KR101429327B1 - Novel Use of Wnt5a for Protecting Germinal Center B cell - Google Patents

Abstract

The present invention relates to the identification of a novel role of the Wnt5a protein in the germinal center, and more particularly to a method for identifying a new role of the Wnt5a protein in the germinal center, which comprises one or more selected from the group consisting of Wnt5a, Wnt5a expression promoting agent and Wnt5a activating agent. ) B cell apoptosis inhibiting composition and an immunostimulating agent therefor.
According to the present invention, the Wnt5a, Wnt5a expression promoter and Wnt5a activator can inhibit the death of B cells in the germinal center through the Wnt / Ca2 ⁺ signal transduction pathway, have.

Description

New Novel Use of Wnt5a for Protective Germinal Center B cell < RTI ID = 0.0 >

The present invention relates to the identification of a novel role of the Wnt5a protein in the germinal center, and more particularly to a method for identifying a new role of the Wnt5a protein in the germinal center, which comprises one or more selected from the group consisting of Wnt5a, Wnt5a expression promoting agent and Wnt5a activating agent. ) B cell apoptosis inhibiting composition and an immunostimulating agent therefor.

When bovine lymphocytes are densely packed to form spherical aggregates, they are called lymphoid bones. At the center of the lymphoid bones, there are occasional circular or elliptical bright areas. This bright area is called the germinal center (GC). At the center of the vasculature, antibodies with high affinity are produced, resulting in extremely rapid proliferation of vascular (GC) B cells and degeneration of immunoglobulin genes. Follicular dendritic cells (FDCs) form matrix networks at the embryonic center, maintain close antigen-antibody complexes, and provide selective signals to GC B cells. FDC protects GC B cells from apoptosis and stimulates cell proliferation through direct intercellular contact and / or secretion of soluble factors. BAFF (TNFSF13B), IL-6, IL-15 and CXCL13 are known to be protective factors for GC B cells.

GC B cells are characterized by extremely high growth rates and gene-remodeling functions. GC B cells are particularly easily cytotoxic, and in The isolated GC B cells rapidly die in the absence of anti-apoptotic signals and / or FDC.

Wnt5a has been implicated in the pathogenesis of thyroid carcinoma (N. Kremenevskaja et al., Wnt5a has tumor suppressor activity in thyroid carcinoma, Oncogene 24 (2005) 2144-2154), breast cancer (M. Jonsson et al., Loss of Wnt5a protein associated with early invasive ductal breast carcinomas) (H. Liang et al., Wnt5a inhibits B cell proliferation and functions as a tumor suppressor in hematopoietic tissue, Cancer Cell 4 (2003) 349-360). However, gastric cancer (M. Kurayoshi et al. Expression of Wnt5a is correlated with aggressiveness of gastric cancer by stimulating cell migration and invasion, Cancer Res. 66 (2006) 10439-10448), melanoma (TB Lewis et al., Molecular classification of melanoma using real-time quantitative reverse transcriptase-polymerase chain reaction, Cancer 104 (2005) 1678-1686) have been acting as tumor promoting factors. These reports suggest that Wnt5a acts differently as a repressor or promoter depending on the type of tumor. In addition, while Wnt5a acts as a B cell proliferation inhibitory factor in Wnt5a-targeted mice, the effect of promoting B-cell lymphocyte production in bone marrow cell culture media has been reported, but the effect on the proliferation of GC B cells has been reported none.

Accordingly, the present invention confirms that Wnt5a (wingless-type MMTV integration site family, member 5A) is an important factor involved in protection of GC B cells, and provides a use of Wnt5a for immune enhancement based on this effect.

Therefore, the present invention is to identify the novel role of Wnt5a on GC B cells, and to provide a method of using Wnt5a as an immunity enhancer and a screening method of an immunostimulant.

In order to solve the above problems, the present invention provides a composition for inhibiting Germinal Center B cell death comprising any one or two or more selected from the group consisting of Wnt5a, Wnt5a expression promoting agent and Wnt5a activating agent.

The present invention also provides a pharmaceutical composition for enhancing immunity, comprising as an active ingredient any one or two or more selected from the group consisting of Wnt5a, Wnt5a expression promoting agent and Wnt5a activating agent.

The present invention also provides a screening method of an immunostimulant comprising the following steps.

(a) treating the candidate drug to the lymphatic tissue of the animal; And

(b) determining whether expression of the Wnt5a protein is increased in the lymphoid tissue as compared to a control in which the candidate drug is not treated.

According to the present invention, the Wnt5a, Wnt5a expression promoter and Wnt5a activator can inhibit the death of B cells in the germinal center through the Wnt / Ca2 ⁺ signal transduction pathway, have.

FIG. 1 shows the results of an experiment in which the secretion of Wnt5a was examined by real-time PCR in FDC, isolated GC B cells, blood mononuclear cells, monoclonal THP-1 cells, GC B-like Ramos cells and HEK293 cells.
FIG. 2 shows the results of an experiment in which BCL-6 expression was examined by real-time PCR in FDC, isolated GC B cells, blood mononuclear cells, monoclonal THP-1 cells, GC B-like Ramos cells and HEK293 cells.
Figure 3 shows the Western blot results on the expression of Wnt5a protein in FDC.
Fig. 4 shows the results of an experiment in which western blotting was performed on total protein in a medium in which FDC was cultured for 24 hours.
FIG. 5 shows the results of experiments on the expression of TC1, an inflammatory mediator, through immunomodulatory factors in FDC (A: poly I: C, B: TNF-α).
Figure 6 shows the results of experiments showing that TNF- [alpha] increases VCAM1 in a dose-dependent manner in FDC.
Figure 7 shows that Wnt5a in FDC was not increased by TNF- [alpha] up to 100 ng / ml, but instead of PCR results showing that polyI: C increased transcription of Wnt5a in a dose-dependent manner, (A: TNF-alpha, B: poly I: C, C: western blot).
FIG. 8 is a photograph of immunohistochemical staining of Wnt5a expression in human lymphoid tissue. FIG.
FIG. 9 shows the results of investigation of the expression level of Wnt5a according to the number of FDCs.
FIG. 10 shows experimental results on the cell death of GC B cells isolated under serum shortage conditions.
FIG. 11 shows experimental results on the cell death of GC B cells isolated in a culture medium containing 10% fetal calf serum.
FIG. 12 is a graph showing the results of treatment of GC B cells with the membrane permeable calcium chelator BAPTA-AM or JNK inhibitor SP600125 to examine the signal transduction pathway of Wnt5a-induced protection.
Figure 13 shows the results of an experiment in which the activity of JNK was investigated using phosphorylated JNK-specific antibodies in GC B-like Ramos cells.
FIG. 14 shows the results of experiments in which BAFF, IL-6 and IL-15 were expressed in FDC treated with Wnt5a (A: BAFF, B: IL-6C: IL-15).
FIG. 15 shows the result of real-time PCR for the expression of COX-2 and TC1 in FDC after treatment with Wnt5a at a maximum of 100 ng / ml in order to confirm the effect of Wnt5a on active FDC (A: COX-2, B: TC1)
Figure 16 shows the Wnt5a-induced transcriptional regulation of downstream genes in GC B cells.
Figure 17 shows the results of an experiment in which NFAT, NF-kB, and BCL-6 activity were investigated in Ramos cells to identify transcriptional regulatory factors involved in Wnt5a-induced signal transduction.
Figure 18 is experimental results of testing the role of NFAT in the Wnt / Ca ^{2 +} signaling.
FIG. 19 shows Western blotting results of Ramos cells for the regulation of NF-kB and BCL-6 using caNFATc1, a structurally activated form of NFATc1.
Figure 20 is a Western blotting result confirming whether the Wnt5a-induced increase in CD40 is due to NFAT.

The present invention provides a composition for inhibiting Germinal Center B cell death comprising any one or two or more selected from the group consisting of Wnt5a, Wnt5a expression promoting agent and Wnt5a activating agent.

Wnt signaling is known to regulate a variety of developmental processes such as organ development, cell proliferation, morphology, motility and cell fate (Wodarz & Nusse, Annu Rev Cell Dev Biol. 1998; 14: 59-88). The Wnt signaling pathway, including Wnt5a, has been shown to inhibit the differentiation of cells and to maintain and proliferate undifferentiated cells in relation to developmental and cellular biology at birth (Aubert, et al., Nat. Biotechnol., 2002; 20: 1240-5).

Wnt signaling is largely divided into a beta-catenin-dependent pathway and a beta-catenin-dependent pathway. The beta-catenin-independent pathway also includes the Wnt / Ca2 + signaling pathway and the Wnt / PCP signaling pathway. As can be seen in the examples below, B cells, NFAT, NF-κB, and BCL-6 were activated to prevent GC B cell death, indicating that Wn5a signaling is mediated through the Wnt / Ca2 + signaling pathway in GC B cells .

The present invention also provides a pharmaceutical composition for enhancing immunity, comprising as an active ingredient any one or two or more selected from the group consisting of Wnt5a, Wnt5a expression promoting agent and Wnt5a activating agent.

The inventors of the present invention have confirmed that Wnt5a is secreted in FDC of the embryo center and that B-cell death is inhibited thereby confirming that Wnt5a, Wnt5a expression promoter or Wnt5a activator can be used for immunization enhancement Thus completing the present invention. Therefore, the present invention relates to a pharmaceutical composition for enhancing immunity comprising one or two or more selected from the group consisting of Wnt5a, Wnt5a expression promoting agent and Wnt5a activator as an active ingredient, Wnt5a, Wnt5a expression promoter or Wnt5a activator for the preparation of an immunostimulating agent A method for treating an immune disorder comprising administering to a subject a Wnt5a, Wnt5a expression promoting agent or a Wnt5a activating agent.

In one embodiment of the present invention, the pharmaceutical composition for immune enhancement comprising any one or two or more selected from the group consisting of Wnt5a, Wnt5a expression promoting agent and Wnt5a activator as an active ingredient is characterized in that Wnt5a, Wnt5a expression A promoter and a Wnt5a activator may be contained in an amount of 0.01 to 90 parts by weight, 0.1 to 90 parts by weight, 1 to 90 parts by weight, or 10 to 90 parts by weight, but not limited thereto, The type of disease and the progress of the disease.

In another embodiment of the present invention, the pharmaceutical composition for enhancing immunity comprising any one or two or more selected from the group consisting of Wnt5a, Wnt5a expression promoting agent and Wnt5a activator is used as a carrier, an excipient, a disintegrant, The composition may further comprise at least one auxiliary selected from the group consisting of replication, swelling agents, lubricants, lubricants, flavors, antioxidants, buffers, bacteriostats, diluents, dispersants, surfactants, binders and lubricants.

Specific examples of carriers, excipients and diluents include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, Cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. Solid formulations for oral administration may be in the form of tablets, pills, powders, granules, capsules These solid preparations can be prepared by mixing at least one excipient, for example, starch, calcium carbonate, sucrose or lactose, gelatin, etc., into the composition. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. Examples of the liquid preparation for oral use include suspensions, solutions, emulsions, syrups and the like, and various excipients such as wetting agents, sweeteners, fragrances, preservatives and the like may be included in addition to water and liquid paraffin which are commonly used simple diluents. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, suppositories, and the like. Examples of the suspending agent include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like. As the suppository base, witepsol, macrogol, tween 61, cacao paper, laurin, glycerogelatin and the like can be used.

In another embodiment of the present invention, the pharmaceutical composition for enhancing immunity comprising one or more selected from the group consisting of Wnt5a, Wnt5a expression promoting agent and Wnt5a activator as an active ingredient is a granule, a powder, a coating, a tablet , Pills, capsules, suppositories, gels, syrups, juices, suspensions, emulsions, drops or solutions.

According to one embodiment of the present invention, the pharmaceutical composition may be administered orally, intraarterally, intraperitoneally, intramuscularly, intraarterally, intraperitoneally, intrasternally, transdermally, nasally, inhaled, topically, rectally, ≪ / RTI > can be administered to the subject in a conventional manner.

The preferred dose of the immunoconjugate pharmaceutical composition comprising any one or two or more selected from the group consisting of Wnt5a, Wnt5a expression promoting agent and Wnt5a activating agent is not particularly limited and may be appropriately determined depending on the condition and body weight of the patient, The route of administration and the period of time, and may be appropriately selected by those skilled in the art. According to one embodiment of the present invention, the daily dose may be 0.01 to 1,000 mg / kg, specifically 0.1 to 1,000 mg / kg, more specifically 0.1 to 100 mg / kg, though it is not limited thereto. The administration may be performed once a day or divided into several times, and thus the scope of the present invention is not limited thereto.

In the present invention, the 'subject' may be a mammal including a human, but is not limited thereto.

The present invention also provides a method for screening an immunostimulant comprising the steps of: (a) treating a candidate drug to the lymphatic tissue of an animal; And (b) determining whether the expression of the Wnt5a protein is increased in the lymphoid tissue as compared to a control in which the candidate drug has not been treated.

In one embodiment of the present invention, the animal may be a mammal including a human, but is not limited thereto. In step (b), the increased expression of Wnt5a protein may be confirmed by immunohistochemical staining, But may also be carried out by ELISA or the like with a protein antibody.

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail with reference to the following examples. However, the following examples are intended to illustrate the contents of the present invention, but the scope of the present invention is not limited to the following examples. Embodiments of the present invention are provided to more fully describe the present invention to those skilled in the art.

< Experimental Example >

The following experimental examples are intended to provide experimental examples that are commonly applied to the respective embodiments according to the present invention.

1. Reagents and plasmids

Purified mouse recombinant Wnt5a protein was purchased from Millipore (Billerica, MA). The protein was purified from conditioned media using blue-sepharose, gel filtration and heparin affinity chromatography. The endotoxin level was 0.15 EU / μg (? 0.015 ng / μg of Wnt5a), which was negligible. Purified human TNF-alpha protein, BAPTA-AM, SP600125 and A23187 were purchased from Sigma (St. Louis, MO) and polyI: C was purchased from InvivoGen (San Diego, CA). Antibodies were purchased from: goat anti-Wnt5a antisera were purchased from R & D Systems (Minneapolis, MN); Mouse monoclonal antibodies to RelA, RelB, NF-kB p50, p52, and p-catenin were obtained from Santa Cruz Biotechnology (Santa Cruz, Calif.); Mouse monoclonal antibodies to CD20, CD38, CD45RA and CD45RO were obtained from BD Biosciences (San Jose, Calif.); Mouse monoclonal antibody 1B10 was purchased from Oxford Biotechnology (Kidlington, UK); Mouse monoclonal antibodies against [beta] -actin were obtained from Sigma; Rabbit anti-JNK antibodies were obtained from Santa Cruz Biotechnology; And mouse monoclonal antibody to the target sites T183 / Y185 and JNK2 of p-JNK, JNK1 are Cell Signaling Technology (Danvers, MA). Mouse monoclonal antibody 3C8 was prepared as described above.

2. Cells

GC B cells were purified from tonsillar B cells via MACS procedure (Miltenyi Biotech Inc., Auburn, Calif.). The purity of isolated GC B cells assessed through CD20 and CD38 expression was> 95%. Primary human FDCs were obtained from adherent cells. The purity measured by 8D6 antigen expression was over 95%. All samples were prepared according to guidelines set by the Asan Medical Center's Institutional Review Board of the Clinical Research Institute.

GC B and FDC were incubated with 10% heat-inactivated fetal bovine serum (FBS), 2 mM L-glutamine, 1 mM sodium pyruvate, 100 IU / ml penicillin (Gibco, Grand Island, NY) containing 100 μg / ml, and 100 μg / ml, and the culture was incubated at 37 ° C in 5% CO _{2 ,} saturated humidity. Experiments were performed using 7-9 FDCs and peripheral blood mononuclear cells were provided from healthy donors via Ficoll-Hypaque centrifugation and Wnt5a expression was immediately analyzed.

Ramos cell line, a human Burkitt B-lymphoma, was cultured in RPMI 1640 containing 10% FBS and penicillin / streptomycin at 0.5 × 10 ⁶ cells / ml and subcultured at 2-day intervals. To produce the short-term infectious agent, 1 × 10 ⁷ cells were electroporated with 10 μg pcDNA3-caNFATc1 at 1mF / 300V via a Gene Pulser II device (Bio-Rad, Hercules, Calif.). Cells were then incubated for 6 hours, and Western blotting was performed.

THP-1 cells were also cultured in RPMI 1640 containing 10% FBS and penicillin / streptomycin. L Wnt-5A cells were purchased from the American Type Culture Collection (ATCC: Manassas, Va.) And 4 mM L-glutamine, adjusted to contain 1.5 g / L sodium bicarbonate and 4.5 g / L glucose, / ml G-418 in Dulbecco's modified Eagle's medium (DMEM) (Gibco) and the cells were maintained in the medium.

Fourteen WI-38 cells were also purchased from ATCC and maintained in MEM (Gibco) containing 10% FBS, 2 mM L-glutamine, 1 mM sodium pyruvate and penicillin / streptomycin. HEK293 cells were maintained in DMEM containing 10% FBS and penicillin / streptomycin.

3. GC  B cell protection assay

For GC B cell protection analysis, 2 X 10 ⁵ / well GC B cells were dispensed into 24 well plates with or without 2 X 10 ⁴ / well FDC. All assays were performed using single donor GC B cells. The cells were cultured in RPMI containing 10% FBS for 24 hours or cultured for 6 hours without FBS. After GC B cells were obtained, only viable cells were counted on a hemocytometer via trypan blue staining. Alternatively, GC B cells were cultured in FDC-conditioned medium for 24 hours. To investigate Wnt5a role in FDC co-culture or conditioned medium, 2 ng / ml monoclonal anti-Wnt5a antibody was applied. The isotype-matched anti-p65 antibody was similarly used as a control antibody. To investigate the exogenous effect of Wnt5a, 10 and / or 50 ng / ml Wnt5a was applied to GC B cells that were not co-cultured with FDC. For inhibitor analysis, 1 [mu] M BAPTA-AM, 10 [mu] M SP600125 or 10 [mu] M cyclosporine A was added to GC B cells and incubated with or without 50 ng / ml Wnt5a.

4. Quantitative RT - PCR

Semi-quantitative and real-time PCR were performed. The PCR primers used are shown in Table 1 below. After cell experiments, total RNA was extracted using Trizol reagent (Invitrogen) and DNA was synthesized using Superscript II reverse transcriptase (Invitrogen). Quantitative PCR was performed using the ^{continuous fluorescence detecting thermal cycler ABI PRISM ®} 7000 Sequence Detection System (ABI, Foster city, CA) and ^{a SYBR ® Green real-time PCR} master mix (Toyobo, Osaka, Japan). Measurements were performed in triplicate using [beta] -actin as an intrinsic control.

Genes
( Human ) sequences  (5 ' to  3 ') Amplicon Forward Reverse ( bp ) β- actin GGCACCCAGCACAATGAAG GCCGATCCACACGGAGTACT 110 BCL -6 CCTGTGAAATCTGTGGCACCCG CGCAGCTGGCTTTTGTGACGG 130 CD40 GTTCGTCTGCCTCTGCAGTG GCTGGCACAAAGAACAGCAC 124 COX -2 TGCATTCTTTGCCCAGCACT AAAGGCGCAGTTTACGCTGT 146 CXCL13 CCTAGACGCTTCATTGATCG TGAGGGTCCACACACACAAT 110 IL -6 AAAGAGGCACTGGCAGAAAA TTTCACCAGGCAAGTCTCCT 99 IL -15 GTTCACCCCAGTTGCAAAGT TACTTGCATCTCCGGACTCA 85 IRF -4 AGAAGAGCATCTTCCGCATC TGCTCTTGTTCAAAGCGCAC 114 PRDM1 ACTACCCTTATCCCGGAGAG GGACATTCTTTGGGCAGAGT 105 TC1 CAAGCCATCATCATGTCCAC GTTGCCCACGGCTTTCTTAC 85 VCAM1 AAGATGGTCGTGATCCTTGG TAGATTCTGGGGTGGTCTCG 91 Wnt5a ACTGTGCCACTTGTATCAGG CTTCGATGTCGGAATTGATA 93

5. Western Blat

Total or partial cellular protein samples were analyzed. The nuclear and cytoplasmic fractions were isolated using a classification kit from BioVision (Mountain View, Calif.). Samples were dissolved in lysis buffer and loaded on 12% SDS-PAGE at 20 μg per lane. Proteins were blotted onto nitrocellulose membranes and examined using a primary antibody and a suitable secondary antibody (Amersham Biosciences, Piscataway, NJ). β-actin was used as a loading control for both cytoplasm and nuclear fraction. The blot was washed and visualized by chemiluminescence.

6. Immunohistochemical staining

Immunohistochemical staining of 6 human lymph nodes and tonsil samples, including 3 hyperplastic lymphoid tissues for 8 to 17 year olds and 4 normal lymph nodes obtained from 40 to 64 year old cancer surgery, was performed using a Benchmark autostainer Medical Systems Inc., Tucson, AZ). Slides were not heated above 65 ° C and the antigen-recovery pretreatment process was omitted. Anti-Wnt5a antiserum was diluted 1: 200 and used as primary antibody. This experiment was approved by the Institutional Audit Committee of the Asan Medical Center and adhered to the prescribed guidelines.

< Example  1> FDC The Wnt5a Actively produce and secrete.

The inventors of the present invention investigated the secretion of Wnt5a through real-time PCR in FDC, isolated GC B cells, blood mononuclear cells, monoclonal THP-1 cells, GC B-like Ramos cells and HEK293 cells. The results are shown in Fig.

Referring to FIG. 1, FDC expresses Wnt5a more than GC B, THP-1, Ramos and HEK293 cells, and peripheral blood mononuclear cells do not express Wnt5a.

Figure 2 shows the results of experiments on BCL-6 expression. Referring to FIG. 2, GC B and Ramos cells express BCL-6 much more than FDC. FDC does not express Wnt3a, a substance that promotes typical [beta] -catenin-dependent signaling.

Expression of Wnt5a protein in FDC was also confirmed by Western blot for total cellular protein. L-Wnt5a cells and L cells, which are mouse-derived stable Wnt5a-infected cell lines used for the production of Wnt5a conditioned medium, were used as controls. The results are shown in Fig.

Referring to FIG. 3, the concentration of β-actin as a loading control indicates that FDC expresses Wnt5a protein at a level about 1/5 of that of L-Wnt5a cells, whereas L cells do not express detectable Wnt5a there was.

To investigate how Wnt5a was secreted by FDC, western blotting was performed on the same amount of total protein in the medium cultured for 24 hours. The results are shown in Fig.

Referring to FIG. 4, Wnt5a in the FDC conditioned medium was found to be about 1/14 of the L-Wnt5a cell culture medium, which means that FDC actively produces and secretes Wnt5a.

< Example  2> polyI : C FDC in Wnt5a  Production Promote .

Inflammatory activity is known to induce Wnt5a expression in macrophages and endothelial cells. The inventors of the present invention then examined the modulation of Wnt5a expression through immunoregulatory factors in FDC using real-time PCR.

polyI: C and TNF-α increased the expression of TC1, a proinflammatory mediator, within 6 hours, which is shown in FIG. 5 (A: poly I: C, B: TNF-α). The results support the fact that FDC is activated by the mediator. TNF-a also increases VCAM1 in a positive manner. This is shown in Fig.

On the other hand, Wnt5a was not increased by TNF-α up to 100 ng / ml, but polyI: C was found to increase the transcription of Wnt5a in a dose-dependent manner. Wnt5a protein was also increased by Western blotting. This is shown in Fig. 7 (A: TNF-α, B: poly I: C, C: western blot). Thus, the above experimental results suggest that Wnt5a expression in FDC is not regulated by nonspecific immunological activity but by a complex regulatory mechanism such as TLR3-mediated signal transduction.

<Room Sime  3> Wnt5a  Expression in vivo  It occurs in lymphoid tissue.

Immunohistochemical staining confirmed the expression of Wnt5a in human lymphoid tissue in vivo. Patient information and immunostaining results are shown in Table 2 and FIG.

Referring to FIG. 8, Wnt5a expression varies depending on the patient, and the lymphatic tissue stained for Wnt5a widely differs from that of the mantle region and the para-follicular region in the GC region.

In hyperplastic lymph nodes and tonsils of children, Wnt5a was strongly expressed in FDC-like hyperplastic cells in GC and is shown in Fig. 8A. On the other hand, the lymph node of the aged patient showed relatively weak Wnt5a expression in scattered FDC-like cells, which is shown in Fig. 8B.

The data show Wnt5a expression in lymphoid tissue, particularly expression in FDC-like cells. Wnt5a expression was significantly affected by age and disease status.

< Example  4> Lower FDC Of high FDC More Wnt5a Lt; / RTI &gt;

The inventors of the present invention have studied the expression of Wnt5a in purified FDC according to the nodule through real time PCR. Wnt5a expression was increased 4- to 5-fold in FDCs of 8, compared to 15 of FDCs, which is shown in Fig. Fifteen cells grew slowly and showed cytologically aging characteristics. Compared to the in vivo data of Wnt5a, the results suggest that Wnt5a plays an important role in the biological function of FDC.

< Example  5> Wnt5a The GC  B cells to prevent cell death.

Based on these results, the inventors of the present invention have investigated how Wnt5a is involved in FDC-mediated B cell protection. First, the cell death of GC B cells isolated under serum shortage conditions was investigated. 2 X 10 ⁵ / well of isolated GC B cells were cultured without stool serum, which rapidly died, leaving only 1% surviving cells within 6 hours (see Figure 10, column 4). On the other hand, GC B cells co-cultured with 2 X 10 ⁴ / well FDCs did not die by FDC (see FIG. 10, column 1).

To analyze the role of Wnt5a in FDC co-culture, cells were cultured similar to 2 ng / ml monoclonal anti-Wnt5 antibody or isotype-matched control antibody. Anti-Wnt5a antibody significantly inhibited FDC-mediated GC B cell protection (see Figure 10, column 2). On the other hand, no such inhibitory effect was observed for the control antibody (see FIG. 10, column 3).

Thereafter, the protective effect of purified Wnt5a was also investigated. Up to 50 ng / ml of exogenous Wnt5a protected GC B cells in a dose dependent manner (see Figure 10, columns 4-6). The results show that Wnt5a is a survival factor of GC B cells and that FDC-mediated protection is highly dependent on the secretion of Wnt5a in serum deprivation conditions.

The inventors of the present invention also repeatedly performed an experiment for culturing in a culture medium containing 10% fetal calf serum for 24 hours, and the results are shown in FIG.

To examine the effect of the soluble factor secreted by FDC, FDC conditioned medium was similarly analyzed for GC B cell protective effect. Most singly cultured GC B cells underwent apoptosis within 24 hours (see Figure 11, column 7). Co-culture with FDC protected GC B cells (see Figure 11, column 1) and the protective effect was inhibited by the anti-Wnt5a antibody, but not by the control antibody (see Figure 11, columns 2 and 3) . Exogenous Wnt5a also protected GCB cells in a dose-dependent manner (see Figure 11, columns 7-9). FDC-conditioned media also significantly protected GC B cells (see Figure 11, columns 4 and 7). The protective effect was inhibited by the anti-Wnt5a antibody, but not by the control antibody (see Fig. 11, columns 4-6). Anti-Wnt5a antibody inhibited GC B cell protection by FDC co-culture and conditional media, and as a result, GC B cell viability (see Figure 11, columns 2 and 5) See column 7).

Taken together, these results indicate that Wnt5a secreted by FDC is an important factor in the survival of GC B cells. Co-culture with FDC more effectively protected GC B cells than FDC-conditioned medium (see Figure 11, columns 1 and 4), indicating that the direct contact effect with FDC is also significant for GC B cell protection It suggests.

< Example  6> Wnt5a The GC  B cells Wnt / Ca ^{2 +}  Protects through signal transmission.

To investigate the signaling pathway of Wnt5a-induced protection, GC B cells were treated with the cell membrane permeable calcium chelator BAPTA-AM or JNK inhibitor SP600125. The results are shown in Fig.

For 6 hours in serum-free conditions, 50 ng / ml Wnt5a inhibited GC B cells from apoptosis (see Figure 12, columns 1 and 2). Wnt5a-induced GC B cell protection was completely inhibited by treatment with 1 μM BAPTA-AM (see FIG. 12, columns 3 and 4), but not by 10 μM SP600125 treatment (see FIG. 12, columns 5 and 6). These results suggest that Wnt / Ca ^{2 +} signaling plays an important role in Wnt5a-induced GC B cell protection.

The inventors of the present invention also investigated the activity of JNK using a phosphorylated JNK-specific antibody in GC B-like Ramos cells. The results are shown in Fig. Referring to FIG. 13, JNK phosphorylation was not induced, and it was found that Wnt5a was rather inhibited by one-hour treatment. These results suggest that Wnt / PCP / JNK signaling is limited to the survival of Wnt5a mediated GC B cells.

< Example  7> Wnt5a Lt; RTI ID = FDC In GC  B cells Survival factor  .

FDCs are known to secrete GCB protective substances, and the inventors of the present invention investigated the expression of BAFF, IL-6, IL-15, CXCL13, and CD154 in FDC treated with Wnt5a. BAFF, IL-6 and IL-15 did not increase expression even after 6 hours of treatment with Wnt5a (see FIG. 14, A: BAFF, B: IL-6 C: IL-15). CXCL13 expression was not detected and CD154 was not detected in FDC, regardless of Wnt5a treatment, except for FDC as a CD40 ligand for GC B cells. The results suggest that the protection of GC B cells is mediated by direct Wnt5a signaling, independent of previously known GC B cell survival factors.

In order to confirm the effect of Wnt5a on active FDC, expression of COX-2 and TC1 in FDC was measured by real-time PCR after treatment with Wnt5a up to 100 ng / ml. Wnt5a showed a characteristic of reducing COX-2 and TC1 expression within 6 hours (see Fig. 15, A: COX-2, B: TC1), suggesting that Wnt5a did not induce inflammatory activity of FDC.

< Example  8> Wnt5a The GC  In B cells CD40  And IRF4  Promote warriors.

Wnt signaling regulates downstream gene expression. The inventors of the present invention investigated the Wnt5a-induced transcriptional regulation of downstream genes in GC B cells. The results are shown in Fig.

Referring to Figure 16A, in a real-time PCR measurement, 50 ng / ml Wnt5a increased expression of CD40 3 times more than the reference value within 1 hour, suggesting rapid activation of GC B cells. CD40 protein modulation was also examined in GC B-like Ramos cells after treatment with Wnt5a for 30 minutes and 1 hour. Referring to FIG. 16B, it was found that Wnt5a continuously increased CD40 expression.

IRF4 is a B cell specific transcription factor and plays a very important role in GC formation. IRF4 was upregulated within 1 hour by Wnt5a and decreased to normal levels after 4 hours (see Fig. 16C). Wnt5a decreased BCL6 a little (see FIG. 16D), while PRDM1 was increased (see FIG. 16E), suggesting IRF4-mediated transcriptional regulation.

< Example  9> Wnt5a The GC  B-similar Ramos  In the cells, NFAT, NF -KB and BCL Activate -6.

To confirm transcriptional regulatory factors involved in Wnt5a-induced signal transduction, NFAT, NF-κB, and BCL-6 activities were examined in Ramos cells. The results are shown in Fig.

Ramos cells were treated with 50 ng / ml Wnt5a for 30 minutes and 1 hour, and Western blotting was performed on the nuclear protein fractions (see left column of FIG. 17). NFATc1 and NFATc2 associated with immune cell regulation were strongly elevated within 30 minutes and increased during 1 hour. RelB, the major mediator of non-normal NF-κB signaling in lymphoid cells, increased expression and then decreased again within an hour. RelA and NF-κB1 also show a small increase in expression within 30 min, suggesting that both non-normal and normal NF-κB signaling are activated by Wnt5a. BCL-6 was also slightly increased. NF-κB2 (p52) and TP53 did not change.

The abrupt increase in NFAT activity suggests that NFAT plays an important role in the regulation of Wnt / Ca ^{2 +} signal transduction-induced GC B cells. To investigate the role of NFAT in Wnt5a signaling, Ramos cells were pretreated with 10 μM cyclosporine A for 10 min before Wnt5a treatment. The results are shown in Fig. 17 (right column).

Referring to the right column of FIG. 17, the nuclear potential of NFATc1 and NFATc2 by Wnt5a was completely inhibited by cyclosporine A. Cyclosporine A inhibited the activation of RelA, RelB, and BCL-6, suggesting that activation of these by Wnt5a is via NFAT.

< Example  10> NFAT The Wnt / Ca ^{2 +}  It is the major transcriptional regulator of signal transduction.

GC B cell survival data (Figure 12) suggests the role of Wnt / Ca ^{2 +} signaling. To investigate which transcription factors are activated by Ca2 + signaling, Ramos cells were treated with 0.1 μM A23187. The results are shown in Fig.

Referring to the left column of FIG. 18, it was found that the nuclear calcium ion permeable carriers NFATc1, NFATc2, RelB and RelA increased rapidly within 30 minutes and decreased again within 1 hour. BCL-6 also increased with calcium influx. Activity pattern of the transcription factor should support this similarly displayed bar, Wnt5a- induced activity with Wnt5a induced regulation (see FIG. 17) yirueojim through the Wnt / Ca ^{2 +} signaling.

The abrupt increase in NFAT activity suggests that NFAT plays an important role in the regulation of Wnt / Ca ^{2 +} signal transduction-induced GC B cells. In order to investigate the role of NFAT in Ca ^{2 +} signaling, it was pretreated for 10 minutes in Ramos cells A23187-treated 10μM cyclosporine A. The results are shown in Fig.

Referring to the right-hand column of Figure 18, Ca ^{+ 2} influx of NFATc1 and NFATc2 - induced nuclear potential was completely inhibited by cyclosporine A. Cyclosporine A also significantly inhibited calcium-dependent RelA and RelB activity, indicating that Ca ^{2 +} -induced activation of NF-κB is NFAT-dependent.

< Example  11> NFATc1 silver Ramos  In a cell NF -KB, BCL -6 and CD40 .

The inventors of the present invention investigated the regulation of NF-κB and BCL-6 using the structurally activated form of NFATc1, caNFATc1. Ramos cells were infected through electroporation with the caNFATc1 expression plasmid. After incubation for 6 hours, the nuclear protein was analyzed by Western blot. The results are shown in Fig.

Referring to FIG. 19, it can be seen that the infected NFATc1 is expressed in the nuclear fraction. RelB and BCL-6 were abruptly activated in NFATc1-infected Ramos cells, and RelA was also significantly increased by NFATc1.

The inventors of the present invention also confirmed whether the Wnt5a-induced increase in CD40 of FIG. 16B is due to NFAT. Ramos cells were infected with caNFATc1 and whole cell proteins were analyzed by Western blot. The results are shown in Fig.

Referring to FIG. 20, it can be seen that caNFATc1 dramatically increases CD40 expression, which supports the fact that NFAT plays a very important role in Wnt5a signaling of GC B cells.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it will be understood by those skilled in the art that various changes and modifications may be made without departing from the spirit and scope of the invention as defined in the appended claims. will be. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

Claims (8)

delete delete A pharmaceutical composition for immune enhancement, which comprises Wnt5a as an active ingredient and inhibits B cell death in the germinal center.
The method of claim 3,
Wherein said Wnt5a inhibits the death of B cells in the germinal center via the Wnt / Ca2 ⁺ signaling pathway.
The method of claim 3,
The pharmaceutical composition for enhancing immunity may be prepared from the group consisting of a carrier, an excipient, a disintegrant, a sweetener, a coating agent, a swelling agent, a lubricant, a lubricant, a flavoring agent, an antioxidant, a buffer, a bacteriostatic agent, a diluent, a dispersant, a surfactant, &Lt; / RTI &gt; wherein the pharmaceutical composition further comprises one or more adjuvants selected.
The method of claim 3,
Wherein the pharmaceutical composition for immunostaining is selected from the group consisting of granules, powders, coated tablets, tablets, pills, capsules, suppositories, gels, syrups, juices, suspensions, emulsions, A pharmaceutical composition for enhancing immunity.
A screening method of an immunostimulant comprising the steps of:
(a) treating the candidate drug to the lymphatic tissue of the animal; And
(b) determining whether expression of the Wnt5a protein is increased in the lymphoid tissue as compared to a control in which the candidate drug is not treated.
8. The method of claim 7,
Wherein expression of said Wnt5a protein is confirmed by immunohistochemical staining.

Images