KR20150029075A - A bacterium salmonella harboring siRNA against Inhibin alpha and antitumoral composition thereof - Google Patents

Abstract

The present invention relates to a bacterium Salmonella which is transformed into a recombinant expression vector comprising genes which transcript siRNAs inhibiting expression of inhibin alpha genes, and to an antitumoral composition comprising the same. The present invention can treat cancer while minimizing side effects by inhibiting cancer or inducing anti-tumor immunity.

Description

[0001] The present invention relates to a Salmonella strain expressing an inhivin alpha siRNA and an anticancer composition containing the siRNA against an inhibin alpha and antitumoral composition thereof,

The present invention relates to a Salmonella strain expressing an inhibin alpha siRNA (Inhibin alpha siRNA) and an anticancer composition containing the same, more specifically, to a composition comprising a vector capable of expressing an inhibin alpha siRNA capable of promoting anti-cancer immunity Salmonella strains and anticancer agent compositions containing the same.

Cancer, which is the number one cause of death in Korea, is on the rise due to aging. Currently, chemotherapy and radiation therapy are mainly used for chemotherapy.

In the case of chemotherapy and radiotherapy, except for surgical operations, various preparations and radiation are used, but their application is limited to the extent that the human body can afford. The limited application of these chemotherapy and radiation therapies has the disadvantage of limiting the range of application and limiting efficacy in clinical trials no matter how good the efficacy is in animal tests. This is due to adverse effects caused by the appearance of cancer cells with anticancer drug resistance or cytotoxicity of each therapy.

For example, cisplatin (cis-diamminedichloroplatinum; CDDP) is one of the most effective anti-cancer agents among the 30 types of cancer drugs currently used in clinical practice. , And cervical cancer (Teni Boulikas, Oncology Reports, 10: 1663-1682, 2003). However, recently, many cancers resistant to cisplatin have been reported, and cancer cells having such resistance are currently being challenged, and there is a risk of recurrence after cancer treatment, so that a combination therapy of cisplatin with other chemicals or cisplatin and intracellular expressed protein (Tito Fojo, Oncogene, 22: 7512-7523, 2003). In the present study,

In addition, radiotherapy is an anti-cancer therapy for treating various cancers occurring in the human body by irradiating an affected part with an appropriate amount of radiation. Such a radiation therapy lowers the hematopoietic function of the human body and suppresses the immune system, There is a problem of lowering. Furthermore, repeated irradiation of radiation causes cancer cells to acquire resistance, which limits radiation therapy.

The side effects of chemotherapy and radiotherapy in such chemotherapy treatments can lead to poor quality of life of the patients, and furthermore, a fatal disease, apart from the success of chemotherapy.

Therefore, in patients requiring chemotherapy, management of the side effects will be as important as chemotherapy itself, unlike other diseases.

Salmonella, on the other hand, is a pathogenic microorganism that causes food poisoning in most cases. However, Yale University researchers report in a paper published in the European Journal of Cancer that they have been very successful in treating melanomas by using a combination of gene-manipulated salmonella and radiation therapy (Antitumour effects of genetically engineered Salmonella in combination with radiation. Journal of Cancer, 18,23972402 J. Platts.). These researchers have previously found that salmonella has the property of attacking mouse tumors. Genomic manipulation of Salmonella can remove toxicity while maintaining tumor-attacking properties, and the injection of the genetically engineered Salmonella The tumor can be suppressed through the. Currently, the bacteria that attack cancer cells are in clinical trials targeting humans in the US and Europe.

In addition, according to the above-mentioned article, when the radiation therapy or the salmonella therapy is administered alone, the tumor suppression effect is only maintained for 2-3 weeks in the mouse, but when the two methods are used in parallel, the effect is doubled It is said. However, even with this method, the tumor did not disappear completely, and there was a limitation that extended the life of the mouse even longer.

The present inventors have found that a Salmonella typhimurium strain expressing an interferon gamma protein that induces an anti-cancer effect and a composition for chemotherapy therewith (Korean Patent No. 10-0818144 (Mar. 31, 2008)) and a tumor Salmonella strains expressing necrotic factor alpha and compositions for chemotherapeutic treatment containing them (Korean Patent No. 10-0790376 (2008.01.02.)) Have been patented for a composition for treating cancer using Salmonella strains. In addition, the present inventors have found that, by transfecting a plasmid capable of expressing Tumor Necrosis Factor Alpha (TNF-α) in eukaryotic cells in an attenuated Salmonella strain having no pathogenicity, it can exhibit a far superior anticancer effect than conventional Salmonella In addition, a Salmonella strain expressing TNF-α capable of solving the toxicity problem of Salmonella which expresses TNF-α in the past has been developed (Korean Patent No. 10-0852687 (2008.08.19.)).

On the other hand, inhibin alpha (used in combination with INHA) protein is used to form secretory inhibitors of pituitary FSH, and this protein is involved in the inhibition of proliferation of gonadal stromal cells and has a cancer suppressing effect It is known. The concentration of this protein in the serum can also be used as an indicator of granulocyte tumors. In prostate cancer, however, the inhibin alpha protein is inhibited and is not expressed and not detected in cancer cells.

Korean Patent No. 10-1039996 (2011.06.09) discloses a group consisting of KLF2 (Kruppel-like factor 2), LOC138225 (OTTHUMP00000021439), GDF15 (growth differentiation factor 15), and INHBE (inhibin, betaE) A marker for detecting marker differentiation from hematopoietic stem cells to megakaryocytes and platelets.

However, the expression pattern of Hibin alpha in skin cancer and rectal cancer and the inhibition of Inhibin Alpha have not yet been reported on the function of cancer cells.

Numerous cited documents and patent documents are referred to and cited throughout this specification. The disclosures of the cited documents and patents are incorporated herein by reference in their entirety to more clearly describe the state of the art to which the present invention pertains and the content of the present invention.

Korean Patent No. 10-0818144 (Mar. 31, 2008) Korean Patent No. 10-0790376 (2008.01.02.) Korean Patent No. 10-0852687 (Aug. 19, 2008) Korean Patent No. 10-1039996 (June, 2011)

Mellor SL et al., Loss of the expression and localization of inhibin alpha-subunit in high grade prostate cancer. J Clin Endocrinol Metab. 1998 Mar; 83 (3): 969-75.

The present inventors have confirmed the relationship between the overexpression of the inhibin alpha protein and the development of cancer and tried to use the sRNA inhibiting the inhibin alpha gene for cancer suppression or anti-cancer immunity enhancement.

Accordingly, an object of the present invention is to provide a Salmonella strain expressing an inhivin alpha sRNA which inhibits an inhivin alpha gene to induce cancer inhibition or anti-cancer immune response.

Another object of the present invention is to provide an anticancer agent composition containing the Salmonella strain.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

According to one aspect of the present invention, there is provided a Salmonella strain characterized by being transformed with a recombinant expression vector comprising a gene transcribing a small interfering RNA (siRNA) inhibiting the expression of an inhibin alpha gene Lt; / RTI >

According to another aspect of the present invention, there is provided an anticancer composition comprising the Salmonella strain.

According to still another aspect of the present invention, there is provided an anticancer composition comprising a recombinant expression vector comprising a gene having a nucleotide sequence of SEQ ID NO: 1 and transcribing a small interfering RNA (siRNA) .

Hereinafter, the present invention will be described in detail.

In the present invention, functional microorganisms were designed to express siRNA in Salmonella strains in order to inhibit cancer and promote cancer-inducing immune response, confirming that overexpression of the human alpha-alpha protein is associated with cancer development (see FIGS. 1 and 2).

Therefore, according to one aspect of the present invention, there is provided a method for producing Salmonella spp., Which is transformed with a recombinant expression vector comprising a gene transcribing a small interfering RNA (siRNA) which inhibits expression of an inhibin alpha gene Lt; / RTI >

Small RNA (hereinafter referred to as "sRNA") refers to a ribonucleic acid having a length of about 17 to 25 nucleotides (hereinafter referred to as " nt ") which functions to regulate gene expression in vivo. An sRNA is largely divided into microRNA (hereinafter referred to as "miRNA") and small interfering RNA (hereinafter referred to as "siRNA") according to the manner in which the sRNA is produced. miRNAs are generated from partially double-stranded hairpin RNAs and siRNAs are derived from double stranded RNAs (hereinafter referred to as "dsRNAs"). And the sRNA used to regulate the expression of a specific gene is classified as siRNA.

The miRNA is an endogenous hairpin-shaped transcript (Bartel, DP, Cell 116: 281-9) as a 19-25 nt long single stranded RNA (ssRNA) MiRNAs complementarily bind to the 3 'untranslated regions (UTRs) of the target mRNA, resulting in post-transcriptional gene suppression (post-transcriptional translation) -transcriptional gene suppressor, which suppresses target genes by inducing translational inhibition and mRNA destabilization. miRNA plays an important role in various processes such as development, differentiation, proliferation, apoptosis and metabolism These processes are often disturbed during tumor formation and miRNAs appear to play a role in tumorigenesis, as many miRNAs remain low in human cancers. A strong association between miRNAs and cancer has recently been demonstrated, New Year (Esquela-kerscher, A. and Slack, FJ., Nat. Rev. Cancer 6 (4): 259-269, 2006), miRNA expression dramatically changes during development and cell differentiation, Profiling of miRNAs has shown reliable results in the developmental and disease stages (Lu, J. et al., Nature 435: 834-838, 2005). Previous analysis of regulatory networks for miRNA function (Kim, VN Nat. Rev. Mol. Cell. Biol. 6: 376-385, 2005).

siRNA (small interfering RNA) refers to short double stranded RNA that can induce RNA interference through cleavage of a specific mRNA. siRNAs are not limited to pairs of double-stranded RNA portions that are paired with each other, but are paired by mismatch (corresponding bases are not complementary), bulge (no bases corresponding to one chain) May be included. The paired base length may preferably be 50 to 80 bases. The siRNA terminal structure can be either a smooth end or a protruding end if it can inhibit the expression of the target gene by RNA interference. The sticky end structure can have both a 3 'end protruding structure and a 5' end protruding structure.

The RNAi phenomenon, a gene silencing mechanism by sRNA, has been used as an effective genetic research tool in mammalian systems. An effective and stable gene knockdown is expressed as small hairpin RNA (shRNA) and processed as small interfering RNA (siRNA). Recent breakthroughs of RNAi technology have been made by producing shRNA expression cassettes mimicking natural miRNA genes (Dickins, RA, et al., Nat. Genet. 37: 1289-1295, 2005; Silva, JM et al., Nat Genet., 37: 1281-1288, 2005: Zeng, Y., et al., Mol Cell 9: 1327-1333, 2002). MiRNA-based shRNAs regulated by the RNA polymerase II promoter induce efficient and stable gene silencing modulation in cultured cells such as animal models.

The miRNA can be synthesized by chemical synthesis into a hairpin-structured shRNA (short hairpin RNA) or a double-stranded RNA (siRNA, small intefering RNA) composed of loops and stems, and a DNA sequence encoding the miRNA a siRNA expression vector, or a recombinant vector prepared by inserting it into a plasmid vector, in the form of a plasmid vector. The expression vector includes an efficient promoter for expression of siRNA. The promoter is preferably recognized by RNA polymerase II or RNA polymerase III, and may be a U6 promoter or a H1 promoter. SiRNA Expression Vectors such as pSilencer (Ambion, Inc.), pSiEx (Novagen, Inc.), siXpress (Takara Bio, Inc.) and pBLOCK-iT (Invitrogen, Inc.) and SilenCircle (Allele) or the like can be used. In the examples of the present invention, the pcDNA (TM) 6.2-GW / EmGFP-miR vector was used.

The siRNA of the human inhibin alpha gene of the present invention may preferably be a double-stranded siRNA comprising the nucleotide sequence of SEQ ID NO: 1 and a sequence complementary thereto.

SiRNAs of the invention include variants having one or more substitutions, insertions, deletions, and combinations thereof that do not degrade their activity. Such modifications may have a sequence homology of 80% or more, preferably 90%, more preferably 95% or more, with the sequence of the above siRNA.

The siRNA of the present invention can be synthesized directly (Sui G et al., (2002) A DNA vector-based RNAi technology to suppress gene expression in mammalian cells, Proc Natl Acad Sci USA 99: 5515-5520) (Brummelkamp TR et al., (2002) A system for stable expression of short interfering RNAs in mammalian cells, Science 296: 550-553) using a transcription transcription method .

The siRNA of the present invention may be a form in which two strands of RNA are paired to form a double-stranded siRNA or a structure having a short hairpin so that it can be used for transfection by a plasmid-based shRNA vector and a PCR expression cassette. It may also be in the form of

The Salmonella strain of the present invention belongs to the group D Salmonella causing typhoid fever. In the present invention, an attenuated Salmonella strain was used to eliminate the pathogenicity of the Salmonella strain. The attenuated Salmonella strain is characterized in that it is an attenuated vaccine for typhoid prevention. The term " attenuation "refers to artificially weakening the toxicity of a living pathogen. It means mutating a gene involved in essential metabolism of a pathogen and inducing the immune system by stimulating only the immune system without causing disease in the body .

Salmonella strains used in specific embodiments of the invention are Salmonella typhimurium head Titanium (Salmonella typhimurium BRD509, an attenuated strain without pathogenicity.

A miRNA polynucleotide sequence according to the present invention may be operably linked to an expression control sequence, wherein said operably linked gene sequence and expression control sequence comprise one expression (s) comprising a selection marker and a replication origin Vector. Said "operably linked" may be a gene and expression control sequence linked in such a way as to enable gene expression when the appropriate molecule binds to the expression control sequence. The expression control sequence refers to a DNA sequence that controls the expression of a polynucleotide sequence operably linked to a particular host cell. Such regulatory sequences include promoters for conducting transcription, any operator sequences for regulating transcription, sequences encoding suitable mRNA ribosome binding sites, sequences controlling the termination of transcription and translation.

In the present invention, the recombinant vector may be any expression vector having a promoter capable of expressing the siRNA and a multicloning site for cloning. In a specific example of the present invention, an expression vector that secretes siRNA transduced into the strain was prepared by adding an Inhibin alpha miRNA sequence to pcDNATM 6.2-GW / EmGFP-miR (INVITROGEN, USA) vector ).

Salmonella strains expressing human hepatic alpha siRNA inducing an anticancer effect in the present invention can be produced by a transfection method commonly used in the art. Salmonella strains produced are Salmonella strains having spectinomycin resistance, When introduced into the body, it can secrete inhivin alpha siRNA.

According to another aspect of the present invention, there is provided an anticancer composition comprising the Salmonella strain.

In a specific embodiment of the present invention, the salmonella of the present invention is prepared by transfecting the attenuated Salmonella strain with a recombinant vector expressing the siRNA which inhibits the inchebin alpha gene, and a mouse model in which the cancer is induced is introduced into the salmonella And the preventive and therapeutic effect of the cancer by the same was compared with the effect of the control Salmonella itself which did not transduce the cancer. As a result of the analysis, Salmonella transfected with a recombinant vector expressing the human hepatic alpha siRNA according to the present invention was administered, unlike the case where only Salmonella without transduction was administered or only PBS solution was treated as shown in Figs. 4A to 6B And the effect of cancer treatment was confirmed.

According to another aspect of the present invention, there is provided an anticancer composition comprising a recombinant expression vector comprising a gene transcribing a small interfering RNA (siRNA) having a nucleotide sequence of SEQ ID NO: 1 which inhibits the expression of an inhivin alpha gene .

Since the overexpression of the Hibin alpha protein upon cancer development, a small interfering RNA (siRNA) that inhibits the expression of the Inhibin alpha gene is transcribed, and a recombinant expression vector containing the gene having the nucleotide sequence of SEQ ID NO: By suppressing the expression, the therapeutic effect of cancer can be promoted. Since the siRNA and the recombinant expression vector are as described above, detailed description will be omitted.

In the present invention, the kind of cancer is not particularly limited, but it may preferably be skin cancer or colon cancer.

The anticancer composition of the present invention may be prepared by a method known in the pharmaceutical art to be used as a pharmaceutical agent, and may be prepared by mixing with a pharmaceutically acceptable carrier, excipient, diluent or the like to prepare powder, granule, tablet, capsule, And the like. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington ' s Pharmaceutical Sciences (19th ed., 1995). They may also be administered parenterally (e. G., Intravenously, subcutaneously, intraperitoneally or topically) or orally.

The anticancer composition of the present invention is administered in a therapeutically effective amount. The term "therapeutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment and includes the age, sex, weight, , The time of administration, and the method of administration. For example, the dose may be 10 ⁵ cells to 10 ⁹ cells once per adult.

As described above, Salmonella strains expressing the human hepatic alpha siRNA according to the present invention can induce toxicity to cancer cells by inhibiting the human hepatic alpha gene. Therefore, the anticancer composition comprising the Salmonella strain according to the present invention induces cancer inhibition or anti-cancer immune response, thus exhibiting far superior anticancer effects to the existing Salmonella strains.

In addition, the present invention is a very useful invention that can provide a more effective anticancer agent by reducing the cost of synthesizing siRNA in Salmonella strains, reducing the cost of expensive siRNA synthesis, and utilizing the cancer suppressing effect of Salmonella strain itself and the anti-cancer immunity effect of siRNA .

FIG. 1 is a graph showing the results of immunohistochemical staining for the expression level of Inhibin alpha protein in a skin cancer patient.
FIG. 2 is a diagram showing the expression level of Inhibin alpha in rectal cancer patients compared with normal tissues.
FIG. 3A is a schematic diagram of Salmonella strains expressing siRNA inhibiting the inhibin alpha protein according to the present invention. FIG.
FIG. 3B is a graph showing the expression of the macrophage line (RAW264.7 CELL), which was obtained by treating normal salmonella (a), PBS solution (b) and Salmonella typhimurium Salmonella strain c according to the present invention to the macrophage line (RAW264.7 CELL) Of the siRNA vector.
FIG. 4A is a photomicrograph of a murine skin cancer cell line (B16F10) taken by a Salmonella strain containing an inhivin alpha siRNA vector at 36 hours after administration.
FIG. 4B is a graph showing the cytotoxicity results showing cancer cell suppression effect by inhibin alpha inhibition Salmonella on skin cancer cell line (B16F10) using LDH ASSAY after 36 hours from administration.
FIG. 5 is a photograph showing the expression of poly caspase using the FLICA (Immunochemistry Co., USA) method for the mechanism of cancer killing effect by Salmonella strains including the expression vector of inhivin alpha siRNA in skin cancer cell lines.
FIG. 6A is a photograph showing the inhibitory effect of Salmonella strains including the expression vector of inhivin alpha siRNA in a skin cancer-induced mouse.
FIG. 6B is a graph showing the inhibitory effect of cancer caused by Salmonella strains including the expression vector of inhivin alpha siRNA in a skin cancer-induced mouse in terms of cancer volume.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

< Example  1: In clinical patient organizations Inhivin  Identification of alpha protein expression >

About 20 patients with skin cancer and rectal cancer were screened and immunohistochemistry was used to examine the expression level of the inhivin alpha protein in their cancer tissues. As a result, 90% or more of Hibin alpha in skin cancer was expressed only in cancer tissues (FIG. 1). In the patient group, expression of the inhibin alpha was observed extensively, but not in the control group. It was confirmed that rectal cancer over-expressed over 70% of normal tissue (FIG. 2).

< Example  2: Inhivin  Alpha miRNA RTI ID = 0.0 > Salmonella &lt; / RTI &gt;

First, the attenuated Salmonella strain BRD509 ( Salmonella typhimurium BRD509) was cultured at 37 占 폚 in Luria Bertani medium. To the cultured Salmonella strains were added inhivin alpha miRNA -TGCTGTTCAGAGGTCCTGTGCATGAAGTTTTGGCCACTGACTGACTTCATGCAGGACCTCTGAA; In order to transduce an expression vector plasmid and a pcDNA3 vector, the Salmonella strain was again cultured in an amount of 100 mL for 24 hours. Then, at a culture concentration showing an optical absorbance (OD600) of 0.7 and a optical density (OD600) of 600 nm, the bacteria were cultured at a speed of 5500 rpm Lt; / RTI &gt; After centrifugation, only the bacteria that settled on the bottom were collected and diluted with cold distilled water of the same volume as the culture volume. The diluted bacteria were again centrifuged in the same manner as described above, diluted with 2 mL of cold 20% glycerol distilled water, and centrifuged again to dilute the obtained bacteria into 100 μl of 20% glycerol. 30 μl (2 μg) of the mixed solution obtained above was placed in a mini-centrifuge vessel, 3 μl (2 μg) of pcDNA ™ 6.2-GW / EmGFP-miR vector, which is a plasmid of the inducible alpha siRNA expression vector, 275-325V (Figure 3a).

In order to confirm the gene expression effect of the recombinant Salmonella strain produced, 10 ⁶ cells were cultured in the macrophage cell line (Raw 264.7 cell), Salmonella strain was added at a concentration of 10 ⁸ CFU, and after 1 hour of culture, And cultured for 3 days. When the gene expression was induced in the cultured cell line, the GFP gene was designed to be expressed and confirmed. Thus, the cultured cell line was observed under a fluorescence microscope to confirm the effect of siRNA expression Salmonella strain. As a result, as shown in FIG. 3B, GFP was expressed in Salinella strains expressing inhivin alpha siRNA as compared to the control groups, and it was confirmed that gene expression by Salmonella was performed (FIG. 3B).

< Example  3: Confirmation of anticancer effect in the cell line of the transfected Salmonella strain according to the present invention>

B16F10 (skin cancer cell line, Korean cell line bank), a skin cancer cell, was cultured in DMEM medium and used as a cancer cell for confirming anticancer effect. In the presence of about 70% cells cultured in a 100 mm culture dish, the Salmonella strain expressing the inulinase siRNA produced in Example 2 was cultured, and 10 ⁶ colonies were diluted in 100 μl of PBS solution.

After 24-36 hours, the cytotoxicity after culturing was examined using a microscope and LDH cytotoxicity assay kit (Promega, USA) (FIGS. 4A and 4B). In order to confirm the cytotoxic mechanism, the test was carried out on cells each of which was prepared by using the FLICA test method capable of examining the apoptosis mechanism. As a result, cytotoxicity was induced by apoptosis mechanism, and poly-caspase expression after FLICA (Immunochemistry Co ltd, USA) test was confirmed by red fluorescent staining in cell line treated with Salmonella strains expressing Hibin alpha siRNA 5).

< Example  4: Confirmation of Anticancer Effect in Animal Model of Transgenic Salmonella Strain According to the Invention>

Skin cancer cells of B16F10 (skin cancer cell line, Korea Cell Line Bank), the PBS solution was diluted to contain a 100㎕ as 10 ⁴ cells, and then, to select a C57 / BL6 mouse cancer model expression (SLC, Japan), a mouse the diluent 100㎕ And the tumor was implanted subcutaneously. Seven to ten days after the injection, 10 ⁶ colonies were diluted in 100 μl of PBS to culture the inhivin alpha siRNA-expressing salmonella strain prepared in Example 2 in the cancer implantation site, The PBS solution was subcutaneously injected into a cancer implantation site of C57 / BL6 mice. Thereafter, the size of the cancer cells and the survival rate of the mice were measured to confirm the anticancer effect of the Salmonella strains expressing human hepin alpha siRNA according to the present invention. At this time, only the PBS solution was treated in the other rats as a control group, and BRD509 Salmonella strains in which the inhivin alpha siRNA was not transfected were treated in another rat, and the experiment was carried out in the same manner as above.

The results are shown in Figs. 6A and 6B. As shown in FIG. 6A, it was found that the cancer size was decreased in the colon cancer model mice prepared using skin cancer (B16F10) compared with the control mice after 4 weeks of the Salmonella strain administration according to the present invention.

Skin Cancer Model The arm of the mouse was vernier calipers, and the lateral and longitudinal lengths were measured to confirm the volume of the cancer. In Figure 6b, the first bar shows the degree of cancer expression in normal cancer model rats treated with only PBS solution without any Salmonella strains, and the second bar shows Salmonella strains not containing the control plasmid And the degree of cancer expression in cancer model mice. The third bar shows that the cancer expression of the mice treated with Salmonella strains expressing the Inhibin alpha siRNA of the present invention was inhibited in cancer, unlike the PBS solution treatment model or the plasmid control Salmonella treated rats.

As can be clearly seen from the above examples, the Salmonella strains expressing human heparin alpha siRNA provided by the present invention are much more effective than the conventional Salmonella strains by transfecting an inhivin alpha siRNA expression vector into an attenuated Salmonella strain without pathogenicity The present invention provides an excellent anticancer effect and particularly solves the disadvantages of administration of only the inhivin alpha siRNA and provides a far superior therapeutic effect especially in skin cancer and colorectal cancer and is very useful in the pharmaceutical industry related to chemotherapy and adjuvant preventive agents Invention.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is obvious that the same is by way of illustration and example only and is not to be construed as limiting the scope of the invention. It is therefore intended that the scope of the present invention be defined by the appended claims and their equivalents.

<110> KOREAN UNIVERSITY RESEARCH AND BUSINESS FOUNDATION <120> A bacterium salmonella harboring siRNA against Inhibin alpha and          antitumoral component thereof <130> P11-130716-02 <160> 1 <170> Kopatentin 2.0 <210> 1 <211> 64 <212> DNA <213> Homo sapiens <400> 1 tgctgttcag aggtcctgtg catgaagttt tggccactga ctgacttcat gcaggacctc 60 tgaa 64

Claims (5)

Wherein the transformed Salmonella strain is transformed with a recombinant expression vector containing a gene transcribing small interfering RNA (siRNA) that inhibits the expression of the inhibin alpha gene. 2. The Salmonella sp. Strain according to claim 1, wherein the gene transcribing the siRNA has the nucleotide sequence of SEQ ID NO: 1. An anticancer composition comprising the Salmonella strain according to claim 1 or 2. The anticancer composition according to claim 3, wherein the type of cancer is skin cancer or colon cancer. 1. An anticancer composition comprising a recombinant expression vector comprising a gene having a nucleotide sequence of SEQ. ID. NO: 1, which transcribes a small interfering RNA (siRNA) that inhibits the expression of an inhivin alpha gene.

Images