KR100808269B1 - Adenoviral recombinant shuttle vector comprising CAG promoter - Google Patents

Abstract

The present invention relates to a recombinant shuttle vector for adenovirus comprising a CAG promoter, more specifically, CMV cytomegalovirus immediate early enhancer of SEQ ID NO: 1, chicken β-actin promoter of SEQ ID NO: 2 (chicken β- A recombinant shuttle vector for adenovirus comprising a CAG promoter comprising an actin promoter) and a rabbit β-globin terminator of SEQ ID NO: 3 and a structural gene operably linked to the promoter. The recombinant shuttle vector of the present invention can effectively express a protein in a host cell. Therefore, the recombinant shuttle vector of the present invention can be usefully used for transformation of host cells using adenovirus.

Adenovirus, Recombinant Expression Vector, CAG Promoter

Description

Adenoviral recombinant shuttle vector comprising CAG promoter

Figures 1a to 1e shows a cleavage map of the recombinant expression vector for adenovirus used in the invention.

Figure 2a and 2b shows the manufacturing process of the pShuttle-CAG and pShuttle-CAG-IRES-hrGFP vector according to the present invention.

Figure 3a and Figure 3b shows a schematic diagram (A) of the structural gene construct (construct) used in the present invention and PCR results (B) to investigate the contamination of the recombinant adenovirus produced by the recombinant expression vector of the present invention.

M: size marker

lane 1: voice control

lane 2: 293A (positive control)

lane 3: AdCMV-GFP

lane 4: AdCMV-TRAIL

lane 5: AdCAG-GFP

lane 6: AdCAG-TRAIL-noGFP

lane 7: AdCAG-TRAIL

lane 8: AdCMV-GFP

lane 9: AdCMV-TRAIL

lane 10: AdCAG-GFP

lane 11: AdCAG-TRAIL-noGFP

lane 12: AdCAG-TRAIL

Figure 4 is a graph showing the results of measuring the amount of TRAIL secreted from human neural stem cells (hNSCs) infected with TRAIL or GFP expressing recombinant adenovirus (AdCAG-TRAIL AdCAG-GFP, AdCMV-TRAIL or AdCMV-GFP).

5A-5C show human glioblastoma cell lines co-cultured with conditioned media from hNSCs infected with TRAIL or GFP expressing recombinant adenovirus (AdCAG-GFP or AdCAG-TRAIL, AdCMV-GFP or AdCMV-TRAIL). The cell death of (U87MG and U343MG) was observed under a microscope (A) and the survival of human glioblastoma cell lines by coculture with the culture medium of the human neural stem cells (B, C).

The present invention relates to a recombinant shuttle vector for adenovirus comprising a CAG promoter, more specifically, CMV cytomegalovirus immediate early enhancer of SEQ ID NO: 1, chicken β-actin promoter of SEQ ID NO: 2 (chicken β- A recombinant shuttle vector for adenovirus comprising a CAG promoter comprising an actin promoter) and a rabbit β-globin terminator of SEQ ID NO: 3 and a structural gene operably linked to the promoter.

In order to express a desired gene in a host cell, an expression vector and a gene transfer technique for transporting and expressing the structural gene are required. In this case, the expression vector is a vector capable of expressing a DNA fragment inserted into the vector, and generally includes expression control sequences such as a promoter sequence capable of expressing a gene in the host. Type, timing of expression, expression amount, etc. of host cells are the main basis for selecting expression vectors, and various expression vectors have been developed to satisfy these points according to the purpose, but the development of more efficient expression vectors continues to be developed. It is a required situation.

On the other hand, gene transfer techniques are largely classified into a method of using a virus as a vector, a non-viral method using synthetic phospholipids or synthetic cationic polymers, and a physical method such as introducing a gene by applying temporary electric stimulation to a cell membrane.

Among them, the method using the virus is less stable than the non-viral method or the physical method, and has high immunogenicity, so it is highly likely to cause side effects when repeated administration.However, the gene expression efficiency and long expression duration are high. It is widely used for gene transfer, such as eukaryotic cells.

The virus used as a vector can be divided into an RNA viral vector and a DNA viral vector. An RNA viral vector is often used as a retroviral vector or a lentiviral vector, and a DNA viral vector is an adenovirus vector. vector), Adeno-associate virus vector, and Herpes simplex virus vector.

Among them, adenovirus vectors carry a large amount of DNA fragments (36kb genome) and are widely used as vectors because they have the ability to infect non-replicating cells at very high titers, but are not inserted into the genome of the host. It is limited to gene transfer and expression, and when the adenovirus is applied directly in vivo, immunorejection can occur, and the gene size that can be delivered by the adenovirus is limited, and thus, development of more diverse and efficient vectors has been required.

Accordingly, the present inventors developed a new recombinant expression vector for adenoviruses capable of efficiently expressing a structural gene during the research to transform human cells using adenoviruses, and analyzed TRAIL using this vector. As a result of preparing the neural stem cells, the present invention completed the present invention by confirming that the cells efficiently secrete TRAIL and are very effective in the treatment of tumors.

Accordingly, it is an object of the present invention to provide a recombinant shuttle vector for adenovirus comprising a CAG promoter.

In order to achieve the above object, the present invention provides a CMV cytomegalovirus immediate early enhancer, chicken β-actin promoter and rabbit β-globin terminator. It provides a recombinant shuttle vector for adenovirus comprising a CAG promoter comprising and a structural gene operably linked to the promoter.

Hereinafter, the present invention will be described in detail.

The present invention provides a CMV cytomegalovirus immediate early enhancer, a chicken β-actin promoter, a structural gene operably linked to the promoter, and a rabbit β-globin terminator. Is characterized in that it provides a recombinant expression vector for adenovirus linked sequentially.

The expression control sequence used in the recombinant expression vector of the present invention is a CAG promoter. The CAG promoter is a modified CMV promoter that is a cytomegalovirus immediate-early enhancer, chicken β-actin promoter, chimeric intron, and exon 1 ) And a combination promoter (exon 2) of rabbit β-globin gene (Hitoshi Niwa et al., Gene, 108: 193-199, 1991, Monahan et al., Gene Therapy) 7: 24-30, 2000), but it is used in various variations depending on its purpose.

In order to properly use the CAG promoter of the present invention as an expression vector for adenoviruses, the composition of the promoter, such as restriction enzyme sites in the promoter, is modified within a range in which the activity of the promoter is not inhibited, and the CMV immediate early enhancer, chicken β- Actin promoter and rabbit β-globin terminator, preferably the CMV immediate early enhancer of SEQ ID NO: 1, the chicken β-actin promoter of SEQ ID NO: 2, rabbit β-globin terminator of SEQ ID NO: 3.

The structural gene can be operably linked to the chicken β-actin promoter of the CAG promoter and inserted into an expression vector, wherein 'operably linked' means that one nucleic acid fragment is associated with another nucleic acid fragment. The function or expression thereof is influenced by other nucleic acid fragments.

The structural gene may be a cDNA sequence, a genomic DNA sequence of a single protein, or may be a complex protein in which two or more proteins or domains having a functional role are synthesized. In addition, since the Pac I restriction enzyme site is required for propagation of adenovirus, the Pac I restriction enzyme site may be removed within a range not impairing the function of the target protein. In addition, the structural gene may further include a base sequence encoding an additional amino acid sequence to assist in the expression, targeting, folding, multimerization, etc. of the protein. In addition, the structural gene may be a nucleotide fragment which functions as a nucleotide sequence without being translated into amino acids.

On the other hand, the structural gene in the present invention may have a base sequence encoding TRAIL and its functional equivalents. The TRAIL may be a protein having an amino acid sequence of SEQ ID NO: 6 or a protein having an amino acid sequence of SEQ ID NO: 4, excluding a transmembrane domain, from a protein having an amino acid sequence of SEQ ID NO: 6. The term 'functional equivalent' is at least 70%, preferably 80%, more preferably 90, of TRAIL comprising the amino acid sequence represented by SEQ ID NO: 4 or SEQ ID NO: 6 as a result of the addition, substitution, or deletion of an amino acid. It refers to a polypeptide having a sequence homology of% or more and exhibiting substantially homogeneous physiological activity with TRAIL of the present invention. Here, "substantially homogeneous physiological activity" means activity that induces the death of tumor cells. The functional equivalent includes, for example, an amino acid sequence variant in which some of the amino acids of TRAIL including the amino acid sequence represented by SEQ ID NO: 4 are substituted, deleted or added. Substitutions of amino acids are preferably conservative substitutions. Examples of conservative substitutions of amino acids present in nature are as follows; Aliphatic amino acids (Gly, Ala, Pro), hydrophobic amino acids (Ile, Leu, Val), aromatic amino acids (Phe, Tyr, Trp), acidic amino acids (Asp, Glu), basic amino acids (His, Lys, Arg, Gln, Asn ) And sulfur-containing amino acids (Cys, Met). Deletion of amino acids is preferably located in portions not directly involved in the catalytic activity of TRAIL of the present invention. The functional equivalent of TRAIL also includes polypeptide derivatives in which some chemical structures of the polypeptide have been modified while maintaining the basic skeleton of TRAIL and its physiological activity. For example, this includes structural modifications for altering the stability, shelf life, volatility or solubility of the polypeptide of the present invention. In addition, nucleic acids encoding the TRAIL can be prepared by genetic recombination methods known in the art (Sambrook, Fritsch and Maniatis, 'Molecular Cloning, A laboratory Manual, Cold Spring Harbor laboratory press, 1989; Short Protocols in Molecular Biology , John Wiley and Sons, 1992). For example, there are techniques for producing PCR amplification, chemical synthesis or cDNA sequences to amplify nucleic acids from the genome.

Since homologous triplex structure of TRAIL is essential for causing cell death, leucine zipper or isoleucine upstream of the nucleic acid encoding TRAIL of the present invention in order to facilitate trimerization of TRAIL. It is desirable to link the isoleucine zipper (ILZ) domains. The leucine or isoleucine zipper domains can be used without limitation as long as they are known in the art. Preferably, an isoleucine zipper domain having an amino acid sequence represented by SEQ ID NO: 7 can be used.

In addition, since TRAIL is a cytokine which is active by binding to cell surface receptors of tumor cells, it is preferable to link secretion signal sequences to nucleotides encoding TRAIL of the present invention. The secretory signal sequence is then preferably linked upstream of the leucine zipper or isoleucine zipper domain. The secretory signal sequence is an Igκ- chain leader, a secretory signal sequence of seminal RNase, SEC2 sequence (N-terminal 28 amino acids of human fibrillin-1), FIB sequence (nucleotides 208-303 derived from rat fibronectin mRNA sequence) or a signal peptide of FGF-4, but is not limited thereto. Preferably an Igκ- chain leader. The Igκ- chain leader may preferably have a nucleotide sequence represented by SEQ ID NO: 8.

TRAIL secreted out of cells is known to induce apoptosis more effectively when cleaved (Kim et al. al ., Biochem . Biophys . Res . Commun ., 321: 930-935, 2004), wherein the secretory signal sequence is characterized by having a signal cleavage site therein or being cleaved when secreted out of a cell without having a special signal cleavage site. desirable. The Igκ- chain leader in the secretion signal sequence is truncated between the last 20 and 21st amino acids when secreted out of the cell even without a special signal cleavage sequence. In other words, the 5'-atg gag aca gac aca ctc ctg cta tgg gta ctg ctg ctc tgg gtt cca ggt tcc act ggt gac-3 'sequence (SEQ ID NO: 8) is cut off between the last ggt and gac-3'.

As described above, DNA structures in which a secretory signal sequence, a leucine or isoleucine zipper, and a nucleic acid encoding TRAIL are sequentially connected are known in the art including PCR amplification, cleavage of DNA using restriction enzymes, ligation, transformation, and the like. Can be prepared by a general cloning method (Example 2). A schematic diagram of the DNA construct is shown in FIG. 3A.

In addition, in the present invention, the expression vector refers to a vector into which a structural gene can be inserted and can express the structural gene in a host cell. Therefore, the recombinant expression vector of the present invention includes all of the components of the expression vector, such as promoters, structural genes, vectors for replication and segregation which are well known to those skilled in the art. The component for the replication and distribution of the vector is a base sequence encoding a protein involved in the replication of prokaryotic cells, such as E. coli or adenovirus, which is used for amplification and preservation of the vector, and interacts with the protein or host protein. Known components known to those skilled in the art such as nucleotide sequences are included. In addition, the recombinant expression vector of the present invention may further include a known selection marker (selection marker) for selection.

Methods for producing adenoviruses using the recombinant expression vectors of the present invention include methods known in the art, such as, but not limited to, adenovirus backbone vectors such as pAdEasy-1 (Stratagene). The co-introduction of BJ5183 together with E. coli to induce homologous recombination between the two vectors, and amplify it in an adenovirus producing cell line, such as 293A cells, can produce an adenovirus inserted with the recombinant expression vector of the present invention. Methods for making such adenoviruses are well described in the literature: Benihoud, K., Yeh, P. and Perricaudet, M. (1999) Curr Opin Biotechnol 10 (5): 440-7, Berkner, KL (1988) Biotechniques 6 (7): 616-29, He, TC, Zhou, S., da Costa, LT, Yu, J., Kinzler, KW et al . (1998) Proc Natl Acad Sci USA 95 (5): 2509-14., Hanahan, D. (1983) J Mol Biol 166 (4): 557-80., Jerpseth, B., Callahan, M. and Greener, A. (1997) Strategies 10 (2): 37-38., Bullock, WO, Fernandez, JM and Short, JM (1987) Biotechniques 5 (4): 376-378., Ausubel, FM, Brent, R., Kingston, RE, Moore, DD, Seidman, JG et al ., (1987). Current Protocols in Molecular Biology . John Wiley and Sons, New York., Graham, FL, Smiley, J., Russell, WC and Nairn, R. (1977) J Gen Virol 36 (1): 59-74., Tollefson, AE, Hermiston, TW and Wold, WSM (1998) Methods in Molecular Medicine 21: 1-9.

In addition, the present invention provides a transformed cell comprising the recombinant expression vector of the present invention. The transformed cells are transformed by methods known in the art using, for example, the recombinant expression vector of the present invention, for example, calcium chloride method, rubidium chloride method, or electrophoresis (electroporation) method, particle total impact (particle gun bombardment, silicon carbide whiskers, sonication, PEG (Polyethylenglycol) method. The transformed cells may preferably be eukaryotic or prokaryotic, more preferably human, dog, chicken, rat, bovine, pig, monkey cells or E. coli, most preferably human neural stem cells or E. coli.

On the other hand, the present invention using the recombinant expression vector of the present invention

(a) preparing a recombinant vector by inserting a structural gene encoding a target protein into a recombinant expression vector of the present invention;

(b) preparing an adenovirus using the recombinant vector;

(c) infecting the adenovirus with a host cell to prepare a transformant; And

(d) provides a method of expressing a protein comprising expressing a protein of interest in the transformant.

The step of preparing the recombinant vector and the step of preparing the adenovirus are as described above, in order to infect the adenovirus to the host cell, methods known in the art, such as, but not limited to, human neural stem cells ( HFT13 cells) growth factor containing N ₂ The cells are plated in medium, and after 1 hour viral cells corresponding to the appropriate multiplicity of infection (MOI) are added to the medium to infect the cells. The virus was stored in a -80 ° C freezer with 4% sucrose buffer (10 mM Tris, 4% sucrose, 2 mM MgCl ₂ in 1 x PBS), and the titer of the virus produced when infected with stem cells and Depending on the MOI, less than 50 μl of viral solution is added per ml of cell medium. 24 hours after infection, the cells may be washed once with N ₂ medium to remove the virus, and the growth factors containing N ₂ medium may be added to continue culturing the stem cells.

Since the expression of the protein of interest in the transformant is carried out by the CAG promoter, the host cell can be a eukaryotic cell to which adenovirus can be infected, such as cells of humans, dogs, chickens, mice, cows, pigs and monkeys. . The host cell may preferably be a human cell, more preferably a human neural stem cell.

In the embodiment of the present invention was inserted into a commercial vector pShuttle vector through the following process to prepare a recombinant expression vector for adenovirus. However, the scope of the present invention is not limited thereto. Cytomegalovirus immediate-early enhancer, chicken β-actin promoter, and rabbit β-globin terminator from the commercial vector TriEX-1.1 Neo DNA vector (Novagen) Clobin terminator) was cloned and inserted into a commercial vector pShuttle vector, respectively, to prepare a vector having a CAG promoter modified to be suitable for adenovirus production (see FIG. 2A).

In addition, IRES and hrGFP were additionally cloned from the commercial vector pShuttle-IRES-hrGFP-1 vector (Stratagene) to further produce a vector having a CAG promoter and expressing GFP (see FIG. 2B).

In another embodiment of the present invention, the TRAIL gene known to use TRAIL as a structural gene is cloned by PCR, and only the apoptogenic receptor binding moiety portion thereof is cloned back by PCR. A construct was constructed by inserting an isoleucine zipper domain and an Igκ- chain leader, a secretory signal sequence.

In another embodiment of the present invention, a recombinant expression vector expressing the structural gene TRAIL was prepared by inserting the structural gene construct into the recombinant expression vector for adenovirus of the present invention, and again, a recombinant adenovirus was prepared.

In one test example of the present invention, human neural stem cells secreting TRAIL were prepared using the recombinant expression vector of the present invention. As a result, it was confirmed that TRAIL is normally secreted in the transformed host cell using the recombinant expression vector of the present invention, and the recombinant expression vector of the present invention contains a larger amount of TRAIL than the recombinant expression vector including the CMV promoter. It can be seen that. This shows that the adenovirus-mediated gene transfer to the host cell can be efficiently used by the recombinant expression vector of the present invention.

In another test example of the present invention, the effect of reducing the tumor volume of human neural stem cells produced using the TRAIL expression vector comprising the recombinant TRAIL expression vector and CMV promoter of the present invention was examined. As a result, when the CMV promoter was used, the tumor volume of the experimental group decreased to 65.4 ± 5.2% compared to the control group, whereas the CAG promoter reduced the tumor volume of the experimental bacteria to 23.43 ± 3.09% compared to the control group. Confirmed.

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited to the following examples.

< Example  1>

CAG  Including promoter For adenovirus  Construction of Recombinant Expression Vector

CMV immediately early enhancer (CMV immediately early enhancer) obtained from pTriEX-1.1 Neo DNA (Novagen) vector at multi cloning site (MCS) of pShuttle vector (Stratagene) to construct recombinant expression vector for adenovirus with CAG promoter ie enhancers, chicken β-actin promoters, rabbit β-globin terminators, and pShuttle- cloned IRESs and hrGFPs derived from pShuttle-IRES-hrGFP-1 (Stratagene) vectors. CAG or pShuttle-CAG-IRES-hrGFP vectors were made respectively (see FIGS. 2A and 2B). This will be described in detail as follows.

First, the rabbit β-globin terminator was cloned between Sal I and Bgl II of the pShuttle vector in the following manner: from the pTriEX-1.1 Neo vector (Novagen), the rabbit β-globin terminator was subjected to PCR using pfu polymerase. Got it. The primers (forward primer: CTCGAGATCAATTCTCTAGCCAAT (SEQ ID NO: 9); reverse primer: GGATCCTTACATATGGGCATATGT (SEQ ID NO: 10)) include Xho I and Bam HI restriction enzyme sequences for cloning into a pShuttle vector. PCR reactions were initially denatured at 95 ° C. for 5 minutes; 35 cycles of denaturation at 94 ° C. for 45 seconds, annealing at 55 ° C. for 45 seconds and extension at 72 ° C. for 30 seconds; And final elongation at 72 ° C. for 7 minutes. The amplified PCR product was cloned into pGEM-T easy vector (Promega, Wisconsin, USA). The pGEM-T easy vector containing the rabbit β-globin terminator was digested with Xho I and Bam HI, and the pShuttle vector was digested with Sal I and Bgl II to link each product. Sal I and Xho I, Bgl II, and Bam HI are complementary cohesive ends, respectively, and can be linked to each other and the linked vectors lose their restriction sites. In this way, the pShuttle vector (pShuttle-rabbit β globin terminator) containing the rabbit β-globin terminator was cloned.

Next, the CMV immediate early enhancer and the chicken β-actin promoter portion were cloned into the pShuttle vector containing the rabbit β-globin terminator in the following manner: between the chicken β-actin promoter and the MCS of the pTriEX-1.1 Neo vector. In order to remove the Pac I restriction enzyme site, first, the pTriEX-1.1 Neo vector was cut with Pac I, and a blunt end was made using a klenow fragment (Takara). This was again cleaved with Sma I and self ligation to obtain a modified pTriEX-1.1 Neo vector without a Pac I restriction enzyme site. The modified pTriEX-1.1 Neo vector was cleaved with Fse I, polymerized with a Klenow fragment to make a blunt end, and further cleaved with Xho I to obtain CMV immediate early enhancer and chicken β-actin promoter. By connecting the pShuttle vector Kpn Ⅰ and product and the CMV immediate early enhancer and chicken β- actin promoter section obtained by cutting with Xho Ⅰ including those previously made rabbit β- globin terminator (ligation), CMV immediate early enhancer, chicken β- A recombinant expression vector (pShuttle-CAG; FIG. 1A) for adenoviruses, including the actin promoter and rabbit β-globin terminator, was completed (see FIG. 2A).

Meanwhile, IRES and hrGFP were cloned into the pShuttle-CAG vector by the following method: IRES and hrGFP portions of pShuttle-IRES-hrGFP-1 (Stratagene) vector were obtained by PCR using pfu polymerase. The primer (forward primer: CTCGAGGACTACAAGGATGAC (SEQ ID NO: 11); reverse primer: CTCGAGCACCCACTCGTGCAGGCTGCC (SEQ ID NO: 12)) includes the Xho I restriction enzyme sequence in front of the IRES for cloning into a pShuttle-CAG vector. PCR reactions were initially denatured at 95 ° C. for 5 minutes; 35 cycles of denaturation at 94 ° C. for 45 seconds, annealing at 55 ° C. for 45 seconds and extension at 72 ° C. for 1 minute; And final elongation at 72 ° C. for 7 minutes. The amplified PCR product was cloned into pGEM-T easy vector (Promega, Wisconsin, USA). The pGEM-T easy vector was cleaved with Eco RI, polymerized with Klenow pieces, and further cleaved with Xho I to obtain IRES and hrGFP moieties. The product obtained by cleaving the pShuttle-CAG vector with Xho I and Eco RV and the above IRES and hrGFP moieties were completed to complete pShuttle-CAG-IRES-hrGFP (FIG. 1B) (see FIG. 2B).

< Example  2>

Structural genes TRAIL ) structure( construct ) Production

First, the TRAIL gene was amplified by PCR using a plasmid obtained from a human fetal brain cDNA library (Clontech, Cat. 634258) as a template. To prepare a water soluble TRAIL, the apoptogenic receptor binding moiety (95-281 of SEQ ID NO: 6, SEQ ID NO: 4) excluding the transmembrane domain in TRAIL of SEQ ID NO: 6 was amplified by PCR . At this time, primers (SEQ ID NO: 13 and SEQ ID NO: 14) used includes the easy each Kpn Ⅰ and Xho Ⅰ restriction enzyme sequences therein for cloned into the pSecTag2A vector (Invitrogen). PCR reactions were initially denatured at 94 ° C. for 3 minutes; 35 cycles of denaturation at 94 ° C. for 30 seconds, annealing at 58 ° C. for 30 seconds and extension at 72 ° C. for 45 seconds; And final elongation at 72 ° C. for 10 minutes. The amplified PCR product was cloned into pGEM-T easy vector (Promega, Wisconsin, USA).

In order to enhance the activity through trimerization of TRAIL, the isoleucine zipper domain (hereinafter referred to as 'ILZ') was cloned in the following manner: the amount of sequence (SEQ ID NO: 15) obtained by reverse translation of the amino acid sequence of known ILZ An oligomer was synthesized by linking the restriction enzyme sequences of Hin dIII and Kpn I to the ends (Bioneer, Daejeon). The synthesized oligomer was inserted into the pGEM-T vector.

Thereafter, the ILZ and TRAIL genes were sequentially inserted into a pSecTag2A vector containing an Igκ-chain leader that induces extracellular secretion of the protein. That is, first, the cutting insert ILZ the pGEM-T vector by Hin dⅢ and Kpn Ⅰ, was inserted into the cut ILZ the pSecTag2A vector. Further, after cutting the two ends of TRAIL is inserted into pGEM-T easy vector gene Kpn Ⅰ and Xho Ⅰ, it was inserted into the cut TRAIL gene in the pSecTag2A the ILZ is inserted. After TRAIL expressed from the pSecTag2A vector is secreted out of the cell, the Igκ-chain leader disappears.

< Example  3>

TRAIL As a structural gene Adenovirus  Construction of Recombinant Expression Vector

In order to clone the Igk chain leader-ILZ-TRAIL construct prepared in Example 2 into an adenovirus shuttle vector, Bgl II and Xho I restriction enzyme sequences were linked by PCR at both ends of the construct. At this time, oligonucleotides having the nucleotide sequences represented by SEQ ID NO: 16 and SEQ ID NO: 14 were used as primers. PCR reactions were initially denatured at 94 ° C. for 3 minutes; 35 cycles of denaturation at 94 ° C. for 30 seconds, annealing at 60 ° C. for 30 seconds and elongation at 72 ° C. for 90 seconds; And final elongation at 72 ° C. for 10 minutes. The amplified PCR product was cloned into pGEM-T easy vector (Promega, Wisconsin, USA). Subsequently, the vector was cleaved with Bgl II and Xho I restriction enzymes and inserted into adenovirus shuttle vectors pShuttle-CAG and pShuttle-CAG-IRES-hrGFP, respectively, and these were respectively expressed as' pShuttle-CAG-Igκ-ILZ-TRAIL (Fig. 1c) 'and' pShuttle-CAG-Igκ-ILZ-TRAIL-IRES-hrGFP '(FIG. 1D). In the pShuttle-CAG-Igκ-ILZ-TRAIL-IRES-hrGFP vector, the GFP gene is linked by IRES downstream of the TRAIL gene so that GFP is naturally expressed when TRAIL is expressed.

< Example  4>

TRAIL  Expression recombination Of adenovirus (AdCAG-TRAIL)  making

PShuttle-CAG-Igκ-ILZ-TRAIL-IRES-hrGFP (FIG. 1D) prepared in Example 3 was digested with Pme I restriction enzyme, and then pAdEasy-1 (Stratagene), an adenoviral backbone vector (adenoviral backbone vector) And co-introduced to BJ5183 E. coli to induce homologous recombination between the two vectors (pAd-CAG-Igκ-ILZ-TRAIL-IRES-hrGFP). Transformation of E. coli was performed by electroporation using a transgene (Gene Pulser, 2.5 kV, 25 μF, 200 μs) (Bio-Rad, Hercules, CA, USA).

The pAd-CAG-Igκ-ILZ-TRAIL-IRES-hrGFP thus obtained was digested with Pac I restriction enzyme and then transfected into 293A cells (Invitrogen, CA), an adenovirus producing cell line, to amplify the virus. The produced recombinant virus (AdCAG-TRAIL) was purified by performing cesium chloride ultracentrifugation for 6 hours at 10 ℃ at 80,000 rpm. After dialysis (Pierce, Rockford, IL, USA) in 4% sucrose buffer (10 mM Tris, 4% sucrose, 2 mM MgCl ₂ in PBS), filtered with a 0.4 μm filter and stored at -70 ° C until use. It was.

< Comparative example  1>

CMV  By promoter TRAIL  Expression recombination Of adenovirus (AdCMV-TRAIL)  making

Inserting the Igk chain leader-ILZ-TRAIL construct prepared in Example 2 into the pShuttle-CMV-hrGFP vector (Stratagene). Recombinant adenovirus was prepared in the same manner as in Example 3 and Example 4 except for naming (FIG. 1E). At this time, the recombinant adenovirus prepared using pShuttle-CMV-Igκ-ILZ-TRAIL-IRES-hrGFP was named AdCMV-TRAIL.

< Comparative example  2>

Gfp  Expression recombination Of adenovirus (AdCAG-GFP)  making

Recombinant adenovirus (AdCAG-GFP, control virus) expressing only GFP by the CAG promoter was prepared in the same manner as in Example 3 and Example 4 using the pShuttle-CAG-IRES-hrGFP vector prepared in Example 1 It was.

< Comparative example  3>

CMV  By promoter Gfp  Expression recombination Of adenovirus (AdCMV-GFP)  making

Recombinant adenovirus (AdCMV-GFP, control virus) expressing only GFP by the CMV promoter was prepared in the same manner as in Example 3 and Example 4 using the pShuttle-CMV-hrGFP vector (Stratagene).

The adenoviruses prepared and named in the present invention are thus summarized as follows. AdCMV-TRAIL prepared using pShuttle-CMV-Igκ-ILZ-TRAIL-IRES-hrGFP vector; AdCMV-GFP prepared using pShuttle-CMV-hrGFP vector; AdCAG-TRAIL prepared using a pShuttle-CAG-Igκ-ILZ-TRAIL-IRES-hrGFP vector; AdCAG-TRAIL-noGFP prepared using a pShuttle-CAG-Igκ-ILZ-TRAIL vector; Those prepared using the pShuttle-CAG-IRES-hrGFP vector were named AdCAG-GFP, respectively.

< Test Example  1>

Manufactured Adenovirus  inspection

<1-1> TCID ₅₀  Test

TCID ₅₀ (Tissue Culture) using 293A cells to quantify the AdCAG-TRAIL, AdCMV-TRAIL, AdCAG-GFP and AdCMV-GFP recombinant viruses prepared in Example 3, Comparative Example 1, Comparative Example 2 and Comparative Example 3 Infectious Dose 50, QBiogene) test. 293A cells were plated in 96 well plates (NUNC) and infected with serially diluted recombinant virus, respectively. Infected after a week by adding the number of wells KABER statistical method (TCID 50 reference;. QBiogene, CA, USA AdenoVator applications manual) by TCID ₅₀ The value was calculated. As a result, all AdCAG-TRAIL, AdCMV-TRAIL, AdCAG-GFP and AdCMV-GFP recombinant viruses all had TCID ₅₀ The average value was 1-5 × 10 ¹⁰ PFU / ml, indicating that the adenovirus vector was well constructed.

<1-2> wild type Adenovirus  Check for contamination

To confirm the contamination of wild-type adenovirus in AdCAG-TRAIL, AdCAG-TRAIL-noGFP, AdCMV-TRAIL, AdCAG-GFP, and AdCMV-GFP recombinant viruses, the E1 gene of the wild type adenovirus removed from the two recombinant adenoviruses PCR was performed by synthesizing primers from internal sequences. First, the genome of each recombinant virus was obtained by phenol / ethanol precipitation method after breaking the virus particles with lysis buffer (0.1% SDS, 10mM Tris-Cl, 1mM EDTA). Subsequently, PCR was performed using primers of SEQ ID NO: 17 and SEQ ID NO: 18 (amplifying the E1 gene of wild type adenovirus) in order to determine whether each genome was obtained as a template and contamination of wild type adenoviruses, and extracted recombinant adenosine. A primer for detecting the hrGFP gene, a target gene (forward primer: ATGGTGAGCAAGCAGATCCTGA (SEQ ID NO: 19); reverse primer: CACCCACTCGTGCAGGCTGCCC (SEQ ID NO: 20)) and a sequence for detecting the TRAIL gene to identify the genome of the virus PCR was performed using primers No. 16 and SEQ ID NO: 14. PCR reactions were initially denatured at 94 ° C. for 3 minutes; 35 cycles of denaturation at 94 ° C. for 30 seconds, annealing at 55 ° C. for 30 seconds and elongation at 72 ° C. for 30 seconds; And final elongation at 72 ° C. for 10 minutes. At this time, the 293A cell genome was used as a positive control group. The 293A cell genome was obtained by phenol / ethanol precipitation after breaking cells with digestion buffer (0.5% SDS, 100 mM NaCl, 10 mM Tris-Cl, 25 mM EDTA). PCR reaction results were confirmed by agarose gel electrophoresis.

As a result, as shown in Figure 3b, 340 bp E1 gene was detected in 293A cells (lane 2), but AdCMV-GFP, AdCMV-TRAIL, AdCAG-GFP, AdCAG-TRAIL-noGFP and AdCAG-TRAIL recombinant virus genome Were not detected (lane 3 to lane 7) and each of the target genes (GFP: 717 bp, TRAIL :) in the AdCMV-GFP, AdCMV-TRAIL, AdCAG-GFP, AdCAG-TRAIL-noGFP and AdCAG-TRAIL recombinant viral genomes 778 bp) was detected to confirm that the extracted viral genome (lane 8 to lane 12).

< Test Example  2>

host Intracellularly TRAIL  Secretion confirmation

AdCAG-TRAIL, AdCAG-GFP, AdCMV-TRAIL, and AdCMV-GFP viruses were transformed into human neural stem cells (HFT13 cells) to confirm whether the AdCAG-TRAIL recombinant adenovirus produced in Example 3 secreted TRAIL in the host cell. After infection, the secreted TRAIL was quantified by an enzyme-linked immunosorbent assay (ELISA) method.

<2-1> human Brain  Derived neural stem cells ( HFT13  Production of cells)

After approval from the Severance Hospital Institution Review Board (IRB), it was spontaneously aborted at 13 weeks of pregnancy following the bioethics legislation of the Ministry of Health and Welfare, the research guidelines of the Ethics Committee of the Cell Applied Research Project Division of the Ministry of Science and Technology, and the human tissue research management guidelines of Sinchon Severance Hospital. The corpse of the dead fetus was obtained with the consent of the guardian in advance. Fetal carcasses were washed with sterile cold HH buffer (Hanks' balanced salt solution, 1 × [GIBCO] + HEPES, 10 mM [GIBCO] in ddH ₂ O, pH 7.4) and dissected only the central nervous system under a microscope. Subsequently, all of the meninges and blood vessels were removed and tissues of the brain region were separated.

The separated brain tissues were placed in a petri dish and cut to a size of about 1 × 1 mm. The supernatant was removed by centrifugation at 950 rpm for 3 minutes. The tissue was washed again with HH buffer and the centrifugation was repeated three times. After the last centrifugation, all supernatants were removed, and 2 ml of 0.1% trypsin (Gibco) and DNase I (Roche, 1 mg / dL) were added to the remaining tissues and mixed well. The reaction was carried out at 37 ° C. and 5% CO ₂ incubator for 30 minutes. After 30 minutes, 3 ml of serum-containing medium (DMEM + 10% FBS + 1 × penicillin / streptomycin / fungizone) (both from Gibco) was added. Serologic pipettes (Falcon) were used to slowly break down the tissue and dissociate to single cell level. Thereafter, the supernatant was removed by centrifugation, and the cell pellet was washed with HH buffer solution. After centrifugation again, the supernatant was removed.

N2 medium (D-MEM / F-12 [98% volume (v) / volume (v)] + N2 supplement [1% v / v] + Penicillin / Streptomycin [1% v / v]) in the cell pellet; 10 ml of Gibco) was added and mixed slowly. About 4 × 10 ⁶ −6 × 10 ⁶ cells were transferred to a tissue culture treated 100 mm plate, Corning. 20 ng / ml recombinant human fibroblast growth factor-basic (R & D), 10 ng / ml recombinant human leukemia inhibitory factor (Sigma), and 8 μg / ml heparin (Sigma) were added as neural stem cell growth factors, respectively. After shaking well to the left and right, and then incubated in 37 ℃, 5% CO ₂ incubator. After 24 hours, 5 ml of medium was discarded and 5 ml of fresh N2 medium was added. At the same time 20 ng / ml bFGF, 10 ng / ml LIF and 8 μg / ml heparin were added and the culture continued. Medium exchange was performed every 3-4 days while observing the state of the medium and cells. At this time, only about half of the medium was replaced with fresh medium and growth factors were added together. In addition, when undifferentiated neural stem cells continued to proliferate and aggregated to form cell masses, that is, neurospheres, were formed, and then subcultured every 7-8 days.

<2-2> ELISA  analysis

To this end, 5 × 10 ⁵ tumor-derived human neural stem cells (HFT13 cells) isolated in Test Example <2-1> containing growth factors N2 Plated in 6 well culture dishes (NUNC) with 1 ml of medium. After 1 hour AdCAG-TRAIL of 65, 130, 195 and 260 multiplicity of infection, AdCAG-GFP of 50 MOI, AdCMV-TRAIL and 100 MOI of 100, 200 and 300 multiplicity of infection, respectively -GFP viral particles were added to the medium to infect the cells. After 24 hours of infection, each well was washed once with 3 ml N2 medium to remove the virus. Thereafter, 3 ml of growth factor-containing N2 medium was added to culture the cells. 48 hours after culturing the virus-infected cells were observed under a fluorescence microscope to confirm that the expression of GFP in the neural stem cells (results not shown).

In order to quantify the TRAIL secreted from the recombinant virus-infected neural stem cells, all cell cultures were collected and subjected to ELISA (BD, San Diego, CA) for TRAIL. The anti-human TRAIL monoclonal antibody was diluted 1: 250 in coating buffer (0.1 M sodium carbonate / bicarbonate, pH 9.5 in distilled water) and 100 μl was dispensed into each well of a 96 well plate (NUNC). . And it reacted at 4 degreeC for one day. Wells were washed three times with wash buffer (1 × PBS with 0.05% Tween-20). Assay diluent (1 × PBS with 10% FBS, pH 7.0) was added to each well and blocked for 1 hour at room temperature. After washing three more times, 100 μl of a culture solution of AdCAG-TRAIL, AdCAG-GFP, AdCMV-TRAIL or AdCMV-GFP recombinant adenovirus and its serial dilutions were dispensed into each well and allowed to react at room temperature for two hours. After the reaction was completed, each well was washed five times. 100 μl of biotin-treated biotinylated anti-human TRAIL monoclonal antibody and avidin-horseradish peroxidase conjuate reagent diluted in assay diluent Aliquots were made and reacted at room temperature for 1 hour. Finally, the cells were washed 7 times, and 100 μl of substrate solution (Tetramethylbenzidine [TMB] and hydrogen peroxide, BD, USA) was dispensed into each well to block light and allowed to react at room temperature for 30 minutes. 50 μl of 2N sulfuric acid was added to stop the reaction. Then, the absorbance was measured at 450-570 nm with a microplate reader (Molecular Devices). As a result, the measured TRAIL amounts were 42.03 ± 2.68 (Mean ± SD), 48.88 ± 3.13, 51.42 ± from 48 million neuronal stem cell cultures after 48 hours, when AdCAG-TRAIL was infected with 65, 130, 195 and 260 MOI, respectively. 6.63 and 53.76 ± 4.38 ng, and 10.3 ± 2.29 (Mean ± SD), 28.5 ± 1.39 and 40.7 ± 2.90 from 1 million neural stem cell cultures after 48 hours, when AdCMV-TRAIL was infected with 100, 200 and 300 MOI, respectively. ng (FIG. 4). Values of less than 0.01 ng were measured in HFT13 cells (control) without virus infection, HFT13 cell cultures infected with AdCMV-GFP and HFT13 cell cultures infected with AdCAG-GFP.

Therefore, the recombinant adenovirus produced by the recombinant expression vector of the present invention was found to express a greater amount of TRAIL at less MOI than when using the CMV promoter in the host cell.

From the above results, it was confirmed that TRAIL is normally secreted from TRAIL-expressing recombinant adenovirus-infected human neural stem cells, which suggests that adenovirus-mediated gene transfer to host cells can be efficiently used by the recombinant expression vector of the present invention. To show.

< Test Example  3>

Recombination Adenovirus  Human Glioblastoma by Infected Human Neural Stem Cells Edema  Apoptosis Assay

<3-1> human Glioblastoma  culture

U87MG cell line, a type of human polymorphic glioblastoma purchased from the American Type Culture Collection (ATCC), was cultured in RPMI 1640 medium (Gibco) to which 10% FBS and 1 × P / S (penicillin / streptomycin; Gibco) were added. Another human glioblastoma U343MG cell line (ATCC) was cultured in DMEM medium (Gibco) to which 10% FBS and 1x P / S was added. These cells were passaged every 2-4 days with 0.05% trypsin / EDTA for 2 minutes 30 seconds. After the last subculture, U87MG or U343MG cells were treated with trypsin / EDTA to make single cell suspensions. The suspension was centrifuged at 950 rpm for 3 minutes to remove supernatant. Cells were resuspended by adding 5 ml of 1 × PBS containing 20 μg / ml CM-DiI (Cell Tracker, Molecular Probes) to the cell pellet. The cells were then stained with CM-DiI for 3 minutes at 37 ° C. and 10 minutes on ice. Cell pellets obtained by centrifugation were resuspended with 10 ml of 1 × PBS and centrifuged again three times to remove the remaining CM-DiI. The cells were then resuspended in 1 × PBS by adjusting the cell number to 5 × 10 ⁵ cells / 4 μl. The cell suspension thus prepared was stored on ice until in vivo transplantation.

<3-2> human Glioblastoma  Apoptosis Assay

In order to determine whether TRAIL secreted from AdCAG-TRAIL recombinant virus infected human neural stem cells produced using the recombinant TRAIL expression vector of the present invention induces the death of human glioblastoma cells, the virus-infected neural stem cell culture and glioblastoma cell line Co-culture was carried out.

First, 5 × 10 ⁵ HFT13 cells were plated with medium in each well of a 6 well plate dish. After 1 hour, cells were infected with 50 MOI AdCAG-GFP virus, 65, 130, 195 and 260 MOI AdCAG-TRAIL virus, 50 MOI AdCMV-GFP virus and 100, 200 and 300 MOI AdCMV-TRAIL virus, respectively I was. After 24 hours, cells were washed with 3 ml of N2 medium and continued incubation in 5 ml of growth factor-containing N2 medium for 3 days. The cell culture was centrifuged for 3 minutes at 1000 rpm. Meanwhile, 2 × 10 ⁵ U87MG or U343MG cells were plated with medium in each well of a 12 well plate dish. After incubation for 24 hours, the medium was removed and 1.5 mL of the prepared neural stem cell culture solution was added to each well, and the tumor cells were killed. As a result, U87MG and U343MG cells co-cultured with media of HFT13 cells infected with AdCAG-TRAIL showed very fast cell death similarly to when directly treated with rhTRAIL (FIG. 5A). On the other hand, U87MG and U343MG cells co-cultured with media of HFT13 cells infected with AdCMV-TRAIL also showed apoptosis, which was weaker than that of AdCAG-TRAIL. In addition, glioblastoma cell cells co-cultured with the medium of HFT13 cells not infected with virus, the medium of HFT13 cells infected with AdCMV-GFP, or the medium of HFT13 cells infected with AdCAG-GFP did not show death (FIG. 5A).

To quantify the degree of apoptosis, a mitochondrial dehydrogenase activity assay (Cell Counting Kit-8 [CCK-8 assay], Dojindo Laboratories, Tokyo, Japan) was performed. 5 × 10 ⁴ HFT13 cells were plated in each well of a 96 well plate with 100 μl of N2 medium containing growth factors. After 24 hours cells were infected with 50 MOI AdCAG-GFP virus, 65, 130, 195 and 260 MOI AdCAG-TRAIL virus, 50 MOI AdCMV-GFP virus and 100, 200 and 300 MOI AdCMV-TRAIL virus, respectively. . After 6 days, 10 μl of water-soluble tetrazolium salt and CCK-8 solution of 1-methoxy PMS, which is an electron carrier, were added to each well. After 2 hours, the absorbance was measured at 450 nm using a micro reader. At this time, the blank control group was a well treated with only CCK-8 solution in the cell medium, and the untreated HFT13 cell culture group was expressed as 100% survival. All experiments were repeated three times under the same conditions to obtain an average value. As a result, at least 24% of HFT13 cell medium and U87MG cells infected with 260 MOI of AdCAG-TRAIL recombinant virus were killed at least 63% of tumor cells and at least 91% of tumor cells when co-cultured with U343MG cells. By comparison, at least 54% of tumor cells were killed when co-cultured with HFT13 cell medium and U87MG cells infected with 300 MOI of AdCMV-TRAIL recombinant virus for 24 hours, and at least 85% of tumor cells when co-cultured with U343MG cells. More apoptosis was observed with low MOI in expression by CAG promoter. Coculture with HFT13 cell medium infected with AdCMV-GFP or AdCAG-GFP showed only less than 7% of tumor cells were killed (FIGS. 5B and 5C).

< Test Example  4>

Glioblastoma  On animal models TRAIL  Reduction of Tumor Size After Transplantation of Expressing Human Neural Stem Cells

In order to quantitatively evaluate the extent of tumor size reduction after transplantation of TRAIL-expressing human neural stem cells by CAG promoter, U87MG cell brain tumor model was established and 100 MOI AdCAG-TRAIL infected human neural stem cells were transplanted (n = 7), control group was implanted with cell medium only (n = 7). As a comparison experiment, AdCMV-TRAIL-infected human neural stem cells were transplanted into a brain tumor animal model (n = 8), and only the control medium was implanted (n = 7).

After 10 days of transplantation, in order to quantitatively evaluate the extent of tumor size reduction, all the slides containing the tumor were stained with hematoxylin in each experimental group and the control group, and then the tumor size was measured using MetaMorph Imaging System, Universal Imaging Corporation, PA, USA). That is, after fixing the brain of each animal with 4% paraformaldehyde (in 0.1M Pipes buffer), the brain was extracted. The extracted brain was immersed in 30% sucrose (in PBS). After 1-2 days at 4 ℃ cryoprotection (cryoprotection), and was cut to 16 ㎛ thickness. Each brain tissue section spacing on the slide was 96 μm each. Slides were immersed in 1 × PBS for 20 minutes and stained for 4 minutes in hematoxylin solution. The slides were then washed in running water and mounted with glycerol mounting medium. After staining, the slides containing the mass sites were photographed at 100 × magnification under bright field microscope. The metamorphic imaging system was used to designate the mass site area, convert the number of pixels of the designated area into area, and multiply the thickness of the tissue section (96 μm) to determine the volume of the final mass. This was done for all experimental and control groups to compare the mean values.

As a result, when using the CAG promoter, the average tumor volume of the control group in the animal model of U87MG glioblastoma is 2.80 mm ³ In contrast, the mean tumor volume of the experimental group was 0.66 mm ³ It was. When the tumor volume of the control group was converted to 100%, the tumor volume of the experimental group was 23.43 ± 3.09% (mean ± SEM). In contrast, the average tumor volume of the control group in the U87MG glioblastoma animal model using the CMV promoter was 2.40 mm ^3. In contrast, the mean tumor volume of the experimental group was 1.57 mm ³ It was. As a result of converting the tumor volume of the control group to 100%, the tumor volume of the experimental group was 65.4 ± 5.2% (mean ± SEM).

In summary, when using the CMV promoter, the tumor volume of the experimental group decreased to 65.4 ± 5.2% compared to the control group, whereas the CAG promoter reduced the tumor volume to 23.43 ± 3.09% compared to the control group. It was confirmed (p <0.01, non-paired t test).

As described above, the recombinant expression vector of the present invention can effectively express a protein in a host cell. Therefore, the recombinant expression vector of the present invention can be usefully used for transformation of host cells using adenovirus.

Attach sequence list electronic file

Claims (9)

Recombinant shuttle vector for adenovirus, CMV cytomegalovirus immediate early enhancer of SEQ ID NO: 1, chicken β-actin promoter of SEQ ID NO: 2, a structural gene operably linked to the promoter And a rabbit β-globin terminator of SEQ ID NO. 3, wherein the recombinant shuttle vector for adenovirus is sequentially connected. delete The method of claim 1, wherein the structural gene is an Igκ- chain leader of SEQ ID NO: 8, the isoleucine zipper domain of SEQ ID NO: 15 and the apopto of a tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) of SEQ ID NO: 4 A recombinant shuttle vector, wherein the gene receptor receptor moiety (apoptogenic receptor binding moiety) is a sequence linked sequentially. The recombinant shuttle vector of claim 3, wherein the recombinant expression vector has a cleavage map disclosed in FIG. 1C. Recombinant adenovirus produced using any one recombinant shuttle vector selected from the group consisting of claim 1, claim 3 and claim 4. Cells transformed with any one recombinant shuttle expression vector selected from the group consisting of claim 1, claim 3 and claim 4. (a) preparing a recombinant vector by inserting a structural gene encoding a target protein into any one vector selected from the group consisting of claims 1, 3 and 4; (b) preparing an adenovirus using the recombinant vector; (c) infecting the adenovirus with a host cell to prepare a transformant; And (d) expressing the target protein in vitro or in animals other than humans, comprising expressing the target protein in the transformant. 8. The apoptosis of claim 7, wherein the structural gene is an Igκ- chain leader of SEQ ID NO: 8, an isoleucine zipper domain of SEQ ID NO: 15, and apoptosis of a tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) of SEQ ID NO: 4. 9. A method of expressing a protein of interest, characterized in that the nucleotide sequence of the apoptogenic receptor binding moiety (sequentially linked). The method of claim 7 or 8, wherein the host cell is a human neural stem cell.

Images