CN112725251A

CN112725251A - Engineering bacterium for producing spermidine

Info

Publication number: CN112725251A
Application number: CN201910972340.3A
Authority: CN
Inventors: 蔡宇杰; 梁鑫鑫; 惠红杰; 邓华祥; 丁彦蕊; 白亚军; 郑晓晖
Original assignee: Jiangnan University
Current assignee: Zhuohong Chaoyuan Biotechnology Zhengzhou Co ltd
Priority date: 2019-10-14
Filing date: 2019-10-14
Publication date: 2021-04-30
Anticipated expiration: 2039-10-14
Also published as: CN112725251B

Abstract

The invention discloses an engineering bacterium for producing spermidine, belonging to the field of genetic engineering. The invention adopts a metabolic engineering modification method to remove the inhibition of various products in the spermidine synthesis path, change a spermidine transport system, strengthen the enzyme activity of a key path and introduce an exogenous path, thereby obtaining the escherichia coli engineering bacterium with high spermidine yield. Has good industrial application prospect.

Description

Engineering bacterium for producing spermidine

Technical Field

The invention relates to an engineering for producing spermidine, belonging to the technical field of biological engineering.

Background

Spermidine (Spermidine) having the linear formula NH₂(CH₂)₃NH(CH₂)₄NH₂It is an important physiologically active substance widely existing in microorganisms, plants and animals. Spermidine has life prolonging effect in animals, and can counteract age-related diseases, such as cardiovascular diseases, neurodegenerative diseases and cancer.

As shown in fig. 1, spermidine synthesis occurs in two major pathways in the organism: (1) the direct synthesis of spermidine by the action of spermidine synthase via carboxylated ademetionine, which can be obtained from methionine (Met) catalyzed by the adenylation and decarboxylation of the relevant enzymes, and putrescine, is a relatively common pathway of conventional spermidine synthesis in animals, plants and microorganisms; (2) spermidine is synthesized via aspartate-beta-semialdehyde, which is often catalyzed by phosphorylation and dehydrogenation of amino acids such as aspartic acid (Asp) by related enzymes, and putrescine under catalysis of carboxyspermidine dehydrogenase and decarboxylase, which is a newly discovered alternative synthetic pathway, mainly present in some bacteria, including important human pathogens, intestinal flora, etc. Only pathway 1 is present in E.coli. The enzymes in these pathways are highly regulated, the spermidine content of animals and plants is low, and no microorganism capable of producing spermidine in large quantities has been found at present.

Disclosure of Invention

[ problem ] to

The invention aims to solve the technical problem of constructing a modified escherichia coli genetic engineering bacterium which can realize the high-efficiency production of spermidine.

[ solution ]

The invention provides an escherichia coli genetic engineering bacterium, which takes escherichia coli as a host, and removes a metJ gene for coding a DNA combined transcription inhibiting factor and an argR gene for coding a DNA combined double transcription regulating factor, and mutates a metA gene for coding homoserine O-succinyltransferase to construct a negative feedback mutant so as to relieve the feedback inhibition of methionine on homoserine O-succinyltransferase.

Further, the present invention also replaces the natural promoters of metK gene encoding methionine adenosyltransferase, speC gene encoding ornithine decarboxylase, speDE gene encoding S-adenosylmethionine decarboxylase and spermidine synthase with strong promoters. For example, the strong promoter trc is used to replace the natural promoters of metK, speC and speDE to enhance the expression of methionine adenosyltransferase, ornithine decarboxylase, S-adenosylmethionine decarboxylase and spermidine synthase.

Further, the present invention knocks down the transporter PotABCD that transfers spermidine to the intracellular, and enhances the expression of the transporter MdtJI that transfers spermidine to the extracellular. For example, the ATP-binding subunit potA of the transporter is knocked out, and the natural promoters of mdtJ and mdtI are replaced by a strong promoter trc, so as to enhance the expression of proteins for transporting spermidine out of cells by escherichia coli.

Further, the present invention further comprises a deletion of lysA gene encoding diaminopimelate decarboxylase, or further comprises a deletion of thrB and thrC genes encoding homoserine kinase and threonine synthase based on the deletion of lysA gene, or further comprises a deletion of proC gene encoding pyrroline-5-carboxylate reductase based on the deletion of lysA, thrB and thrC genes.

Furthermore, the puA gene encoding the glutamic acid-putrescine ligase is knocked out further.

Furthermore, the invention further introduces an exogenous pathway for synthesizing spermidine. For example, the present invention further expresses a foreign carboxyspermidine dehydrogenase gene and a foreign carboxyspermidine decarboxylase gene.

The genetic engineering bacteria provided by the invention can be used for producing spermidine, and is particularly used for producing spermidine through high-density culture.

The host which can be selected by the genetically engineered bacterium of the present invention includes Escherichia coli BL21(DE3), Escherichia coli JM109, Escherichia coli DH5 alpha, Escherichia coli Top10 or Escherichia coli MG 1655.

When the genetic engineering bacteria are constructed, the integration expression of genes can be carried out by utilizing the principle of homologous recombination, and a homologous recombination knockout method or a Crispr/Cas9 knockout method can be adopted when the genes are knocked out.

[ advantageous effects ]

The invention constructs the escherichia coli for high-yield production of spermidine by taking glucose as a raw material based on a synthetic biology method, has simple production process, easily obtained raw materials and low cost, and has good industrial application prospect.

The present invention relieves the feedback inhibition and repression, and as shown in FIG. 1, methionine synthesis is a multi-stage enzyme-linked reaction starting from homoserine, and removal of methionine is necessary for the inhibition of metA-encoded homoserine O-succinyltransferase. MetJ and ArgR are repressors of the methionine (Met) and butanediamine (Put) pathways, respectively. The invention relieves the feedback inhibition of methionine and relieves the repression of MetJ and ArgR on the pathway.

The present invention enhances the expression of key enzymes. The spermidine synthetase encoded by speE gene is a key enzyme for forming spermidine (Spd) by condensing Put and Dc-SAM, and the methionine adenosyltransferase encoded by metK is a key enzyme for synthesizing Dc-SAM, so that the expression of the two enzymes is enhanced, and the yield of spermidine can be improved.

The invention improves the transport way of spermidine, the PotABCD and MdtJI proteins are the proteins for transferring spermidine into and out of cells respectively, PotABCD is knocked out, MdtJI is expressed intensively, and the yield of spermidine can be improved.

The invention weakens the competitive path of spermidine process, and the aspartic semialdehyde intermediate in the spermidine synthesis process has the competitive path generated by a plurality of amino acids, such as Lys, Thr/Iso; there are also competing pathways for glutamate intermediates, such as the synthesis of Pro, which can be attenuated to increase spermidine production.

According to the invention, relevant decomposition paths are knocked out, and the enzyme for utilizing and degrading the intermediate and the product of spermidine synthesis exists in Escherichia coli, such as succinyl ornithine aminotransferase coded by astC can degrade ornithine; speG encodes a butanediamine acetyltransferase which converts butanediamine into an acetylated form, and also has a PuuA-mediated pathway for butanediamine degradation. Therefore, by knocking out the several related degradation pathways, the production of spermidine can be increased.

The invention introduces an exogenous approach, a traditional spermidine synthesis approach in escherichia coli, synthesizes spermidine through carboxylation-S-adenosylmethionine and putrescine under the action of spermidine synthetase, and the synthesis approach of carboxylation-S-adenosylmethionine is longer. Therefore, an exogenous CASDH/CASDC synthesis way is introduced, the double-way synthesis of spermidine is realized in escherichia coli, and the yield of spermidine can be further improved.

Drawings

FIG. 1 two existing routes for spermidine synthesis

Detailed Description

1. The invention relates to a strain and a plasmid

pRSFDuet-1, pTrc99a, PKD46, pCP20, T19 vector plasmids, pMD18-T vector plasmids, Escherichia coli BL21(DE3), Escherichia coli JM109, Escherichia coli DH 5. alpha., Escherichia coli Top10, Escherichia coli MG1655, available from Novagen.

2. Conditions of fermentation

The formula of the shake flask fermentation medium adopted when the yield of the strain is verified in the invention is as follows: each liter contains 10g of glucose, 10g of yeast extract, 20g of NaCl, 50% (v/v) of R/2 culture medium and 5ml of trace metal element stock solution; the components of the R/2 culture medium are as follows: 2g (NH) per liter₄)₂HPO₄、6.75g KH₂PO₄0.85g of citric acid, 0.7g of MgSO₄·7H₂O,. ph 6.86; the trace metal element stock solution comprises the following components: each liter contains 5M HCl and 10g FeSO₄·7H₂O、2.25g ZnSO₄·7H₂O、1g CuSO₄·5H₂O、0.5g MnSO₄·5H₂O、0.23g Na₂B₄O₇·10H₂O、2g CaCl₂·2H₂O、0.1g(NH₄)₆Mo₇O₂₄.. The temperature of the shake flask fermentation is controlled to be 37 ℃ and the initial pH value is 7, the liquid loading amount is 1/5 of the volume of the shake flask, the rotating speed is controlled to be 200rpm, and the shake flask fermentation time is 24 hours.

3. Method for measuring spermidine content

Preparation of OPA derivatizing reagents: OPA reagent was prepared by the Uren method and Karababa (15). 0.20g OPA was dissolved in 9.0mL methanol, and 1.0mL of0.40M (pH 9.0) borate buffer and 160. mu.L 2-mercaptoethanol (reducing agent) were added. The OPA reagent was stored at 4 ℃.

Spermidine was first derivatized with ortho-phthalaldehyde (OPA; Sigma, St. Louis, Mo.). mu.L of the sample and 450. mu.L of water were added to 400. mu.L of methanol. After addition of 100. mu.L of OPA reagent, the mixture was filtered through a 0.2- μm filter and immediately 20.0. mu.L of the filtrate was injected into the HPLC apparatus.

HPLC detection conditions: spermidine was detected by a method described in the literature references (Qian, Z.G., X.X.Xia, and S.Y.Lee, metabolism engineering of Escherichia coli for the production of pus cine: a four carbon diamine. Biotechnol Bioeng,2009.104(4): p.651-662): a Luna 5- μm C18(2)100A column (250X 4.6 mm; Phenomenex) operating at 25 ℃ and 0.8mL/min mobile phase was used for all sample separations. The mobile phase consisted of solvent A (55% methanol in 0.1M sodium acetate, pH7.2) and solvent B (methanol). The following gradient was applied: 1-6 minutes, 100% a; 6-10 min, linear gradient of B from 0% to 30%; 10-15 min, linear gradient of B from 30% to 50%; 15-19 min, linear gradient of B from 50% to 100%; 19-23 min, 100% B; 23-25 min, linear gradient of B from 100% to 30%; from 25 to 28 minutes, a linear gradient of B from 30% to 0% (all in% by volume).

4. Integration expression scheme of genes

The integration and expression of the gene are carried out by adopting the principle of homologous recombination. Specifically, the target gene is amplified by using an amplification primer 'KZ-F/R', and is integrated to the polyclonal site of the T19 vector plasmid by means of homologous recombination. And (3) amplifying a Left Arm (LA) and a Right Arm (RA) of a homology arm by taking the upper and lower 1000bp positions of the target gene as templates, and connecting the left arm and the right arm to two ends of the target gene on the T19 carrier plasmid to construct the homology arm. Extracting plasmids connected with the left arm and the right arm: T19-LA-trc-target gene-RA, using the target gene-RA as a template, and using corresponding primers to amplify a target fragment: LA-trc-target gene-RA, PCR product is purified, and restriction enzyme DpnI is used to eliminate template effect. The enzyme-digested product is continuously purified and then transferred into escherichia coli for feelingIn the state cells, positive transformants are screened on a resistance plate by using a kanamycin resistance marker, and in order to verify whether recombination occurs or not, if the recombination occurs, fragments of about 1200bp can be amplified by using corresponding primers 'target gene-YZ-F' and 'target gene-YZ-R', otherwise, any fragment cannot be amplified. Meanwhile, PCR verification bacteria corresponding to the ampicillin sodium double-antibody plate points are used for determining that the correct transformant E.coli-PKD46 (kana) is obtained^R). Elimination of kanamycin resistance, first CaCl₂Method for preparing E.coli-PKD46 (kana)^R) Competent, pCP20 plasmid was transformed into E.coli-PKD46 (kana)^R) After the competence is in, a resistance elimination transformant is screened by using a non-resistance plate and a resistance plate, the transformant is identified by colony PCR, and the transformant integrating the target gene and eliminating the resistance is screened.

The integration expression method and the integration operation steps are applied to integrate the mutant gene, the replaced promoter sequence and the like to the required position of the genome, and the corresponding metabolic engineering modification is carried out on the strain.

An enzyme digestion reaction system: 10 XQ Cut Buffer 5. mu.L, DNA 20. mu.L, ddH₂And (3) mixing the mixture of 33 mu L of O, 11 mu L of endonuclease and 21 mu L of endonuclease, and heating the mixture in a water bath at 37 ℃ for 0.5-1 h.

Connecting a reaction system: lightning clonase 5 μ L, double enzyme digestion plasmid (10-100ng)1-2 μ L, homologous target fragment 4-5 μ L, ddH₂And supplementing O to 10 mu L, mixing uniformly, and heating in water bath at 50 ℃ for 30 min.

DpnI Elimination template Effect reaction System (60. mu.L): 3 μ L of DpnI, 20 μ L of PCR-purified product, 10 XFastdigest Buffer6 μ L, ddH₂O 31μL。

PCR amplification of the target Gene reaction System (50. mu.L): DNA template 1. mu.L, 5 XPrimeSTAR Buffer 10. mu.L, dNTP mix 4. mu.L, amplification primer 1. mu.L, PrimeSTAR HS DNA Polymerase 0.5. mu.L, ddH₂O32.5μL。

PCR amplification procedure: 30 cycles (98 ℃ for 10s, 55 ℃ for 10s, 72 ℃ for 1kb/min), 72 ℃ for 10min, 4 ℃ storage.

Colony PCR reaction system: 2 × Tag Master Mix 10 μ L, upstream primer (10 μ M concentration) 1 μ L, downstream primer (conc. concentration)Degree 10. mu.M) 1. mu.L, ddH₂O8 mu L, and a small amount of colony or bacterial liquid is used as a template.

Example 1: relieving feedback inhibition of important enzymes in pathway and repressing pathway promoter by repressor protein

In the process of decarboxylating important intermediates in the synthesis of S-adenosylmethionine and putrescine, important repressor protein exists to inhibit the synthesis of intermediates and final products, and the DNA coded by metJ gene is combined with a transcription inhibitor to inhibit the expression of met series gene, so as to finally inhibit the excessive synthesis of methionine; the argR gene encodes DNA which combines double transcription regulating factors to inhibit the expression of arg series genes and inhibit the excessive synthesis of ornithine and arginine which are important intermediates, so that the genes encoding the two repressor proteins are deleted to improve the metabolic flux in order to ensure the stable and high-speed synthesis of each intermediate.

In the metabolic pathway of decarboxylation S-adenosylmethionine synthesis, homoserine O-succinyltransferase coded by metA is subject to feedback inhibition by product methionine, and in order to improve the activity of the enzyme, on the basis of knocking out metJ gene and argR gene, the gene coding the enzyme is further subjected to base mutation to construct a negative feedback mutant, and the feedback inhibition is removed to obtain the engineering bacterium E^fbrΔ MetJ Δ ArgR, which was designated E1.

The specific process is as follows:

(1) knockout of the repressor MetJ and ArgR

Primer design is as follows in table 1:

table 1(SEQ ID NO.1 to 10)

Primer name	Primer sequence 5 '-3'
		ApaI-LA-metJ	GAGATTGGGCCCGCAGCAGATAGCTGTCAAAC
MetJ-LA-EcoRI	CACGGAGAATTCGAGATACTTAATCCTCTTCG
		KpnI-RA-metJ	CTCGGTACCAGCAAAAAAGAGCGGCGCGG
MetJ-RA-SalI	GACGATGTCGACGAAAATCCGCTCCACCGTTG
		LA-YZ-F	tgaattagaactcggtacgcgcgga
LA-YZ-R	tagagaataggaacttcgaactgca
		RA-YZ-F	aacttcgaagcagctccagcctaca
RA-YZ-R	atgattacgccaagtttgcacgcct
		metJ-YZ-F	AGTTTTTTCACCAACGGCTGGGTTT
metJ-YZ-R	Cgccctgagtgcttgcggcagcgtg

The plasmid extraction kit is used for extracting the homologous recombinase expression PKD46 plasmid, and the purified homologous recombinase expression PKD46 plasmid is transformed into a competent cell E.coli BL21 to construct E.coli BL21-PKD 46. CaCl₂Preparation of E.coliBL21-PKD46 competent cells were then stored at-80 ℃ until use. And extracting a homologous recombination fragment template plasmid T19 vector by using a plasmid extraction kit, and purifying and recovering by using a tapping recovery kit. Primers ApaI-LA-metJ, MetJ-LA-EcoRI, KpnI-RA-metJ and MetJ-RA-SalI are designed to amplify corresponding homologous arm LA and RA fragments, and a tapping recovery kit is used for purification and recovery. Carrying out double enzyme digestion on the plasmid T19 vector by using ApaI and EcoRI, detecting the enzyme digestion result by electrophoresis, wherein the size of the enzyme digestion product is 5041bp, and purifying and recycling the enzyme digestion product. The product of the T19 vector after double enzyme digestion is connected with the LA fragment of the left arm. And transforming the connected product into JM109 competence, coating the competence on a sodium bicarbonate resistant plate, screening positive clone strains, carrying out colony PCR verification result by using primers LA-YZ-F and LA-YZ-R, wherein the size of a strip is about 1100bp, sending the successfully verified strains to sequence, and further confirming that the fragments are successfully connected. The T19 plasmid ligated with the LA fragment was digested with KpnI and SalI in a double manner, the RA fragment was ligated in the same manner as described above, and the ligated plasmid was verified. Extracting T19 carrier plasmid connected with LA and RA segments, and using the T19 carrier plasmid as a template and primers ApaI-LA-metJ and MetJ-RA-SalI to perform PCR to obtain the target segment metJ-LA-FRT-Kan-FRT-RA. The size of the band is 3324bp by electrophoresis identification. After the PCR product is purified, the template effect is eliminated by using restriction enzyme DpnI. And (3) continuously purifying the target fragment metJ-LA-FRT-Kan-FRT-RA PCR product after the restriction enzyme DpnI is cut, transferring the purified product into E.coli BL21-PKD46 competent cells, screening positive transformants on a resistance plate by using a kanamycin resistance marker, taking the positive transformants as templates, and using primers metJ-YZ-F and metJ-YZ-R to amplify fragments about 1100bp to judge that the recombination occurs, otherwise, judging that the fragments are false positive if any fragment cannot be amplified by using the positive transformants as templates. And (3) carrying out PCR amplification to verify whether recombination occurs, and simultaneously carrying out corresponding PCR verification bacteria on the ampicillin sodium plate. Coli BL21-PKD46 (kana) was identified as the correct transformant in which recombination did occur^R) Elimination of kanamycin resistance is carried out by first using CaCl₂Method for preparing E.coli BL21-PKD46 (kana)^R) Competence, extracted pTransformation of CP20 plasmid into E.coli BL21-PKD46 (kana)^R) After competence, a resistance-eliminating transformant is screened by using a non-resistant plate and a resistant plate, the transformant is identified by colony PCR, and a metJ gene knockout and resistance-eliminating transformant E.coli BL 21-delta metJ are screened.

The repressor ArgR was knocked out in the same manner as above, and primers were designed as shown in Table 2 below. The correct knock-out strain E.coli BL 21. DELTA. metJ. DELTA. argR was selected.

Table 2(SEQ ID NO.11 to 30)

(2)metA^fbrConstruction of mutants

As for metA gene, feedback inhibition of the target product methionine is carried out, and researches show that the 79 th base C of metA gene is mutated into T, and the yield of methionine is remarkably improved after the coded arginine is changed into cysteine, so that the site is mutated and integrated into the plasmid pRSFDuet-1.

The specific process is as follows:

primer design is as follows in table 3:

table 3(SEQ ID NO.31 to 34)

Primer name	Primer sequence 5 '-3'
		F-metA-amplification primer	GGAGATATACATATGATGCCGATTCGTGTGCCGG
R-metA-amplification primer	GGTTTCTTTACCAGACTCGAGTTAATCCAGCGTTGGATTCATGTGCCG
		metA-TB-F	GTGATGACAACTTCTTGTGCGTCTG
metA-TB-R	AAGAAGTTGTCATCACAAAGACGTT

First, pRSFDuet-1 (high copy) plasmid was extracted using a plasmid extraction kit, and BamHI and HindIII were selected for double digestion in the following digestion system (50. mu.L): 10 XQ Cut Buffer 5. mu.L, plasmid 20. mu.L, BamHI 1. mu.L, HindIII 1. mu.L, ddH₂O33. mu.L, digested and purified. Secondly, the wild E.coli BL21 genome is extracted, the metA gene fragment is amplified by taking the genome as a template, and the amplified metA gene fragment is connected to the digested pRSFDuet-1 plasmid after PCR product verification. CaCl₂Preparing E.coli JM109 competent cells, transforming the pRSFDuet-1 plasmid connected with the metA fragment into competence, selecting positive transformants, and identifying colonies by PCR to obtain the successfully transformed strain E.coli JM 109-metA. Plasmid pRSFDuet1-metA of E.coli JM109-metA was extracted, and site-directed mutagenesis of metA was carried out using this plasmid as a template. Designing and extracting mutant genes by using Fast mutagenesis System kit, using extracted pRSFDuet1-metA plasmid as a template, and using metA mutant primer metA-TB-F/R to amplify metA^fbrFragment, wherein the PCR amplification system (50. mu.L) is as follows: plasmid template 3. mu.L, metA-TB-F1. mu.L, metA-TB-R1. mu.L,

Fly PCR SuperMix 25μL，ddH₂o20. mu.L. The PCR amplification procedure was: at 94 deg.C for 2-5min, cycling at 20-25 deg.C (94 deg.C for 20s, 55 deg.C for 20s, 72 deg.C for 2-6kb/min), storing at 72 deg.C for 10min, and storing at 4 deg.C. For the obtained PCRThe product was digested with 1-3. mu.L DMT enzyme, mixed well and incubated at 37 ℃ for 1 h. The resulting DMT enzyme-digested product was purified using a PCR product purification kit, and 2 to 5. mu.L of the purified product was added to 50. mu.L of JM109 competent cells to carry out transformation. Selecting positive transformant, carrying out colony PCR preliminary identification, and screening out correct transformant JM109-metA after company sequencing^fbr。

Extraction of transformant JM109-metA^fbrPlasmid pRSFDuet1-metA of (1)^fbrThe gene fragment metA was expressed according to the "expression scheme for integration of 4 genes" described above^fbrIntegrated to the knock-out strain E.coli BL21 DeltametJ DeltaargR to construct the strain E.coli A^fbrΔ MetJ Δ ArgR, designated E1, was used as the base strain for subsequent studies.

The shaking flask culture verified the yield of E1 spermidine, and the spermidine concentration in the supernatant of the shaking flask was determined to be 4.8 g/L.

Example 2: enhanced expression of pathway key enzymes

In the metabolic process of synthesizing important intermediates of decarboxylation S-adenosylmethionine and putrescine, some genes are used as rate-limiting enzymes to strictly regulate and control the flux expression of the whole metabolic pathway, methionine adenosyltransferase coded by metK gene is used as the rate-limiting enzyme of the metabolic synthesis pathway of methionine to inhibit the excessive synthesis of methionine to a great extent, therefore, a strong promoter trc is used for replacing a natural promoter of the metK gene, the expression of the metK gene is enhanced, and the synthesis of the metabolic flux of methionine is promoted. Wherein the trc promoter (sequence: 5'-TTGACAATTAATCATCCGGCTCGTATAATG-3') is derived from pTrc99a plasmid. S-adenosylmethionine decarboxylase coded by the speD gene catalyzes S-adenosylmethionine to synthesize decarboxylated-S-adenosylmethionine, then the decarboxylated-S-adenosylmethionine is catalyzed by spermidine synthetase coded by speE and synthesizes a target product spermidine (Spd) together with putrescine, and in order to strengthen the enzyme activity and metabolic flux of the metabolic pathway, a strong promoter trc is used for replacing a natural promoter of the enzyme activity and metabolic flux, so that the expression of the enzyme activity and metabolic flux is strengthened. The ornithine decarboxylase coded by the speC is inhibited by the products putrescine and spermidine, and the strong trc promoter is replaced to promote the overexpression of the ornithine decarboxylase, relieve the feedback inhibition and accumulate more target products.

With E1The bacterium is a development bacterium, further enhances the expression of key enzymes metK, speD, speC and speE of a synthetic pathway, and obtains an engineering bacterium E1-P by replacing a natural promoter of the gene with a strong trc promoter_trcmetKP_trcspeDP_trcspeCP_trcspeE strain.

The specific process is as follows:

primer Premier5 was used to design relevant fragment primers according to metK of e.coli BL21 in NCBI (table 4). E.coli BL21 genome is used as a template, metK-KZ-F/R is used as a primer, a target gene fragment metK is amplified by PCR, restriction enzyme cutting sites EcoRI and Hind III are respectively carried at upstream and downstream, and a PCR fragment is purified. Carrying out double digestion on pTrc99a plasmid by EcoRI and Hind III, purifying the digested plasmid, connecting with the purified metK fragment, transforming E.coli JM109 competence, selecting positive transformants, carrying out colony PCR and sequencing by using verification primers metK-99a-YZ-F/R, and verifying the correctness. Extracting successfully transformed plasmid pTrc-metK, using it as template, using BamHI-trc-metK-F and trc-metK-SacI-R as primer to amplify target fragment trc-metK sequence, and making it be checked by running gel to obtain about 1253bp, and purifying. The T19 vector plasmid is subjected to double enzyme digestion by BamHI and SacI enzymes, is connected and transformed with a trc-metK fragment after being purified, is verified by colony PCR and company sequencing by a verification primer trc-metK-T19-YZF/YZR, and is selected to be a correct positive transformant T19-trc-metK. The method comprises the steps of designing and amplifying a left arm fragment LA by taking a metK genome in E.coli BL21 as a template and metK-LA-ApaI and EcoRI-metK-LA as primers, amplifying a right arm fragment RA by taking metK-RA-KpnI and SalI-metK-RA as primers, purifying, respectively connecting to a plasmid T19-trc-metK left arm and a plasmid right arm which are subjected to double digestion and purification, performing colony PCR preliminary verification by using verification primers metK-LA-YZ-F, metK-LA-YA-R, metK-RA-YZ-F and metK-RA-YA-R, and sending the verification primers to a company for sequencing to find out the plasmid T19-LA-trc-metK-RA which is correctly connected with the left arm and the right arm. Extracting plasmid T19-LA-trc-metK-RA connected with the right arm of the left arm, using the plasmid as a template, using metK-LA-ApaI and SalI-metK-RA as primers, amplifying a target fragment LA-trc-metK-RA, wherein the size is about 3700bp, and after a PCR product is purified, eliminating the template effect by using restriction enzyme DpnI. The enzyme-digested product is continuously purified and thenTransferring the cells into E1-PKD46 (extracting a homologous recombinase expression plasmid PKD46 by using a plasmid extraction kit, purifying and then transferring the cells into competent cells E1 to construct E1-PKD46), screening positive transformants on a resistant plate by using a kanamycin resistance marker, and in order to verify whether recombination occurs, amplifying fragments of about 1200bp by using primers metK-YZ-F and metK-YZ-R, otherwise, amplifying any fragment. Meanwhile, ampicillin sodium plate was used to spot the corresponding PCR-verified bacteria. Determination of the correct transformant E1-PKD46 (kana)^R). Elimination of kanamycin resistance, first CaCl₂Preparation of E1-PKD46 (kana)^R) Competent, pCP20 plasmid was transformed into E1-PKD46 (kana)^R) After competence, the transformants were identified by colony PCR using non-resistant plates and resistant plates for resistance elimination, and transformants E1-metKP for replacement of metK gene promoter and elimination of resistance were selected_trc。

The promoters of the genes speC, speD and speE were replaced in sequence according to the method described above. Coli genome analysis revealed that speE and speD were located in the same gene cluster and induced by the same promoter, and thus the common promoter was changed. Construction of the Strain E1-metKP_trcspeCP_trcspeEDP_trcThis was designated as E2. The primers used are as follows in table 4:

table 4(SEQ ID NO.35 to 88)

The shaking flask culture verified the yield of E2 spermidine, and the spermidine concentration in the supernatant of the shaking flask was determined to be 6.3 g/L.

Example 3: improvement of transport pathways

PotABCD is a transporter that takes spermidine into the cell by E.coli, thus knocking it out; since the PotABCD protein consists of four subunits encoded by the gene clusters of potA, potB, potC and potD, the potA encodes an ATP binding subunit and provides necessary energy for transportation, the potB encodes an ABC transport membrane subunit PotB, the potC encodes an ABC transport membrane subunit PotC, the potD encodes an ABC transport protein periplasm binding protein, the four genes of an operon are necessary for the correct expression of the functions of the operon, and the deletion of any one gene necessarily leads to the inactivation of the functions, the ATP binding subunit potA is deleted in the research, the capacity of transferring the protein transport spermidine is weakened, and a strain for improving the transportation pathway is constructed on the basis of E3. PotABCD was knocked out according to the method of Red homologous recombination in example 1, yielding strain E3. delta. PotABCD. MdtJI is a protein for transporting spermidine out of cells by E.coli, encoded by a gene cluster consisting of the gene clusters mdtJ and mdtI, and thus, enhanced expression thereof using a strong trc promoter. The promoter was replaced according to the method described in example 2 to obtain a strain E3. delta. PotABCDP with improved transport pathway_trcMdtJI and is named E3.

Table 5(SEQ ID NO.89 to 116)

The shaking flask culture verified the yield of E3 spermidine, and the spermidine concentration in the supernatant of the shaking flask was determined to be 8.5 g/L.

Example 4: weakening of the competitive pathway

(1) Lys competition pathway:

the intermediate aspartate semialdehyde is further converted to lysine by means of a diaminopimelate decarboxylase encoded by a gene of dap series and a gene of lysA, and in order to release the diversion of the competitive metabolic pathway, the gene lysA was deleted by means of Red homologous recombination based on the strain E3 according to the method described in example 1 to construct the strain E3. delta. lysA. The resulting strain was named E4-1.

(2) Thr/Iso competition pathway: deleting thrB or thrBC operon;

homoserine kinase and threonine synthase encoded by thrB and thrC genes respectively, threonine and isoleucine are converted from homoserine, which are key genes of the two amino acid synthetic pathways, and in order to weaken the influence of the branched pathway, more homoserine is flowed to the metabolic pathway for methionine synthesis, the operon gene thrBC is knocked out by using the method of Red homologous recombination based on the strain E3 DeltalysA to construct the strain E3 DeltalysA DeltathrBC according to the method described in example 1. The resulting strain was named E4-2.

(3) Glu presents a competing pathway: glutamate kinase encoded by proB, glutamate semialdehyde dehydrogenase encoded by proA forms glutamate semialdehyde which can be converted spontaneously into pyrroline-5-carboxylic acid, which is converted into proline (Pro) by pyrroline 5-carboxylate reductase encoded by proC, so to prevent the metabolic flux of the competing pathway, we would delete the gene proC, weakening the pathway. The expression of the competing pathway gene proC was deleted by Red homologous recombination based on the strain E3 DeltalysA DeltathrBC as described in example 1 to construct strain E4 DeltalysA DeltathrBC DeltaproC. The resulting strain was named E4-3.

The primers required are shown in Table 6 below.

Table 6(SEQ ID NO.117 to 146)

The shaking flask culture verifies the yield of the spermidine E4-1, E4-2 and E4-3, and the spermidine concentration in the supernatant of the shaking flask is measured to be 9.3g/L, 9.7g/L and 11.3 g/L.

Example 5: knock-out of related breakdown pathways

There are pathways for utilization and degradation of Put (competitive pathways): (1) put is converted to aminobutyric acid via the Puu pathway. Firstly, putrescine is catalytically converted into gamma-glutamic acid-putrescine by a glutamic acid-putrescine ligase encoded by the puuA gene, and then oxidized into gamma-glutamic acid-gamma-butyraldehyde by gamma-glutamic acid-gamma-butyraldehyde oxidase encoded by puuB, and further oxidized into gamma-glutamic acid-gamma-aminobutyric acid by gamma-glutamic acid-gamma-butyraldehyde dehydrogenase encoded by puuC c, which is then hydrolyzed into glutamic acid and aminobutyric acid (GABA) by gamma-glutamic acid-gamma-aminobutyric acid hydrolase encoded by puuD, and the Puu pathway mediated by the puu gene cluster is accompanied by a reaction process of glutamyl amination intermediates. (2) In addition, there is a non-Puu YgjG mediated pathway, the ygIGG-encoded putrescine ketoglutarate aminotransferase and the YdcW-encoded aminobutyric dehydrogenase, the classical pathway for the degradation of putrescine to GABA without glutamylation, the intermediate gamma-aminobutanal of which is very unstable and is prone to spontaneously forming delta¹-pyrrolines. Puu pathway glutamine stabilizes intermediate substance, and researches show that the activity ratio of YgjG in non-Puu pathway is lower, therefore, in order to reduce the damage of metabolic engineering bacteria, we weaken the main pathway of Put utilization, namely deleting puuA gene, and weakening Puu pathway.

According to the method described in example 1, strain E4-3 is used as the starting strain of the metabolic pathway, and the gene puuA is deleted by means of Red homologous recombination, so that further degradation of putrescine is prevented, and more metabolic flux flows to the synthesis of spermidine, thus obtaining strain E5 (E4-3. delta. PuuA, or E.hzh01). The primers required are as follows in table 7:

table 7(SEQ ID NO.147 to 156)

The shaking flask culture verified the yield of E5 spermidine, and the spermidine concentration in the supernatant of the shaking flask was determined to be 14.7 g/L.

Example 6: dual pathway synthesis of spermidine

Aspartate semialdehyde is an important intracellular intermediate metabolite, a direct precursor for the synthesis of methionine and decarboxylated S-adenosylmethionine, and an important precursor for the synthesis of spermidine. The metabolic pathways from aspartate semialdehyde to decarboxylation S-adenosylmethionine synthesis are complex and changeable, the metabolic pathways are long, the metabolism of various amino acid intermediates is involved, and after the metabolic pathways are excessively modified, the growth of thalli is easily influenced. For the reasons described above, we introduced the CASDH/CASDC pathway from different microbial strains into e. The carboxylated spermidine dehydrogenase coded by the CASDH directly utilizes aspartate semialdehyde and putrescine as direct precursors to synthesize the carboxylated spermidine, and then the carboxylated spermidine dehydrogenase coded by the CASDC directly decarboxylates under the action of the carboxylated spermidine decarboxylase to synthesize the spermidine. To reduce this metabolic pathway and increase the metabolic pathway for aspartic acid to methionine, we integrated the cassdh/CASDC gene into this site, with a replacement knockout of this gene. Thus, the CASDH/CASCD pathway was integrated exogenously, according to the homologous recombination approach used in example 1.

The specific process is as follows:

the carboxy spermidine dehydrogenase genes rccsdh, pccsdh, rscsdh and cscsdh were cloned from the genomes of Ruminococcus caligenes ATCC 27760, Porphyromonas cataniae ATCC51270, Rhodobacter sphaeroides ATCC BAA-808 and Clostridium symbiosum ATCC 14940 by using amplification primers. The amino acid sequence is access NO at NCBI as ERJ96771.1, EWC93538.1, YP _351518.1 and ERI 79986.1. The carboxy spermidine decarboxylase genes bccscdc, cscsdc, cjcscddc, rscscddc are cloned from the genomes of bacteria cellulolytic bacteria DSM 14838, Clostridium symbolosum ATCC 14940, Campylobacter jejuni subsp. jejuni ATCC 700819, Rhodobacter sphaeroides ATCC BAA-808, and the numbering of the amino acid sequences in NCBI is EEF87925.1, ERI79985.1, YP _002344893.1, YP _351517.1, respectively. The two cloned genes are respectively connected to pRSFDuet-1 plasmid, and the recombinant Escherichia coli with enhanced expression of 2 genes can be obtained.

Amplifying a target fragment rccsdh by taking rccsdh-BamHI-F and rccsdh-Hind III-R as primers and a genome of Ruminococcus callidus ATCC 27760 as a template; carrying out enzyme digestion treatment on a first multiple cloning site of a plasmid pRSFDuet-1 by using double enzymes BamHI and Hind III, purifying an enzyme digestion product, then connecting the cut plasmid with a target fragment rccsdh obtained by amplification, transferring the connection product pRSFDuet-1-rccsdh into a JM109 competent cell, selecting a positive clone bacterium in a resistant flat plate sodium plate, and further verifying the correctness of the clone by colony PCR; the method comprises the steps of using bccsdc-KpnI-F and bccsdc-XhoI-R as primers and Bacteroides cellulolyticus DSM 14838 as a template, amplifying a target fragment bccsdc, using double enzymes KpnI and XhoI to enzyme-cut a second multiple cloning site of a plasmid pRSFDuet-1-rccsdh, purifying an enzyme-cut product, connecting the enzyme-cut product with the amplified target fragment bccsdc, transforming the connecting product pRSFDuet-1-rccsdh-bccsdc into JM109 competent cells, selecting positive clone bacteria from a resistant flat plate sodium plate, and further verifying the correctness of the bacterial colony PCR. Selecting a correctly connected strain pRSFDuet-1-rccsdh-bccsdc, extracting a plasmid pRSFDuet-1-rccsdh-bccsdc, and transforming the plasmid pRSFDuet-1-rccsdh-bccsdc into an E5 competent cell to construct an E5-rccsdh-bccsdc spermidine synthetic strain. The other strains were constructed in the same manner as E5-rccsdh-bccscdc, by ligating carboxy spermidine dehydrogenase and carboxy spermidine decarboxylase from different strains to two multiple cloning sites of pRSFDuet-1 plasmid, respectively. The other genes are ligated in the same manner as described above. The primer sequences used are shown in table 8:

table 8(SEQ ID NO.157 to 160)

Primer name	Sequence 5 '-3'
		rccsdh-BamHI-F	CCACAGCCAGGATCCGATGAACATGGGAAAAGCGTT
rccsdh-HindⅢ-R	GCATTATGCGGCCGCAAGCTTTTAATCTACCAGCACCGGAT
		bccsdc-KpnI-F	GCGATCGCTGACGTCGGTACCTTGGTTAAAAAAGAAAATAT
bccsdc-XhoI-R	GGTTTCTTTACCAGACTCGAGTCAACTCATTCTGTCGCGAT

Transferring the recombinant Escherichia coli into LB culture medium (peptone 10g/L, yeast powder 5g/L, NaCl10g/L) at a volume ratio of 2%, when the cell OD₆₀₀After reaching 0.6-0.8, IPTG was added to a final concentration of0.4 mM, and expression-induced culture was carried out at 20 ℃ for 12 hours. After the induction expression was completed, the supernatant was collected by centrifugation at 8000rpm for 20 minutes at 4 ℃. The spermidine concentration in the supernatant was determined by HPLC as shown in table 9.

TABLE 9

The key genes for synthesizing spermidine are over-expressed by using an expression vector, so that the metabolism burden is brought to thalli to influence the growth of the thalli, the structure of the expression vector in the reproduction process of the thalli is unstable, the expression vector is easy to lose, the copy number of the expression vector in cells is unstable, the thalli is influenced by adding antibiotics to pollute the environment, the expansion of the production scale is limited by factors such as cost increase caused by IPTG induction, and the like, therefore, a strain E5-rccsdh-bccsdc with the best effect of inducing and expressing spermidine is selected, the genes of the strain are integrated into an E5 (or called E.hzh01) strain according to the method shown in the embodiment 1, and the dual synthetic pathway strain E.hzh02 is constructed. Specifically, plasmid pRSFDuet-1-rccsdh-bccscdc is used as a template, a Kana complete gene with upper and lower homologous arms (50bp) of a panD gene (a gene encoding aspartate 1-decarboxylase zymogen, which decomposes aspartate into alanine and carbon dioxide) is amplified and connected to a pMD18-T vector plasmid to construct pMD 18-K. And continuously using pRSFDuet-1-rccsdh-bccsdc as a template to amplify two rccsdh-bccsdc genes, and connecting the two rccsdh-bccsdc genes with a pMD18-K plasmid to obtain pMD 18-K-rccsdh-bccsdc. The target segment panDF-Kan-rccsdh-bccsdc-panDR is obtained by utilizing endonuclease Pvu II for enzyme digestion, and is electrically transformed into an expression host strain E5/pKD46 competence (prepared according to the preparation competence method in the embodiment 1), under the action of recombinase, according to the principle of homologous recombination, the target segment of exogenous panDF-Kan-rccsdh-bccsdc-panDR and the corresponding region of panD on the chromosome are subjected to homologous recombination, the gene is deleted and replaced by the Kan-rccsdh-bccsdc segment, so as to obtain the strain integrating the target gene of rccs dhbcsdc, and the strain is named as E.hzh02, E.hzh02 is the strain integrating the rccsdh-bccsdc gene. PCR is carried out by taking the upstream and downstream sequences of the panD gene as primers and E.hzh02 genome DNA as a template, and the result of an amplification product shows that rccsdh-bccsdc is successfully integrated on the genome.

The shaking flask culture verifies the yield of the E.hzh01 and E.hzh02 spermidine, and the spermidine concentration in the supernatant of the shaking flask is measured to be 14.7g/L and 18.5 g/L.

Example 7 comparison of various integrative expression strains and high-Density culture

Further, the same procedures as in examples 1-7 were carried out in Escherichia coli JM109, DH5 α, Top10, and MG1655, respectively, to obtain similar two-way integrated spermidine-producing strains E.JM, E.DH, E.TO, and E.MG, and high-density culture was carried out for 24 hours, with the medium composition and feeding operation shown in the literature (Simple fed-batch technology for high cell density culture of Escherichia coli. journal of Biotechnology 1995,39:59-65), and the bacterial amounts and spermidine production are shown in Table 10.

The yield of spermidine by shake flask culture of E.JM, E.DH, E.TO and E.MG is 17.3, 21.3, 22.4 and 25.6g/L respectively.

TABLE 10 results of high-density culture of different strains

Bacterial strains	Wet weight of thallus (g/L)	Concentration of spermidine
			E.hzh02	118	196g/L
E.JM	114	178g/L
			E.DH	131	193g/L
E.TO	119	200g/L
			E.MG	140	223g/L

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

SEQUENCE LISTING

<110> university of south of the Yangtze river

<120> BAA190787A

<130> an engineering bacterium for producing spermidine

<160> 160

<170> PatentIn version 3.3

<210> 1

<211> 32

<212> DNA

<213> Artificial sequence

<400> 1

gagattgggc ccgcagcaga tagctgtcaa ac 32

<210> 2

<211> 32

<212> DNA

<213> Artificial sequence

<400> 2

cacggagaat tcgagatact taatcctctt cg 32

<210> 3

<211> 29

<212> DNA

<213> Artificial sequence

<400> 3

ctcggtacca gcaaaaaaga gcggcgcgg 29

<210> 4

<211> 32

<212> DNA

<213> Artificial sequence

<400> 4

gacgatgtcg acgaaaatcc gctccaccgt tg 32

<210> 5

<211> 25

<212> DNA

<213> Artificial sequence

<400> 5

tgaattagaa ctcggtacgc gcgga 25

<210> 6

<211> 25

<212> DNA

<213> Artificial sequence

<400> 6

tagagaatag gaacttcgaa ctgca 25

<210> 7

<211> 25

<212> DNA

<213> Artificial sequence

<400> 7

aacttcgaag cagctccagc ctaca 25

<210> 8

<211> 25

<212> DNA

<213> Artificial sequence

<400> 8

atgattacgc caagtttgca cgcct 25

<210> 9

<211> 25

<212> DNA

<213> Artificial sequence

<400> 9

agttttttca ccaacggctg ggttt 25

<210> 10

<211> 25

<212> DNA

<213> Artificial sequence

<400> 10

cgccctgagt gcttgcggca gcgtg 25

<210> 11

<211> 47

<212> DNA

<213> Artificial sequence

<400> 11

cgcgcggatc ttccagagat tgggcccgca gcagatagct gtcaaac 47

<210> 12

<211> 47

<212> DNA

<213> Artificial sequence

<400> 12

aagcttgacg tccaggtgcc tcttaaggag atacttaatc ctcttcg 47

<210> 13

<211> 47

<212> DNA

<213> Artificial sequence

<400> 13

cacgctagcg gatccgagct cggtaccagc aaaaaagagc ggcgcgg 47

<210> 14

<211> 47

<212> DNA

<213> Artificial sequence

<400> 14

cgtgcggacg gcaagctgct acagctggaa aatccgctcc accgttg 47

<210> 15

<211> 25

<212> DNA

<213> Artificial sequence

<400> 15

tgaattagaa ctcggtacgc gcgga 25

<210> 16

<211> 25

<212> DNA

<213> Artificial sequence

<400> 16

tagagaatag gaacttcgaa ctgca 25

<210> 17

<211> 25

<212> DNA

<213> Artificial sequence

<400> 17

aacttcgaag cagctccagc ctaca 25

<210> 18

<211> 25

<212> DNA

<213> Artificial sequence

<400> 18

atgattacgc caagtttgca cgcct 25

<210> 19

<211> 25

<212> DNA

<213> Artificial sequence

<400> 19

agttttttca ccaacggctg ggttt 25

<210> 20

<211> 25

<212> DNA

<213> Artificial sequence

<400> 20

cgccctgagt gcttgcggca gcgtg 25

<210> 21

<211> 47

<212> DNA

<213> Artificial sequence

<400> 21

cgcgcggatc ttccagagat tgggcccacc tgtgacagca gcggcag 47

<210> 22

<211> 47

<212> DNA

<213> Artificial sequence

<400> 22

aagcttgacg tccaggtgcc tcttaagaag tcacccgata tggtggt 47

<210> 23

<211> 47

<212> DNA

<213> Artificial sequence

<400> 23

cacgctagcg gatccgagct cggtacctct ctgccccgtc gtttctg 47

<210> 24

<211> 47

<212> DNA

<213> Artificial sequence

<400> 24

cgtgcggacg gcaagctgct acagctgcga tgcacggcag aactcgc 47

<210> 25

<211> 25

<212> DNA

<213> Artificial sequence

<400> 25

tgaattagaa ctcggtacgc gcgga 25

<210> 26

<211> 25

<212> DNA

<213> Artificial sequence

<400> 26

tagagaatag gaacttcgaa ctgca 25

<210> 27

<211> 25

<212> DNA

<213> Artificial sequence

<400> 27

aacttcgaag cagctccagc ctaca 25

<210> 28

<211> 25

<212> DNA

<213> Artificial sequence

<400> 28

atgattacgc caagtttgca cgcct 25

<210> 29

<211> 25

<212> DNA

<213> Artificial sequence

<400> 29

agacccgcca ccggccttcg cttca 25

<210> 30

<211> 25

<212> DNA

<213> Artificial sequence

<400> 30

cgccctgagt gcttgcggca gcgtg 25

<210> 31

<211> 34

<212> DNA

<213> Artificial sequence

<400> 31

ggagatatac atatgatgcc gattcgtgtg ccgg 34

<210> 32

<211> 48

<212> DNA

<213> Artificial sequence

<400> 32

ggtttcttta ccagactcga gttaatccag cgttggattc atgtgccg 48

<210> 33

<211> 25

<212> DNA

<213> Artificial sequence

<400> 33

gtgatgacaa cttcttgtgc gtctg 25

<210> 34

<211> 25

<212> DNA

<213> Artificial sequence

<400> 34

aagaagttgt catcacaaag acgtt 25

<210> 35

<211> 28

<212> DNA

<213> Artificial sequence

<400> 35

tggaattcat ggcaaaacac ctttttac 28

<210> 36

<211> 29

<212> DNA

<213> Artificial sequence

<400> 36

gccaagcttt tacttcagac cggcagcat 29

<210> 37

<211> 25

<212> DNA

<213> Artificial sequence

<400> 37

tcactgcata attcgtgtcg ctcaa 25

<210> 38

<211> 25

<212> DNA

<213> Artificial sequence

<400> 38

cgctactgcc gccaggcaaa ttctg 25

<210> 39

<211> 41

<212> DNA

<213> Artificial sequence

<400> 39

agcctacacg ctagcggatc cttgacaatt aatcatccgg c 41

<210> 40

<211> 41

<212> DNA

<213> Artificial sequence

<400> 40

agtatctcag gtaccgagct cttacttcag accggcagca t 41

<210> 41

<211> 25

<212> DNA

<213> Artificial sequence

<400> 41

tcttctaata aggggatctt gaagt 25

<210> 42

<211> 25

<212> DNA

<213> Artificial sequence

<400> 42

cgctgttgcg gatcatctcc agcgt 25

<210> 43

<211> 47

<212> DNA

<213> Artificial sequence

<400> 43

cgcgcggatc ttccagagat tgggcccgcg agcttccggg acgtccg 47

<210> 44

<211> 47

<212> DNA

<213> Artificial sequence

<400> 44

aagcttgacg tccaggtgcc tcttaagatt taatatcacc taaagag 47

<210> 45

<211> 47

<212> DNA

<213> Artificial sequence

<400> 45

cacgctagcg gatccgagct cggtacctct ttcttcacct gcgttca 47

<210> 46

<211> 47

<212> DNA

<213> Artificial sequence

<400> 46

cgtgcggacg gcaagctgct acagctgctg gcaggaagaa gacacca 47

<210> 47

<211> 25

<212> DNA

<213> Artificial sequence

<400> 47

tgaattagaa ctcggtacgc gcgga 25

<210> 48

<211> 25

<212> DNA

<213> Artificial sequence

<400> 48

tagagaatag gaacttcgaa ctgca 25

<210> 49

<211> 25

<212> DNA

<213> Artificial sequence

<400> 49

aacttcgaag cagctccagc ctaca 25

<210> 50

<211> 25

<212> DNA

<213> Artificial sequence

<400> 50

atgattacgc caagtttgca cgcct 25

<210> 51

<211> 25

<212> DNA

<213> Artificial sequence

<400> 51

ggaacgcaaa cggtgctgca ggatc 25

<210> 52

<211> 25

<212> DNA

<213> Artificial sequence

<400> 52

cgccctgagt gcttgcggca gcgtg 25

<210> 53

<211> 41

<212> DNA

<213> Artificial sequence

<400> 53

aggaaacaga ccatggaatt catgaaatca atgaatattg c 41

<210> 54

<211> 41

<212> DNA

<213> Artificial sequence

<400> 54

tccgccaaaa cagccaagct tttacttcaa cacataaccg t 41

<210> 55

<211> 25

<212> DNA

<213> Artificial sequence

<400> 55

tcactgcata attcgtgtcg ctcaa 25

<210> 56

<211> 25

<212> DNA

<213> Artificial sequence

<400> 56

cgctactgcc gccaggcaaa ttctg 25

<210> 57

<211> 41

<212> DNA

<213> Artificial sequence

<400> 57

agcctacacg ctagcggatc cttgacaatt aatcatccgg c 41

<210> 58

<211> 44

<212> DNA

<213> Artificial sequence

<400> 58

atcagtatct caggtaccga gctcttactt caacacataa ccgt 44

<210> 59

<211> 25

<212> DNA

<213> Artificial sequence

<400> 59

tcttctaata aggggatctt gaagt 25

<210> 60

<211> 25

<212> DNA

<213> Artificial sequence

<400> 60

cgctgttgcg gatcatctcc agcgt 25

<210> 61

<211> 47

<212> DNA

<213> Artificial sequence

<400> 61

cgcgcggatc ttccagagat tgggcccggt tgccagcagc aataaac 47

<210> 62

<211> 47

<212> DNA

<213> Artificial sequence

<400> 62

aagcttgacg tccaggtgcc tcttaagaag cgcaaacccg tttcggg 47

<210> 63

<211> 47

<212> DNA

<213> Artificial sequence

<400> 63

cacgctagcg gatccgagct cggtaccgaa taaaaaaaac gggtcac 47

<210> 64

<211> 47

<212> DNA

<213> Artificial sequence

<400> 64

cgtgcggacg gcaagctgct acagctgtcg tttgcttata tgccaac 47

<210> 65

<211> 25

<212> DNA

<213> Artificial sequence

<400> 65

tgaattagaa ctcggtacgc gcgga 25

<210> 66

<211> 25

<212> DNA

<213> Artificial sequence

<400> 66

tagagaatag gaacttcgaa ctgca 25

<210> 67

<211> 25

<212> DNA

<213> Artificial sequence

<400> 67

aacttcgaag cagctccagc ctaca 25

<210> 68

<211> 25

<212> DNA

<213> Artificial sequence

<400> 68

atgattacgc caagtttgca cgcct 25

<210> 69

<211> 25

<212> DNA

<213> Artificial sequence

<400> 69

caaaccaggc ggtccaggcg gcgga 25

<210> 70

<211> 25

<212> DNA

<213> Artificial sequence

<400> 70

cgccctgagt gcttgcggca gcgtg 25

<210> 71

<211> 41

<212> DNA

<213> Artificial sequence

<400> 71

aggaaacaga ccatggaatt catggccgaa aaaaaacagt g 41

<210> 72

<211> 41

<212> DNA

<213> Artificial sequence

<400> 72

tccgccaaaa cagccaagct tttaggacgg ctgtgaagcc a 41

<210> 73

<211> 25

<212> DNA

<213> Artificial sequence

<400> 73

tcactgcata attcgtgtcg ctcaa 25

<210> 74

<211> 25

<212> DNA

<213> Artificial sequence

<400> 74

cgctactgcc gccaggcaaa ttctg 25

<210> 75

<211> 41

<212> DNA

<213> Artificial sequence

<400> 75

agcctacacg ctagcggatc cttgacaatt aatcatccgg c 41

<210> 76

<211> 44

<212> DNA

<213> Artificial sequence

<400> 76

atcagtatct caggtaccga gctcttagga cggctgtgaa gcca 44

<210> 77

<211> 25

<212> DNA

<213> Artificial sequence

<400> 77

tcttctaata aggggatctt gaagt 25

<210> 78

<211> 25

<212> DNA

<213> Artificial sequence

<400> 78

cgctgttgcg gatcatctcc agcgt 25

<210> 79

<211> 47

<212> DNA

<213> Artificial sequence

<400> 79

cgcgcggatc ttccagagat tgggccctca ccgagcgctt gccacct 47

<210> 80

<211> 47

<212> DNA

<213> Artificial sequence

<400> 80

aagcttgacg tccaggtgcc tcttaagggg ttgatacctc ctttgtt 47

<210> 81

<211> 47

<212> DNA

<213> Artificial sequence

<400> 81

cacgctagcg gatccgagct cggtaccgga gaagataaga aattgaa 47

<210> 82

<211> 47

<212> DNA

<213> Artificial sequence

<400> 82

cgtgcggacg gcaagctgct acagctggag gtgatggttc gcgccaa 47

<210> 83

<211> 25

<212> DNA

<213> Artificial sequence

<400> 83

tgaattagaa ctcggtacgc gcgga 25

<210> 84

<211> 25

<212> DNA

<213> Artificial sequence

<400> 84

tagagaatag gaacttcgaa ctgca 25

<210> 85

<211> 25

<212> DNA

<213> Artificial sequence

<400> 85

aacttcgaag cagctccagc ctaca 25

<210> 86

<211> 25

<212> DNA

<213> Artificial sequence

<400> 86

atgattacgc caagtttgca cgcct 25

<210> 87

<211> 25

<212> DNA

<213> Artificial sequence

<400> 87

atggccgaaa aaaaacagtg gcatg 25

<210> 88

<211> 25

<212> DNA

<213> Artificial sequence

<400> 88

cgccctgagt gcttgcggca gcgtg 25

<210> 89

<211> 47

<212> DNA

<213> Artificial sequence

<400> 89

cgcgcggatc ttccagagat tgggcccggc tttcatccgc cggaact 47

<210> 90

<211> 47

<212> DNA

<213> Artificial sequence

<400> 90

aagcttgacg tccaggtgcc tcttaaggta aacgcaacgg atggctt 47

<210> 91

<211> 47

<212> DNA

<213> Artificial sequence

<400> 91

cacgctagcg gatccgagct cggtaccgtt ccagaatgta gtgattg 47

<210> 92

<211> 47

<212> DNA

<213> Artificial sequence

<400> 92

cgtgcggacg gcaagctgct acagctgtgt cgttgttcat cagcagg 47

<210> 93

<211> 25

<212> DNA

<213> Artificial sequence

<400> 93

tgaattagaa ctcggtacgc gcgga 25

<210> 94

<211> 25

<212> DNA

<213> Artificial sequence

<400> 94

tagagaatag gaacttcgaa ctgca 25

<210> 95

<211> 25

<212> DNA

<213> Artificial sequence

<400> 95

aacttcgaag cagctccagc ctaca 25

<210> 96

<211> 25

<212> DNA

<213> Artificial sequence

<400> 96

atgattacgc caagtttgca cgcct 25

<210> 97

<211> 25

<212> DNA

<213> Artificial sequence

<400> 97

cggtcgaaat cacggatgat gtagt 25

<210> 98

<211> 25

<212> DNA

<213> Artificial sequence

<400> 98

cgccctgagt gcttgcggca gcgtg 25

<210> 99

<211> 41

<212> DNA

<213> Artificial sequence

<400> 99

aggaaacaga ccatggaatt catgtatatt tattggattt t 41

<210> 100

<211> 41

<212> DNA

<213> Artificial sequence

<400> 100

tccgccaaaa cagccaagct ttcaggcaag tttcaccatg a 41

<210> 101

<211> 25

<212> DNA

<213> Artificial sequence

<400> 101

tcactgcata attcgtgtcg ctcaa 25

<210> 102

<211> 25

<212> DNA

<213> Artificial sequence

<400> 102

cgctactgcc gccaggcaaa ttctg 25

<210> 103

<211> 41

<212> DNA

<213> Artificial sequence

<400> 103

agcctacacg ctagcggatc cttgacaatt aatcatccgg c 41

<210> 104

<211> 41

<212> DNA

<213> Artificial sequence

<400> 104

agtatctcag gtaccgagct ctcaggcaag tttcaccatg a 41

<210> 105

<211> 25

<212> DNA

<213> Artificial sequence

<400> 105

tcttctaata aggggatctt gaagt 25

<210> 106

<211> 25

<212> DNA

<213> Artificial sequence

<400> 106

cgctgttgcg gatcatctcc agcgt 25

<210> 107

<211> 53

<212> DNA

<213> Artificial sequence

<400> 107

cgcgcggatc ttccagagat tgggcccccc ggggataatg agaaacactg tca 53

<210> 108

<211> 47

<212> DNA

<213> Artificial sequence

<400> 108

aagcttgacg tccaggtgcc tcttaagtgt ccttctcctg caagaga 47

<210> 109

<211> 47

<212> DNA

<213> Artificial sequence

<400> 109

cacgctagcg gatccgagct cggtacctga agacgctgcc cgcgctg 47

<210> 110

<211> 53

<212> DNA

<213> Artificial sequence

<400> 110

cgtgcggacg gcaagctgct acagctgggg cccttttatg cgcactgatt acc 53

<210> 111

<211> 25

<212> DNA

<213> Artificial sequence

<400> 111

tgaattagaa ctcggtacgc gcgga 25

<210> 112

<211> 25

<212> DNA

<213> Artificial sequence

<400> 112

tagagaatag gaacttcgaa ctgca 25

<210> 113

<211> 25

<212> DNA

<213> Artificial sequence

<400> 113

aacttcgaag cagctccagc ctaca 25

<210> 114

<211> 25

<212> DNA

<213> Artificial sequence

<400> 114

atgattacgc caagtttgca cgcct 25

<210> 115

<211> 25

<212> DNA

<213> Artificial sequence

<400> 115

gccagcaatc cccagacaaa agcga 25

<210> 116

<211> 25

<212> DNA

<213> Artificial sequence

<400> 116

cgccctgagt gcttgcggca gcgtg 25

<210> 117

<211> 47

<212> DNA

<213> Artificial sequence

<400> 117

cgcgcggatc ttccagagat tgggcccccc cgcttgtaaa tgcccac 47

<210> 118

<211> 47

<212> DNA

<213> Artificial sequence

<400> 118

aagcttgacg tccaggtgcc tcttaagaga gagcgctaat ggccgcc 47

<210> 119

<211> 47

<212> DNA

<213> Artificial sequence

<400> 119

cacgctagcg gatccgagct cggtaccctg cggttagtcg ctggttg 47

<210> 120

<211> 47

<212> DNA

<213> Artificial sequence

<400> 120

cgtgcggacg gcaagctgct acagctgttc agtcgccacc gtttccc 47

<210> 121

<211> 25

<212> DNA

<213> Artificial sequence

<400> 121

tgaattagaa ctcggtacgc gcgga 25

<210> 122

<211> 25

<212> DNA

<213> Artificial sequence

<400> 122

tagagaatag gaacttcgaa ctgca 25

<210> 123

<211> 25

<212> DNA

<213> Artificial sequence

<400> 123

aacttcgaag cagctccagc ctaca 25

<210> 124

<211> 25

<212> DNA

<213> Artificial sequence

<400> 124

atgattacgc caagtttgca cgcct 25

<210> 125

<211> 25

<212> DNA

<213> Artificial sequence

<400> 125

gtgtttgata ccgcggcgat ccatg 25

<210> 126

<211> 25

<212> DNA

<213> Artificial sequence

<400> 126

cgccctgagt gcttgcggca gcgtg 25

<210> 127

<211> 47

<212> DNA

<213> Artificial sequence

<400> 127

cgcgcggatc ttccagagat tgggcccagc tggctgaaga ataaaca 47

<210> 128

<211> 47

<212> DNA

<213> Artificial sequence

<400> 128

aagcttgacg tccaggtgcc tcttaaggtc agactcctaa cttccat 47

<210> 129

<211> 47

<212> DNA

<213> Artificial sequence

<400> 129

cacgctagcg gatccgagct cggtaccatg aaactctaca atctgaa 47

<210> 130

<211> 47

<212> DNA

<213> Artificial sequence

<400> 130

cgtgcggacg gcaagctgct acagctgcat catccacggc tgcataa 47

<210> 131

<211> 25

<212> DNA

<213> Artificial sequence

<400> 131

tgaattagaa ctcggtacgc gcgga 25

<210> 132

<211> 25

<212> DNA

<213> Artificial sequence

<400> 132

tagagaatag gaacttcgaa ctgca 25

<210> 133

<211> 25

<212> DNA

<213> Artificial sequence

<400> 133

aacttcgaag cagctccagc ctaca 25

<210> 134

<211> 25

<212> DNA

<213> Artificial sequence

<400> 134

atgattacgc caagtttgca cgcct 25

<210> 135

<211> 25

<212> DNA

<213> Artificial sequence

<400> 135

tcatcagatg ctgttcaata ccgat 25

<210> 136

<211> 25

<212> DNA

<213> Artificial sequence

<400> 136

cgccctgagt gcttgcggca gcgtg 25

<210> 137

<211> 47

<212> DNA

<213> Artificial sequence

<400> 137

cgcgcggatc ttccagagat tgggcccgcc gccgcctgta gcgataa 47

<210> 138

<211> 47

<212> DNA

<213> Artificial sequence

<400> 138

aagcttgacg tccaggtgcc tcttaagtgc ctcactcctg ccgtgaa 47

<210> 139

<211> 47

<212> DNA

<213> Artificial sequence

<400> 139

cacgctagcg gatccgagct cggtacctga ctttcgccgg acgtcag 47

<210> 140

<211> 47

<212> DNA

<213> Artificial sequence

<400> 140

cgtgcggacg gcaagctgct acagctgcgt gcggttggcc tggctgg 47

<210> 141

<211> 25

<212> DNA

<213> Artificial sequence

<400> 141

tgaattagaa ctcggtacgc gcgga 25

<210> 142

<211> 25

<212> DNA

<213> Artificial sequence

<400> 142

tagagaatag gaacttcgaa ctgca 25

<210> 143

<211> 25

<212> DNA

<213> Artificial sequence

<400> 143

aacttcgaag cagctccagc ctaca 25

<210> 144

<211> 25

<212> DNA

<213> Artificial sequence

<400> 144

atgattacgc caagtttgca cgcct 25

<210> 145

<211> 25

<212> DNA

<213> Artificial sequence

<400> 145

cagcttgcag tcggttaacc aggac 25

<210> 146

<211> 25

<212> DNA

<213> Artificial sequence

<400> 146

cgccctgagt gcttgcggca gcgtg 25

<210> 147

<211> 47

<212> DNA

<213> Artificial sequence

<400> 147

cgcgcggatc ttccagagat tgggcccttg catttcctta aactgta 47

<210> 148

<211> 47

<212> DNA

<213> Artificial sequence

<400> 148

aagcttgacg tccaggtgcc tcttaaggat tcttcgcctt tggtttg 47

<210> 149

<211> 47

<212> DNA

<213> Artificial sequence

<400> 149

cacgctagcg gatccgagct cggtacctac cccttgcggg gttgttt 47

<210> 150

<211> 46

<212> DNA

<213> Artificial sequence

<400> 150

cgtgcggacg gcaagctgct acagcttccg gcgtctcttc cgaaag 46

<210> 151

<211> 25

<212> DNA

<213> Artificial sequence

<400> 151

tgaattagaa ctcggtacgc gcgga 25

<210> 152

<211> 25

<212> DNA

<213> Artificial sequence

<400> 152

tagagaatag gaacttcgaa ctgca 25

<210> 153

<211> 25

<212> DNA

<213> Artificial sequence

<400> 153

aacttcgaag cagctccagc ctaca 25

<210> 154

<211> 25

<212> DNA

<213> Artificial sequence

<400> 154

atgattacgc caagtttgca cgcct 25

<210> 155

<211> 25

<212> DNA

<213> Artificial sequence

<400> 155

gtcagcccgg agagttcggc ggcac 25

<210> 156

<211> 25

<212> DNA

<213> Artificial sequence

<400> 156

cgccctgagt gcttgcggca gcgtg 25

<210> 157

<211> 36

<212> DNA

<213> Artificial sequence

<400> 157

ccacagccag gatccgatga acatgggaaa agcgtt 36

<210> 158

<211> 41

<212> DNA

<213> Artificial sequence

<400> 158

gcattatgcg gccgcaagct tttaatctac cagcaccgga t 41

<210> 159

<211> 41

<212> DNA

<213> Artificial sequence

<400> 159

gcgatcgctg acgtcggtac cttggttaaa aaagaaaata t 41

<210> 160

<211> 41

<212> DNA

<213> Artificial sequence

<400> 160

ggtttcttta ccagactcga gtcaactcat tctgtcgcga t 41

Claims

1. An escherichia coli genetic engineering bacterium is characterized in that a metJ gene for coding a DNA combined transcription inhibitor and an argR gene for coding a DNA combined double transcription regulator in an escherichia coli genome are knocked out, and a negative feedback mutant is constructed by mutating a metA gene for coding homoserine O-succinyltransferase so as to relieve the feedback inhibition of methionine on homoserine O-succinyltransferase.

2. The engineered Escherichia coli strain of claim 1, wherein the metK gene encoding methionine adenosyltransferase, the speC gene encoding ornithine decarboxylase, the speDE gene encoding S-adenosylmethionine decarboxylase and spermidine synthase are naturally expressed in the form of a strong promoter.

3. The engineered Escherichia coli strain of claim 2, wherein the strong promoter is trc promoter.

4. The genetically engineered Escherichia coli of claim 1 or 2, wherein a transporter PotABCD for transferring spermidine into the cell is knocked out and a native promoter of a gene encoding a transporter MdtJI protein for transferring spermidine into the cell is replaced with a strong promoter.

5. The engineered Escherichia coli bacterium according to any one of claims 1, 2 or 4, wherein lysA gene encoding diaminopimelate decarboxylase is further deleted, or thrB and thrC genes encoding homoserine kinase and threonine synthase are further deleted on the basis of deletion of lysA gene, or proC is further deleted on the basis of deletion of lysA, thrB and thrC genes.

6. The genetically engineered Escherichia coli according to any one of claims 1, 2, 4 or 5, wherein a puuA gene encoding glutamic acid-putrescine ligase is further knocked out.

7. The genetically engineered Escherichia coli according to claim 1, 2, 4, 5 or 6, wherein an exogenous pathway for synthesizing spermidine is introduced.

8. The engineered Escherichia coli strain of claim 7, wherein the exogenous means for introducing the synthetic spermidine is expression of exogenous carboxy spermidine dehydrogenase gene and exogenous carboxy spermidine decarboxylase gene.

9. The engineered Escherichia coli strain of any one of claims 1 to 8, wherein the host is Escherichia coli BL21(DE3), Escherichia coli JM109, Escherichia coli DH5 α, Escherichia coli Top10 or Escherichia coli MG 1655.

10. The use of an engineered Escherichia coli strain of any one of claims 1 to 9 in the production of spermidine.