strain

The PCR product deleted from puuA gene prepared in 1-3 and the PCR product deleted from puuP gene prepared in 1-4 above were sequentially electroporated to XQ23 strain (W3110 Δ lacI Δ speE Δ speG Δ argI ) to XQ26 strain. (W3110 Δ lacI Δ speE Δ speG Δ argI Δ puuP Δ puuA ) were prepared.

1-7: Preparation of XQ27 Strain

PCR was carried out using the plasmid pECmulox as a template, the primers of SEQ ID NOs: 16 and 17, to prepare a PCR product that lacked the ygjG gene.

[SEQ ID NO 16]: 5'-CTGCAATACTTAAATCGGTATCATGTGATACGCGAGCCTCCGGAGCATATGA CACTATAGAACGCGGCCG-3 '

[SEQ ID NO: 17]: 5'-CGTCGTATCGCCATCCGATTTGATATTACGCTTCTTCGACACTTACTCGCCC GCATAGGCCACTAGTGGA-3 '

After purifying the PCR product by electroporation with the XQ23-2 strain (W3110 lacI Δ Δ Δ speE speG) prepared in Preparation 1-5 and the XQ27-1 strain (W3110 Δ lacI speE Δ Δ Δ speG ygjG) In addition, the PCR products deleted from the puuA gene prepared in 1-3 and the PCR products deleted from the puuP gene prepared in 1-4 were sequentially electroporated to obtain an XQ27 strain (W3110 Δ lacI Δ speE Δ speG Δ ygjG Δ puuP Δ puuA ) was prepared.

1-8: Preparation of XQ29 Strain

The PCR product from which the ygjG gene prepared in 1-7 was deleted was electroporated to the XQ26 strain (W3110 Δ lacI Δ speE Δ speG Δ argI Δ puuP Δ puuA ) prepared in 1-6, and the XQ29 strain (W3110 Δ lacI Δ speE Δ speG Δ ygjG Δ argI Δ puuP Δ puuA ) were prepared.

Example 2: Promoter Substitution

In order to improve the production ability of putrescine, the promoter of the mutant strain (XQ26) prepared in Example 1 was replaced with trc, a strong promoter.

2-1: Preparation of XQ33 Strain

The exchange of the argECBH operon to the trc promoter for the native promoter was performed according to the following.

The fused lox71-chloroamphenicol antibiotic marker-lox66 DNA fragment was obtained by first PCR using pECmulox as a template and SEQ ID NOs: 18 and 19 as primers.

[SEQ ID NO: 18]: 5'-TATCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTGTCAA CAGCTGACACTATAGAACGCGGCCG-3 '

[SEQ ID NO 19]: 5'-TATCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTGTCAA CAGCTCCGCATAGGCCACTAGTGGA-3 '

In order to introduce the trc promoter, the first PCR product was used as a template and a second PCR reaction was performed using the primers of SEQ ID NOs: 20 and 21.

[SEQ ID NO: 20]: 5'-CGCTGGCACCCACAATCAGCGTATTCAACATGGTCTGTTTCCTGTGTGAA ATTGTTATCCGCTCACAATTCCACA-3 '

[SEQ ID NO 21]: 5'-TCTCGATAAATGGCGGTAATTTGTTTTTCATGGTCTGTTTCCTGTGTGA AATTGTTATCCGCTCACAATTCCACA-3 '

In order to introduce a homologous site into the final PCR product, a second PCR product was used as a template, and a third PCR reaction was performed using primers of SEQ ID NOs: 22 and 23.

[SEQ ID NO 22]: 5'-ATGTTCATATGCGGATGGCGATTTACATAGGTCACTAGCTCTGCGCCAGC GTAGCCGCTGGCACCCACAATCAGC-3 '

[SEQ ID NO 23]: 5'-TCGAGTGCCTCTTCCGTGGCGCTTATTGAAGGTGTGGCAATCAGAGCGCG GTAAATCTCGATAAATGGCGGTAAT-3 '

The final PCR product was electroporated to the XQ26 strain (W3110 Δ lacI Δ speE Δ speG Δ argI Δ puuP Δ puuA ) prepared in 1-6 to produce a recombinant microorganism, which was then agar containing chloroamphenicol. (Agar) Only cells undergoing double homologous recombination while incubated in solid medium were screened to prepare XQ33 strain (W3110 Δ lacI Δ speE Δ speG Δ argI Δ puuP Δ puuA P argEC BH :: P trc ). . Next, the exchange of the prepared strain to the trc promoter was confirmed by DNA sequence analysis.

2-2: Preparation of XQ37 Strain

The exchange of the speF-potE operon to the trc promoter for the native promoter was performed in the following manner.

The first PCR reaction was carried out using pECmulox, a plasmid as the template, SEQ ID NO: 19 above and SEQ ID NO: 24 below.

[SEQ ID NO: 24]: 5'-ACTAAGGGCACTTCAGCGTACAGGTCTTCCTGACTCTCTGTAGACACTATA GAACGCGGCCG-3 '

The second PCR reaction was carried out using the first PCR product as a template and the primers of SEQ ID NOs: 25 and 26.

[SEQ ID NO 25]: 5'-AGCTTCGACTTTCACTTCTTCAATGCCCGTTAGTCTACCGACTAAGGGCAC TTCAGCGTA-3 '

[SEQ ID NO 26]: 5'-AATCACTAACCGCAATTTTTAATTTTGACATGGTCTGTTTCCTGTGTGAAA TTGTTATCCGCTCACAATTCCACA-3 '

The third PCR reaction is based on the second PCR product. It was performed using the primers of SEQ ID NOs: 27 and 28.

[SEQ ID NO 27]: 5'-AAGGCGGACAACTCATATTATGAAGTTTGCTCATCGCAATAGCTTCGACTTT CACTTCTT-3 '

[SEQ ID NO 28]: 5'-CGACTTTCATTAATGTAGATACATTCTCGCTGCGTGGTAAAACAGTCCGGGC AAGAATCACTAACCGCAATTTTTAA-3 '

The final PCR product was electroporated to the XQ33 strain (W3110 Δ lacI Δ speE Δ speG Δ argI Δ puuP Δ puuA P argECBH :: P trc ) prepared in 2-1 to prepare a recombinant microorganism, and then chloroamphenicol ( Incubated in agar solid medium containing chloroamphenicol, screening only cells that have undergone double homologous recombination and screening XQ37 strain (W3110 Δ lacI Δ speE Δ speG Δ argI Δ puuP Δ puuA P argEC BH :: P trc P speF-potE :: P trc ) was prepared. Promoter exchange to the trc promoter was confirmed by DNA sequence analysis.

2-3: Preparation of XQ39 Strain

The exchange of the argD operon with the trc promoter for the native promoter was performed according to the following method.

The first PCR reaction was carried out using pECmulox as a template and primers of SEQ ID NO: 19 and SEQ ID NO: 29 below.

[SEQ ID NO 29]: 5'-CAACTGCTGGCTAATTTCCTGCATCGCTGATTTCTGATTGGACACTATAGAA CGCGGCCG-3

The second PCR reaction was carried out using the first PCR product as a template and the primers of SEQ ID NOs: 30 and 31.

[SEQ ID NO 30]: 5'- GCAGTTCCATCCAGAAAGTATTCTTAGCGAACAAGGACATCAACTGCTGG CTAATTTCCT-3 '

[SEQ ID NO 31]: 5'- CGCGTGTAATTGCTGTTTGTTCAATTGCCATGGTCTGTTTCCTGTGTGAAA TTGTTATCCGCTCACAATTCCACA-3 '

The third PCR reaction was carried out using the first PCR product as a template and the primers of SEQ ID NOs: 32 and 33.

[SEQ ID NO 32]: 5'- TTATGGGGATTCGCCATCGCCAGTGGGATCTGGAAGGTGTGCAGTTCCATC CAGAAAGTA-3 '

[SEQ ID NO: 33]: 5'- CGGAGCATAAATCGGCAGGATCACTTCATCGAAAGTCGCGCGTGTAATTGC TGTTTGT-3 '

The final PCR product was electroporated to the XQ37 strain (W3110 Δ lacI Δ speE Δ speG Δ argI Δ puuP Δ puuA P argECBH :: P trc P speF-potE :: P trc ) prepared in 2-2 above. lacI Δ speE Δ speG Δ argI Δ puuP Δ puuA P argECBH :: P trc P speF-potE :: P trc P argD :: P trc ). Next, the prepared strains were screened only in cells subjected to double homologous recombination while culturing in agar solid medium containing chloroamphenicol. Promoter exchange to the trc promoter was confirmed by DNA sequence analysis.

2-4: Preparation of XQ43 Strain

The exchange of the speC gene to the trc promoter for the wild type promoter was performed according to the following method. The first PCR reaction was carried out using pECmulox as a template and primers of SEQ ID NO: 19 and SEQ ID NO: 36.

[SEQ ID NO 36]: 5'-TTTGCCCGATGCACGCCATCTCCTTACATTCTCTCGCTTATCGCCGTTTCGAC ACTATAGAACGCGGCCG-3 '

The second PCR reaction was carried out using the first PCR product as a template and the primers of SEQ ID NOs: 37 and 38.

[SEQ ID NO: 37]: 5'-TGCCATGATTGCGCGAATTTTCTCCTCTCTGTACGGAGTTTGCCCGATGCAC GCCAT-3 '

[SEQ ID NO: 38]: 5'-TACTGGCGGCAATATTCATTGATTTCATGGTCTGTTTCCTGTGTGAAATTG TTATCCGCTCACAATTCCACACAT-3 '

The third PCR reaction was carried out using the second PCR product as a template and using the primers of SEQ ID NOs: 39 and 40.

[SEQ ID NO: 39]: 5'-GATGGCTTGTTTGTTCGCAAAGTCCTGGCTTGCACGCTTTAGCGAAAGGTGC CATGATTGCGCGAATTT-3 '

[SEQ ID NO 40]: 5'-ATCTCCCAACGCCACCACGCGACGATGAGAAGAAAGTCGGGATACCAGTTC ACTACTGGCGGCAATATTCATTGA-3 '

The final PCR product is the XQ39 strain prepared in the above 2-3 (W3110 lacI Δ Δ Δ speE speG argI Δ Δ Δ puuP puuA argECBH :: P P P trc speF-potE P trc :: P :: P trc argD) electroporation To produce recombinant microorganisms, and then cultured in agar (agar) solid medium containing chloroamphenicol while screening only cells undergoing double homologous recombination, and then XX43 strain (W3110 Δ lacI Δ). speE Δ speG Δ argI Δ puuP Δ puuA P argECBH :: P trc P speF-potE :: P trc P argD :: P trc P speC :: Ptrc ). Promoter exchange to the trc promoter was confirmed by DNA sequence analysis.

Example 3: Preparation of Putrescine Using Mutant Microorganisms

The variant strains ( E. coli K12 WL3110 variants) of Table 1 prepared in Examples 1 and 2 were 4g / L (NH ₄ ) ₂ HPO ₄ , 13.5g / L KH ₂ PO ₄ , 1.7g / L citric acid, 0.7 g / L MgSO _4? The flask was cultured in a minimum R medium (Lee, SY, & Chang, HN, Biotechnol. Lett., 15: 971-974, 1993) consisting of 7H ₂ O, 0.5% (v / v) trace metal solution. Trace metal solution contains 5 M HCl: 10 g FeSO _4? 7H ₂ O, 2.25 g ZnSO _4? 7H ₂ O, 1g CuSO _4? 5H ₂ O, 0.5 g MnSO _4? 5H ₂ O, 0.23 g Na ₂ B ₄ O _7? 10H ₂ O, 2g CaCl _2? 2H ₂ O, and 0.1 g (NH ₄ ) ₆ Mo ₇ O ₂₄ . Glucose (100 g / l) stock solution was sterilized separately and added to the sterilized medium to a final concentration of 10 g / l.

100 μL cell cultures activated in LB medium were inoculated with a preliminary minimal medium and then incubated at 30 ° C. and 220 rpm for 24 hours until the maximum OD ₆₀₀ reached 5. Then, 1 ml of these was added to a 350-mL baffled flask containing 50 mL of the same medium, and then incubated at 30 ° C. and 220 rpm for 15 hours. After separating the cells using centrifugation, the dissociated supernatants were analyzed by HPLC. The amines contained in the supernatant were detected as ophthaldialdehyde (OPA) derivatives on Hewlett-Packard 1100 series equipment (230 nm region). This instrument uses a C18-reverse phase column equilibrated to buffer A (buffer A, 45% 0.1 M sodium acetate pH 7.2 / Methanol buffer B methanol). The assay was performed using the following conditions (1-6 min 100% A equilibration, 6-10 min linear gradient from 0 to 30% buffer B, 10-15 min 30% to 50% buffer B, 15-19 min 50% to 100% buffer B, 19 -23min 100% buffer B and 23-25 min from 100% to 30% buffer B, 25-28min from 30% B to 100% A with a flow rate of 0.8 ml / min). At this time, a standard material was used for calibration, and the measured concentration of putrescine is shown in Table 1 below.

 [Table 1]

Strain Genotype Putrescine concentration (mg / L) WL3110 W3110 Δ lacI 0 XQ08 W3110 Δ lacI Δ speE 0.65 XQ17 W3110 Δ lacI Δ puuA 0 XQ22 W3110 Δ lacI Δ puuP Δ puuA 0.6 XQ23 W3110 Δ lacI Δ speE Δ speG Δ argI 1.8 XQ26 W3110 Δ lacI Δ speE Δ speG Δ argI Δ puuP Δ puuA 8.5 XQ27 W3110 Δ lacI Δ speE Δ speG Δ ygjG Δ puuP Δ puuA 4.2 XQ29 W3110 Δ lacI Δ speE Δ speG Δ ygjG Δ argI Δ puuP Δ puuA 8.5 XQ33 W3110 Δ lacI Δ speE Δ speG Δ argI Δ puuP Δ puuA PargECBH :: Ptrc 28.3 XQ37 W3110 Δ lacI Δ speE Δ speG Δ argI Δ puuP Δ puuA PargECBH :: Ptrc PspeF-potE :: Ptrc 510 XQ39 W3110 ΔlacI ΔspeE ΔspeG ΔargI Δ puuP Δ puuA P argECBH :: P trc PspeF-potE :: Ptrc PargD :: Ptrc 820 XQ43 W3110 ΔlacI ΔspeE ΔspeG ΔargI ΔpuuP ΔpuuA PargECBH :: Ptrc PspeF-potE :: Ptrc PargD :: Ptrc PspeC :: Ptrc 827

From Table 1 , mutant microorganisms in which genes involved in the degradation or utilization pathway of putrescine ( puuP, puuA, speE, speG, argI ) are deleted are produced according to the type and number of genes deleted. It was confirmed that this was increased. The gene encoding the operon for arginine biosynthesis of the mutant microorganism ( argECBH ), the gene encoding acetylornithine amino transaminease ( argD ), and the inducible ornithine decarboxylase and putrescine / When the gene encoding the ornithine antiporter (putecine / ornithine antiporter) ( speF-potE ) and the ornithine decarboxylase ( speC ) promoter were exchanged for a strong promoter, the production of putrescine was further increased. I could confirm it.

Example 4: Genes encoding ornithine decarboxylase ( speC Amplification

4-1: Plasmid pKKSpeC Preparation

Coding for speC of E. coli W3110 Ornithine decarboxylase was cloned into pKK223-3 (Pharmacia Biotech, Uppsala, Sweden) expression vector, which proceeds with strong gene expression of the tac promoter. E. coli W3110 by genomic DNA of (derived from E. coli K-12 , λ - -, F, prototrophic) as a template, by using the synthetic primer of SEQ ID NO: 34 and 35, perform the PCR, speC fragment (2156 bp) was prepared.

[SEQ ID NO 34]: 5'-CAGCGAATTCATGAAATCAATGAATATTGCC-3 '

[SEQ ID NO 35]: 5'-CATTCTGCAGTTACTTCAACACATAACCGTA-3 '

Next, the prepared speC fragment (2156bp) and the pKK223-3 plasmid were treated with restriction enzymes ( Eco RI and Pst I), and then treated with T4 DNA ligase to digest s peC fragment and pKK223-3 plasmid. By polymerization, a vector pKKSpeC, a high copy number recombinant plasmid, was prepared.

4-2: Preparation of Plasmid p15SpeC

Coding for speC of constitutive and biosynthetic E. coli W3110 Ornithine decarboxylase was cloned into pTac15K (p15A origin, low copies, Km ^R ; KAISTMBELstock) expression vector that promotes strong gene expression of the tac promoter. Doing the E. coli W3110 genomic DNA template of (derived from E. coli K-12, λ-, F-, prototrophic), by using the synthetic primer of SEQ ID NO: 34 and 35, by carrying out the PCR, speC Sections (2156 bp) were prepared.

Next, the prepared speC fragment (2156bp) and pTac15K plasmid were treated with restriction enzymes ( Eco RI and Pst I), and then treated with T4 DNA ligase to polymerize the s peC fragment and pTac15K plasmid digested with restriction enzyme. A vector p15SpeC, which is a copy number recombinant plasmid, was prepared.

4-3: Preparation of WL3110 / pKKSpeC Strain

The WL3110 / pKKSpeC strain was prepared by introducing the pKKSpeC vector prepared in 4-1 into the WL3110 strain prepared in Example 1-1. Next, the recombinant strains were selected while culturing the prepared strains in agar (agar) solid medium containing ampicillin (ampicillin).

4-4: Preparation of XQ17 / pKKSpeC Strain

The XQ17 / pKKSpeC strain was prepared by introducing the pKKSpeC vector prepared in 4-1 to the XQ17 strain prepared in Example 1-3. Next, the recombinant strains were selected while culturing the prepared strains in agar (agar) solid medium containing ampicillin (ampicillin).

4-5: Preparation of XQ22 / pKKSpeC Strain

The XQ22 / pKKSpeC strain was prepared by introducing the pKKSpeC vector prepared in 4-1 into the XQ22 strain prepared in Examples 1-4. Next, the recombinant strains were selected while culturing the prepared strains in agar (agar) solid medium containing ampicillin (ampicillin).

4-6: Preparation of XQ26 / pKKSpeC Strain

The XQ26 / pKKSpeC strain was prepared by introducing the pKKSpeC vector prepared in 4-1 into the XQ26 strain prepared in Example 1-6. Next, the recombinant strains were selected while culturing the prepared strains in agar (agar) solid medium containing ampicillin (ampicillin).

4-7: Preparation of XQ33 / pKKSpeC Strain

The XQ33 / pKKSpeC strain was prepared by introducing the pKKSpeC vector prepared in 4-1 into the XQ33 strain prepared in Example 2-1. Next, the recombinant strains were selected while culturing the prepared strains in agar (agar) solid medium containing ampicillin (ampicillin).

4-8: Preparation of XQ37 / pKKSpeC Strain

The XQ37 / pKKSpeC strain was prepared by introducing the pKKSpeC vector prepared in 4-1 into the XQ37 strain prepared in Example 2-2. Next, the recombinant strains were selected while culturing the prepared strains in agar (agar) solid medium containing ampicillin (ampicillin).

4-9: Preparation of XQ39 / pKKSpeC Strain

The XQ39 / pKKSpeC strain was prepared by introducing the pKKSpeC vector prepared in 4-1 to the XQ39 strain prepared in Example 2-3. Next, the recombinant strains were selected while culturing the prepared strains in agar (agar) solid medium containing ampicillin (ampicillin).

4-10: Preparation of XQ43 / p15SpeC Strain

The XQ43 / p15SpeC strain was prepared by introducing the p15SpeC vector prepared in 4-2 into the XQ43 strain prepared in Example 2-4. Next, the recombinant strains were selected while culturing the prepared strains in agar (agar) solid medium containing ampicillin (ampicillin).

Example 5: gene encoding ornithine decarboxylase ( speC Preparation of Putrescine Using Mutant Microorganism Amplified)

The variant strains prepared in Example 4 were cultured in shake flasks containing the same medium as in Example 3.

100 μL cell cultures activated in LB medium were inoculated with a preliminary minimal medium and then incubated at 30 ° C. and 220 rpm for 30 hours until the maximum OD ₆₀₀ became 5. Thereafter, 1 ml of these was added to a 350-mL baffled flask containing 50 mL of the same medium, and then incubated at 30 ° C. and 220 rpm for 27 hours. After separating the cells by centrifugation, the dissociated supernatants were analyzed by HPLC under the same conditions as in Example 3, and the results are shown in Table 2.

[Table 2]

Strain / plasmid Putrescine concentration (mg / L)  WL3110 / pKKSpeC 220 XQ17 / pKKSpeC 368 XQ22 / pKKSpeC 400 XQ26 / pKKSpeC 433 XQ33 / pKKSpeC 910 XQ37 / pKKSpeC 1100 XQ39 / pKKSpeC 1189 XQ43 / p15SpeC 1317

From Table 2, mutant microorganisms (WL3110 / pKKSpeC, XQ17 / pKKSpeC, XQ22 / pKKSpeC, XQ26 / pKKSpeC, XQ33 / pKKSpeC, XQ37) when co-expressed with ornithine decarboxylase speC have reduced putrescine degradation and utilization activity. / pKKSpeC, XQ39 / pKKSpeC and XQ43 / p15SpeC) show a significant increase in putrescine production compared to the mutant microorganisms of Table 1 (WL3110, XQ17, XQ22, XQ26, XQ33, XQ37, XQ39 and XQ43) without the introduction of pKKSpeC or p15SpeC. Could know.

Example 6: Preparation of Putrescine through Fed-Batch Culture of XQ37 / pKKSpeC Strains

The potential of reduced putrescine degradation and utilization activity was analyzed in fed-batch fermentation with increased ornithine decarboxylase activity. The fed-batch fermentation was carried out in a 6.6 liter fermenter (Bioflo 3000; New Brunswick Scientific Co., Edison, NJ) after adding 10 g / l glucose to 2 liters of R medium. 1 ml of the activated XQ37 / pKKSpeC culture in LB medium was added to a 350-mL baffled flask containing 50 mL of the same medium, followed by incubation at 30 ° C. and 220 rpm for 24 hours until OD ₆₀₀ became 5. 200 ml of the preliminary culture was then used to inoculate the fermentor. Dissolved oxygen was maintained at 20% saturated air by automatically increasing the stirring speed of 850 rpm. As glucose was depleted to 0.02 above the fixed pH 6.8 following depletion, the feed solution was automatically added to increase the glucose concentration to 3 g / l or more. The feed solution also contains 500 g / l of glucose and 200 g / L of (NH ₄ ) ₂ SO ₄ . Except for the short time of pH increase due to glucose depletion, the pH was maintained at 6.8 by adding 28% (v / v) ammonia solution in most cases. Samples were taken, the cells were separated using centrifugation, and the dissociated supernatants were analyzed by HPLC in the same manner as in Example 3. As shown in FIG. 2, XQ37 / pKKSpeC strain produced 14.3 g / l putrescine after 55.8 hours of inoculation, and the maximum putrescine productivity was 0.28 g L ⁻¹ h ⁻¹ after 47 hours of inoculation. It was.

Example 7: Preparation of Putrescine through Fed-Batch Culture of XQ39 Strain

A fed-batch fermentation was carried out in the same manner as in Example 6, except that the XQ39 strain was used instead of the XQ37 / pKKSpeC strain, and the fermentation broth was analyzed by HPLC. As shown in FIG. 3, the XQ39 strain produced 14.7 g / l putrescine 36 hours after inoculation, and the maximum putrescine productivity was 0.42 g L ⁻¹ h ⁻¹ after 31 hours of inoculation. .

Example 8: Preparation of Putrescine through Fed-Batch Culture of XQ43 Strain

The XQ43 strain prepared in Example 2 was prepared using 2 g / L (NH ₄ ) ₂ HPO ₄ , 6.75 g / L KH ₂ PO ₄ , 0.85 g / L citric acid, 0.7 g / L MgSO _4? 3 g / L of (in a minimum R / 2 medium consisting of 7H ₂ O, 0.5% (v / v) trace metal solution (Qian et al. , Biotechnol.and Bioeng, 101 (3): 587-601, 2008) The flask was cultured in 50 ml of medium added with NH ₄ ) ₂ SO ₄ .

Trace metal solution contains 5 M HCl: 10 g FeSO _4? 7H ₂ O, 2.25 g ZnSO _4? 7H ₂ O, 1g CuSO _4? 5H ₂ O, 0.5 g MnSO _4? 5H ₂ O, 0.23 g Na ₂ B ₄ O _7? 10H ₂ O, 2g CaCl _2? 2H ₂ O, and 0.1 g (NH ₄ ) ₆ Mo ₇ O ₂₄ . Glucose (100 g / l) stock solution was sterilized separately and added to the sterilized medium to a final concentration of 10 g / l. At this time, 1 ml of the activated XQ43 culture in the LB medium was added to a 350 mL baffled flask containing 50 mL of the above-described medium, and then incubated at 37 ° C. and 220 rpm for 24 hours until the OD ₆₀₀ reached 3.3. 200 ml of the preliminary culture was then used to inoculate the fermentor. Dissolved oxygen was maintained at 20% saturated air by automatically increasing the stirring speed of 1000 rpm.

The fed-batch fermentation of the XQ43 strain was performed in a 6.6 liter fermenter (Bioflo 3000; New Brunswick Scientific Co., Edison, NJ) after adding 10 g / l glucose to the same medium. When the glucose level was raised to 0.01 above the fixed pH 6.8, the feed solution was automatically added to increase the glucose concentration to 2 g / l or more. The feed solution also contains 522 g / l glucose and 8 g / L MgSO ₄ 170 g / L (NH ₄ ) ₂ SO ₄ . Except for the short time of pH increase due to glucose depletion, the pH was maintained at 6.8 by mostly adding 10 M KOH solution. Samples were taken, the cells were separated using centrifugation, and the dissociated supernatants were analyzed by HPLC in the same manner as in Example 3. As shown in FIG. 4, XQ43 strain produced 18.0 g / l putrescine 30 hours after inoculation, and the maximum putrescine productivity was 0.63 g L ⁻¹ h ⁻¹ after 28 hours of inoculation.

Example 9: Preparation of Putrescine by Fed-Batch Culture of XQ43 / p15SpeC Strains

A fed-batch fermentation was carried out in the same manner as in Example 8, except that the XQ43 / p15SpeC strain was used instead of the XQ43 strain, and the fermentation broth was analyzed by HPLC. As shown in FIG. 5, the XQ43 / p15SpeC strain produced 21.7 g / l putrescine 37 hours after inoculation, and the maximum putrescine productivity was 0.58 g L ⁻¹ h ⁻¹ 37 hours after inoculation. It was.

1 is a schematic diagram showing a synthetic route of putrescine from glucose.

2 is a graph showing the production of putrescine in fed-batch fermentation using glucose from XQ37 / pKKSpeC cells.

Figure 3 is a graph showing the production of putrescine in fed-batch fermentation using glucose from XQ39 cells.

4 is a graph showing the production of putrescine in fed-batch fermentation using glucose from XQ43 cells.

5 is a graph showing the production of putrescine in fed-batch fermentation using glucose from XQ43 / p15SpeC cells.

<110> Korea Advanced Institute of Science and Technology <120> Variant Microorganism Having Putrescine Producing Ability and          Method for Preparing Putrescine Using the Same <130> p09-b036 <150> KR10-2008-0033125 <151> 2008-04-10 <160> 40 <170> Kopatentin 1.71 <210> 1 <211> 73 <212> DNA <213> Artificial Sequence <220> <223> primer 1 <400> 1 gtgaaaccag taacgttata cgatrtcgca gagtatgccg gtgtctctta gattggcagc 60 attacacgtc ttg 73 <210> 2 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> primer 2 <400> 2 tcactgcccg ctttccagtc gggaaacctg tcgtgccagc tgcattaatg cacttaacgg 60 ctgacatggg 70 <210> 3 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> primer 3 <400> 3 cgcctgaata atttcggttg agagatggcg taaggcgtcg ttatctgtcg gacactatag 60 aacgcggccg 70 <210> 4 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> primer 4 <400> 4 atgttgcgcc ctttttttac gggtgttaac aaaggaggta tcaacccatg ccgcataggc 60 cactagtgga 70 <210> 5 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> primer 5 <400> 5 gatgaaacaa ccccgcaagg ggtattacgc gtttttcaac atccactcaa gacactatag 60 aacgcggccg 70 <210> 6 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> primer 6 <400> 6 cgagcggaaa acaaaccaaa ggcgaagaat catggaaacc aatatcgttg ccgcataggc 60 cactagtgga 70 <210> 7 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> primer 7 <400> 7 tcaccatcat acaacggcac tttgcgatag cggcggatca gataccataa gacactatag 60 aacgcggccg 70 <210> 8 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> primer 8 <400> 8 cgcctgaata atttcggttg agagatggcg taaggcgtcg ttatctgtcg gacactatag 60 aacgcggccg 70 <210> 9 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> primer 9 <400> 9 atgttgcgcc ctttttttac gggtgttaac aaaggaggta tcaacccatg ccgcataggc 60 cactagtgga 70 <210> 10 <211> 69 <212> DNA <213> Artificial Sequence <220> <223> primer 10 <400> 10 aatgtaagga cacgttatgc caagcgccca cagtgttaag ctacgcccgg acactataga 60 acgcggccg 69 <210> 11 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> primer 11 <400> 11 ctattgtgcg gtcggcttca ggagagtctg acccggtgtt ttgtgctctg ccgcataggc 60 cactagtgga 70 <210> 12 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> primer 12 <400> 12 taatgtgatg ccgggatggt ttgtatttcc cggcatcttt atagcgatag gacactatag 60 aacgcggccg 70 <210> 13 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> primer 13 <400> 13 ccatataaat tgaattttaa ttcattgagg cgttagccac aggagggatc ccgcataggc 60 cactagtgga 70 <210> 14 <211> 71 <212> DNA <213> Artificial Sequence <220> <223> primer 14 <400> 14 atagcaatag aacactttgg gtggaagaat agacctatca ctgcataaaa taatgtgatg 60 ccgggatggt t 71 <210> 15 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> primer 15 <400> 15 ccacctttgt gacaaagatt tatgctttag acttgcaaat gaataatcat ccatataaat 60 tgaattttaa 70 <210> 16 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> primer 16 <400> 16 ctgcaatact taaatcggta tcatgtgata cgcgagcctc cggagcatat gacactatag 60 aacgcggccg 70 <210> 17 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> primer 17 <400> 17 cgtcgtatcg ccatccgatt tgatattacg cttcttcgac acttactcgc ccgcataggc 60 cactagtgga 70 <210> 18 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> primer 18 <400> 18 tatccgctca caattccaca cattatacga gccggatgat taattgtcaa cagctgacac 60 tatagaacgc ggccg 75 <210> 19 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> primer 19 <400> 19 tatccgctca caattccaca cattatacga gccggatgat taattgtcaa cagctccgca 60 taggccacta gtgga 75 <210> 20 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> primer 20 <400> 20 cgctggcacc cacaatcagc gtattcaaca tggtctgttt cctgtgtgaa attgttatcc 60 gctcacaatt ccaca 75 <210> 21 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> primer 21 <400> 21 tctcgataaa tggcggtaat ttgtttttca tggtctgttt cctgtgtgaa attgttatcc 60 gctcacaatt ccaca 75 <210> 22 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> primer 22 <400> 22 atgttcatat gcggatggcg atttacatag gtcactagct ctgcgccagc gtagccgctg 60 gcacccacaa tcagc 75 <210> 23 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> primer 23 <400> 23 tcgagtgcct cttccgtggc gcttattgaa ggtgtggcaa tcagagcgcg gtaaatctcg 60 ataaatggcg gtaat 75 <210> 24 <211> 62 <212> DNA <213> Artificial Sequence <220> <223> primer 24 <400> 24 actaagggca cttcagcgta caggtcttcc tgactctctg tagacactat agaacgcggc 60 cg 62 <210> 25 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> primer 25 <400> 25 agcttcgact ttcacttctt caatgcccgt tagtctaccg actaagggca cttcagcgta 60                                                                           60 <210> 26 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> primer 26 <400> 26 aatcactaac cgcaattttt aattttgaca tggtctgttt cctgtgtgaa attgttatcc 60 gctcacaatt ccaca 75 <210> 27 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> primer 27 <400> 27 aaggcggaca actcatatta tgaagtttgc tcatcgcaat agcttcgact ttcacttctt 60                                                                           60 <210> 28 <211> 77 <212> DNA <213> Artificial Sequence <220> <223> primer 28 <400> 28 cgactttcat taatgtagat acattctcgc tgcgtggtaa aacagtccgg gcaagaatca 60 ctaaccgcaa tttttaa 77 <210> 29 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> primer 29 <400> 29 caactgctgg ctaatttcct gcatcgctga tttctgattg gacactatag aacgcggccg 60                                                                           60 <210> 30 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> primer 30 <400> 30 gcagttccat ccagaaagta ttcttagcga acaaggacat caactgctgg ctaatttcct 60                                                                           60 <210> 31 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> primer 31 <400> 31 cgcgtgtaat tgctgtttgt tcaattgcca tggtctgttt cctgtgtgaa attgttatcc 60 gctcacaatt ccaca 75 <210> 32 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> primer 32 <400> 32 ttatggggat tcgccatcgc cagtgggatc tggaaggtgt gcagttccat ccagaaagta 60                                                                           60 <210> 33 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> primer 33 <400> 33 cggagcataa atcggcagga tcacttcatc gaaagtcgcg cgtgtaattg ctgtttgt 58 <210> 34 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> primer 34 <400> 34 cagcgaattc atgaaatcaa tgaatattgc c 31 <210> 35 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> primer 35 <400> 35 cattctgcag ttacttcaac acataaccgt a 31 <210> 36 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> primer 36 <400> 36 tttgcccgat gcacgccatc tccttacatt ctctcgctta tcgccgtttc gacactatag 60 aacgcggccg 70 <210> 37 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> primer 37 <400> 37 tgccatgatt gcgcgaattt tctcctctct gtacggagtt tgcccgatgc acgccat 57 <210> 38 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> primer 38 <400> 38 tactggcggc aatattcatt gatttcatgg tctgtttcct gtgtgaaatt gttatccgct 60 cacaattcca cacat 75 <210> 39 <211> 69 <212> DNA <213> Artificial Sequence <220> <223> primer 39 <400> 39 gatggcttgt ttgttcgcaa agtcctggct tgcacgcttt agcgaaaggt gccatgattg 60 cgcgaattt 69 <210> 40 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> primer 40 <400> 40 atctcccaac gccaccacgc gacgatgaga agaaagtcgg gataccagtt cactactggc 60 ggcaatattc attga 75  

Claims (31)

A gene encoding spermidine synthase involved in the degradation or utilization pathway of putrescine ( speE ), a gene encoding spermidine N-acetyltransferase ( speG ) One or more selected from the group consisting of a gene encoding ornithine carbamoyltransferase I ( argI ) and a gene encoding putrescine importer ( puuP ), and γ- Gene encoding glutamylputrescine syntase (γ-glutamylputrescine syntase ( puuA ), gene encoding putrescine transaminase ( ygjG ) and ornithine carbamoyltransferase F) sides one or more selected from the group consisting of a gene (argF) encoding this with putrescine producing ability, characterized in that the deletion additionally Microorganisms. delete The method of claim 1, wherein the gene encoding lac operon repressor ( lacI ) is further deleted so that expression of a gene encoding an enzyme involved in putrescine biosynthesis is increased. microbe. The mutant microorganism having putrescine-producing ability according to claim 1, wherein a gene ( speC ) encoding ornithine decarboxylase is further introduced or amplified. The method of claim 4, wherein the gene encoding ornithine decarboxylase ( speC ) contains a strong promoter selected from the group consisting of trc promoter, tac promoter, T7 promoter, lac promoter and trp promoter. Mutant microorganism having a putrescine-producing ability, characterized in that introduced in the form of an expression vector. delete The method of claim 1, wherein the microorganisms are of the genus Bacillus sp., Corynebacterium sp., Escherichia sp., Pichia sp., Pseudomonas genus. Pseudomonas sp.) And Saccharomyces sp. Mutant microorganism having a putrescine-producing ability, characterized in that selected from the group consisting of. A gene encoding spermidine synthase involved in the degradation or utilization pathway of putrescine ( speE ), a gene encoding spermidine N-acetyltransferase ( speG ) One or more selected from the group consisting of a gene encoding ornithine carbamoyltransferase I ( argI ) and a gene encoding putrescine importer ( puuP ), and arginine biosynthesis Gene encoding argECBH operon ( argECBH ), gene encoding acetylornithine amino transaminease ( argD ), and inducible ornithine decarboxylase and putrescine / ornithine antiporter trc promote one or more gene promoters selected from the group consisting of the genes encoding the putrescine / ornithine antiporter ( speF-potE ) A mutant microorganism having putrescine-producing ability, characterized in that it is substituted with a strong promoter selected from the group consisting of r, tac promoter, T7 promoter, lac promoter and trp promoter. The method of claim 8, wherein the gene encoding γ-glutamylputrescine syntase ( puuA ), the gene encoding putrescine transaminase ( ygjG ) and ornithine carba A mutant microorganism having putrescine-producing ability, characterized in that at least one member selected from the group consisting of genes ( argF ) encoding ornithine carbamoyltransferase F is deleted. The method of claim 8, wherein the putrescine mutations that new biosynthetic enzyme is increased expression of the gene coding for which is involved in having the putrescine producing ability, characterized in that the gene (lacI) encoding a lac operon repressor is deleted in addition microbe. The mutant microorganism having a putrescine-producing ability according to claim 8, wherein a gene ( speC ) encoding ornithine decarboxylase is further introduced or amplified. The method of claim 11, wherein the gene for encoding ornithine decarboxylase ( speC ) contains a strong promoter selected from the group consisting of trc promoter, tac promoter, T7 promoter, lac promoter and trp promoter Mutant microorganism having a putrescine-producing ability, characterized in that introduced in the form of an expression vector. delete According to claim 8, wherein the microorganisms are genus Bacillus ( Gen. sp.), Corynebacterium sp. ( Coynebacterium sp.), Escherichia sp., Pichia sp., Pseudomonas genus ( Pseudomonas sp.) And Saccharomyces sp. Mutant microorganism having a putrescine-producing ability, characterized in that selected from the group consisting of. In microorganisms with putrescine-producing metabolic pathways, the genes encoding spermidine synthase ( speE ), spermidine N-acetyltransferase (spermidine) involved in the degradation or utilization pathway of putrescine In the group consisting of a gene encoding N-acetyltransferase ( speG ), a gene encoding ornithine carbamoyltransferase I ( argI ) and a gene encoding putrescine importer ( puuP ) Deletion of one or more selected, gene encoding γ-glutamylputrescine syntase ( puuA ), gene encoding putrescine transaminase ( ygjG ) and orni Further deletion of one or more selected from the group consisting of genes encoding ornithine carbamoyltransferase F ( argF ) Method for producing a mutant microorganism having a putrescine production ability. delete 16. The mutant microorganism having a putrescine-producing ability according to claim 15, further comprising a deletion of a gene encoding lac operon repressor ( lacI ) such that expression of a gene encoding an enzyme involved in putrescine biosynthesis is increased. Manufacturing method. The method according to claim 15, wherein the method for producing a mutant microorganism having putrescine-producing ability is further introduced or amplified by a gene ( epe ) encoding ornithine decarboxylase. 19. The method of claim 18, wherein the gene for encoding ornithine decarboxylase ( speC ) contains a strong promoter selected from the group consisting of trc promoter, tac promoter, T7 promoter, lac promoter and trp promoter Method for producing a mutant microorganism having a putrescine generating ability, characterized in that it is introduced in the form of an expression vector. delete 20. The method according to claim 19, wherein the expression vector is pKKSpeC or p15SpeC. The genus of claim 15, wherein the microorganism is of the genus Bacillus sp., Corynebacterium sp., Escherichia sp., Pichia sp., Pseudomonas genus. Pseudomonas sp.) And Saccharomyces sp.) A method for producing a mutant microorganism having a putrescine-producing ability, characterized in that it is selected from the group consisting of. In microorganisms with putrescine-producing metabolic pathways, the genes encoding spermidine synthase ( speE ), spermidine N-acetyltransferase (spermidine) involved in the degradation or utilization pathway of putrescine In the group consisting of a gene encoding N-acetyltransferase ( speG ), a gene encoding ornithine carbamoyltransferase I ( argI ) and a gene encoding putrescine importer ( puuP ) After deletion of one or more selected genes encoding operon for arginine biosynthesis ( argECBH ), genes encoding acetylornithine amino transaminease ( argD ) and inducible ornithine decarboxylase And the gene coding for putrescine / ornithine antiporter ( speF-potE ). A method for producing a mutant microorganism having a putrescine-producing ability, wherein the promoter of at least one gene is replaced with a strong promoter selected from the group consisting of trc promoter, tac promoter, T7 promoter, lac promoter and trp promoter. The gene according to claim 23, wherein the gene encoding γ-glutamylputrescine syntase ( puuA ), the gene encoding putrescine transaminase ( ygjG ) and ornithine carba A method for producing a mutant microorganism having putrescine-producing ability, characterized in that it further deletes one or more selected from the group consisting of genes ( argF ) coding for ornithine carbamoyltransferase F. The method of claim 23, wherein the putrescine mutant microorganism the new biosynthetic gene (lacI) encoding a lac operon repressor such that the increased expression of the gene coding for the enzyme involved in having the putrescine producing ability, comprising a step of adding fruit to Manufacturing method. 24. The method according to claim 23, further comprising introducing or amplifying a gene ( speC ) encoding ornithine decarboxylase. The gene of claim 26, wherein the gene encoding ornithine decarboxylase ( speC ) contains a strong promoter selected from the group consisting of trc promoter, tac promoter, T7 promoter, lac promoter, and trp promoter. Method for producing a mutant microorganism having a putrescine generating ability, characterized in that it is introduced in the form of an expression vector. delete 28. The method of claim 27, wherein the expression vector is pKKSpeC or p15SpeC. The genus of claim 23, wherein the microorganism is Bacillus sp., Corynebacterium sp., Escherichia sp., Pichia sp., Pseudomonas sp. Pseudomonas sp.) And Saccharomyces sp.) A method for producing a mutant microorganism having a putrescine-producing ability, characterized in that it is selected from the group consisting of. The mutant microorganism of any one of claims 1, 3 to 5, 7 to 12 and 14 is produced to produce putrescine, and then the putrescine is recovered from the culture solution. Method of preparing trecine.

Images