KR101088764B1 - Compositon for treatment and prevention of alcohol dependence including nk1r inhibitor - Google Patents

Abstract

The present invention relates to an alcohol dependent therapeutic and prophylactic composition comprising an NK1R protein expression or action inhibitor as an active ingredient. The composition according to the present invention can be used for the treatment and prevention of alcohol dependent diseases by regulating the expression of NK1R protein in the brain associated with alcohol intake using RNA interference.

RNA interference, artificial microRNA, amiRNA, siRNA, shRNA, neurokinin 1 receptor (NK1R), alcohol dependence

Description

Alcohol dependent prophylaxis and treatment composition comprising NVR protein inhibitor {COMPOSITON FOR TREATMENT AND PREVENTION OF ALCOHOL DEPENDENCE INCLUDING NK1R INHIBITOR}

The present invention relates to a composition for preventing and treating alcohol dependence comprising an NK1R protein inhibitor. More specifically, the present invention relates to gene therapeutics for preventing and / or treating alcohol dependence by inhibiting expression or action of NK1R protein in the brain associated with alcohol uptake using RNA interference technology (or microRNA technology).

Alcohol dependence is the same as alcohol addiction, which means a chronic disease in which physical, mental and social functions are impaired by repeated and excessive drinking. In general, it is easy to think that alcohol dependence occurs in a person with weak will due to personality problems, environmental problems, or stress. However, alcohol dependence is an obvious brain disease.

Alcohol dependence, together with schizophrenia and depression, has a high share of the bed, and 30-50% of treated alcohol-dependent patients relapse within three months. In particular, the lifetime prevalence of alcoholism in Korea is 21.98%, which is higher than in other countries.

Although there are therapeutic agents to be administered to alcohol dependent patients, the effects are temporary. To date, chemical drugs are mainly used for the treatment of alcohol dependence. However, these drugs have so many side effects that they can not be used by everyone. Disulfiram, for example, has the effect of reducing alcohol intake by inhibiting the enzyme aldehyde dehydrogenase, which degrades alcohol in the body. However, this drug does not properly decompose acetaldehyde, and this acetaldehyde accumulates in the body, causing side effects such as tachycardia, flushing, nausea and vomiting. Naltrexone or acamprosate, another drug for alcoholism, is more effective than disulfiram but is not used in all alcoholics because of side effects.

There is a need to overcome the side effects of chemical drug treatments mentioned above, and to develop a more fundamental and persistent treatment of alcohol dependent diseases. Specifically, the method of treating alcohol may be exemplified by artificially lowering the expression of a genetically inherited trait. In this regard, it is thought that the therapeutic effect can be maximized through genetic treatment methods, that is, by effectively reducing the expression of unique genes transmitted from parents .

Alcohol dependence or alcoholism is associated with the nervous and mental systems as well as liver enzymes. Indeed, there has been a report that alcohol uptake is reduced in mice when the virus inhibits the expression of brain mu opioid receptors or α4-containing GABA receptor genes (AW Lasek et al., Genes Brain Behav. 6 (2007) 728-). 735, M. Rewal et al ., J. Neurosci. 29 (2009) 543-549).

NK1R (neurokinin 1 receptor) is one of the proteins expressed throughout the brain. This protein is especially stress response in the prefrontal cortex, hippocampus, tail-caudate putamen, lateral septum, nucleus accumbens and amygdala. It is known that it is expressed in a lot of institutions associated with drug addiction.

Rodents have been reported to have significantly reduced alcohol intake, increased sensitivity to alcohol, and sedation to alcohol intake compared to normal rats with NK1R genetically eliminated mice. Similarly, in the case of NK1R antagonists, the desire for alcohol intake was suppressed.

In the post-genome era, small RNAs are emerging as new gene expression regulators. Small RNA is produced at sites that were considered garbage DNA sequences that do not encode proteins. Small RNAs do not produce proteins, and their molecules themselves inhibit sequence-specific expression of target genes by mechanisms known as RNAi (RNA interference) or microRNA-mediated regulation. Thus, such RNA interference or microRNA technology is one of the technologies that are attracting interest in new gene therapy.

Typical small RNAs, siRNA and miRNA, are produced by Dicer enzymes belonging to the RNase III group, which are dsRNA (double strandRNA) -specific endonuclease.

The siRNA is a dsRNA consisting of about 21 nucleotides, consisting of 19 base pairs and two nucleotide overhangs present on the 3 'side. These 3 'overhangs function as intermediate mediators in the RNAi process. siRNAs are produced when long dsRNAs are made from transposons, viruses, or genes in vivo, or when dsRNAs are artificially injected into cells from outside.

miRNAs are made naturally in cells, and are RNAs that do not have the genetic information to produce proteins. The formation process of miRNA is as follows. It is transcribed into primary miRNAs by genes in the nucleus and then cleaved by drosha to form precursor miRNAs in the form of short hairpins, which then migrate from the nucleus to the cytoplasm. In the cytoplasm, a small stem loop of a precursor miRNA is cleaved by a diser enzyme, a kind of ribonuclease, and matures into a single strand of miRNA.

siRNA inhibits gene function by inducing degradation of RNA through the RNA-induced silencing complex (RISC), while miRNA inhibits the translation of mRNA, which is part of the nucleotide sequence of the 3'-UTR (untranslated region) of the target mRNA. Complementary binding inhibits gene function by inhibiting the translation of mRNA into proteins in ribosomes.

Early RNAi-related studies mostly used synthetic siRNA (double stranded RNA oligonucleotide). RNAi using synthetic siRNA is a specific nucleic acid in a short time by transfecting dsRNA directly to the cell in vitro. There is an advantage that can be screened for the effect of inhibiting gene expression by sequence. However, since the synthetic siRNA has a short half-life, the gene expression inhibitory effect is maintained for only 2 to 3 days, and thus, there is a problem in that a large amount of synthetic dsRNA is repeatedly injected in order to exhibit a continuous antiviral effect.

In the case of RNAi using short hairpin RNA (shRNA), instead of directly injecting synthetic dsRNA, plasmid DNA is used to transcribe single-stranded RNA of hairpin structure. Finally converted to siRNA. Specifically, in the case of RNAi using shRNA, the plasmid controlled by the RNA polymerase III promoter is transcribed into single-stranded RNA having a loop similar to pre-miRNA in the nucleus of the target cell, and then moved to the cytoplasm by Exportin-5. It is converted into siRNA during processing by Dicer.

As mentioned above, in order to express the shRNA in the cell, DNA capable of artificially expressing the shRNA is recombinantly injected into the cell. Thereafter, the shRNA is expressed in the cell by the expression mechanism of the miRNA present in the cell, thereby suppressing the expression of the target gene. Such RNA is also referred to as "artificial microRNA" (hereinafter referred to as "amiRNA").

In the case of shRNA, RNAi is retained longer than siRNA because the transcription of shRNA occurs continuously while the injected DNA remains in the cell. However, in order for the shRNA to be transcribed from naked plasmids, the plasmid must be transferred to the nucleus of the target cell, so that the plasmid can be delivered in the nucleus only in actively dividing cells. In addition, the injected foreign DNA is inactivated in cells by various pathways, which makes it difficult to expect long-term expression.

AmiRNAs produced on the basis of RNA interference (or miRNA technology) have the advantage of less cytotoxicity than conventional shRNAs, and also reduce off-target effects that affect expression of other genes besides target genes. Therefore, this amiRNA can be used as a new gene therapy. In addition, if the viral vector used for gene therapy is applied to RNAi, the efficiency of nucleic acid delivery in vivo will be high. To date, no technology using RNAi to inhibit NKIR gene expression has been reported.

The inventors have continued the research to solve the above-mentioned problems and to prevent and / or treat alcohol dependence using gene therapy agents. As a result, the use of genetic techniques based on RNA interference technology (or miRNA technology) has led to the development of techniques for preventing and / or treating alcohol dependence.

 The present invention aims to prevent and / or treat alcohol dependence by inhibiting the expression or action of the NK1R gene, a gene involved in alcohol dependence using RNA interference technology.

An object of the present invention is to provide a composition for the prevention and treatment of alcohol dependence comprising an NK1R protein expression or action inhibitors as an active ingredient.

Another object of the present invention is to provide an amiRNA that inhibits the expression or action of NK1R protein, a gene encoding the same, an expression vector comprising the gene, and a cell transformed with the expression vector.

Another object of the present invention is to provide a composition for preventing and treating alcohol dependence consisting of NK1R specific siRNA, antisense nucleic acids and LNAs (Locked nucleic acids).

The present invention provides a composition for preventing and treating alcohol dependence comprising an inhibitor of the expression or action of NK1R protein having the amino acid sequence of SEQ ID NO: 1 as an active ingredient.

In the present invention, since "expression or action of proteins" is a term commonly used in the art, detailed description thereof will be omitted.

In the present invention, "protein expression or action inhibitor" means a composition that inhibits transcription, translation, etc. for the expression of the protein or inhibits the action at the molecular biology level that appears during the process of making the protein.

In the present invention, "alcohol dependence" means a chronic disease in which physical, mental and social functions are impaired due to continuous and repeated excessive drinking. In the present invention, the term "alcohol dependency" is used to include all diseases related to alcohol, such as alcoholism and alcohol abuse.

In the present invention, "artificial miRNA (amiRNA)" is RNA designed to specifically act on a target gene, and expression / action of miRNA when recombinant DNA is injected into a cell that can express a desired "artificial miRNA". RNA is expressed by mechanism. Artificial miRNAs serve to inhibit the expression of target genes.

In the present invention, "specific" means specifically selecting a target, or specifically binding or reacting with a target in a cell. The present invention provides NK1R gene specific amiRNA. The amiRNA can be used to prevent, ameliorate and treat alcohol dependent diseases associated with expression of NK1R.

The inhibitor of expression or action of the NK1R protein of the present invention may be i) an artificial miRNA (amiRNA) that inhibits transcription or translation of the NK1R gene or ii) a gene encoding the amiRNA.

The NK1R protein sequence is already known and described by SEQ ID NO: 1. The amiRNA may be amiRNA having a nucleotide sequence of SEQ ID NO: 2 (named "amiRNA3") or an amiRNA having a nucleotide sequence of SEQ ID NO: 3 (named "amiRNA4"). The gene may be DNA having a nucleotide sequence of SEQ ID NO: 4 or DNA having a nucleotide sequence of SEQ ID NO: 5.

The amiRNA consists of 21 nt and has a small hairpin structure similar to the form of miRNA produced in the body.

The present invention also provides an amiRNA having a nucleotide sequence of SEQ ID NO: 2 and an amiRNA having a nucleotide sequence of SEQ ID NO: 3.

The method for preparing amiRNA is not particularly limited, but a method of chemically synthesizing RNA oligonucleotide, a method of synthesizing small RNA using in vitro transcription, and the like can be exemplified.

The present invention also provides a recombinant expression vector comprising the gene encoding the amiRNA.

A gene encoding (encoding) the nucleotide sequence of the recombinant amiRNA may be synthesized and inserted into an expression vector.

The amiRNA expression vector can be transformed or infected into cells so that amiRNAs of the invention can be expressed temporarily or permanently in the cells. The recombinant expression vector of the present invention may be constructed by recombinant DNA methods known in the art.

The expression vector may be selected from the group consisting of plasmids, lentiviral vectors, retroviral vectors, adenovirus vectors known in the art, used for replication and expression of mammalian cells or other target cell types. Particularly preferred viral vectors are in the present invention. The reason is that viral vectors have high efficiency of nucleic acid delivery in vivo, and therefore, it is thought that the effect will be high when applied to RNAi.

In the present invention, it is particularly preferable to use a lentivirus. Lentiviruses are a retroviral vector that can transduce even non-dividing cells, and the injected genes can be expressed over months (Kafri T, Blomer U, Peterson DA, Gage FH, Verma IM. Sustained expression of genes delivered directly into liver and muscle by lentiviral vectors. Nat Genet 1997; 17: 314-317.), Which has the advantage of long-term maintenance of RNAi.

The present invention also provides a transformant prepared by introducing the expression vector into a host cell.

The expression vector into which the gene encoding the amiRNA sequence is inserted can be introduced into a host cell by methods well known to those skilled in the art. Introduction methods include, but are not limited to, electroporation and lipofection, and methods known in the art may be selected.

Cells that can be used in the present invention may be selected from the group consisting of E. coli, yeast, heart cells, lymphocytes, liver cells, vascular endothelial cells, spleen cells, cancer cells, animal cell lines such as CHO, Cos7, NIH3T3, insect cells, Although not limited, all possible cells can be used as host cells.

The present invention also provides a composition for preventing and treating alcohol dependence consisting of NK1R-specific siRNA, antisense nucleic acids and LNAs (Locked nucleic acids).

As described above, "siRNA" refers to a double-chain RNA that can specifically act on the mRNA of the target gene to induce RNA interference. siRNA consists of a sense RNA strand having a sequence homologous to the mRNA of the target gene and an antisense RNA strand having a sequence complementary thereto. Specifically, the antisense RNA strand having the same sequence as the partial region of the mRNA encoded by the NK1R gene and the antisense RNA strand having the sequence complementary to the partial region of the mRNA encoded by the NK1R gene form a double stranded RNA. .

The term “antisense nucleic acid” refers to a nucleic acid sequence that is DNA or RNA or a derivative thereof including a nucleic acid sequence complementary to a sequence of a particular mRNA, and binds to a complementary sequence in the mRNA to inhibit translation from mRNA to protein. The sequence and length of the antisense nucleic acid are not particularly limited, and may include some sequences that do not correspond to mRNA The total length is 6 to 60 bases, preferably 8 to 50 bases, more preferably Is 10 to 40 bases.

The siRNA of the present invention is formed by completely pairing double-stranded RNA portions paired with RNA, one or more mismatches (corresponding bases are not complementary), bulges (no bases corresponding to one chain), and the like. It may include unpaired portions.

In the case of antisense RNA, conventional methods are synthesized in vitro and administered in vivo or to allow antisense RNA to be synthesized in vivo. One example of synthesizing antisense RNA in vitro is using RNA polymerase I. One example of allowing antisense RNA to be synthesized in vivo is to allow the antisense RNA to be transcribed using a vector whose origin of the recognition site (MCS) is in the opposite direction. Such antisense RNA is preferably such that a translation stop codon is present in the sequence so that it is not translated into the peptide sequence.

In the present invention, "Locked nucleic acids" refers to a nucleic acid analog including 2'-0, 4'-C methylene bridges.

The pharmaceutical compositions of the present invention may be formulated by mixing with a pharmaceutically acceptable carrier using techniques known in the art. For example, in the case of injections, buffers, preservatives, analgesics, solubilizers, isotonic agents, stabilizers and the like can be used in combination, and for topical administration, bases, excipients, lubricants, preservatives and the like can be used.

The present invention also relates to a method of inhibiting alcohol intake by treating a composition comprising an inhibitor of expression or action of NK1R protein as an active ingredient.

The composition of the present invention can be used for the treatment of a subject suffering from a disease associated with alcohol dependence, in particular an alcohol dependent disorder. Individuals capable of administering the compositions of the present invention include not only humans but also animals such as birds, poultry, and livestock. In the present invention, treatment includes preventing the development of alcohol dependence or reducing, alleviating, or reversing the symptoms associated with the disease.

The composition of the present invention may be administered in combination with various therapeutic agents, such as existing cytotoxic agents, chemotherapeutic agents, and in this case, may be administered simultaneously or sequentially.

The compositions of the present invention can be administered to a subject in any manner that delivers to the surface. Suitable parenteral routes of administration include, but are not limited to, subcutaneous injections or depositions including intravascular administration (eg, intravenous bolus injection, intravenous infusion, intraarterial bolus injection, intraarterial injection, catheter drip into the vasculature), subcutaneous injection ( deposition (eg, using an osmotic pump), administration around and within tissue (eg, pertumoral and intratumoral injection) or deposition, and the like.

The effective amount of the pharmaceutical composition of the present invention can be easily determined by those skilled in the art in consideration of various factors such as sex, age, health condition, weight, method and frequency of administration, target tissue or cell, and the like. The effective amount is an amount sufficient to inhibit NK1R expression or an amount sufficient to inhibit NK1R action. The total dose required for each treatment may be administered in multiple or single doses.

The expression of NK1R protein in the brain, which is associated with alcohol consumption, can be controlled using RNA interference to reduce the amount of alcohol the individual absorbs. Thus, by treating the subject with an inhibitor based on the RNAi gene therapy of the present invention, it is possible to effectively treat, ameliorate and prevent alcohol dependent diseases.

Hereinafter, preferred examples are provided to aid the understanding of the present invention, but the following examples are merely illustrative of the present invention, and various changes and modifications can be made within the scope and spirit of the present invention. It is obvious to the skilled person, and it is natural that such variations and modifications fall within the scope of the appended claims.

Example  One: amiRNAs  Design Lentivirus  synthesis

1-1: Cell Culture

Mouse fibroblast NIH3T3 cell line (Korea Cell Line Bank, Korea) was incubated at 37 ° C. and 5% carbon dioxide concentration in DMEM medium containing 10% FBS, 100 IU / ml penicillin and 10 ug / ml streptomycin.

1-2: amiRNAs  Design Lentivirus  synthesis

In order to suppress the expression of the NK1R gene, a five-part stem-loop structure amiRNA for the mRNA of the NK1R gene was designed as shown in FIGS. 1 and 2. Sequences targeting NK1R mRNA (NCBI Reference Sequence: NM_009313.4) were designed using BLOCK-iT RNAi Designer (http://rnaidesigner.invitrogen.com/rnaiexpress/). The designed sequence information is summarized in Table 1 below.

[Table 1]

designation Initiation site order SEQ ID NO: amiRNA 3 1356 GGUUUCACCAGUAGAAACAGU 2 amiRNA 4 1483 GUCCUGAAUGCUCUUUCGCAU 3 amiRNA 3 coding DNA 1356 CCAAAGTGGTCATCTTTGTCA 4 amiRNA 4 coding DNA 1483 CAGGACTTACGAGAAAGCGTA 5

The designed amiRNA sequence was confirmed for homology using BLAST, and the amiRNA sequence was designed to have a stem-loop structure. The amiRNA sequence was inserted into the plenti6.2-GW / EmGFP-miR vector (Invitrogen) and the BLOCK-iT ^™ to prepare a vector for expressing the amiRNA sequence targeting NK1R mRNA. HiPerform ^TM It was cloned using the Lentiviral Pol II miR RNAi Expression System (Invitrogen) according to the manufacturer's instructions. Cloned amiRNA is finally put on the vector plenti6.4 / R4R2 / V5-DEST MultiSite Gateway ® made a lentiviral vector (see Fig. 3). Negative control vectors were cloned using the pcDNA6.2-GW / EmGFP-miR-neg control plasmid (Invitrogen).

Preparation of these lentiviruses was made according to the manufacturer's experimental instructions using 293FT cells and Invitrogen's ViraPower packaging mix. To make lentiviruses in 293FT cells, 3 ug of plenti6.4 / EF1αMSGW / EmGFP-miR expressing plasmid DNA and 9 ug ViraPower packaging mix containing amiRNA sequences were prepared. The prepared DNA and ViraPower mix were mixed with Lipofectamine 2000 and reacted at room temperature for 20 minutes to form a DNA-Lipofectamine 2000 complex. 293FT cells (6x10 ⁶ total cells) were prepared, and the DNA-Lipofectamine 2000 complex was mixed and incubated in a CO ₂ incubator for one day. After incubation, the medium of the cell plate was removed, and DMEM medium containing sodium pyruvate was added thereto and cultured in a CO ₂ incubator for 48 to 72 hours. After 48-72 hours, the virus-containing medium was harvested and the supernatant was collected after centrifugation to obtain the virus. The obtained virus was infected with NIH3T3 cells, and the cells infected with the virus were selected using antibiotics (blasticidin S 5 ug / ml) for about 10 days. The titer was identified by crystal violet staining to select a good virus.

Example  2: NIH3T3  Virus infection on cell line

NIH3T3 cells were infected with lentiviruses containing the respective NK1R amiRNAs sequence and changed to DMEM medium containing blasticidine S (5 ug / ml) once every 3 to 4 days. After 30 days, only lentiviral infected cells were selected to establish a cell line stably expressing the NK1R amiRNAs sequence in NIH3T3 cells.

Example  3: in cells amiRNA  Efficiency Verification

Cells expressing each NK1R amiRNAs gene were treated with Trizol (Invitrogen) to isolate total RNA, and cDNA was synthesized using reverse transcriptase (Superscript III, Invitrogen) and oligo dT. Real-time RT-PCR used Applied Biosystems' 7500 fast real-time PCR system. Primers of NK1R gene, Applied Biosystems Primer Express, 2X SYBR Green PCR Master Mix (Takara Bio Inc., Shiga, Japan) and 2ug cDNA were tested with a final buffer of 25 ul. The NK1R primer base sequence used is as follows.

SEQ ID NO: 6 (NK1R forward primer): 5'-CTCCACCAACACTTCTGAGTC-3 '

SEQ ID NO: 7 (NK1R reverse primer): 5'-TCACCACTG TATTGAATGCAGC-3 '

The data were normalized using the GAPDH gene, and the product of each cycle was measured using an increasing amount of SYBR green that binds two strands of DNA. All data were analyzed for expression increase and decrease of genes using the 2 ^{-ΔΔ CT} method (KJ Livak et al ., Methods . 25 (2001) 402-408). The expression pattern of the protein of the cell expressing each NK1R amiRNAs sequence was confirmed using Western blotting. NIH3T3 cells infected with a lentiviral containing NK1R amiRNAs sequence were lysed using a reaction mixture of RIPA Lysis buffer (Sigma) and 1% protease inhibitor (Calbiochem), and then proteins were isolated and BCA Protein Assay Reagent. Quantification using (Pierce). 20 ug of the quantified protein was subjected to 10% SDS-PAGE and then transferred to the PVDF membrane. Proteins were transferred to PVDF membranes and then blocked for 2 hours in a 5% scheme-milk solution. After reacting with an antibody of each protein, it is reacted with a secondary antibody (Pierce) to which HRP is bound. The primary antibody was diluted with Santa Cruz rabbit anti-NK1R at 1: 3000 (sc-15323) and Sigma's Goat anti-beta actin (A5316) at 1: 5000 and reacted at 4 ° C. for 1 day. After the antibody reaction, each protein was identified using an ECL kit (Pierce).

Example  4: screened amiRNA Efficacy evaluation in vivo

8-week-old C57BL / 6 male mice were reared in a controlled temperature and humidity environment with 12/12 h light / dark cycles. Injection of the lentiviral was done using intracerebral injection. 15 ul of virus suspension was injected using a needle (0.25 G) and alcohol intake was measured for 4 weeks to determine alcohol intake. Alcohol was fed 3 days after lentiviral injection and after 15 days the alcohol concentration was increased to 15%. The rat's cage was given a bottle of water and a bottle of alcohol, and after a period of time, the positions of the two bottles were changed so that they could not find water or alcohol. In addition, 200 ul (16 mg / ml) was injected once every 4 days by using intraperitoneal injection of naltrexone, which is known as an alcohol-dependent therapeutic agent. After the lentiviral and naltrexone injections, the cages were given water and 10% alcohol to measure weight, water and alcohol consumption every three days for four weeks. After 4 weeks, the brains of the mice whose alcohol intake was measured were excised to excise the prefrontal cortex, striatum, hippocampus and cortex. Trizol (Invitrogen) was treated to dissociate brain tissues to isolate total RNA, and cDNA was synthesized using reverse transcriptase (Superscript III, Invitrogen) and oligo dT. NK1R gene expression was measured by real-time RT-PCR method using the synthesized cDNA.

Example  5: Immunohistochemical Staining

Mice were anesthetized with Zoletil 50 (Virbac) and perfused with 4% paraformaldehyde. After perfusion, the brain was removed and fixed in 4% paraformaldehyde for about two weeks. The immobilized brain tissue was embedded in paraffin, and the embedding tissue was cut into 5 μm thickness and subjected to conventional immunohistochemical staining. The thin embedded tissue was removed from paraffin by using xylene, stepped with ethyl alcohol, and then attempted to recover antigen by heating the citrate buffer in a microwave for 12 minutes. In order to suppress the endogenous peroxidase activity, 1% hydrogen peroxide (H ₂ O ₂ ) solution was treated for 10 minutes. After all the reactions were completed, the Abcam NK1R primary antibody was reacted at 4 ° C. for one day, and then reacted with a secondary antibody with HRP. Color development was performed using DAB (3,3-diaminobenzidine tetrachloride) chromogen and then stained with hematoxylin.

Example  6: NK1R amiRNA  Expression Lentivirus NIH3T  After infection EmGFP Observation of Expression

After the production of the lentivirus including the amiRNA sequences (amiRNA 3 and 4) according to the present invention, the mice were infected with NIH3T3 cells, which are fibroblasts of mice expressing the NK1R gene. In order to confirm the degree of infection of the lentiviral, the amount of EmGFP fluorescence expression of the lentiviral-infected NIH3T3 cells was observed. As shown in Figure 4 it can be seen that the infection rate of both amiRNA according to the present invention is high.

Example  7: NK1R  Intracellular Expression Confirmation

To confirm the intracellular expression rate of NK1R, total RNA and protein were isolated from NIH3T3 cells expressing the NK1R gene, and NK1R gene expression was confirmed through real-time RT-PCR and Western blot. As shown in Figure 5, amiRNA 3, 4 of the present invention compared to the negative control gene expression was significantly reduced by more than 60% and protein expression also showed the same results.

Example  8: Measuring Alcohol Intake Changes

15 μl of NK1R-specific amiRNA3-containing lentivirus and negative control lentivirus were injected into the brain of mice 3 days after inoculation, and after 15 days, the alcohol concentration was increased to 15%. As a result, as shown in Figure 6, both groups did not show a significant difference in alcohol intake at the beginning of the experiment, but after 15 days there was a sharp difference.

15 μl of NK1R-specific aimRNA4 lentivirus and negative control lentivirus were inoculated into the brain of mice, and 200 ul (16 mg / ml) was administered by intraperitoneal injection of naltrexone, which is currently used as an alcohol treatment ) Was injected every 4 days to determine the alcohol intake. If 10% was supplied after 3 days of virus injection, it was changed to 15% alcohol after 15 days. As shown in FIG. 7, mice injected with NK1R-specific aimRNA4-containing lentivirus and naltrexone injected intraperitoneally showed 50% or more reduction in alcohol intake compared to mice injected with negative control lentiviral. . On the other hand, there was no significant difference in water intake. Through these results, it was confirmed that the amiRNA4 used in the present invention reduces the expression of NK1R to significantly reduce the alcohol intake of mice.

Example  8: Lentivirus  In the brain of infected mice NK1R  Gene expression change measurement

Four weeks after injection of the NK1R-specific amiRNA4-containing lentivirus and the negative control lentivirus, the brain was harvested to confirm expression of NK1R in the rat brain. Incision was made. After RNA extraction, the expression change of the NK1R gene was confirmed using real-time RT-PCR. As a result, there was no change in NK1R gene expression in the frontal cortex or cortex, whereas the hippocampal portion was found to have a 40-50% reduction in NK1R gene expression compared to the negative control (FIGS. 8, 9 and 10).

Compositions of the invention comprising inhibitors of the expression or action of NK1R protein can be used in the medical field for the prevention, amelioration and treatment of diseases associated with alcohol dependence.

1 and 2 show the design of amiRNAs according to the invention, wherein the amiRNAs for the invention are amiRNAs 3 and 4.

Figure 3 shows a vector map capable of expressing amiRNA according to an embodiment of the present invention.

Figure 4 shows the expression of EmGFP after infection with mouse fibroblast NIH3T cells with NK1R amiRNA expression lentivirus.

5 is a graph showing the results of confirming the gene expression change of NK1R mRNA by real-time RT-PCR and Western blot after blasticidin antibiotic selection for one month after lentiviral infection. (Data described later is also a ± SE value).

FIG. 6 is a graph measuring the change in alcohol intake after lentiviral injection with amiRNA3: (a) shows the change in water intake of the negative control group and the amiRNA3 injection group after lentiviral injection, and (b) shows the change in alcohol intake.

7 is a graph measuring the change in alcohol intake after lentiviral injection with amiRN4: (a) shows the water intake of the negative control group and the amiRNA 4 injection group after the lentiviral injection, and (b) shows the change of alcohol intake.

8 is a graph confirming the gene expression change of NK1R mRNA by real-time RT-PCR by separating the hippocampus, the cortex, and the frontal cortex of rats infected with lentivirus.

Figure 9 shows the brain of lentiviral infected mice observed under a microscope to see NK1R protein expression.

10 shows NK1R protein expression changes in rat brain infected with lentivirus through immunohistochemical staining.

<110> Industry-University Cooperation Foundation Hanyang University <120> COMPOSITON FOR TREATMENT AND PREVENTION OF ALCOHOL DEPENDENCE          INCLUDING NK1R INHIBITOR <160> 7 <170> KopatentIn 1.71 <210> 1 <211> 407 <212> PRT <213> Mus musculus <400> 1 Met Asp Asn Val Leu Pro Val Asp Ser Asp Leu Phe Pro Asn Thr Ser   1 5 10 15 Thr Asn Thr Ser Glu Ser Asn Gln Phe Val Gln Pro Thr Trp Gln Ile              20 25 30 Val Leu Trp Ala Ala Ala Tyr Thr Val Ile Val Val Thr Ser Val Val          35 40 45 Gly Asn Val Val Val Ile Trp Ile Ile Leu Ala His Lys Arg Met Arg      50 55 60 Thr Val Thr Asn Tyr Phe Leu Val Asn Leu Ala Phe Ala Glu Ala Cys  65 70 75 80 Met Ala Ala Phe Asn Thr Val Val Asn Phe Thr Tyr Ala Val His Asn                  85 90 95 Val Trp Tyr Tyr Gly Leu Phe Tyr Cys Lys Phe His Asn Phe Phe Pro             100 105 110 Ile Ala Ala Leu Phe Ala Ser Ile Tyr Ser Met Thr Ala Val Ala Phe         115 120 125 Asp Arg Tyr Met Ala Ile Ile His Pro Leu Gln Pro Arg Leu Ser Ala     130 135 140 Thr Ala Thr Lys Val Val Ile Phe Val Ile Trp Val Leu Ala Leu Leu 145 150 155 160 Leu Ala Phe Pro Gln Gly Tyr Tyr Ser Thr Thr Glu Thr Met Pro Ser                 165 170 175 Arg Val Val Cys Met Ile Glu Trp Pro Glu His Pro Asn Arg Thr Tyr             180 185 190 Glu Lys Ala Tyr His Ile Cys Val Thr Val Leu Ile Tyr Phe Leu Pro         195 200 205 Leu Leu Val Ile Gly Tyr Ala Tyr Thr Val Val Gly Ile Thr Leu Trp     210 215 220 Ala Ser Glu Ile Pro Gly Asp Ser Ser Asp Arg Tyr His Glu Gln Val 225 230 235 240 Ser Ala Lys Arg Lys Val Val Lys Met Met Ile Val Val Val Cys Thr                 245 250 255 Phe Ala Ile Cys Trp Leu Pro Phe His Ile Phe Phe Leu Leu Pro Tyr             260 265 270 Ile Asn Pro Asp Leu Tyr Leu Lys Lys Phe Ile Gln Gln Val Tyr Leu         275 280 285 Ala Ser Met Trp Leu Ala Met Ser Ser Thr Met Tyr Asn Pro Ile Ile     290 295 300 Tyr Cys Cys Leu Asn Asp Arg Phe Arg Leu Gly Phe Lys His Ala Phe 305 310 315 320 Arg Cys Cys Pro Phe Ile Ser Ala Gly Asp Tyr Glu Gly Leu Glu Met                 325 330 335 Lys Ser Thr Arg Tyr Leu Gln Thr Gln Ser Ser Val Tyr Lys Val Ser             340 345 350 Arg Leu Glu Thr Thr Ile Ser Thr Val Val Gly Ala His Glu Asp Glu         355 360 365 Pro Glu Glu Gly Pro Lys Ala Thr Pro Ser Ser Leu Asp Leu Thr Ser     370 375 380 Asn Gly Ser Ser Arg Ser Asn Ser Lys Thr Met Thr Glu Ser Ser Ser 385 390 395 400 Phe Tyr Ser Asn Met Leu Ala                 405 <210> 2 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> amiRNA3 for NK1R <400> 2 gguuucacca guagaaacag u 21 <210> 3 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> amiRNA3 for NK1R <400> 3 guccugaaug cucuuucgca u 21 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> DNA of amiRNA3 <400> 4 ccaaagtggt catctttgtc a 21 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> DNA of amiRNA 4 <400> 5 caggacttac gagaaagcgt a 21 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> NK1R forward primer <400> 6 ctccaccaac acttctgagt c 21 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> NK1R reverse primer <400> 7 tcaccactgt attgaatgca gc 22  

Claims (11)

Alcohol-dependent prevention and treatment composition comprising an inhibitor of the expression or action of NK1R protein having the amino acid sequence of SEQ ID NO: 1 as an active ingredient. According to claim 1, wherein the NK1R protein expression or action inhibitor is iii) artificial miRNA (amiRNA) that inhibits the transcription or translation of the NK1R gene or ii) a gene encoding the amiRNA, the composition for preventing and treating alcohol dependence. According to claim 1, The expression or action inhibitor of the NK1R protein is selected from the group consisting of NK1R specific siRNA, antisense nucleic acids and LNAs (Locked nucleic acids), the composition for preventing and treating alcohol dependence. According to claim 2, wherein the amiRNA that inhibits the transcription or translation of the NK1R gene is amiRNA having a nucleotide sequence of SEQ ID NO: 2 or amiRNA having a nucleotide sequence of SEQ ID NO: 3, the composition for preventing and treating alcohol dependence. According to claim 2, wherein the gene is DNA having a nucleotide sequence of SEQ ID NO: 4 or DNA having a nucleotide sequence of SEQ ID NO: 5, alcohol dependent prevention and treatment composition. An amiRNA having the nucleotide sequence of SEQ ID NO: 2, which inhibits the expression or function of the NK1R protein having the amino acid sequence of SEQ ID NO: 1. An amiRNA having the nucleotide sequence of SEQ ID NO: 3 that inhibits the expression or function of the NK1R protein having the amino acid sequence of SEQ ID NO: 1. A recombinant expression vector comprising a gene encoding the amiRNA of claim 6. The recombinant expression vector of claim 8, wherein the gene is DNA having a nucleotide sequence of SEQ ID NO: 4 or DNA having a nucleotide sequence of SEQ ID NO: 5. 10. The recombinant expression vector of claim 8, wherein the expression vector is selected from the group consisting of lentiviral vectors, retroviral vectors, and adenoviruses. Cell transformed with the recombinant expression vector of claim 8.

Images