CN117165549A - Cystathionine-gamma-synthase mutant and application thereof - Google Patents

Cystathionine-gamma-synthase mutant and application thereof Download PDF

Info

Publication number
CN117165549A
CN117165549A CN202311111182.5A CN202311111182A CN117165549A CN 117165549 A CN117165549 A CN 117165549A CN 202311111182 A CN202311111182 A CN 202311111182A CN 117165549 A CN117165549 A CN 117165549A
Authority
CN
China
Prior art keywords
cystathionine
metb
gamma
synthase
mutant
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202311111182.5A
Other languages
Chinese (zh)
Inventor
张成林
闫倩玉
芦楠
孙浩
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tianjin University of Science and Technology
Original Assignee
Tianjin University of Science and Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tianjin University of Science and Technology filed Critical Tianjin University of Science and Technology
Priority to CN202311111182.5A priority Critical patent/CN117165549A/en
Publication of CN117165549A publication Critical patent/CN117165549A/en
Pending legal-status Critical Current

Links

Classifications

    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Enzymes And Modification Thereof (AREA)

Abstract

The invention relates to a high-activity cystathionine-gamma-synthase mutant and application thereof. In order to overcome the problems of low L-methionine synthesis efficiency and the like caused by low cystathionine-gamma-synthase activity, the invention provides a high-activity cystathionine-gamma-synthase mutant and application of the mutant to L-methionine biosynthesis. The cystathionine-gamma-synthase mutant MetB M Is obtained by mutating Q5R, F I, E136G, V231E, F321V and A346T based on wild-type cystathionine-gamma-synthase derived from Escherichia coli W3110. The Km and Kcat of the enzyme were 0.13mmol/L and 138.2s, respectively ‑1 Kcat/Km is 1063.1 (mmol/L) ‑1 S ‑1 The specific activity is 195.3U/mg. The substrate binding efficiency and enzyme activity were higher than those of wild type MetB. The cystathionine-gamma-synthase mutant is applied to L-methionine synthesis,the yield is improved by 11 times, and the method can be widely used for producing L-methionine.

Description

Cystathionine-gamma-synthase mutant and application thereof
Technical field:
the invention relates to a high-activity cystathionine-gamma-synthase mutant and application thereof, and belongs to the field of metabolic engineering.
The background technology is as follows:
l-methionine, also known as "L-methionine", is the only sulfur-containing amino acid of the eight essential amino acids, belonging to the aspartate family of amino acids as are L-threonine, L-isoleucine and L-lysine. L-methionine plays an extremely important role in many bodily functions. In addition to its role in protein biosynthesis, it can also be involved in methyl transfer, phosphorus metabolism, and selenium and zinc bioavailable. L-methionine can also be used directly in the treatment of medical conditions such as allergies and wind-damp-heat. However, L-methionine cannot be synthesized by itself in higher animals and is taken up from the outside. Today, most of the industrially produced L-methionine is added to animal feeds to promote animal growth and reproduction and reduce production costs. Because of the special biological and chemical activities of L-methionine and its derivatives, the L-methionine is widely applied to industries such as food, medicine, agriculture, cosmetics, feed additives and the like. At present, L-methionine is mainly synthesized by a chemical method, but the problems of toxic synthesis raw materials, high energy consumption, harsh reaction conditions, complex extraction process, environmental pollution and the like exist. In contrast, the microbial fermentation method has low production cost, mild conditions and environmental protection, and is widely applied to the production of various amino acids in recent years.
In the L-methionine biosynthetic pathway, metB-encoded cystathionine-gamma-synthase is a key enzyme. The enzyme catalyzes the production of cystathionine and succinic acid from L-cysteine and O-succinyl-homoserine. Cystathionine forms L-homocysteine under the action of beta-cystathionine enzyme, and then L-homocysteine forms L-methionine under the catalysis of homocysteine methyltransferase. Insufficient cystathionine-gamma-synthase activity limits the efficient synthesis of L-methionine to a large extent.
The invention comprises the following steps:
in order to overcome the problems of low L-methionine synthesis efficiency and the like caused by low cystathionine-gamma-synthase activity, the invention provides a high-activity cystathionine-gamma-synthase mutant and application of the mutant to L-methionine biosynthesis.
One of the technical schemes for solving the problems of the invention is as follows: provides a high activitySex cystathionine-gamma-synthase mutant MetB M The amino acid sequence is shown as SEQ ID NO.1, and the cystathionine-gamma-synthase mutant MetB M Is obtained by mutating Q5R, F87I, E136G, V E, F V and A346T on the basis of wild-type cystathionine-gamma-synthase derived from Escherichia coli (Escherichia coli) W3110 shown in SEQ ID NO. 3.
The second technical proposal provided by the invention is the cystathionine-gamma-synthase mutant MetB M Is a coding gene of (a);
further, the encoding gene of the cystathionine-gamma-synthase mutant is metB M The nucleotide sequence is shown in a sequence table SEQ ID NO. 2.
The third technical scheme provided by the invention is the cystathionine-gamma-synthase mutant MetB M Particularly in the production of L-methionine.
The beneficial effects are that:
metB of the invention M Gene-encoded cystathionine-gamma-synthase MetB M Has the following characteristics: the Km and Kcat of the enzyme were 0.13mmol/L and 138.2s, respectively -1 Kcat/Km is 1063.1 (mmol/L) -1 S -1 The specific activity is 195.3U/mg. The substrate binding efficiency and enzyme activity were higher than those of wild type MetB.
Description of the drawings:
FIG. 1 is a schematic diagram of the screening principle of the high-activity cystathionine-gamma-synthase mutant;
FIG. 2 strain biomass.
The specific embodiment is as follows:
in order to make the objects, technical solutions and advantages of the present patent more apparent, the present patent will be described in further detail below with reference to specific embodiments. It should be understood that the specific embodiments described herein are for purposes of illustration only and are not intended to limit the scope of the present invention.
In the present invention, the mutant MetB M The screening process is as follows:
the library of metB mutants was obtained using error-prone PCR and ligated into pUC19 to obtain a library of recombinant plasmids containing metB mutants (designated pUC-metBs). Then taking Escherichia coli Escherichia coli W3110 as an initial strain, and sequentially knocking out the cystathionine-gamma-synthase encoding gene metB and the succinyl-CoA encoding gene sucCD (obtaining strain MET 02). pUC-metBs library was transformed to MET02 and plated on solid screening media. Larger colonies were picked and inoculated into 96 well cell culture plate liquid screening media. Selecting a strain with fast growth, extracting plasmids, and amplifying the encoding gene of the cystathionine-gamma-synthase mutant by PCR. The PCR product was recovered and sequenced, and the enzyme was found to have the following amino acid mutations relative to the wild-type cystathionine-gamma-synthase from E.coli W3110: Q5R, F87I, E136G, V231E, F321V, A346T.
The following definitions are employed in the present invention:
1. nomenclature of amino acids and DNA nucleic acid sequences
Using the accepted IUPAC nomenclature for amino acid residues, the three letter/single letter code format is used. The DNA nucleic acid sequence uses accepted IUPAC nomenclature.
2. Identification of cystathionine-gamma-synthase mutants
The "original amino acid+position+substituted amino acid" is used to list the mutated amino acids in the cystathionine-gamma-synthase mutant. If Q5R, the amino acid at position 5 is replaced by Arg from Gln of wild-type cystathionine-gamma-synthase, Q5 indicates that the amino acid at position 5 is Gln, and the numbering of the positions corresponds to the amino acid sequence numbering of wild-type cystathionine-gamma-synthase in SEQ ID NO. 3.
In the invention, metB represents a wild-type cystathionine-gamma-synthase encoding gene (shown as SEQ ID NO. 4), and MetB represents a wild-type cystathionine-gamma-synthase (shown as SEQ ID NO. 3); metB M Is cystathionine-gamma-synthase mutant gene (shown in SEQ ID NO. 2); metB (MetbMetbMetbMetbMetbMetbMetbMetb M Is cystathionine-gamma-synthase mutant (shown in SEQ ID NO. 1). Amino acid comparison before and after mutation is shown in the following table:
cystathionine-gamma-synthase Amino acids
MetB Q5、F87、E136、V231、F321、A346
MetB M Q5R、F87I、E136G、V231E、F321V、A346T
The cystathionine-gamma-synthase mutant MetB M Has the following enzymatic properties: km, kcat and specific activity of 0.13mmol/L and 138.2s respectively -1 And 195.3U/mg, kcat/Km of 1063.1 (mmol/L) -1 S -1 。
The partial gene or amino acid sequence related to the invention is as follows:
cystathionine-gamma-synthase mutant MetB M ，SEQ ID NO.1：
MTRKRATIAVRSGLNDDEQYGCVVPPIHLSSTYNFTGFNEPRAHDYSRRGNPTRDVVQRALAELEGGAGAVLTNTGMSAIHLVTTVILKPGDLLVAPHDCYGGSYRLFDSLAKRGCYRVLFVDQGDEQALRAALAGKPKLVLVESPSNPLLRVVDIAKICHLAREVGAVSVVDNTFLSPALQNPLALGADLVLHSCTKYLNGHSDVVAGVVIAKDPDVVTELAWWANNIGETGGAFDSYLLLRGLRTLVPRMELAQRNAQAIVKYLQTQPLVKKLYHPSLPENQGHEIAARQQKGFGAMLSFELDGDEQTLRRFLGGLSLVTLAESLGGVESLISHAATMTHAGMTPEARAAAGISETLLRISTGIEDGEDLIADLENGFRAANKG。
Cystathionine-gamma-synthase mutant gene metB M ，SEQ ID NO.2：
ATGACGCGTAAACGGGCCACCATCGCAGTGCGTAGCGGGTTAAATGACGACGAACAGTATGGTTGCGTTGTCCCACCGATCCATCTTTCCAGCACCTATAACTTTACCGGATTTAATGAACCGCGCGCGCATGATTACTCGCGTCGCGGCAACCCAACGCGCGATGTGGTTCAGCGTGCGCTGGCAGAACTGGAAGGTGGTGCTGGTGCAGTACTTACTAATACCGGCATGTCCGCGATTCACCTGGTAACGACCGTCATTTTGAAACCTGGCGATCTGCTGGTTGCGCCGCACGACTGCTACGGCGGTAGCTATCGCCTGTTCGACAGTCTGGCGAAACGCGGTTGCTATCGCGTGTTGTTTGTTGATCAAGGCGATGAACAGGCATTACGGGCAGCGCTGGCAGGAAAACCCAAACTGGTACTGGTAGAAAGCCCAAGTAATCCATTGTTACGCGTCGTGGATATTGCGAAAATCTGCCATCTGGCAAGGGAAGTCGGGGCGGTGAGCGTGGTGGATAACACCTTCTTAAGCCCGGCATTACAAAATCCGCTGGCATTAGGTGCCGATCTGGTGTTGCATTCATGCACGAAATATCTGAACGGTCACTCAGACGTAGTGGCCGGCGTGGTGATTGCTAAAGACCCGGACGTTGTCACTGAACTGGCCTGGTGGGCAAACAATATTGGCGAGACGGGCGGCGCGTTTGACAGCTATCTGCTGCTACGTGGGTTGCGAACGCTGGTGCCGCGTATGGAGCTGGCGCAGCGCAACGCGCAGGCGATTGTGAAATACCTGCAAACCCAGCCGTTGGTGAAAAAACTGTATCACCCGTCGTTGCCGGAAAATCAGGGGCATGAAATTGCCGCGCGCCAGCAAAAAGGCTTTGGCGCAATGTTGAGTTTTGAACTGGATGGCGATGAGCAGACGCTGCGTCGTTTCCTGGGCGGGCTGTCGTTGGTTACGCTGGCGGAATCATTAGGGGGAGTGGAAAGTTTAATCTCTCACGCCGCAACCATGACACATGCAGGCATGACACCAGAAGCGCGTGCTGCCGCCGGGATCTCCGAGACGCTGCTGCGTATCTCCACCGGTATTGAAGATGGCGAAGATTTAATTGCCGACCTGGAAAATGGCTTCCGGGCTGCAAACAAGGGGTAA。
Wild-type cystathionine-gamma-synthase MetB, SEQ ID NO.3:
MTRKQATIAVRSGLNDDEQYGCVVPPIHLSSTYNFTGFNEPRAHDYSRRGNPTRDVVQRALAELEGGAGAVLTNTGMSAIHLVTTVFLKPGDLLVAPHDCYGGSYRLFDSLAKRGCYRVLFVDQGDEQALRAALAEKPKLVLVESPSNPLLRVVDIAKICHLAREVGAVSVVDNTFLSPALQNPLALGADLVLHSCTKYLNGHSDVVAGVVIAKDPDVVTELAWWANNIGVTGGAFDSYLLLRGLRTLVPRMELAQRNAQAIVKYLQTQPLVKKLYHPSLPENQGHEIAARQQKGFGAMLSFELDGDEQTLRRFLGGLSLFTLAESLGGVESLISHAATMTHAGMAPEARAAAGISETLLRISTGIEDGEDLIADLENGFRAANKG。
wild-type cystathionine-gamma-synthase encoding gene metB, SEQ ID NO.4:
ATGACGCGTAAACAGGCCACCATCGCAGTGCGTAGCGGGTTAAATGACGACGAACAGTATGGTTGCGTTGTCCCACCGATCCATCTTTCCAGCACCTATAACTTTACCGGATTTAATGAACCGCGCGCGCATGATTACTCGCGTCGCGGCAACCCAACGCGCGATGTGGTTCAGCGTGCGCTGGCAGAACTGGAAGGTGGTGCTGGTGCAGTACTTACTAATACCGGCATGTCCGCGATTCACCTGGTAACGACCGTCTTTTTGAAACCTGGCGATCTGCTGGTTGCGCCGCACGACTGCTACGGCGGTAGCTATCGCCTGTTCGACAGTCTGGCGAAACGCGGTTGCTATCGCGTGTTGTTTGTTGATCAAGGCGATGAACAGGCATTACGGGCAGCGCTGGCAGAAAAACCCAAACTGGTACTGGTAGAAAGCCCAAGTAATCCATTGTTACGCGTCGTGGATATTGCGAAAATCTGCCATCTGGCAAGGGAAGTCGGGGCGGTGAGCGTGGTGGATAACACCTTCTTAAGCCCGGCATTACAAAATCCGCTGGCATTAGGTGCCGATCTGGTGTTGCATTCATGCACGAAATATCTGAACGGTCACTCAGACGTAGTGGCCGGCGTGGTGATTGCTAAAGACCCGGACGTTGTCACTGAACTGGCCTGGTGGGCAAACAATATTGGCGTGACGGGCGGCGCGTTTGACAGCTATCTGCTGCTACGTGGGTTGCGAACGCTGGTGCCGCGTATGGAGCTGGCGCAGCGCAACGCGCAGGCGATTGTGAAATACCTGCAAACCCAGCCGTTGGTGAAAAAACTGTATCACCCGTCGTTGCCGGAAAATCAGGGGCATGAAATTGCCGCGCGCCAGCAAAAAGGCTTTGGCGCAATGTTGAGTTTTGAACTGGATGGCGATGAGCAGACGCTGCGTCGTTTCCTGGGCGGGCTGTCGTTGTTTACGCTGGCGGAATCATTAGGGGGAGTGGAAAGTTTAATCTCTCACGCCGCAACCATGACACATGCAGGCATGGCACCAGAAGCGCGTGCTGCCGCCGGGATCTCCGAGACGCTGCTGCGTATCTCCACCGGTATTGAAGATGGCGAAGATTTAATTGCCGACCTGGAAAATGGCTTCCGGGCTGCAAACAAGGGGTAA。
the invention is further illustrated by the following examples.
Example 1: construction of metB knockout bacterium MET01
(1) Overlapping segment U metB -D metB Construction of (3)
The wild E.coli W3110 genome is used as a template, the primers metB-1/metB-2 and metB-3/metB-4 are used to amplify the upstream and downstream homology arms of metB, and then overlap PCR is used to obtain the fusion fragment U of the upstream and downstream homology arms of metB metB -D metB 。
(2) Construction of pGRB-metB plasmid
The gRNA20bp forward and reverse sequences pG-metB-1/pG-metB-2 were designed and synthesized according to the metB sequence, and after annealing, they were connected to plasmid pGRB by recombinant kit ClonExpress IIOne Step Cloning Kit (Nanjinouzan medical science and technology Co., ltd.) and were obtained by transforming E.coli DH 5. Alpha., screening with LB solid medium containing 100. Mu.g/mL ampicillin, and sequencing and identifying.
(3) Construction of metB knockout bacterium MET01
Recombinant plasmid pGRB-metB and fusion fragment U metB -D metB Electrotransformation into E.coli W3110 competent cells containing pREDcas9 plasmid, resuscitating, and plating onto LB solid culture containing 100. Mu.g/mL spectinomycin and ampicillin, and culturing overnight at constant temperature of 32 ℃. The next day colony PCR was performed with the primer metB-1/metB-4, and positive transformants were selected. Activating the transformant, adding arabinose with the final concentration of 0.2mmol/L, and carrying out shake culture at 32 ℃ overnight to ensure that pGRB-metB is lost; then shake culturing overnight at 42 ℃ to lose pREDcas9 plasmid and obtain metB knockout bacteriaStrain MET01.
Example 2: construction of sucCD knockout bacterium MET02
As shown in FIG. 1, succinic acid-CoA synthase encoded by sucCD catalyzes the production of succinic acid from succinic acid-CoA. Thus, after knocking out the sucCD gene of strain MET01, the strain could not grow on the screening medium due to succinic acid deficiency. Cystathionine-gamma-synthase catalyzes the production of cystathionine and succinic acid from L-cysteine and O-succinyl-homoserine, so that if metB is supplemented back in MET01 strain knocked out of sucCD gene, succinic acid can be provided for TCA cycle, and the strain resumes growth. And the higher the cystathionine-gamma-synthase activity is, the larger the succinic acid production amount is, and the faster the strain grows. By using this principle, a cystathionine-gamma-synthase mutant with high activity is obtained by screening strains that grow rapidly (are large in colony size).
(1) Overlapping segment U sucCD -D sucCD Construction of (3)
The upstream and downstream homology arms of the sucCD are amplified by using primers sucCD-1/sucCD-2 and sucCD-3/sucCD-4 respectively by using the wild escherichia coli W3110 genome as a template, and then fusion fragments U of the upstream and downstream homology arms of the sucCD are obtained by using overlap PCR sucCD -D sucCD 。
(2) Construction of pGRB-sucCD plasmid
The 20bp forward and reverse sequences pG-sucCD-1/pG-sucCD-2 of the gRNA are designed and synthesized according to the sucCD sequence, and after annealing, the sequences are connected to plasmid pGRB by using a recombination kit ClonExpress IIOne Step Cloning Kit (Nanjinouzan medical science and technology Co., ltd.) and the recombinant plasmid pGRB-sucCD is obtained through screening and sequencing identification of transformed E.coli DH5 alpha and LB solid medium containing 100 mug/mL ampicillin.
(3) Construction of sucCD knockout bacterium MET02
Recombinant plasmid pGRB-sucCD and fusion fragment U sucCD -D sucCD Electrotransformation into MET01 competent cells containing the pREDcas9 plasmid, resuscitating, and plating on LB solid culture with 100 μg/mL spectinomycin and ampicillin, and culturing overnight at 32 ℃. The next day colony PCR was performed with primers sucCD-1/sucCD-4 and positive transformants were selected. Activating the transformant, adding arabinose with a final concentration of 0.2mmol/L, shaking culture at 32 ℃After overnight incubation, pGRB-sucCD was lost; then, the pREDcas9 plasmid was lost by shaking culture at 42℃overnight to obtain the strain MET02.
Example 3: metB M Screening of (C)
The wild E.coli W3110 genome was used as a template, and error-prone PCR (i.e., the use of error-prone PCR kit, beijing Tian Enzem Gene technology Co., ltd.) was performed using primer ER-1/ER-2 to obtain the metB mutant library. The error-prone PCR reaction system was 30. Mu.L: error-prone PCR Mix 3. Mu.L, dNTP 3. Mu.L, 5mmol/LMnCl 2 3. Mu.L of template, 1. Mu.L of ER-1 and ER-2, 10. Mu.L each, 1. Mu.L of Taq DNA polymerase, and 30. Mu.L of deionized water. The PCR conditions were: 94 ℃ for 3min,1 cycle; 94℃for 1min s, 45℃for 90s, 72℃for 1min,30 cycles.
The amplified metB mutant was then recombined with the expression plasmid pUC19 (digested with HindIII) to obtain a recombinant plasmid library (designated pUC-metBs) containing the metB mutant.
pUC-metBs were transformed into MET 02-competent cells. MET02 transformed with pUC plasmid containing wild-type metB (designated pUC-metB) was used as a control (designated CK). Resuscitates and spreads on solid screening medium containing 100. Mu.g/mL ampicillin, and incubates at 37 ℃. 480 larger single colonies on the plates were picked the next day and transferred to ampicillin (100. Mu.g/mL) containing liquid screening medium on 96 well cell culture plates and cultured with shaking at 37℃for 24h. OD determination Using an enzyme-labeled Instrument 600 . Selecting OD 600 The highest 20 strains (designated as M1-M20 respectively) were inoculated in 1% inoculum size into a shaking tube containing 5mL of liquid screening medium for rescreening, shake-cultured at 37deg.C for 24h, and then OD was measured by a spectrophotometer 600 The results are shown in FIG. 2. Wherein OD of M4 600 The highest value (1.89) was 1.17 times higher than the control strain.
Extracting plasmid in M4, and metB mutant thereof M Sequencing was performed (this plasmid was designated pUC-metB M ). The nucleotide sequence result is shown as SEQ ID NO.2, and the corresponding amino acid sequence is shown as SEQ ID NO. 1.
The enzyme was found to undergo the following amino acid mutations relative to the wild-type cystathionine-gamma-synthase from E.coli Escherichia coli W3110: Q5R, F87I, E136G, V231E, F321V, A346T.
Solid screening medium: glucose 10g/L MgSO 4 0.24g/L，KH 2 PO 4 2.5g/L，(NH 4 ) 2 SO 4 5g/L，FeSO 4 2g/L, 20g/L of agar, 1000mL of deionized water and pH 6.5-7.0.
Liquid screening medium: glucose 10g/L MgSO 4 0.24g/L，KH 2 PO 4 2.5g/L，(NH 4 ) 2 SO 4 5g/L，FeSO 4 2g/L, 1000mL of deionized water and pH 6.5-7.0.
Example 4: enzymatic characterization of cystathionine-gamma-synthase
Respectively pUC-metB and pUC-metB M PCR amplification of metB and metB using primers CGS-1 and CGS-2 as templates M The recovered plasmid was electrophoretically connected to the Sac I digested expression vector pET-28a by using a recombination kit ClonExpress IIOne Step Cloning Kit (Nanjinouzan medical science and technology Co., ltd.) to obtain plasmids p28-metB and p28-metB M . Recombinant strains DE-CGS and DE-CGS were obtained by transforming them into E.coli BL21 (DE 3) competent cells, respectively M 。
DE-CGS and DE-CGS, respectively M Seed cultures were inoculated into LB liquid medium and induced to express with 0.1mmol/L IPTG for 4h. 1mL of the culture was collected by centrifugation at 10000g at 4℃for 1min, and the bacterial pellet was washed 3 times with 1mL of buffer (200 mmol/L Tris-HCl, pH 8.1) and resuspended in 1mL of buffer. The bacterial suspension is crushed by ultrasonic waves by an ultrasonic crusher, and the working conditions are as follows: the power was 350W, the on time was 5sec, the off time was 10sec, and 5 cycles were run on ice. Centrifuging the crushed solution at 8000g of 4deg.C, collecting supernatant, and separating and purifying recombinant cystathionine-gamma-synthase MetB and its mutant MetB by Ni-NTA affinity chromatography M 。
And taking a proper amount of recombinant enzyme solution to measure the enzyme activity. The reaction conditions are as follows: 50mmol/L Tris-HCl solution (pH 7.8) containing 20mmol/L O-succinyl-homoserine, 0.025-20mmol/L L-cysteine (L-cysteine concentration 20mmol/L in enzyme activity assay), 10. Mu.L cystathionine-gamma-synthase solution, 20. Mu. Mol/L pyridoxal phosphate. After incubation at 25℃for 30min, the reaction was quenched with acetone. The consumption of L-cysteine was determined by high performance liquid chromatography. The enzyme activity is defined as: the amount of enzyme required for 1. Mu. Mol L-cysteine conversion at 25℃and pH7.8 was one enzyme activity unit (U).
Detection of L-cysteine in the reaction solution: centrifuging the reaction solution for 10min at 8000 Xg, taking supernatant, diluting with deionized water for 10 times, performing derivatization reaction on the reaction solution by using 0.8% (V/V) 2, 4-dinitrofluorobenzene, and measuring the content of L-cysteine by adopting high performance liquid chromatography, wherein the detection conditions are as follows: agilent C18 (150 mm. Times.4.6 mm,5 μm) was eluted with a binary gradient of acetonitrile/sodium acetate at a column temperature of 33℃and a detection wavelength of 360nm.
Determination of MetB and MetB at different L-cysteine concentrations M Calculating the Km value of the enzyme by adopting a double reciprocal method; the enzyme activity was also measured at an L-cysteine concentration of 20 mmol/L. The specific results are shown in the following table.
Km Kcat Kcat/Km Specific enzyme activity (U/mg)
MetB 0.25mmol/L 111.9s -1 447.6(mmol/L) -1 S -1 ) 158.1
MetB M 0.13mmol/L 138.2s -1 1063.1(mmol/L) -1 S -1 195.3
From the above results, it can be seen that MetB M There is a certain difference from MetB in both Km and Kcat. The smaller Km, the stronger the substrate specificity; the larger Kcat indicates a faster rate of enzymatic conversion of the substrate. MetB (MetbMetbMetbMetbMetbMetbMetbMetb M The specific activity of (C) was 23.5% higher than that of MetB. Therefore, the affinity and the catalytic efficiency of the cystathionine-gamma-synthase mutant obtained by the invention with a substrate are higher than those of the wild cystathionine-gamma-synthase.
Example 5: application of high-activity cystathionine-gamma-synthase in L-methionine synthesis
(1) Respectively pUC-metB and pUC-metB M As templates, metB and metB were amplified using primers pS-1/pS-2, respectively M Plasmids pSTV-metB and pSTV-metB were obtained by ligating recombinant kit ClonExpress IIOne Step Cloning Kit (Nanjinouzan medical science Co., ltd.) to BamH I digested plasmid pSTV28 M . pSTV-metB and pSTV-metB, respectively M The strain was transformed into E.coli W3110 to obtain recombinant strains LMT-1 and LMT-2.
(2) LMT-1 and LMT-2 were inoculated into 30mL of minimal medium, respectively, and shake-cultured at 37℃and 220rpm for 24 hours.
The basic culture components are as follows: glucose 15g/L, mgSO 4 0.3g/L，KH 2 PO 4 2g/L，(NH 4 ) 2 SO 4 4g/L，MgSO 4 1g/L，FeSO 4 ·7H 2 O 10mg/L，MnSO 4 10mg/L, 1000mL of deionized water, pH 6.5-7.0.
(3) Detection of L-methionine in fermentation broths
Centrifuging the fermentation liquor by 8000 Xg for 10min, taking supernatant, diluting with deionized water, performing derivatization reaction on the fermentation liquor by using 0.8% (V/V) 2, 4-dinitrofluorobenzene, and determining the content of L-methionine by adopting high performance liquid chromatography, wherein the detection conditions are as follows: agilent C18 (150 mm. Times.4.6 mm,5 μm) was eluted with a binary gradient of acetonitrile/sodium acetate at a column temperature of 33℃and a detection wavelength of 360nm.
L-methionine production of LMT-1 and LMT-2 was 0.02g/L and 0.25g/L, respectively, indicating that cystathionine-gamma-synthase mutants MetB obtained by the present invention M The ability to synthesize L-methionine is significantly improved relative to the wild type.
List of primer sequences used in the examples of the present invention:
the above examples merely represent a few embodiments of the present invention, which are described in more detail and are not to be construed as limiting the scope of the patent. It should be noted that, for a person skilled in the art, the above embodiments may also make several variations, combinations and improvements, without departing from the scope of the present patent. Therefore, the protection scope of the patent is subject to the claims.

Claims (5)

1. The cystathionine-gamma-synthase mutant is characterized in that the amino acid sequence of the cystathionine-gamma-synthase is shown as SEQ ID NO. 1.
2. A gene encoding the cystathionine-gamma-synthase mutant according to claim 1.
3. The coding gene as claimed in claim 2, wherein the nucleotide sequence is shown in the sequence table SEQ ID NO. 2.
4. Use of the cystathionine- γ -synthase mutant according to claim 1.
5. The use according to claim 4, wherein the cystathionine- γ -synthase mutant is used for producing L-methionine.
CN202311111182.5A 2023-08-30 2023-08-30 Cystathionine-gamma-synthase mutant and application thereof Pending CN117165549A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202311111182.5A CN117165549A (en) 2023-08-30 2023-08-30 Cystathionine-gamma-synthase mutant and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202311111182.5A CN117165549A (en) 2023-08-30 2023-08-30 Cystathionine-gamma-synthase mutant and application thereof

Publications (1)

Publication Number Publication Date
CN117165549A true CN117165549A (en) 2023-12-05

Family

ID=88938861

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202311111182.5A Pending CN117165549A (en) 2023-08-30 2023-08-30 Cystathionine-gamma-synthase mutant and application thereof

Country Status (1)

Country Link
CN (1) CN117165549A (en)

Similar Documents

Publication Publication Date Title
Brautaset et al. Bacillus methanolicus: a candidate for industrial production of amino acids from methanol at 50 C
Neuner et al. Mixed glucose and lactate uptake by Corynebacterium glutamicum through metabolic engineering
US10865404B1 (en) Aspartase mutant, recombinant expression vector and recombinant bacterium containing aspartase mutant, and use thereof
CN101960005B (en) The production method of 5'-GMP
CN109777763B (en) Genetically engineered bacterium for producing L-theanine and construction and application thereof
CN110540976B (en) Isopropyl malate synthase and application thereof
CN110272857B (en) Beta-alanine producing strain and its preparation method and use
KR102006977B1 (en) Modified phosphoribosylpyrophosphate amidotransferase and method for producing purine nucleotide using the same
WO2022174597A1 (en) Genetically engineered bacterium for producing l-sarcosine, construction method therefor and use thereof
CN112725251B (en) Engineering bacterium for producing spermidine
CN111411092B (en) Corynebacterium glutamicum for high yield of L-lysine and application thereof
Jiang et al. Enhanced low molecular weight poly-γ-glutamic acid production in recombinant Bacillus subtilis 1A751 with zinc ion
CN110218710B (en) Phosphoketolase with improved activity and use thereof for producing metabolites
CN104480169A (en) Method for producing 5'-guanylic acid
WO2006025477A1 (en) Industrially useful microorganism
CN113174378B (en) Glutamate dehydrogenase mutant, encoding gene thereof, genetically engineered bacterium and application thereof in preparation of L-2-aminobutyric acid
CN117165549A (en) Cystathionine-gamma-synthase mutant and application thereof
CN114058609B (en) H-protein and application thereof
CN109182319A (en) A kind of threonine deaminase mutant and its preparation method and application
CN103898089A (en) Strain capable of highly producing L-alanine and tolerant to tap water and construction method thereof
CN113789307A (en) Pantothenate synthetase mutant, encoding gene, vector and application
CN109929853B (en) Application of thermophilic bacteria source heat shock protein gene
US11760988B2 (en) L-aspartate alpha-decarboxylase mutant and application thereof
WO2015154208A1 (en) Bacterial strain capable of producing l-alanine and being tolerant to tap water, and construction method thereof
CN112592903B (en) Mutant pyruvate oxidase and application thereof in metabolism detoxification of 2-ketobutyric acid

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination