KR100881058B1 - Composition for treatment and prevention of human glioblastoma comprising Wnt5a inhibitor - Google Patents

Abstract

The present invention relates to the identification of a novel role of Wnt5a protein in glioma, and more particularly to a composition for treating and preventing glioma, comprising an inhibitor of the expression or action of Wnt5a protein.

According to the present invention, Wnt5a protein expression, which affects the proliferation and tumorigenic ability of glioma cells, can be used for the development of glioma gene therapy by regulating RNA interference such as siRNA or shRNA.

Description

Composition for treatment and prevention of glioblastoma comprising inhibitor of ｎｔ５ａ protein {Composition for treatment and prevention of human glioblastoma comprising Wnt5a inhibitor}

The present invention relates to the identification of a novel role of Wnt5a protein in glioma, and more particularly to a composition for treating and preventing glioma, comprising an inhibitor of the expression or action of Wnt5a protein.

Polymorphic glioblastoma is the most frequent and difficult to treat brain tumor. Recently, however, a variety of genetic changes have been proposed to treat the glioma. It has been reported that various genetic changes occur with glioma, and tumor treatment methods through hyperproliferation or inhibition of these factors have been used. (A.D. Norden et al., Glioma therapy in adults, Neurologist 12 (2006) 279-292)

Among them, Wnt genes such as Wnt2, Wnt7b, and Wnt5a are reported to be involved in various tumorigenesis. (MJ Smalley et al., Wnt signaling in mammalian development and cancer, Cancer Metastasis Rev. 18 (1999) 215? 230; M. Jonsson et al., Wnt and fibroblast growth factor gene expression during development of the mammary gland and role of wnts in human cancer , in: RB Dickson et al., Hormones and Growth Factors in Development and Neoplasia, Wiley & Liss, New York (1998) 361-382))

Wnt5a is a thyroid cancer (N. Kremenevskaja et al., Wnt5a has tumor suppressor activity in thyroid carcinoma, Oncogene 24 (2005) 2144-2154), breast cancer (M. Jonsson et al., Loss of Wnt5a protein is associated with early relapse in invasive ductal breast carcinomas) Hematological cancers (H. Liang et al., Wnt5a inhibits B cell proliferation and functions as a tumor suppressor in hematopoietic tissue, Cancer Cell 4 (2003) 349-360), etc., act as tumor suppressors, but gastric cancer (M. Kurayoshi et al. Expression of Wnt5a is correlated with aggressiveness of gastric cancer by stimulating cell migration and invasion, Cancer Res. 66 (2006) 10439-10448), Melanoma (TB Lewis et al., Molecular classification of melanoma using real-time quantitative reverse transcriptase-polymerase chain reaction, Cancer 104 (2005) 1678-1686). These reports indicated that Wnt5a acts differently as an inhibitor or promoter depending on the type of tumor. Thus, it is difficult to predict whether Wnt5a will act as an inhibitor or promoter in a particular tumor. Wnt signaling is also known to be involved in a variety of developmental processes, including neurogenesis in the nervous system (J. Huelsken, W. Birchmeier, New aspects of Wnt signaling pathways in higher vertebrates, Curr Opin Genet Dev. 11 (2001) 547- 553). However, the role of Wnt5a in glioma is not yet reported.

Although the incidence of cranial gliomas is increasing, alternative treatments are required because of the high risk of recurrence following radiation therapy and chemotherapy. Therefore, the discovery of new inhibitors involved in the proliferation of glioma.

Accordingly, the present invention confirms that Wnt5a (wingless-type MMTV integration site family, member 5A) is an important factor involved in glioma formation, and provides a basis for treating glioma by inhibiting such factors.

Therefore, the main object of the present invention is to identify and inhibit the role of Wnt5a in the generation and proliferation of glioma and to use it in the treatment of tumors.

Another object of the present invention is to provide a method for screening a new glioma agent for inhibiting the expression of Wnt5a.

According to an aspect of the present invention, the present invention provides a composition for treating and preventing glioma, comprising as an active ingredient an inhibitor of the expression or action of Wnt5a protein having the amino acid sequence of SEQ ID NO: 1. In the present invention, Wnt5a is a protein that is highly expressed in glioma tissues and cells and is related to the ability of glioblastoma formation. Therefore, the present invention has been shown for the first time that glioma can be treated or prevented by inhibiting the expression or action of Wnt5a.

In the present invention, the expression or action inhibitor of the Wnt5a protein may be used any material or method known to inhibit the expression or action of the protein, but preferably down-regulate the transcription or translation of the Wnt5a gene, or It provides a composition for treating and preventing glioblastoma, characterized by inhibiting the action of the protein. Here, down-regulation of transcription or translation of the Wnt5a gene includes all down-regulation, such as binding to a promoter of the Wnt5a gene to down-regulate transcription, to degrade mRNA after transcription, or to inhibit translation. In addition, inhibiting the action of the Wnt5a protein includes inhibiting the activity of the protein, or competitively binding to the ligand binding site of the protein to interfere with the action. Examples of the latter include Frizzled 4-CRD protein, a competitive inhibitor of Wnt5a (T. Netor H. Masckauchan et al., Wnt5a Signaling Induces Proliferation and Survival of Endothelial Cells in vitro and Expression of MMP-1 and Tie-2, Mol Biol Cell. 17 (2006): 5163-72) using Wnt5a inhibition and anti-Wnt5a neutralizing antibody (Blumenthal A et al., The Wingless homolog WNT5A and its receptor Frizzled-5 regulate inflammatory responses of human mononuclear cells induced by microbial stimulation, Blood. 108 ( 2006) 965-73) Wnt5a inhibition.

 Examples of the former may include siRNA (short interfering RNA) or shRNA (short hairpin RNA) using RNA interference of the Wnt5a gene. RNA interference (hereinafter abbreviated as "RNAi") is a method of post-transcriptional gene regulation conserved in many eukaryotes. RNAi is induced by short double-stranded RNA ("dsRNA") molecules present in cells (Fire A et al. (1998), Nature 391: 806-811). These short dsRNA molecules, also called "siRNAs", separate into single strands and then bind to "RNA-induced silencing (RISC)" to cleave or inhibit translation of targeted mRNAs (Elbashir SM et al. (2001) , Genes Dev, 15: 188-200).

Therefore, the present invention provides an isolated siRNA comprising short double-stranded RNA consisting of about 17 nucleotides to about 25 nucleotides that target the mRNA of the Wnt5a gene. The siRNA comprises antisense RNA strands complementary to the sense RNA strands, both of which are annealed to each other by standard Watson-Crick base pair interactions (hereinafter referred to as "base-paired"). ). The sense strand comprises a nucleic acid sequence identical to the target sequence in the target mRNA. Techniques for selecting the target sequence of siRNA are described, for example, in Tuschul T et al., "The siRNA User Guide" revised Oct. 11, 2002. The Wnt5a mRNA target sequence used to prepare the siRNA of the present invention is 5'-uuccaccuucgaugucggaau-3 '(SEQ ID NO: 2).

The sense and antisense strands of the siRNA of the present invention comprise two complementary single-stranded RNA molecules, or two complementary portions form base pairs and are defined by a single "hairpin" region of the single strand. It may comprise a single molecule covalently bonded. The latter case is called shRNA (short hairpin RNA), and the shRNA has a single strand of about 50-70 nucleotides in length and forms a stem-loop structure in vivo. Long RNAs of 19-29 nucleotides complementary to both loop regions of 5-10 nucleotides form base pairs to form double stranded stems. shRNAs are generally synthesized in vivo by transcription of complementary DNA sequences from Pol III promoters. Pol-III-induced transcription begins at the well-defined start site and terminates at the second residue of the linear (-TTTT-) consisting of four or more thymidines to produce non-poly (A) transcripts. Pol III promoter is active in all cells and can express shRNA. After transcription, shRNAs are cleaved by Dicer and interact with RISC like siRNAs (see Tuschl, T. (2002), Cell 110 (5): 563­74).

The siRNA of the present invention can be obtained using many techniques known to those of ordinary skill in the art. For example, siRNA can be chemically synthesized using a method known in the art, or produced by recombinant methods. Preferably, the siRNA of the invention can be chemically synthesized using appropriately protected ribonucleoside phosphoramidites and conventional DNA / RNA synthesizers. siRNA can be synthesized as two RNA molecules complementary and separated or as one RNA molecule with two complementary regions. Alternatively, siRNA can also be expressed from recombinant DNA plasmids using appropriate promoters. Suitable promoters for expressing siRNAs of the invention from plasmids include, for example, U6 or H1 RNA pol III promoter sequences and cytomegalovirus promoters. In addition, the recombinant plasmids of the present invention may include inducible or controllable promoters for expressing siRNA in specific tissues or specific intracellular environments.

The siRNA of the invention can be expressed as two RNA molecules that are complementary and separated from the recombinant plasmid or as one RNA molecule having two complementary regions. Selection of a plasmid suitable for expressing siRNA of the present invention, a method for inserting a nucleic acid sequence for expressing siRNA into a plasmid, and a method for delivering a recombinant plasmid to a cell of interest are within the skill of the art. See, eg, Tuschl, T. (2002), Nat. Biotechnol, 20: 446-448; Bloommelkamp TR et al. (2002), Science 296: 550-553; Miyagishi M et al. (2002), Nat. Biotechnol. 20: 497-500; Paddison PJ et al. (2002), Genes Dev. 16: 948-958; Lee NS et al. (2002), Nat. Biotechnol. 20: 500-505; And Paul CP et al. (2002), Nat. Biotechnol. 20: 505-508, which is incorporated herein by reference.

In the present invention, the expression inhibitor of the Wnt5a protein is preferably Wnt5a siRNA (short interfering RNA) having the nucleotide sequence of SEQ ID NO: 2, Wnt5a shRNA having the nucleotide sequence of SEQ ID NO: 3 ( 5'- uuccaccuucgaugucggaauuugauauccgauuccuacaucgaagguggaa-3 ') It provides a composition for treating and preventing glioblastoma, characterized in that (short hairpin RNA) or a gene for transcription thereof.

In the present invention, preferably, the gene for transcription of the Wnt5a shRNA provides a composition for treating and preventing glioma, characterized in that the double-stranded DNA having the nucleotide sequence of SEQ ID NO: 4 and 5. (SEQ ID NO: 5'-GTT ACC CGT TCC ACC TTC GAT GTC GGA ATT TGA TAT CCG ATT CCG ACA TCG AAG GTG GAA TTT TTT CCA AGC-3 ', SEQ ID NO: 5'-GGC CGC TTG GAA AAA ATT CCA CCT TCG ATG TGC GAA TCG GAT ATC AAA TTC CGA CAT CGA AGG TGG AAC GG-3 ') The underlined portions allow the formation of double stranded DNA as complementary sequences from which the Wnt5a shRNA is transcribed. The remaining underlined portions may be varied within the scope of the present invention depending on the type of recombinant vector as a restriction enzyme site for cloning.

In the present invention, preferably, the gene for transcribing the Wnt5a shRNA provides a composition for treating and preventing glioblastoma, characterized in that it is inserted into a recombinant viral vector for delivery to cells in vivo. Selection of recombinant viral vectors useful in the present invention, methods for inserting nucleic acid sequences for expressing shRNAs into vectors, and methods for delivering viral vectors to cells of interest are within the skill of the art. See, eg, Dornburg R (1995), Gene Therap. 2: 301-310; Eglitis MA (1988), Biotechniques 6: 608-614; Miller AD (1990), Hum Gene Therap. 1: 5-14; And Anderson WF (1998), Nature 392: 25-30, which are incorporated herein by reference. Examples of recombinant viral vectors that can be used in the present invention include pWPT-GFP vector (Example 2), pLenti6-GW / U6-laminshrna (Invitrogen Life Technologies Inc.), pLenti4 / V5-DEST ™, (Invitrogen Life Technologies Inc.). ), pLenti6 / V5-DEST ™, (Invitrogen Life Technologies Inc.), pLenti6.2 / UbC / V5-DEST ™ (Invitrogen Life Technologies Inc.), pLenti6 / BLOCK-iT-DEST (Invitrogen Life Technologies Inc.), pLenti6 / V5-DEST (Invitrogen Life Technologies Inc.), pLenti6 / -TOPO (Invitrogen Life Technologies Inc.), U6.1 / Lenti vector (GenScript), pRNAT-U6.2 / Lenti (GenScript), pRNATin-H1. 4 / Lenti (GenScript), Lenti-CRE ™ (with EF-1α / HTLV promoter) -Lentigene, Lenti-GFP ™ (with EF-1α / HTLV promoter) -Lentigene, Lenti-GFP ™ (with SCMV promoter) -Lentigene , Lenti-LacZ ™ (with SCMV promoter) -Lentigene, Lenti-Luciferase ™ (with EF-1α / HTLV promoter) -Lentigene, Lenti-RFP ™ (with EF-1α) -Lentigene, Lenti-RFP ™ (with the SCMV promoter) -Lentigene, Lenti-YFP (with the SCMV promoter)-Lentigene, psiLentG ene ™ (promega) and the like.

According to another aspect of the present invention, the present invention provides a method for screening a glioma tumor therapeutic agent, comprising the steps of: (a) treating any agent with an animal cell expressing Wnt5a protein; And (b) determining whether the expression of the Wnt5a protein is reduced in comparison with the non-medicated agent in the animal cell. In the step (a), the animal cells may be intentionally transfected with a plasmid (see Example 2) overexpressing Wnt5a. In step (b), whether expression is reduced may be measured at the RNA level through RT-PCR, or at the protein level through ELISA with a protein antibody.

According to another aspect of the present invention, the present invention provides a biomarker composition for diagnosing glioma comprising a Wnt5a protein having an amino acid sequence of SEQ ID NO: 1, the expression of which is increased in glioma tissue than normal brain tissue.

According to another aspect of the invention, the invention provides a shRNA (short hairpin RNA) molecule for the Wnt5a gene having the nucleotide sequence of SEQ ID NO: 2.

According to another aspect of the present invention, the present invention provides a viral vector comprising double-stranded DNA having the nucleotide sequence of SEQ ID NO: 4 and 5 capable of transcription of the Wnt5a shRNA molecule of the present invention.

In the present invention, preferably, the viral vector is pWPT-GFP-siWnt5a having a cleavage map of FIG. 3.

According to another aspect of the present invention, the present invention provides a viral clone in which the viral vector of the present invention is packaged in 293T cells. In an embodiment of the present invention, a lentivirus clone was prepared using the viral vector of FIG. 3.

The pharmaceutical composition of the present invention may be administered with a physiologically acceptable carrier, and upon oral administration, a binder, a suspending agent, a disintegrant, an excipient, a solubilizer, a dispersant, a stabilizer, a suspending agent, a pigment, a perfume, and the like In the case of injections, buffers, preservatives, analgesic agents, solubilizers, isotonic agents, stabilizers and the like can be mixed and used, and for topical administration, bases, excipients, lubricants, preservatives and the like can be used.

The formulation of the pharmaceutical composition of the present invention may be prepared in various ways by mixing with a pharmaceutically acceptable carrier as described above. For example, in the case of oral administration, it may be prepared in the form of tablets, troches, capsules, elesir, suspensions, syrups, wafers, etc., and in the case of injections, may be prepared in unit dosage ampoules or multiple dosage forms. Other pharmaceutical compositions of the present invention may be prepared according to techniques commonly used in the form of various formulations.

The pharmaceutical compositions of the invention are administered to humans and animals orally or parenterally, intravenously, subcutaneously, intranasally or intraperitoneally. Parenteral administration includes injection and drip methods such as subcutaneous injection, intramuscular injection and intravenous injection.

The range of effective dose of shRNA for the Wnt5a gene contained in the pharmaceutical composition of the present invention may vary depending on various factors such as sex, severity, age, method of administration, target cell, expression level, and the like. Can be easily determined. As one example, it may range from about 0.01 ug to about 100 ug / kg.

Hereinafter, the present invention will be described in more detail with reference to Examples. Since these examples are only for illustrating the present invention, the scope of the present invention is not to be construed as being limited by these examples.

Example 1 Differences in Wnt5a Protein Expression in Normal Brain Tissues and Glioblastoma Tissues

Wnt5a expression in normal brain tissue and glioblastoma tissue was confirmed by immunohistostaining and RT-PCR. Fix astrocytoma tissue (Grade II) and glioblastoma tissue (Grade IV) with 4% paraformaldehyde at a lower level than normal brain tissue, glioblastoma tissue, and then block with 5% serum + 0.3% Triotn + PBS solution for 1 hour. And react with Wnt5a primary antibody (R & D systems) for 1 hour. Rinse well and react with a secondary antibody (FITC-conjugated anti-goat, Jackson Immunoresearch Laboratorie). 1 is a result of comparing the difference in the expression of Wnt5a in the normal brain tissue and tissues isolated from glioma, the result of confirming that Wnt5a expression is increased in glioma compared with normal tissue. As a result, it was confirmed that the expression of Wnt5a was increased in the glioblastoma tissue (Grade IV) compared to the normal tissue and astrocytoma tissue (Grade II). (Figure 1-A, B, C) Total RNA was isolated from normal brain tissue and glioblastoma tissue, and total RNA was converted to cDNA using reverse transcriptase (RT) and oligo (dT) primers, followed by Taq polymerase and Wnt5a primers. Wnt5a was amplified by RT-PCR using (Forward: 5'-GGA ATA TTA AGC CCA GGA GT-3 ', Reverse: 5'- AGT GGC ACA GTT TCT TCT GT-3'). As a result, it was confirmed that Wnt5a expression was increased in glioblastoma tissue (GBM) compared to normal tissue (Normal). (Fig. 1-D, E) The Wnt5a amino acid sequence (SEQ ID NO: 1) is a US NCBI (www.ncbi.nlm, nih.gov) found the human Wnt5a amino acid sequence from the unigene database. The ACCESSION number is NM_003392.

Example 2: Effect of Wnt5a on Proliferation in Glioblastoma Cells

1) Overexpression of Wnt5a in Glioblastoma Cells

To confirm the effect of Wnt5a on glioma cell proliferation, Wnt5a was overexpressed in glioma cell line. The cells used in the experiment were obtained from GBM-05 (Korean Cell Line Research Foundation, Accession No. KCLRF-BP-00118), which was isolated from glioma patients, and U87MG (human grade IV glioblastoma, glioma cell line obtained, ATCC, HTB- 14) was used. After transfection of GBM-05 and U87MG cells with Wnt5a plasmid (Upstate, USA) and overexpressing, two days later, each cell was placed in a 12 well culture dish at 1,000 / cm ² and removed after 24, 48 and 72 hours. Cell counts were counted with a hemocytometer. Figure 2 shows the result of increased proliferation when overexpression of Wnt5a in glioma cells. As a result, it was confirmed that proliferation was increased in GBM-05 and U87MG cells expressed with Wnt5a.

2) Preparation of Lentivirus containing Wnt5a shRNA

RNA interference was used to inhibit Wnt5a expression in GBM-05 and U87MG cells. To construct a GFP-Lentivirus made of a vector containing a shRNA sequence capable of suppressing Wnt5a expression, first, pAVU6 + 27 plasmid (Good PD et al., (1997) Gene Ther. ), 45-54) from human U6 promoter gene to U6 forward (5'-AAA ACT GCA GGG ATC CAA GGT CGG GC -3 ') and reverse (5'-TTT TCT GCA G GC GGC CGC ACT AGT GGT AAC CTA Amplify by PCR using GTA TAT GTG CTG CCG AAG-3 ') primers. To increase the efficiency of inducing oligonucleotides encoding shRNAs on both primers, include the Pst I site at the 5'-end and the Not I and BstE II sites at the 3'-end. The amplified PCR product was cut with Pst I and Not I restriction enzymes and linked into pBluescript-II KS plasmid (Stratagene, LaJolla, Calif.) To form PKS-U6 plasmid. The pKS-U6 plasmid was cut with BamH I and Xho I restriction enzymes, and the fragment was cut and inserted into the pDNR-CMV plasmid (BD Biosciences Clontech, Palo Alto, Calif.). To clone the U6 promoter from the completed pDNR-CMV-U6 plasmid to the Lentivirus vector pWPT-GFP lox P site, the pDNR-CMV-U6 plasmid and pWPT-GFP lentivirus plasmids (Mammalian expression, Lentiviral, Cre / Lox, Addgene, USA, FIG. 3a) and Cre recombinase (BD Biosciences Clontech, Palo Alto, Calif.) Were incubated together to complete the pWPT-GFP-U6 plasmid, a Lentivirus vector. The recombinant vector pWPT-GFP-siWnt5a was cloned by cloning a shRNA sequence (SEQ ID NO: 3,4) capable of inhibiting Wnt5a expression between Not I and BstE II in a lentivirus vector (pWPT-GFP-U6) having a U6 promoter (Fig. 3B). Made. DNA sequencing of the pWPT-GFP-siWnt5a vector confirms cloning of the siRNA sequence. The 393 generation packaging mix (pLP1, pLP2, pLP / VSVG vector) supplied from these vectors and invitrogen were transfected into lipofectamine plus (Invitrogen) in 293T cells, and the supernatant was recovered at 24 hour intervals to make lentivirus clones.

3) Proliferative test of glioma cells with suppressed Wnt5a expression

GFP-Letivirus made of a vector containing the shRNA sequence that inhibits Wnt5a expression was treated with glioma cells for 6 hours to inhibit Wnt5a expression. After culturing for 72 hours, the cells were separated with 0.25% trypsin / EDTA, and the cells expressing GFP were separated using the BD FACSCanto ™ II Flow Cytometry System (BD biosciences). In order to confirm that Wnt5a expression is suppressed, the results of RT-PCR and western blot confirmed that Wnt5a expression was inhibited. (FIG. 4-A, B) Confirming proliferative capacity in GBM-05 and U87MG cells in which Wnt5a expression was suppressed. Colony forming assay experiments were performed. As a result, it was confirmed that Wnt5a expression was significantly reduced and the colony forming ability of glioma cells inhibited. Figure 4C, D, E Figure 4 shows the results of inhibiting proliferation when Wnt5a was inhibited by glioma cells using RNA interference.

4) Tumor Formation Test of Glioblastoma Cells with Inhibited Wnt5a Expression

To confirm tumor formation in GBM-05 and U87MG cells that inhibited Wnt5a expression in vivo, 2x10 ⁵ cells with Wnt5a expression were transplanted into immunodeficient mice, respectively. After 5 weeks, when abnormalities were observed in the behavior, hair color, and weight of the rats, the rats were sacrificed and brains were extracted to check for tumor formation (Fig. 5-A) and the tumor volume (Fig. 5-B) was measured. . 5 is a result showing tumorigenic ability of glioma cells in which Wnt5a function was suppressed in vivo. As a result, it was confirmed that tumorigenic ability was significantly reduced in GBM-05 and U87MG cells in which Wnt5a expression was suppressed compared to the control group. This is a result showing that inhibition of Wnt5a expression inhibits the proliferation and tumorigenic ability of glioma cells.

As described above, according to the present invention, Wnt5a protein expression, which affects the proliferation and tumorigenic ability of glioma cells, can be used for the development of glioma gene therapy by regulating RNA interference such as siRNA or shRNA. .

1 is a result of comparing the difference in the expression of Wnt5a in the normal brain tissue and tissues isolated from glioma, the result of confirming that Wnt5a expression is increased in glioma compared with normal tissue.

Figure 2 shows the result of increased proliferation when overexpression of Wnt5a in glioma cells.

Figure 3 is a map of a recombinant viral vector transcribing Wnt5a sh RNA prepared according to the present invention.

4 is a result showing that the inhibition of proliferation when the Wnt5a is inhibited by using the RNA interference in glioma cells.

5 is a result showing tumorigenic ability of glioma cells in which Wnt5a function was suppressed in vivo.

<110> Pusan National University Industry-University Cooperation Foundation <120> Composition for treatment and prevention of human glioblastoma          comprising Wnt5a inhibitor <130> PN070241 <160> 5 <170> KopatentIn 1.71 <210> 1 <211> 380 <212> PRT <213> Homo sapiens <400> 1 Met Lys Lys Ser Ile Gly Ile Leu Ser Pro Gly Val Ala Leu Gly Met   1 5 10 15 Ala Gly Ser Ala Met Ser Ser Lys Phe Phe Leu Val Ala Leu Ala Ile              20 25 30 Phe Phe Ser Phe Ala Gln Val Val Ile Glu Ala Asn Ser Trp Trp Ser          35 40 45 Leu Gly Met Asn Asn Pro Val Gln Met Ser Glu Val Tyr Ile Ile Gly      50 55 60 Ala Gln Pro Leu Cys Ser Gln Leu Ala Gly Leu Ser Gln Gly Gln Lys  65 70 75 80 Lys Leu Cys His Leu Tyr Gln Asp His Met Gln Tyr Ile Gly Glu Gly                  85 90 95 Ala Lys Thr Gly Ile Lys Glu Cys Gln Tyr Gln Phe Arg His Arg Arg             100 105 110 Trp Asn Cys Ser Thr Val Asp Asn Thr Ser Val Phe Gly Arg Val Met         115 120 125 Gln Ile Gly Ser Arg Glu Thr Ala Phe Thr Tyr Ala Val Ser Ala Ala     130 135 140 Gly Val Val Asn Ala Met Ser Arg Ala Cys Arg Glu Gly Glu Leu Ser 145 150 155 160 Thr Cys Gly Cys Ser Arg Ala Ala Arg Pro Lys Asp Leu Pro Arg Asp                 165 170 175 Trp Leu Trp Gly Gly Cys Gly Asp Asn Ile Asp Tyr Gly Tyr Arg Phe             180 185 190 Ala Lys Glu Phe Val Asp Ala Arg Glu Arg Glu Arg Ile His Ala Lys         195 200 205 Gly Ser Tyr Glu Ser Ala Arg Ile Leu Met Asn Leu His Asn Asn Glu     210 215 220 Ala Gly Arg Arg Thr Val Tyr Asn Leu Ala Asp Val Ala Cys Lys Cys 225 230 235 240 His Gly Val Ser Gly Ser Cys Ser Leu Lys Thr Cys Trp Leu Gln Leu                 245 250 255 Ala Asp Phe Arg Lys Val Gly Asp Ala Leu Lys Glu Lys Tyr Asp Ser             260 265 270 Ala Ala Ala Met Arg Leu Asn Ser Arg Gly Lys Leu Val Gln Val Asn         275 280 285 Ser Arg Phe Asn Ser Pro Thr Thr Gln Asp Leu Val Tyr Ile Asp Pro     290 295 300 Ser Pro Asp Tyr Cys Val Arg Asn Glu Ser Thr Gly Ser Leu Gly Thr 305 310 315 320 Gln Gly Arg Leu Cys Asn Lys Thr Ser Glu Gly Met Asp Gly Cys Glu                 325 330 335 Leu Met Cys Cys Gly Arg Gly Tyr Asp Gln Phe Lys Thr Val Gln Thr             340 345 350 Glu Arg Cys His Cys Lys Phe His Trp Cys Cys Tyr Val Lys Cys Lys         355 360 365 Lys Cys Thr Glu Ile Val Asp Gln Phe Val Cys Lys     370 375 380 <210> 2 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> siRNA of Wnt 5a <400> 2 uuccaccuuc gaugucggaa u 21 <210> 3 <211> 52 <212> RNA <213> Artificial Sequence <220> <223> shRNA of Wnt5a <400> 3 uuccaccuuc gaugucggaa uuugauaucc gauuccuaca ucgaaggugg aa 52 <210> 4 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> DNA strand of Wnt5a shRNA <400> 4 gttacccgtt ccaccttcga tgtcggaatt tgatatccga ttccgacatc gaaggtggaa 60 ttttttccaa gc 72 <210> 5 <211> 71 <212> DNA <213> Artificial Sequence <220> <223> DNA strand of Wnt5a shRNA <400> 5 ggccgcttgg aaaaaattcc accttcgatg tgcgaatcgg atatcaaatt ccgacatcga 60 aggtggaacg g 71  

Claims (10)

Expression inhibitor of the Wnt5a protein having the amino acid sequence of SEQ ID NO: 1 Wnt5a siRNA (short interfering RNA) having the nucleotide sequence of SEQ ID NO: 2, Wnt5a shRNA (short hairpin RNA) having the nucleotide sequence of SEQ ID NO: 3, or transcript thereof Glioblastoma treatment and composition comprising the gene as an active ingredient. delete delete The method of claim 1, wherein the gene is a double-stranded DNA having a nucleotide sequence of SEQ ID NO: 4 and 5, the composition for treating and preventing glioma. Screening method for glioma treatment comprising the following steps: (a) treating any agent with an animal cell expressing Wnt5a protein; And (b) determining whether the expression of the Wnt5a protein is reduced in comparison with the non-medicated agent in the animal cells. delete delete delete delete delete

Images