WO2008120832A1 - Human neural stem cell secreting a smac, preparation method and use thereof - Google Patents

Human neural stem cell secreting a smac, preparation method and use thereof Download PDF

Info

Publication number
WO2008120832A1
WO2008120832A1 PCT/KR2007/001577 KR2007001577W WO2008120832A1 WO 2008120832 A1 WO2008120832 A1 WO 2008120832A1 KR 2007001577 W KR2007001577 W KR 2007001577W WO 2008120832 A1 WO2008120832 A1 WO 2008120832A1
Authority
WO
WIPO (PCT)
Prior art keywords
neural stem
smac
cells
stem cell
vector
Prior art date
Application number
PCT/KR2007/001577
Other languages
French (fr)
Inventor
Kook-In Park
Original Assignee
Industry-Academic Cooperation Foundation, Yonsei University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Industry-Academic Cooperation Foundation, Yonsei University filed Critical Industry-Academic Cooperation Foundation, Yonsei University
Priority to PCT/KR2007/001577 priority Critical patent/WO2008120832A1/en
Publication of WO2008120832A1 publication Critical patent/WO2008120832A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0618—Cells of the nervous system
    • C12N5/0623—Stem cells
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/105—Murine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A01K2267/0306—Animal model for genetic diseases
    • A01K2267/0318—Animal model for neurodegenerative disease, e.g. non- Alzheimer's
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A01K2267/0331—Animal model for proliferative diseases
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/40—Regulators of development
    • C12N2501/48—Regulators of apoptosis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2799/00—Uses of viruses
    • C12N2799/02—Uses of viruses as vector
    • C12N2799/021—Uses of viruses as vector for the expression of a heterologous nucleic acid
    • C12N2799/022—Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from an adenovirus

Definitions

  • the present invention relates to a human neural stem cell secreting SMAC, a preparation method thereof and a use thereof. More particularly, it relates to a human neural stem cell transformed by a SMAC-encoding nucleotide, a preparation method thereof and a use thereof.
  • Neural stem cells mainly exist in the nervous systems, which is continuous proliferation in an immature and undifferentiated state, and are defined by self- renewal and multipotency of differentiating both neurons and glia cells. Neural stem cells are found existing in various anatomical sites over fetal nervous systems of mammals including human beings. Recently, it was found out that neural stem cells exist in adult nervous systems not only in fetal ones. Throughout life, neural stem cells proliferate consistently in a specific brain region to generate new nerve cells. Further, they were reported to have plasticity to differentiate into various other cells or tissues, not only the nerve cells.
  • neural stem cells are increasing recently, not only with regard to basic researches on mechanisms of proliferation and differentiation of stem cells and development of nervous systems, but also with regard to the possibility of original cell and gene therapy of intractable tumors, particularly in neurological diseases, which are known not to be regulated once damaged, utilizing biological characteristics of the neural stem cells.
  • numerous drugs, proteins and neurotrophic factors are screened for the treatment of neurological diseases, and various therapies are actively developed through evaluation of therapeutic and nerve- protecting effects thereof in vivo and in vitro. But, there are few substantial results. Actually, there is no special therapy enabling clinically protecting and regenerating damaged nerve tissues, as yet.
  • neural stem cells are only in the earliest stages and require more basic researches. Further, several problems have to be solved for their clinical application. In particular, the mechanisms of survival, migration and differentiation of donor cells, expression of foreign genes and integration with the host nervous system during the transplantation of neural stem cells have to be elucidated, and it needs to be confirmed whether the differentiated nerve cells exhibit adequate nerve connections and links and functional improvements in the host nervous system. Cell death by apoptosis may occur either extracellularly (extrinsic pathway) or intracellularly (intrinsic pathway) .
  • death receptors such as CD95 (APO-1/FAS) and TRAIL receptor, which are member of a tumor necrosis factor (TNF) receptor superfamily, are stimulated to activate caspases which conduct cell executions.
  • APO-1/FAS apoptosis-inducing material
  • SMAC second mitochondria- derived activator of caspase
  • endonuclease G are excreted from mitochondria into the cytoplasm.
  • IAPs inhibitors of apoptosis proteins
  • SMAC is also excreted from mitochondria in response to the apoptosis-inducing stimulation. It is known as a protein that induces apoptosis by mainly be inhibiting the action of IAPs [Cell 102:33, 2000; Cell 102:43, 2000; Nature 410:112, 2001; Nature 406:855, 2000].
  • an object of the present invention is to provide a human neural stem cell secreting SMAC, a preparation method thereof and a use thereof.
  • the present invention provides a human neural stem cell transformed by a SMAC encoding nucleotide.
  • the present invention provides a preparation method of the neural stem cell.
  • the present invention provides a composition for treating tumors comprising the neural stem cell.
  • the present invention is characterized in that a human neural stem cell genetically modified to secrete the tumor cell apoptosis-inducing SMAC for the first time .
  • the human neural stem cell may preferably be one isolated from the brain of a human fetus.
  • the brain may be the one selected from the group consisting of telencephalon, diencephalon, mesencephalon, cerebellum, medulla oblongata, pons or spinal cord.
  • the brain may be the telencephalon.
  • the human neural stem cell secreting SMAC according to the present invention does not exhibit cytotoxicity, and grows on a plate in undifferentiated status (see FIG. 1 and FIG. 2) .
  • the neural stem cell of the present invention has the ability to express nestin or vimentin, which are neural stem cell markers, in 99% or more cells and to differentiate into such nerve cells as neuron, oligodendrocyte and astrocyte (see FIG. 3).
  • nestin or vimentin which are neural stem cell markers
  • the human neural stem cell secreting TRAIL and SMAC When cultured along with tumor cells, the human neural stem cell secreting TRAIL and SMAC according the present invention, it is induced the apoptosis of the tumor cells
  • the neural stem cells of the present invention when transplanted in tumor animal models (e.g., human glioblastoma animal model) , specifically enclose the boundary of the primary tumor mass and implant or distribute by the manner of infiltrating into the tumors. Also, they implant or distribute in the secondary tumor by specifically migrating along with tumor cells the metastasizing to the nearly nerve tissue. And, some of the neural stem cells of the present invention may differentiate into neurons or glia cells after being transplanted, and replace and regenerate the nerve cells damaged by tumors.
  • tumor animal models e.g., human glioblastoma animal model
  • the neural stem cells of the present invention excrete SMAC to assist synergically the action of TRAIL and induce apoptosis of nearby tumor cells, thereby reducing the volume of the tumors (see FIG. 11). On the other hand, they do not induce special damage to normal brain nerve tissues.
  • the neural stem cells of the present invention may be prepared by transforming human neural stem cells using a SMAC encoding nucleotide.
  • SMAC encoding nucleotide refers to the introduction of a SMAC encoding nucleotide into human neural stem cells.
  • the preparation method of a human neural stem cell secreting SMAC according to the present invention may comprise the steps of:
  • the polynucleotide encoding the said SMAC may be used without limit, if the sequence is known as encoding SMAC for the skilled.
  • the said polynucleotide may comprise a sequence encoding SMAC, which contains amino acid sequence of SEQ ID NO: 1. More preferably, the said polynucleotide may comprise the sequence encoding polypeptide sequence of SEQ ID NO: 1. Most preferably, the said polynucleotide may comprise the sequence of SEQ ID NO: 2.
  • the said polynucleotide may be the sequence set forth in Genbank Accession Nos. NM__138929, NM_019887, NM_138930, AF_298770, AF_262240, but not limited thereto.
  • the said polynucleotide may comprise nucloetide sequence encoding functional equivalent of SMAC.
  • the said functional equivalents means polypeptides which show at least 70% amino acid sequence homology with the amino acid sequence of SEQ ID NO: 2, preferably 80%, and more preferably 90% produced by as a result of addition, substitution, or deletion of amino acid and exhibit substantially identical physiological activity to the inventive SMAC.
  • the term "identical physiological activity” refer to activity which induce apoptosis of cancer cell by supproting the function of TRAIL.
  • the said functional equivalents means polypeptides which have at least 70% amino acid sequence homology (i.e., identity) with the peptide of SEQ ID NO: 1, preferably at least 80%, and more preferably at least 90%, for example, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87 %, 88 %, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and 100% and exhibit substantially identical phisiological activity to the polypeptide of SEQ ID NO: 1.
  • the said functional equivalent may be produced by as a result of addition, substitution, or deletion of a part of the amino acid of SEQ ID NO: 1.
  • the substitution of the amino acid is preferably conservative substitution.
  • the substitutions of the amino acid in nature are as follows; aliphatic amino acid(Gly, Ala, Pro), hydrophobic amino acid(Ile, Leu, VaI), aromatic amino acid(Phe, Tyr, Trp) , acidic amino acid(Asp, GIu), basic amino acid(His, Lys, Arg, GIn, Asn) and sufur containing amino acid(Cys, Met).
  • the said functional equivalent may comprise the tranformants which are deleted a part of SMAC amino acid comprising amino acid sequence of SEQ ID NO: 1.
  • the deletion and substitution of the said amino acid may occur preferably in the region which is no related to physiological activity of the inventive polypeptide.
  • the said functional equivalent may comprise the tranformants which are added some amino acid in the sequence or termimals.
  • the range of the functional equvalent in the invention may comprise polypetide derivatives which maintain the inventive polypeptide backbone and physiological activity, but were modified in some chemical structures. For example, they may comprise modified chemical sturctures for changing stability, preservation, volatility, or solubility of the inventive polypeptide.
  • amino acid encoding the SMAC may be prepared by the genetic engineering method known in the art (Sambrook, Fritsch and Maniatis, ⁇ Molecular Cloning, A labolatory Manual, Cold Spring Harbor laboratory press, 1989; Short Protocols in Molecular Biology, John Wiley and Sons, 1992) .
  • they comprise PCR amplification which amplify nucleotides from the genome, chemical synthesis, cDNA producing technique and the like.
  • Sequence identity and homology is defined by aligning the sequences (SEQ ID NO: 1) and the candidate sequence and introducing gaps, and the percentage of amino acid residues in that are identical with amino acid sequence of SEQ ID NO: 1. If necessary, to achieve the maximum percent sequence identity, any conservative substitutions is not considered as part of the sequence identity. In addition, none of N-terminal, C-terminal, or internal extensions, deletions, or insertions into the amino acid sequence of SEQ ID NO: 1 shall be constructed as affecting sequence identity or homology. Thus, sequence identity can be determined by standard methods that are commonly used to compare the similarity in position of the amino acids of two polypeptides.
  • two polypeptides are aligned for optimal matching of their respective amino acids (either along the full length of one or both sequences or along a predetermined portion of one or both sequences).
  • the programs provide a default opening penalty and a default gap penalty, and a scoring matrix such as PAM 250 (a standard scoring matrix; Dayhoff et al., in Atlas of Protein Sequence and Structure, vol 5, supp. 3, 1978) .
  • PAM 250 a standard scoring matrix; Dayhoff et al., in Atlas of Protein Sequence and Structure, vol 5, supp. 3, 1978
  • the percent identity can be calculated as: the total number of identical matches multiplied by 100 and then divided by sum of the length of a longer sequence within the matched span and the number of gaps introduced into longer sequences in order to align the two sequences.
  • the nuclotide encoding the SMAC may be inserted to a expression vector operably linked to sequence regulating expression of the of nucleic acid sequence.
  • operably linked means that one nucleic acid fragment is linked to other nucleic acid fragment so that the function or expression thereof is affected by the other nucleic acid fragment.
  • expression control sequence means a DNA sequence regulating expression of the of nucleic acid sequence operably linked in a specific host cell.
  • the control sequence may comprise the promoter for initiating transcription, operator sequence for controlling transcrpition, a sequence encoding a suitable mRNA ribosome-binding site, and sequences controlling the termination transcription and translation.
  • the promoter it may be constitutive promoter which constitutively induces the expression of a target gene, or inducible promoter which induces the expression of a target gene at a specific site and a specific time, and examples thereof include CMV promoter, CAG promoter (Hitoshi Niwa et al., Gene, 108:193-199, 1991; Monahan et al., Gene Therapy, 7:24-30, 200Oj, CaMV 35S promoter (Odell et al., Nature 313:810-812, 1985), Rsyn7 promoter (US Patent Application No.
  • a CAG promoter is one of a modified CMV promoter and consists of a cytomegalovirus immediate-early enhancer, a chicken ⁇ -actin promoter, a chimeric intron, and exon 1 and part of exon 2 of a rabbit ⁇ -globin gene [Hitoshi Niwa et al., Gene, 108:193-199, 1991; Monahan et al., Gene Therapy, 7:24-30, 2000].
  • the inventors of the present invention modified the previously known CAG promoter since it is not suited for the manufacture of adenovirus .
  • the CAG promoter used in the present invention was introduced to the commercially available pShuttle vector.
  • each of cytomegalovirus immediate-early enhancer, chicken ⁇ -actin promoter and rabbit ⁇ -globin terminator was cloned and inserted into the commercially available pShuttle vector in order to obtain a vector having a CAG promoter modified adequate for the manufacture of adenovirus (see FIG. 5) .
  • IRES and hrGFP were further cloned from the commercially available pShuttle-IRES-hrGFP-1 vector in order to manufacture a vector having a CAG promoter and expressing GFP (see FIG. 7) .
  • a structure enabling the expressed protein to move into the cytoplasm is essential.
  • a protein transduction domain (PTD) is linked preferably in the upstream of the SMAC encoding nucleotide.
  • the protein transduction domain is an oligopeptide consisting of several amino acid residues and capable of introducing itself and other polymer compounds such as oligonucleotide, peptide, protein and oligosaccharide, without requiring special receptors or consuming energy.
  • the protein transduction domain is not limited thereto, but is, for example, a transduction domain of HIV-I TAT, an oligopeptide consisting of 5 to 12 arginine residues, an oligopeptide consisting of 5 to 12 lysine residues, PEP-I peptide, ANTP, VP22 protein, and so forth can be used [Morris et al., Nat. Biotechnol.
  • the PTD may be any one known in the related art.
  • one selected from the group consisting of TAT PTD (YGRKKRRQRRR) of HIV-I (human immunodeficiency virus type 1), an oligopeptide consisting of 9 arginine residues, an oligopeptide consisting of 10 lysine residues and PEP-I peptide (KETWWETWWTEWSQPKKKRKV) may be used [Yang et al., FEBS Letters, 532:36-44, 2002, Vives et al., J. Biol. Chem., 272:16010-16017, 1997, Nagahara et al., Nature Med., 4:1449-1452, 1998].
  • the transduction domain of HIV-I Tat is characterized by having signals for opening the lipid barrier of the cell to infiltrate.
  • the hydrophobic domain of the PEP-I peptide binds with the hydrophobic moiety of the protein to infiltrate, thereby enhancing targeting efficiency of the cell membrane, whereas the hydrophilic domain facilitates transfer into the cytoplasm.
  • the SMAC since the SMAC has to be excreted out of the human neural stem cell after expression so as to enter the cytoplasm of the tumor cell, it is preferable to link a secretion signal sequence to a TAT-SMAC encoding nucleotide.
  • the secretion signal sequence is linked in the upstream of the TAT-SMAC.
  • the secretion signal sequence may be an Ig ⁇ -chain leader, a secretion signal sequence of seminal RNase, a SEC2 sequence (N-terminal 28 amino acids of human fibrillin- 1), a FIB sequence (nucleotides 208-303 derived from rat fibronectin mRNA sequence) or a signal peptide of FGF-4, but not limited thereto.
  • it may be an Ig ⁇ - chain leader.
  • the Ig ⁇ -chain leader may have a base sequence represented by SEQ ID NO 22
  • the Ig ⁇ -chain leader is cut off after excretion out of the cell, because it is not necessary any more.
  • the secretion signal sequence includes a signal cleavage site or is cut off after excretion out of the cell even though it does not include a signal cleavage site. In the secretion signal sequence, cleavage occurs between the last 20th and 21st amino acids of the Ig ⁇ -chain leader.
  • cleavage occurs between the last ggt and gac-3' of the sequence 5 ' -atg gag aca gac aca etc ctg eta tgg gta ctg ctg etc tgg gtt cca ggt tec act ggt gac-3'.
  • the DNA construct consisting of the secretion signal sequence, TAT and SMAC encoding nucleotide in sequence can be prepared by the cloning method well known in the related art, including PCR amplification, cutting of DNA using restriction enzymes, ligation and transformation (see Example 4).
  • expression vector may be inserted nucleotide encoding structural gene and may be plasmid, viral vector, or other biological vehicle which express the said nucleotide and known in the art. Preferably, it may be viral vector.
  • the acceptable expression plasmids of the invention may comprise mammalian expression plasmids which are used in the art.
  • mammalian expression plasmids which are used in the art.
  • pRK5 European Patent No. 307,247
  • pSV16B PCT Publication No. WO91/08291
  • pVL1392 pVL1392
  • the method which introduce plasmid DNA directly into a human cell, and FDA has approved to use for human (Nabel, E. G., et al., Science, 249:1285-1288, 1990).
  • a plasmid DNA has advantage in respect of even purification.
  • the viral vectors may comprise, but not limited thereto, retrovirus vector, adenovirus vector, herpes virus vector, avipox virus vector, lenti virus and the like. All of the viral genes of the said retroviral vectors were deleted or modified, and consequently non-viral proteins of the said vectors were produced by the infected cells.
  • the main advantages of the retroviral vectors for gene therapy are to transfer large amount of genes into cloned cells, to integrate genes specifically which are transferred to cellular DNA , and to prevent additional infection after gene transformation (Miller, A. D., Nature, 357:455-460, 1992).
  • the retroviral vectors which are approved by the FDA is manufactured by using PA317 amphotrophic retroviral packaging cell (Miller, A. D. and Buttimore, C, Molec. Cell Biol., 6:2895-2902, 1986).
  • PA317 amphotrophic retroviral packaging cell Miller, A. D. and Buttimore, C, Molec. Cell Biol., 6:2895-2902, 1986.
  • non-retroviral vectors there is the said adenovirus (Rosenfeld et al., Cell, 68:143-155, 1992; Jaffe et al., Nature Genetics, 1:372-378, 1992; Lemarchand et al., Proc. Natl. Acad. Sci. USA, 89:6482-6486, 1992).
  • adenovirus The main advantages of the adenovirus are to transfer large molecular DNA fragment (36kb) , and to transfect non-cloned cells with very high titer.
  • herpes viruses could be used in gene therapy for human (Wolfe, J. H., et al., Nature Genetics, 1:379-384, 1992).
  • viral vector which is known in the art may be used in the invention. Preferably, it may be adenovirus vector.
  • the preparation method for adenovirus by using the inventive expression vector may comprise, but not limited thereto, the method of which co- transfection with adenoviral backbone vector such as pAsEasy-1 (Stratagene) into BJ5183 E coli and inducing homologous recombination and amplify it from adenovirus producing cells such as 293A cells.
  • adenoviral backbone vector such as pAsEasy-1 (Stratagene) into BJ5183 E coli
  • adenovirus producing cells such as 293A cells.
  • the said praparation methods were described well in the following references: Benihoud, K., Yeh, P. and Perricaudet, M. (1999) Curr Opin Biotechnol 10(5):440-7, Berkner, K. L. (1988) Biotechniques 6(7): 616-29, He, T.
  • the plasmid expression vector which comprise the said nucleic acid could be introduced to a target cell by, but not limited thereto, transient transfection, microinjection, transduction, cell fusion, calcium phosphate precipitation, liposome-mediated transfection,
  • the human neural stem cell secreting SMAC may be prepared by a method comprising the steps of: (a) preparing a recombinant viral vector including a DNA construct consisting of a secretion signal sequence, an HIV-derived protein transduction domain and a SMAC encoding nucleotide in sequence;
  • a recombinant viral vector is prepared by inserting a DNA construct consisting of a secretion signal sequence, a protein transduction domain derived from HIV (human immunodeficiency virus) and a SMAC encoding nucleotide in sequence into a viral vector.
  • the DNA construct consisting of a secretion signal sequence, an HIV-derived protein transduction domain and a TRAIL encoding nucleotide in sequence has been described above.
  • the DNA construct may be inserted into a viral vector known in the related art as operably linked to an expression control sequence, e.g., promoter.
  • a SMAC expressing recombinant virus is prepared by introducing the recombinant viral vector including the SMAC encoding nucleotide into a virus producing cell line.
  • the virus producing cell line may be a cell line producing viruses corresponding to the employed viral vector. For instance, when an adenoviral vector is used, 293 cell line that produces adenovirus may be used.
  • a human neural stem cell is infected by the SMAC expressing recombinant adenovirus.
  • the infection of the human neural stem cell with adenovirus can be performed by the method known in the related art.
  • human neural stem cells HFT13 cells
  • HFT13 cells may be plated in growth factor containing N2 medium and infected by adding viral particles with adequate MOI (multiplicity of infection) to the medium 1 hour later.
  • the virus is kept in a refrigerator at -80 °C in 4% sucrose buffer (10 mM Tris, 4% sucrose, 2 mM MgCl 2 in IxPBS) , and less than about 50 ⁇ L of viral solution per 1 mL of cell medium is added for the infection of the stem cell, depending on the corresponding titer and MOI. After 24 hours of infection, the cells are washed once with N2 medium, and growth factor containing N2 medium is added to further culture the stem cells.
  • the neural stem cell may be one isolated from the brain of human fetus.
  • the brain neural stem cell may be one isolated from telencephalon, diencephalon, mesencephalon, cerebellum, medulla oblongata, pons or spinal cord, and preferably from the telencephalon.
  • the human neural stem cell may be purchased commercially or prepared by culturing cells isolated from the brain tissue of human fetus in neural stem cell growth factor containing medium (Example 1) .
  • the neural stem cell growth factor may be bFGF (fibroblast growth factor-basic), LIF (leukemia inhibitory factor) or heparin.
  • 20 ng/mL bFGF, 10 ng/mL LIF and 8 ⁇ g/mL heparin may be used.
  • the human neural stem cell secreting SMAC according to the present invention may be grown and cultivated by the method known in the related art.
  • the neural stem cell of the present invention is cultivated in a culture medium that supports the survival or growth of the wanted cell type. Occasionally, it is preferable to supply a culture medium in the form of free amino acid instead of serum. It is preferable to add an additive designed for consistent cultivation of nerve cells to the culture medium. For instance, N2 and B27 additives commercially available from Gibco may be used.
  • N2 and B27 additives commercially available from Gibco may be used.
  • the neural stem cells according to the present invention are cultivated as follows. N2 or B27 additives (Gibco) , neural stem cell growth inducing cytokines (e.g., bFGF, EGF, LIF, etc.) and heparin are added to a culture medium with known compositions (e.g., DMEM/F-12 or Neurobasal medium) . In general, serum is not added. In the medium, the neural stem cells grow into neurospheres. About half of the medium is replaced with fresh one every 3 to 4 days. When the number of the cells increases, the cells are dissociated every 7 to 8 days mechanically or using trypsin (0.05% trypsin/EDTA, Gibco) .
  • the neural stem cells of the present invention may be differentiated into various nerve cells according to the methods known in the related art. In general, differentiation of the cells is carried out using a nutrient medium including an adequate substrate or differentiation reagent but without including a neural stem cell growth inducing cytokine.
  • a preferred substrate is a solid surface coated with cationic charges, for example, poly-1-lysine and polyornithine.
  • the substrate may be coated with extracellualr matrix components, for example, fibronectin and laminin.
  • extracellualr matrix includes Matrigel.
  • a mixture of poly-1-lysine with fibronectin or laminin, or a combination substrate thereof may be used.
  • Adequate differentiation reagent includes a variety of growth factor, e.g., epidermal growth factor (EGF), transforming growth factor ⁇ (TGF- ⁇ ) , all types of fibroblast growth factors (FGF-4, FGF-8 and bFGF) , platelet-derived growth factor (PDGF) , insulin-like growth factors (IGF-I and others), high-concentrated insulin, bone morphogenetic proteins (particularly, BMP-2 and BMP-4), retinoic acid (RA) and ligands that bind with the gpl30 receptor (e.g., LIF, CNTF and IL-6) , but is not limited thereto.
  • EGF epidermal growth factor
  • TGF- ⁇ transforming growth factor ⁇
  • FGF-4, FGF-8 and bFGF transforming growth factor ⁇
  • PDGF platelet-derived growth factor
  • IGF-I and others insulin-like growth factors
  • high-concentrated insulin particularly, BMP-2 and BMP-4
  • RA retinoic
  • the neural stem cells of the present invention may be preserved in frozen status (cryopreservation) for long-term storage.
  • cryopreservation is performed as follows. When a sufficient quantity of neural stem cells is acquired through repeated subculturing, the resultant neurospheres are dissociated mechanically or using trypsin to obtain a single cell suspension. Then, the cell suspension is mixed with a cryopreserving solution consisting of 20-50% fetal bovine serum (Gibco) , 10-15% DMSO (Sigma) and cell culture medium, and moved into a freezing vial (NUNC) .
  • the cells mixed with the cryopreserving solution are immediately transferred to a freezer of -70 °C, after kept at 4 °C, and moved to a liquid nitrogen tank after at least 24 hours for long-term storage [Gage et al., PNAS, 92(11) : 879, 1995; McKay, Science, 276:66, 1997; Gage, Science, 287:1433, 2000; Snyder et al., Nature, 374:367, 1995; Weiss et al., Trends Neurosci., 19:387, 1996].
  • the cryopreserved neural stem cells of the present invention may be thawed by the method known in the related art.
  • the cryopreserved cells may be thawed by immersing the freezing vial in a water bath of 37 °C and shaking slowly. When about half of the cells in the freezing vial are thawed, the cell suspension is moved into a conical tube containing a neural stem cell medium, which is warmed to 37 0 C. When all the cell suspension is transferred, centrifuge is carried out and the supernatant removed. The precipitated cell pellet is cautiously floated into the neural stem cell medium. Then, the cell suspension is moved to a 60 mm cell culture plate.
  • neural stem cell growth inducing cytokine is added to the medium, and cultivation is carried out in a 5% CO 2 incubator at 37 0 C.
  • neural stem cells isolated from the human brain tissue were grown, characterized and induced to differentiate.
  • human glioblastoma cells were cultured and an animal model was established thereabout.
  • SMAC structural gene
  • TAT and the secretion signal sequence, Ig ⁇ -chain leader were inserted to prepare a structural gene construct.
  • the structural gene construct was inserted into a recombinant expression vector for adenovirus to prepare a SMAC expressing recombinant expression vector, then, the recombinant expression vector was used to produce recombinant adenovirus. Further, a TRAIL expressing recombinant expression vector was prepared, and recombinant adenovirus was produced using the same.
  • a human neural stem cell secreting SMAC and a human neural stem cell secreting both SMAC and TRAIL were produced utilizing the recombinant expression vector of the present invention, and growth and degree of protein expression thereof were investigated. As a result, it was understood that the SMAC or SMAC and TRAIL are secreted in the host cells transformed using the recombinant expression vector of the present invention.
  • the cells infected with both SMAC and TRAIL exhibited relatively lower growth and protein expression. Further, the effect of the SMAC expressing human neural stem cell of the present invention on the action of TRAIL was investigated. As a result, although the SMAC expressing human neural stem cell of the present invention could not kill tumor cells on its own, it provided advantageous effects by assisting the action of TRAIL.
  • the present invention provides a pharmaceutical composition for treating tumors comprising the human neural stem cells secreting SMAC which are transformed by a SMAC encoding nucleotide and human neural stem cells secreting TRAIL.
  • the human neural stem cells secreting SMAC transformed by a SMAC encoding nucleotide according to the present invention can be utilized for kill tumor cells and/or reconstruct or regenerate nerve tissues in the human body, along with TRAILs or TRAIL secreting cells in human in need thereof.
  • the neural stem cell according to the present invention is very effective in treating tumors because it assists synergically the action of TRAIL.
  • treatment refers to any manner in which the symptoms of a condition are ameliorated or otherwise beneficially altered.
  • Treatment also encompasses retardation of the progress of a disease and improvement, palliation and (partial or complete) remission of symptoms. Also, treatment may mean increased possibility of survival as compared to absence of the treatment. Treatment also encompasses prophylactic measures. Cases in need of treatment include those with existing diseases and those where prevention is required. Improvement of diseases means improvement or retardation of symptoms as compared to absence of the treatment.
  • the treatment includes the administration of the neural stem cell of the present invention for killing tumor cells or regenerating tissues.
  • the human neural stem cell secreting SMAC according to the present invention is directly transplanted in the target tissue or transferred after being administered, thereby inducing apoptosis of tumor cells, reconstructing or regaining the functionally deficient region.
  • the human neural stem cell secreting SMAC according to the present invention may be directly transplanted in the parenchyma of the central nervous system or into the spinal canal, depending on the disease to be treated. Transplantation is performed using single cell suspensions or small aggregates with a density of IxIO 5 to 1.5 ⁇ lO 5 cells per ⁇ L (US Patent No. 5,968,829).
  • the human neural stem cell secreting SMAC may be prepared as a form of pharmaceutical composition to be administered into human.
  • the pharmaceutical composition of the invention may comprise pharmaceutically acceptable carriers.
  • pharmaceutically acceptable refers to not be toxic when exposed to cell or human beings.
  • the carriers may comprise, but not limited thereto, buffers, preservatives, alagesic, solubilizer, isotonic reagent, stabilizer, basis, excipient, lubricant, and the carriers which are well known in the art.
  • the inventive pharmaceutical composition may be prepared into various preparations which is known in the art. For example, the injectable preparations may be prepared into single-dose ampule of multi-dose ampule. The general principle of the preparation of the inventive pharmaceutical composition are well described in the following references.
  • inventive pharmaceutical composition may be packaged in a relevant container according to the instruction to achieve the purpose, for example, to reconstitute of damaged tissues by tumors and tumor treatment.
  • the tumors to which the pharmaceutical composition of the present invention can be applied include glioma, meningioma, pituitary adenoma, medulloblastoma, metastatic brain tumor, acoustic neuroma, prostatic cancer, malignant melanoma and neuroblastoma, but are not limited thereto.
  • the glioma includes astrocytoma, oligodendroglioma, ependymoma, glioblastoma multiforme, etc.
  • malignant brain tumors such as glioblastoma multiforme are impossible to cure completely even with extensive operative treatments alongside adjuvant radiotherapies and chemotherapies.
  • the pharmaceutical composition of the present invention may be utilized as adjuvant therapy for the complete treatment of glioblastoma multiforme or other malignant brain tumors.
  • the treatment method using the pharmaceutical composition of the present invention may be employed along with other therapies known in the related art such as chemotherapies, radiotherapies, surgical operations, drug administrations, and the like. Further, it may be employed as an alternative adjuvant therapy for treating tumors .
  • the human neural* stem cell migrates specifically to the brain tumor site in response to the signals therefrom.
  • the pharmaceutical composition of the present invention can be utilized effectively for the treatment of not only brain tumors but also systemic non- CNS tumors, including prostatic cancer, malignant melanoma, neuroblastoma and other malignant tumors.
  • the present invention provides the method for treating tumors which comprises administering SMAC secreting human neural stem cells which is transformed with SMAC-encoding nucleotide and TRAIL secreting human neural stem cells, as an active ingredient, to the subject in need.
  • the "effective amount” refers to the amount effective in treating tumor, and the “subject” refers to mammals, particularlly, animals comprising human. The subject may be patient in need of treatment.
  • the inventive neural stem cell may be administered until the desired effect among the said effects were deduced, and may be administered via various routes which is well known in the art.
  • the present invention provides the use of SMAC secreting human neural stem cells which is transformed with SMAC-encoding nucleotide and TRAIL secreting human neural stem cells for preparing anti tumor reagents.
  • the tumor, the inventive neural stem cell, and the effect thereof were described well previously.
  • FIG. 1 shows the microscopic images illustrating the proliferation and growth of human neural stem cells isolated from various brain tissues.
  • HFT13 neural stem cells from the telencephalon
  • HFD13 neural stem cells from the diencephalon
  • HFM13 neural stem cells from the mesencephalon
  • HFC13 neural stem cells from the cerebellum
  • FIG. 2 shows the graphs comparing the growth of human neural stem cells isolated from various brain tissues .
  • FIG. 3 shows the microscopic images illustrating the differentiation of human neural stem cells according to the present invention using various markers.
  • FIG. 4 shows the tumors induced in an animal model of human glioblastoma wherein U87MG or U343MG cells were transplanted, by staining with hematoxylin and CM-DiI.
  • FIGS. 5 to 8 show (a) the procedure of preparing a pShuttle-CAG vector, (b) a schematic diagram thereof, (c) the procedure of preparing pShuttle-CAG-IRES-hrGFP vector and (d) a schematic diagram thereof.
  • FIGS. 9 and 10 show the cleavage maps of (a) the SMAC expressing recombinant adenoviral vector and (b) the TRAIL expressing recombinant adenoviral vector used in the present invention.
  • FIG. 11 shows the PCR result of the recombinant adenovirus produced from the SMAC expressing recombinant adenoviral vector for detecting the contamination of wild-type adenovirus.
  • M size marker
  • Lane 1 negative control
  • Lane 2 293A (positive control)
  • Lane 3 AdCAG-TAT-SMAC
  • Lane 4 AdCAG-TAT-SMAC
  • FIG. 12 shows the CCK-8 assay result for investigating the viability of human neural stem cells infected by the SMAC or GFP expressing recombinant viruses (AdCAG-TAT-SMAC or AdCAG-GFP) .
  • FIG. 13 shows the quantity of SMAC secreted from human neural stem cells infected by the SMAC or GFP expressing recombinant viruses (AdCAG-TAT-SMAC or AdCAG- GFP) .
  • FIG. 14 shows the quantity of SMAC and TRAIL secreted from human neural stem cells infected by the SMAC, TRAIL or GFP expressing recombinant viruses (AdCAG- TAT-SMAC, AdCAG-TRAIL or AdCAG-GFP) .
  • FIGS. 15 and 16 show (a) the microscopic images illustrating the apoptosis of human glioblastoma cell line (U87MG) co-cultured with the human neural stem cell culture medium infected by TRAIL, SMAC and GFP expressing recombinant viruses (AdCAG-TRAIL, AdCAG-TAT-SMAC and AdCAG-GFP) and (b) the viability of the human glioblastoma cell line co-cultured with the culture medium.
  • TRAIL apoptosis of human glioblastoma cell line
  • SMAC SMAC and GFP expressing recombinant viruses
  • AdCAG-TRAIL AdCAG-TAT-SMAC
  • AdCAG-GFP AdCAG-GFP
  • FIG. 17 compares the decrease of tumor size in glioblastoma (U87MG) animal model for the group to which human neural stem cells infected by TRAIL and SMAC expressing recombinant viruses (hNSCs-AdTRAIL + hNSCs- AdTAT-SMAC) were transplanted, the group to which human neural stem cells infected by TRAIL and GFP expressing recombinant viruses (hNSCs-AdTRAIL + hNSCs-AdGFP) were transplanted, and the group to which human neural stem cells infected only by GFP expressing recombinant viruses (hNSCs-AdGFP) were transplanted.
  • Mode for Invention
  • Each separated brain tissue was placed in a petri dish, and cut to a size of about 1 * 1 mm. After centrifuging at 950 rpm for 3 minutes, the supernatant was removed. The tissue was washed with H-H buffer, and centrifuge was repeated for 3 more times. After the last centrifuge, the supernatant was completely removed and the 2 mL of 0.1% trypsin (Gibco) and DNase I (Roche, 1 mg/dL) were added to the remaining tissue. After mixing well, the tissue was incubated in a 5% CO 2 incubator of 37 °C for 30 minutes.
  • DMEM + 10% FBS + lxpenicillin/streptomycin/fungizone, Gibco serum containing medium
  • the tissue was triturated with a serologic pipette (Falcon) into single cells. Then, after centrifuging and removing the supernatant, the resulting cell pellet was washed with H-H buffer. Then, centrifuge was performed again and the supernatant was removed.
  • Example 1-1 To the cell pellet of each brain tissue obtained in Example 1-1, 10 mL of N2 medium (D-MEM/F-12 [98% v/v] + N2 supplement [1% v/v] + penicillin/streptomycin [1% v/v] ; Gibco) was added and mixed slowly. About 4 ⁇ lO 6 to ⁇ ⁇ l ⁇ 6 cells were moved to a 100 mm tissue culture treated plate (Corning) .
  • N2 medium D-MEM/F-12 [98% v/v] + N2 supplement [1% v/v] + penicillin/streptomycin [1% v/v] ; Gibco
  • 20 ng/mL bFGF (recombinant human fibroblast growth factor-basic, R & D) , 10 ng/mL LIF (recombinant human leukemia inhibitory factor, Sigma) and 8 ⁇ g/mL heparin (Sigma) were added as neural stem cell growth factors and the cells were cultivated in a 5% CO 2 incubator at 37 0 C after shaking well. 24 hours later, 5 mL of the medium was discarded and 5 mL of fresh N2 medium was added. At the same time, 20 ng/mL bFGF, 10 ng/mL LIF and 8 ⁇ g/mL heparin were added and cultivation was continued. Exchange of the medium was performed every 3 to 4 days while monitoring the status of the medium and the cells, by replacing about half of the medium with fresh one and adding growth factors.
  • Example 1-2 When the undifferentiated neural stem cells in Example 1-2 proliferated and began to form aggregates, neurospheres (FIG. 1), subculturing was performed every 7 to 8 days. Subculturing was carried out as follows. All the medium was removed from the cell culture plate. The cells were treated with 2 mL of 0.05% trypsin/EDTA (T/E, Gibco) , and reacted in a 5% CO 2 incubator at 37 0 C for 2 minutes and 30 seconds. Subsequently, 2.5 mL of trypsin inhibitor (T/I, soybean, Sigma, 1 mg/mL) was added and mixed well in order to stop the action of trypsin. The resulting cell suspension was moved into a 15 mL conical tube (Falcon) .
  • T/I trypsin inhibitor
  • Centrifuge was carried out and the supernatant was removed. After resuspending the cells with 3 mL of N2 medium, they were triturated with a serologic pipette until the neurospheres were dissociated into single cells. The cells were counted. The cell suspension including about 4 ⁇ lO 6 to 6 ⁇ lO 6 cells were moved to a new cell culture plate holding some of the existing medium, and N2 medium was further added to make the volume 10 mL. Then, after adding 20 ng/mL bFGF, 10 ng/mL LIF and 8 ⁇ g/mL heparin, cultivation was continued in a 5% CO 2 incubator.
  • cryopreservation was carried out as follows. The neurospheres were treated with 0.05% trypsin/EDTA and trypsin inhibitor, triturated and moved into a 15 mL tube. The cells were washed with 8 mL of H- H buffer. Centrifuge was carried out and the supernatant was removed. A previously prepared cryopreservation solution (N2 medium [40% v/v] + FBS [50% v/v] + DMSO [10% v/v, Sigma] ) of 4 0 C was added to the cell pellet to softly resuspend the cells.
  • the cell suspension was divided into 1.8 mL per each freezing vial (NUNC) .
  • NUNC freezing vial
  • the cells contained in one 10 mm cell culture plate were divided into 3 to 4 freezing vials. Then, the cells were transferred to a freezer of -70 °C as held in an ice bucket. Then, at least 24 hours later, they were moved to a liquid nitrogen tank for long-term storage.
  • the freezing vial containing the cryopreserved cells was immersed in a water bath of 37 °C and shaken slowly. When about half the cells were thawed, the cell suspension was moved to a conical tube containing 10 mL of N2 medium and preheated to 37 °C. Centrifuge was carried out and the supernatant was removed. The cell pellet was resuspended cautiously with 5 mL of N2 medium and transferred to a 60 mm cell culture plate. Subsequently, 20 ng/mL bFGF, 10 ng/mL LIF and 8 ⁇ g/mL heparin were added to the plate, and culturing was performed in a 5% CO 2 incubator at 37 0 C. When the cells grew to form neurospheres, subculturing was carried out in the manner described in Example 1-3. In general, the cells grew enough to be transferred to a 10 mm cell culture plate in about 10 days.
  • the neural stem cells isolated from the human central nervous system and cultured into neurospheres in Example 1 were transferred to 100 mm cell culture plates, with 4 ⁇ lO 6 cells per each plate, and grown for 50 days.
  • the neural stem cells exhibited an exponential growth pattern (FIG. 2) .
  • the neurospheres isolated from the diencephalon (HFD13 cells) increased about 1,850 times, and those isolated from the telencephalon (HFT13 cells) increased about 1,035 times.
  • the neurospheres isolated from the cerebellum (HFC13 cells) those isolated from the mesencephalon (HFM13 cells) and those isolated from the spinal cord (HFS13 cells) exhibited growth of about 453 times, 19 times and 12 times, respectively.
  • the neural stem cells isolated from the forebrain that is the diencephalon and the telencephalon
  • grow fast while those isolated from the mesencephalon and the spinal cord grow slowly and those isolated from the cerebellum exhibits an intermediate growth rate.
  • the neurospheres of each the brain tissues was subcultured while separating every 7 to 10 days.
  • the neurospheres from the telencephalon, the diencephalon, the cerebellum, the mesencephalon and the spinal cord could be subcultured for a period long time, with passage numbers of 42 ( ⁇ 1 year), 36 (-11 months), 30 ( ⁇ 9 months), 10 ( ⁇ 6 months) and 15 ( ⁇ 7 months), respectively.
  • passage numbers 42 ( ⁇ 1 year), 36 (-11 months), 30 ( ⁇ 9 months), 10 ( ⁇ 6 months) and 15 ( ⁇ 7 months), respectively.
  • no special change in cell morphologies or growth rate was observed.
  • the neurospheres growing in vitro were stained immunohistochemically.
  • the neurospheres were moved to a chamber slide (NUNC) coated with 10 ⁇ g/mL poly-1-lysine (Sigma) and cultured for a day.
  • the medium was removed and the cells were washed once with cold IxPBS.
  • the cells were fixed by treating with 4% paraformaldehyde (in Pipes buffer, Sigma) for 10 minutes. Then, after washing 3 times with IxPBS, the cells were reacted at room temperature for 1 hour in blocking solution (5% bovine serum albumin [BSA, Sigma] + 3% normal goat serum [NGS, Vector] + 0.3% Triton X-IOO [Sigma] in PBS).
  • FIG. 3A shows the result for the neurospheres from the telencephalon (HFT13 cells) .
  • the differentiation pattern of the human neural stem cells growing while forming neurospheres was investigated immunohistochemically .
  • the neurospheres were treated with 0.05% trypsin/EDTA to prepare single cell suspensions, which were moved to an 8-we11 chamber slide coated with 10 ⁇ g/mL poly-1-lysine (Sigma) . Then, they were cultured in N2 medium without including growth factor for a week. As a result, the cells adhered to the plate and differentiated into nerve cells. After removing the medium, the cells were washed once with cold IxPBS. The cells were fixed by treating with 4% paraformaldehyde (in Pipes buffer, Sigma) for 10 minutes.
  • reaction was performed at room temperature for 1 hour in blocking solution (5% bovine serum albumin [BSA, Sigma] + 3% normal goat serum [NGS, Vector] + 0.3% Triton X-100 [Sigma] in PBS) .
  • BSA bovine serum albumin
  • NGS normal goat serum
  • Triton X-100 0.3% Triton X-100 [Sigma] in PBS
  • various primary antibodies Table 1 diluted in carrier solution (3% NGS + 0.3% Triton X- 100 in PBS) were added, and reaction was performed overnight at 4 0 C.
  • Table 1 Primary antibodies used in analysis of differentiation pattern of human neural stem cells
  • the cells treated with the primary antibodies were washed 3 times with IxPBS, and, after adding specific secondary antibodies conjugated with fluorescein (1:200, Vector) diluted in the aforesaid carrier solution, reaction was performed at 37 °C for 1 hour. After washing 3 times with IxPBS, mounting medium (Vector) was dropped on the cells and a cover glass was put on. The cells were observed with an epifluorescent microscope (Olympus) .
  • the human neural stem cells exhibited multipotency of differentiation as they differentiated into various nerve cells and expressed various neurotransmitters (FIG. 3B). More specifically, the expression of TUJl, early neural marker, was observed in all the human neural stem cells derived from various sites of the central nervous system. This indicates that the neural stem cells can differentiate into medulliblasts . The level of expression of 04, early oligodendrocyte marker, was relatively low. This indicates only a few of the neural stem cells differentiate into oligodendrocytes.
  • GFAP which is known as the marker of astrocyte, one of glial cell
  • All the human neural stem cells obtained from various parts of the central nervous system were identified to express GFAP.
  • HFT13 cells exhibited very high degree of GFAP expression of 80% and 90-95% at early and late subculturing, respectively. The expression increased as subculturing continued.
  • the human neural stem cells of the present invention expressed various neurotransmitters after being differentiated. Particularly, GABA and glutamate were expressed in almost all cells. Also, it was identified that only a very small amount the human neural stem cells cultured according to the invention expressed choline acetyltransferase (choline AT) and tyrosine hydrolase (TH) . This indicates that they are hardly differentiated into dopamine-producing or cholinergic nerve cells.
  • choline AT choline acetyltransferase
  • TH tyrosine hydrolase
  • U87MG cell line a kind of human glioblastoma, obtained from the ATCC (American Type Culture Collection) was cultured in RPMI 1640 medium (Gibco) containing 10% FBS and 1> ⁇ P/S (penicillin/streptomycin; Gibco) .
  • U343MG cell line (ATCC) , another kind of human glioblastoma, was cultured in DMEM medium (Gibco) containing 10% FBS and l ⁇ P/S. The cells were subcultured by treating with 0.05% trypsin/EDTA for 2 minutes and 30 seconds every 3 to 4 days. After the last subculturing, the U87MG or U343MG cells were treated with trypsin/EDTA to prepare a single cell suspension.
  • the suspension was centrifuged at 950 rpm for 3 minutes and the supernatant was removed.
  • the resultant cell pellet was resuspended by adding 5 mL of IxPBS containing 20 ⁇ g/mL CM-DiI (cell tracker, Molecular Probes) . Then, the cells were incubated for 3 minutes at 37 °C and for 10 minutes on ice, and stained with CM-DiI. After centrifuge, the resultant cell pellet was resuspended with 10 mL of IxPBS. After 3 times of centrifuging, -remaining CM-DiI was removed.
  • the CM-DiI marked tumor cell suspension prepared in Example 3-1 was placed in a 10 ⁇ L Hamilton syringe.
  • 4 ⁇ L of the tumor cell suspension was slowly transplanted in the corpus striatum at a rate of 1 ⁇ L/min, using a microinjection pump (Stoelting) .
  • the syringe needle was slowly withdrawn for a duration of 3 minutes.
  • the incision was treated with iodine ointment and sutured.
  • the mouse was stabilized on a warm pad at 37 °C until it came out of the anesthesia.
  • CMV immediate-early enhancer CMV immediate-early enhancer
  • chicken ⁇ -actin promoter and rabbit ⁇ -globin terminator from pTriEX-1.1 Neo DNA (Novagen) vector
  • IRES and hrGFP from pShuttle-IRES-hrGFP-1 (Stratagene) vector were cloned to the MCS (multi cloning site) of pShuttle vector (Stratagene) to prepare a pShuttle-CAG or a pShuttle-CAG-IRES-hrGFP vector (see FIGS. 5 and 7).
  • MCS multi cloning site
  • Rabbit ⁇ -globin terminator was cloned between Sail and BgIII of the pShuttle vector as follows.
  • Rabbit ⁇ -globin terminator was obtained from pTriEX-1.1 Neo vector (Novagen) through PCR using Pfu polymerase.
  • the used primers [forward primer expressed by SEQ ID NO 4 (CTCGAGATCAATTCTCTAGCCAAT) and reverse primer expressed by SEQ ID NO 5 (GGATCCTTACATATGGGCATATGT)] included Xhol and BamHI restriction enzyme sequences for cloning of the pShuttle vector.
  • PCR was carried out as follows: initial denaturation at 95 °C for 5 minutes; 35 cycles of denaturation at 94 °C for 45 seconds, annealing at 55 0 C for 45 seconds and extension at 72 0 C for 30 seconds; and final extension at 72 °C for 7 minutes.
  • the amplified PCR product was cloned in the pGEM-T easy vector (Promega, Wisconsin, USA) .
  • the pGEM-T easy vector in which the rabbit ⁇ -globin terminator had been inserted was cut with Xhol and BamRI , and the pShuttle vector was cut with Sail and BgIII. The two products were ligated.
  • Sail and Xhol, and BgIII and BamUI can be ligated with compatible cohesive ends.
  • the ligated vector loses corresponding restriction enzyme sites.
  • the pShuttle vector having rabbit ⁇ -globin terminator pShuttle-rabbit ⁇ -globin terminator
  • CMV immediate-early enhancer and chicken ⁇ -actin promoter were cloned in the pShuttle vector having rabbit ⁇ -globin terminator as follows.
  • the pTriEX-1.1 Neo vector was cut with Pad and a blunt end was made using a Klenow fragment (Takara) . Then, after cutting with Smal, a modified pTriEX-1.1 Neo vector with the Pad restriction enzyme removed was obtained through self ligation. The modified pTriEX-1.1 Neo vector was cut with Fsel and polymerization was performed using a Klenow fragment to make a blunt end. Then, the CMV immediate-early enhancer and the chicken ⁇ -actin promoter portions were obtained by cutting with Xhol.
  • the product obtained by cutting the pShuttle vector having rabbit ⁇ -globin terminator with Kpnl and Xhol was ligated with the CMV immediate- early enhancer and the chicken ⁇ -actin promoter to obtain the pShuttle vector (pShuttle-CAG) including CMV immediate-early enhancer, chicken ⁇ -actin promoter and rabbit ⁇ -globin terminator (see FIGS. 5 and 6).
  • IRES and hrGFP were cloned in the pShuttle-CAG vector as follows. IRES and hrGFP were obtained from a pShuttle-IRES-hrGFP-1 vector (Stratagene) by PCR using Pfu polymerase.
  • the primers [forward primer (CTCGAGGACTACAAGGATGAC) of SEQ ID NO 6 and reverse primer (CTCGAGCACCCACTCGTGCAGGCTGCC) of SEQ ID NO 7] included a Xhol restriction enzyme sequence in front of IRES for cloning into the pShuttle-CAG vector.
  • PCR was carried out by: initial denaturation at 95 0 C for 5 minutes; 35 cycles of denaturation at 94 °C for 45 seconds, annealing at 55 0 C for 45 seconds and extension at 72 0 C for 1 minute; and final extension at 72 0 C for 7 minutes.
  • the amplified PCR product was cloned in the pGEM-T easy vector (Promega, Wisconsin, USA) .
  • the pGEM-T easy vector was cut with EcoRI and polymerization was performed using a Klenow fragment. Then, IRES and hrGFP were obtained by cutting with Xhol.
  • the product obtained by cutting the pShuttle-CAG vector with Xhol and EcoRM was ligated with IRES and hrGFP to obtain the pShuttle-CAG-IRES-hrGFP (see FIGS. 7 and 8) .
  • a culture medium of SK-N-MC (ATCC number: HTB-10TM) , which is a kind of human neuroblastoma cell line inducing apoptosis by TRAIL, was treated with 1000 ng/mL of rhTRAIL (Peprotech) to induce apoptosis. 12 hours later, RNAs were extracted from the cells using Trizol (Qiagen, USA) . cDNA was synthesized by reacting at 37 0 C for 50 minutes, using M-MLV reverse transcriptase (Invitrogen, USA) and Oligo dT primer.
  • the SMAC gene expressed by SEQ ID NO 2 was amplified by PCR.
  • the primers include the Xhol restriction enzyme sequence for easier cloning into the pSecTag2A vector (Invitrogen, USA) .
  • PCR was carried out by: initial denaturation at 94 0 C for 3 minutes; 35 cycles of denaturation at 94 °C for 30 seconds, annealing at 53 °C for 40 seconds and extension at 72 0 C for 45 seconds; and final extension at 72 0 C for 10 minutes.
  • the amplified PCR product was cloned in the pGEM-T easy vector (Promega, Wisconsin, USA) (pGEM-T easy-SMAC) .
  • the full-length SMAC (SEQ ID NO 3) is a protein targeted to the mitochondria after being expressed and has a mitochondria targeting sequence (MTS) at the N- terminal.
  • MTS mitochondria targeting sequence
  • the SMAC sequence amplified by the PCR corresponds to SEQ ID NO 1 wherein the MTS (1st through 55th amino acids of SEQ ID NO 3) has been removed.
  • the protein transduction domain obtained from HIV and consisting of 11 amino acids was ligated to the N-terminal of the SMAC as follows.
  • TAT protein transduction domain
  • YGRKKRRQRRR protein transduction domain obtained from HIV and consisting of 11 amino acids was ligated to the N-terminal of the SMAC as follows.
  • a part of the TAT sequence was extended at the 5 '-terminal of the SMAC sequence through PCR amplification.
  • PCR was carried out as follows: initial denaturation at 94 0 C for 3 minutes; 35 cycles of denaturation at 94 °C for 30 seconds, annealing at 55 °C for 30 seconds and 72 0 C extension at 45 seconds; and final extension at 72 °C for 10 minutes.
  • the amplified PCR product was cloned in the pGEM-T easy vector (Promega) .
  • PCR amplification was performed to extend the remaining TAT sequence.
  • PCR was carried out by: initial denaturation at 94 0 C for 3 minutes; 35 cycles of denaturation at 94 0 C for 30 seconds, annealing at 53 0 C for 40 seconds and extension at 72 0 C for 45 seconds; and final extension at 72 0 C for 10 minutes.
  • the amplified PCR product was cloned in the pGEM-T easy vector (Promega) (pGEM-T easy- TAT-SMAC) .
  • the SMAC of the present invention linked to TAT was cloned in the pSecTag2A vector
  • the pGEM-T easy-TAT-SMAC vector and the pSecTag2A vector were cut with HindiII and Xhol restriction enzymes, respectively, and the SMAC fragment of the present invention linked to TAT was ligated with the pSecTag2A vector to obtain an Ig ⁇ -chain leader-TAT-SMAC construct.
  • BgIII and Sail restriction enzyme sequences were linked to the both ends of the resultant Ig ⁇ -chain leader-TAT-SMAC construct by PCR in order to clone the construct in the adenovirus shuttle vector.
  • PCR was performed using the pSecTag2A vector including TAT-SMAC as template and also using the forward primer (AGATCTGCCACCATGGAGACA) of SEQ ID NO 13 and the reverse primer (GTCGACTTACAGATCCTCTTCTG) of SEQ ID NO 14.
  • PCR was carried out by: initial denaturation at 94 °C for 3 minutes; 35 cycles of denaturation at 94 °C for 30 seconds, annealing at 53 0 C for 40 seconds and extension at 72 0 C for 45 seconds; and final extension at 72 0 C for 10 minutes.
  • the amplified PCR product was cloned in the pGEM-T easy vector (Promega) (pGEM-T easy-Ig K -TAT-SMAC) .
  • the pGEM-T easy-Ig K -TAT-SMAC vector was cut with BgIII and Sail restriction enzymes, and the Ig K -TAT- SMAC fragment was inserted in the adenovirus shuttle vector pShuttle-CAG prepared in Example 4-1 and was named as "pShuttle-CAG-Ig K -TAT-SMAC" (see FIG. 9) .
  • the resultant pShuttle-CAG-Ig K -TAT-SMAC was cut with Pmel restriction enzyme and was introduced in E. coil BJ5183 along with the adenoviral backbone vector pAdEasy-1 (Stratagene) , in order to induce homologous recombination between the two vectors (pAd-CAG-Ig K -TAT- SMAC) . Transformation of E. coil was carried out by electroporation using Gene Pulser (2.5 kV, 25 ⁇ F, 200 ⁇ , Bio-Rad, Hercules, CA, USA) .
  • pAd-CAG-Ig K -TAT-SMAC was cut with Pad restriction enzyme, and transfected to the 293A cells (Invitrogen, CA), an adenovirus producing cell line, to amplify the viruses.
  • the produced recombinant virus (AdCAG-TAT-SMAC) was isolated by performing cesium chloride ultracentrifugation with 80,000 rpm at 10 0 C for 6 hours.
  • TCID 5O tissue culture infectious dose 50, QBiogene
  • TCID 50 tissue culture infectious dose 50, QBiogene
  • KABER statistical method TCID 50 reference; QBiogene, CA, USA, AdenoVator applications manual
  • the adenoviral vector was prepared as wanted, with the TCID 50 value of the AdCAG- TAT-SMAC recombinant virus ranging from IxIO 10 to 5> ⁇ 10 10 PFU/mL.
  • a primer was synthesized from the internal sequence of the El gene of the wild-type adenovirus and PCR was carried out.
  • the genome of each recombinant virus was obtained through phenol/ethanol precipitation after treating the virus particles with lysis buffer (0.1% SDS, 10 mM Tris-Cl, 1 mM EDTA). Then, PCR was carried out using the resultant genome as template and also using the primers of SEQ ID NO 15
  • PCR was carried out by: initial denaturation at 94 °C for 3 minutes; 35 cycles of denaturation at 94 °C for 30 seconds, annealing at 53 °C for 40 seconds and extension at 72 °C for 45 seconds; and final extension at 72 0 C for 10 minutes.
  • the genome of 293A cells was used as positive control group.
  • the genome of 293A cells was obtained by phenol/ethanol precipitation after treating the cells with digestion buffer (0.5% SDS, 100 mM NaCl, 10 mM Tris-Cl, 25 mM EDTA) . PCR result was confirmed through agarose gel electrophoresis.
  • 340-bp El gene was detected in the 293A cells (lane 2), but it was not detected in the genome of the AdCAG-TAT-SMAC recombinant virus (lane 3) and the target gene (TAT-SMAC: 756 bp) was detected (lane 4).
  • TRAIL gene was amplified by PCR using the plasmid obtained from the cDNA library (Clontech, Cat. 634258) of the brain of human fetus as template.
  • the apoptogenic receptor binding moiety (95th through 281st in SEQ ID NO 17, SEQ ID NO 18) of the TRAIL (SEQ ID NO 17) excluding the transmembrane domain was amplified by PCR.
  • the primers used included Kpnl and Xhol restriction enzyme sequence, respectively, for easier cloning in the pSecTag2A vector (Invitrogen) .
  • PCR was carried out by: initial denaturation at 94 °C for 3 minutes; 35 cycles of denaturation at 94 °C for 30 seconds, annealing at 58 0 C for 30 seconds and extension at 72 °C for 45 seconds; and final extension at 72 0 C for 10 minutes.
  • the amplified PCR product was cloned in the pGEM-T easy vector (Promega, Wisconsin, USA) .
  • ILZ isoleucine zipper domain
  • GGCATGAAGCAGATCGAGGACAAAATTGAGGAAATCCTGTCCAAGATTTACCACAT CGAGAACGAGATCGCCCGGATTAAGAAACTCATTGGCGAGGGC, SEQ ID NO 21) which was obtained from reverse transcription of the known ILZ amino acid sequence, in order to synthesize an oligomer (Bioneer, Daejeon, Korea) .
  • the synthesized oligomer was inserted in the pGEM-T vector.
  • ILZ and TRAIL genes were inserted in sequence in the pSecTag2A vector including the Ig ⁇ -chain leader which induces extracellular secretion of proteins.
  • the pGEM-T vector including ILZ was cut with ifindIII and Kpnl, and the cut ILZ was inserted in the pSecTag2A vector. Then, both ends of the pGEM-T easy vector having TRAIL gene were cut with Kpnl and Xhol , and the cut TRAIL gene was inserted in the aforesaid pSecTag2A vector including ILZ.
  • the Ig ⁇ -chain leader is lost when TRAIL is expressed by the pSecTag2A vector and secreted out of the cell.
  • Such prepared Ig K -ILZ-TRAIL construct was cloned in the modified pShuttle vector including CAG promoter (pShuttle-CAG-IRES-hrGFP) as follows. BgIII and Xhol restriction enzyme sites were linked at both ends of the Ig K -ILZ-TRAIL construct through PCR. To this end, an oligonucleotide having base sequences of SEQ ID NO 23 (AGATCTATGGAGACAGACACACTCCT) and SEQ ID NO 20 was used as primer.
  • PCR was carried out by: initial denaturation at 94 °C for 3 minutes; 35 cycles of denaturation at 94 0 C for 30 seconds, annealing at 60 °C for 30 seconds and extension at 72 °C for 90 seconds; and final extension at 72 0 C for 10 minutes.
  • the amplified PCR product was cloned in the pGEM-T easy vector (Promega, Wisconsin, USA) . Subsequently, the vector was cut with BgIII and Xhol restriction enzymes and inserted into the adenovirus shuttle vector pShuttle-CAG-IRES-hrGFP.
  • the resultant vector was named as pShuttle-CAG-Ig K -ILZ-TRAIL-IRES-hrGFP (see FIG. 10) .
  • GFP gene is linked to IRES downstream of the TRAIL gene. Therefore, during the expression of TRAIL, GFP is also expressed spontaneously.
  • the recombinant adenovirus that expresses TRAIL by the CAG promoter was prepared as follows.
  • CAG-Ig K -ILZ-TRAIL-IRES-hrGFP vector was cut with Pmel restriction enzyme and introduced to E. coil BJ5183 along with the adenoviral backbone vector pAdEasy-1
  • pAd-CAG-Ig K -ILZ-TRAIL-IRES-hrGFP was cut with Pad restriction enzyme and transfected in 293A cells (Invitrogen, USA), which is an adenovirus producing cell line, in order to amplify the viruses.
  • the produced recombinant viruses (AdCAG-TRAIL) were isolated by performing cesium chloride ultracentrifugation at 80,000 rpm, at 10 0 C for 6 hours.
  • the recombinant adenovirus that expresses GFP only by the CAG promoter was prepared in the same manner of Examples 5-1 and 5-2, using the pShuttle-CAG-IRES-hrGFP vector prepared in Example 4-1.
  • TRAIL and SMAC 6-1 Analysis of proliferation and growth of human neural stem cells infected by SMAC expressing recombinant adenovirus
  • 5 x 10 5 HFT13 cells were plated in a 6-well culture dish along with 1 mL of N2 medium including growth factor, per each well.
  • 50 MOI AdCAG-GFP and 50 and 100 MOI AdCAG-TAT-SMAC virus particles were directly added to each medium to infect the cells.
  • 24 hours after the infection the cells were washed once with 3 mL of N2 medium in order to remove the viruses, and grown further in 3 mL of N2 medium including growth factor. 2 days later, the cells were identified to express GFP and proliferate and grow while forming normal neurospheres (not shown) .
  • CCK-8 assay was carried out in order to quantitatively analyze the effect of the infection by the SMAC or GFP expressing recombinant adenovirus on the proliferation and growth of human neural stem cells.
  • 5*10 4 HFT13 cells were plated in a 96-well culture dish along with 100 ⁇ L of N2 medium including growth factor, per each well.
  • 50 MOI AdCAG-GFP and 50 and 100 MOI AdCAG-TAT-SMAC virus particles were directly added to each medium to infect the cells.
  • 24 hours after the infection the cells were washed once with 100 ⁇ L of N2 medium in order to remove the viruses, and grown further in 100 ⁇ L of N2 medium including growth factor.
  • the cells were treated with 10 ⁇ L of CCK-8 solution and absorbance was measured at 450 nm using a microplate reader 2 hours later.
  • the well treated only with the CCK-8 solution served as blank control, and the HFT13 cells to which no virus had been added was named as 100% cell survival group.
  • Each test group consisted of 3 wells, and test was carried out 3 times and then averaged.
  • viability of the HFT13 cells not infected by the virus being 100%
  • viability of the cells infected by AdCAG-GFP was 99.28 ⁇ 1.98 % on the average
  • viability of the cells infected by 50 MOI AdCAG- TAT-SMAC was 96.22 ⁇ 2.19 % on the average
  • viability of the cells infected by 100 MOI AdCAG-TRAIL was 92.78 ⁇ 1.97 % on the average (see FIG. 12).
  • 5 x 10 5 HFT13 cells were plated in a 6-well culture dish along with 1 mL of N2 medium including growth factor, per each well. One hour later, the cells were directly infected by adding virus particles under the conditions of: infection with 50 MOI AdCAG-GFP; infection with 130 MOI AdCAG-TRAIL; infection with 100 MOI AdCAG- TAT-SMAC; coinfection with 65 MOI AdCAG-TRAIL and 50 MOI AdCAG-TAT-SMAC; and coinfection with 130 MOI AdCAG-TRAIL and 100 MOI AdCAG-TAT-SMAC.
  • the cells were washed once with 3 mL of N2 medium in order to remove the viruses, and grown further in 3 mL of N2 medium including growth factor. 2 days later, it was identified that the human neural stem cells expressed GFP well and proliferated and grew well while forming normal neurospheres, except for the cells coinfected by 130 MOI AdCAG-TRAIL and 100 MOI AdCAG-TAT- SMAC, wherein the cells showed poor state and did not exhibit normal cell growth (not shown) .
  • the spontaneous expression of TRAIL and SMAC by the CAG promoter does not inhibit the proliferation and growth of human neural stem cells significantly, but it affects the proliferation and growth of cells when the concentration of adenovirus is high.
  • the AdCAG-TAT-SMAC and AdCAG-GFP viruses were infected in human neural stem cells (HFT13 cells) and the secretion of SMAC was quantitatively analyzed by ELISA (enzyme-linked immunosorbent assay) .
  • HFT13 cells human neural stem cells isolated from the telencephalon isolated from the telencephalon isolated from the telencephalon isolated from the telencephalon isolated from the telencephalon (Example 1) were plated in a 6-well culture dish along with 1 mL of N2 medium including growth factor.
  • 50, 75, 100 and 200 MOI AdCAG-GFP virus particles were directly added to each medium to infect the cells.
  • the cells were washed once with 3 mL of N2 medium in order to remove the viruses, and grown further in 100 ⁇ L of N2 medium including growth factor. Then, the cells were cultured for 48 hours after adding 3 mL of N2 medium.
  • Biotinylated anti-human SMAC antibody was diluted in IC Diluent #1 (1% BSA in PBS, pH7.2-7.4, 0.2 ⁇ m filtered) to 150 ng and, added to the well, 100 ⁇ L per each well. After 2 hours of reaction at room temperature, each well was washed 3 times. Avidin-horseradish peroxidase conjugate reagent was diluted in IC Diluent #1 and added to the well, 100 ⁇ L per each well. After 20 minutes of reaction at room temperature, each well was washed 3 times. To each well, 100 ⁇ L of substrate solution (tetramethylbenzidine [TMB] and hydrogen peroxide, R&D systems, USA) was added. After 20 minutes of reaction at room temperature in the absence of light, 50 ⁇ L of 2N sulfuric acid was added to stop the reaction. Then, absorbance was measured at 450 nm using a microplate reader (Molecular Devices, USA) .
  • TMB tetramethylbenzidine
  • the quantity of the SMAC protein measured 48 hours later after infecting with 50, 75, 100 and 200 MOI AdCAG-TAT-SMAC was 13.20 ⁇ 0.46 (mean ⁇ SD), 18.70 ⁇ 0.12, 21.71 ⁇ 0.29 and 26.55 ⁇ 1.32 ng, respectively, based on the culture medium of 1,000,000 neural stem cells.
  • Measurement result for the culture medium of HFT13 cells not infected by viruses and the culture medium of HFT13 cells infected by 50 MOI AdCAG- GFP was 0.57 and 0.59 ng, respectively (see FIG. 13).
  • HFT13 human neural stem cells
  • the cells were directly infected by adding virus particles under the conditions of: infection with 50 MOI AdCAG-GFP; infection with 130 MOI AdCAG-TRAIL/ infection with 100 MOI AdCAG-TAT-SMAC; coinfection with 65 MOI AdCAG-TRAIL and 50 MOI AdCAG-TAT-SMAC; and coinfection with 130 MOI AdCAG-TRAIL and 100 MOI AdCAG-TAT-SMAC.
  • the cells were washed once with 3 mL of N2 medium in order to remove the viruses, and grown further after adding 3 mL of N2 medium including growth factor.
  • ELISA for SMAC R&D Systems Inc., Minneapolis, MN
  • ELISA for TRAIL BD, San Diego, CA
  • ELISA for TRAIL was performed in the same manner of ELISA for SMAC, except for infecting the cells by adding 65, 130, 195 and 260 MOI AdCAG-TRAIL and 50 MOI AdCAG-GFP.
  • the quantity of the SMAC protein measured 48 hours later after infection was 22.97 ⁇ 0.85 ng (mean ⁇ SD) for infection with 100 MOI AdCAG-TAT-SMAC, 12.32 ⁇ 0.25 ng for coinfection with 65 MOI AdCAG-TRAIL and 50 MOI AdCAG-TAT-SMAC, and 13.15 ⁇ 0.19 ng for coinfection with 130 MOI AdCAG-TRAIL and 100 MOI AdCAG- TAT-SMAC, based on the culture medium of 1,000,000 neural stem cells.
  • the quantity of the TRAIL protein measured 48 hours later after infection was 42.94 ⁇ 0.15 ng (mean ⁇ SD) for infection with 130 MOI AdCAG-TRAIL, 37.29 ⁇ 0.92 ng for coinfection with 65 MOI AdCAG-TRAIL and 50 MOI AdCAG-TAT-SMAC, and 38.28 ⁇ 0.73 ng for coinfection with 130 MOI AdCAG-TRAIL and 100 MOI AdCAG- TAT-SMAC, based on the culture medium of 1,000,000 neural stem cells (see FIG. 14) .
  • Example 8 Analysis of apoptosis of human glioblastoma induced by human neural stem cells infected by TRAIL and SMAC expressing recombinant adenoviruses
  • AdCAG-TRAIL or AdCAG-TAT-SMAC recombinant viruses induces the apoptosis of human glioblastoma cells, the culture medium of the neural stem cells infected by each virus was cocultured with the glioblastoma cell line.
  • AdCAG-GFP, 130 MOI AdCAG-TRAIL and 100 MOI AdCAG-TAT-SMAC virus particles to the medium of each well. 24 hours later, the cells were washed with 3 mL of N2 medium and grown further in 5 mL of N2 medium including growth factor for 3 days. The culture medium was centrifuged at 1000 rpm for 3 minutes. Meanwhile, 2 ⁇ lO 5 U87MG cells were plated in a 12-well plate dish along with the medium. After culturing for 24 hours, the medium was removed, and 1.5 mL of each of the culture medium of the neural stem cells infected by the viruses was added to each well. Then, the apoptosis of the tumor cells was observed.
  • the U87MG cells cocultured either with 0.75 mL of the medium of the HFT13 cells infected by AdCAG-TRAIL and with 0.75 mL of the medium of the HFT13 cells infected by AdCAG-GFP showed apoptosis pattern similar to when rhTRAIL was treated directly.
  • the U87MG cells cocultured with 0.75 mL the medium of the HFT13 cells infected by AdCAG-TRAIL and with 0.75 mL the medium of the HFT13 cells infected by AdCAG-TAT-SMAC exhibited faster apoptosis (see FIG. 15).
  • the culture medium of the neural stem cells infected by the viruses was cocultured with the glioblastoma cell line.
  • HFT13 cells were plated in each well along with the medium as described above. One hour later, the cells were infected by directly adding the recombinant adenovirus particles of Example 8-1 to the medium of each well, alone or together. 24 hours later, the cells were washed with 3 mL of N2 medium and grown further in 5 mL of N2 medium including growth factor for 3 days. The culture medium was centrifuged at 1000 rpm for 3 minutes. Meanwhile, 2 ⁇ lO 5 U87MG cells were plated in a 12-well plate dish along with the medium. After culturing for 24 hours, the medium was removed, and 1.5 mL of each of the culture medium of the neural stem cells infected by the viruses was added to each well. Then, the apoptosis of the tumor cells was observed.
  • CCK-8 assay was carried out in the same manner as in Example 8- 1.
  • 60% or more of the tumor cells died when the U87MG cells were cocultured with the medium of the HFT13 cells infected by 130 MOI AdCAG-TRAIL for 24 hours
  • 51% or more of the tumor cells died when the U87MG cells were cocultured with the medium of the HFT13 cells coinfected by 65 MOI AdCAG-TRAIL and 50 MOI AdCAG-TAT- SMAC
  • a brain tumor model was established as in Example 3-2, by transplanting U87MG cells in the right corpus striatum of athymic nude mouse at 7*10 4 cells/4 ⁇ L. 1 week later, neural stem cells were transplanted through the skull burr hole used for the transplantation of the tumor cells as follow.
  • human neural stem cells grown as neurospheres were plated in a culture plate as single cells by treating with 0.05% trypsin/EDTA
  • the neural stem cells were infected with the wanted virus. 24 hours later, the cells were washed once with N2 medium and grown further in N2 medium including growth factor for 2 more days. For transplantation, the cells were prepared into single cells by treating with 0.05% trypsin/EDTA (Gibco). Then, after washing 3 times with H-H buffer and staining with 0.05% Trypan blue, the cells were stored in ice until they were transplanted.
  • average tumor volume was measured for the test and control groups as follows. For quantitative evaluation of average tumor volume, all the slides holding the tumors of the test and control groups were stained with hematoxylin and tumor size was measured using MetaMorph Imaging System (Universal Imaging Corporation, PA, USA) .
  • the test animal was fixed with 4% paraformaldehyde (in 0. IM Pipes buffer) and the brain was picked out.
  • the brain was immersed in 30% sucrose (in PBS) .
  • the brain was cryosected into 16 ⁇ m slices. The spacing between the brain tissue fragments on each slide was 96 ⁇ m.
  • the brain tissue was stored at - 20 °C before staining.
  • staining was performed for 4 minutes using hematoxylin solution. Subsequently, the slide was washed with flowing water and mounted with glycerol mounting medium.
  • the image of the tumor mass was taken with a bright field microscope at xlOO.
  • the region of the tumor mass determined using MetaMorph imaging system, and the area of the region was calculated by counting the number of pixels.
  • the volume of the tumor mass was obtained by multiplying the area by the thickness of the tissue slice
  • the average tumor volume of the control group in the animal model of U87MG glioblastoma was 0.280 mm 3
  • the average tumor volume of the test group to which TRAIL and GFP expressing neural stem cells had been transplanted was 0.066 mm 3
  • that of the test group to which TRAIL and SMAC expressing neural stem cells had been transplanted was 0.035 mm 3
  • the tumor volume of the control group was set as 100%
  • the tumor volume of the TRAIL and GFP expressing cells transplantation group was 23.55 ⁇ 3.11% (mean ⁇ SEM) and that of the TRAIL and SMAC expressing cells transplantation group was 12.65 ⁇ 0.71% (see FIG.
  • the SMAC secreting human neural stem cell of the invention which is transformed by a SMAC encoding nucleotide proliferates and grows on a plate in undifferentiated state, without inducing cytotoxicity, and is capable of differentiating into nerve cells such as neuron, oligodendrocyte and astrocyte in vivo and in vitro.
  • the neural stem cell of the present invention secretes SMAC in the human body and assists the action of TRAIL, thereby inducing apoptosis of tumor cells and reduction of tumor volume. Accordingly, the neural stem cell of the present invention can be effectively used for the treatment or prevention of tumors .

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Neurology (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Neurosurgery (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Developmental Biology & Embryology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention relates to a human neural stem cell secreting SMAC, a preparation method thereof and a use thereof, more particularly to a human neural stem cell secreting SMAC transformed by a SMAC-encoding nucleotide, a preparation method thereof and a use thereof. The SMAC secreting human neural stem transformed by a SMAC encoding nucleotide provided by the present invention proliferates and grows on a plate in undifferentiated state, without inducing cytotoxicity, and is capable of differentiating into nerve cells such as neuron, oligodendrocyte and astrocyte in vivo and in vitro. Further, the neural stem cell of the present invention secretes SMAC in the human body and assists the action of TRAIL, thereby inducing apoptosis of tumor cells and reduction of tumor volume. Accordingly, the neural stem cell of the present invention can be effectively used for the treatment or prevention of tumors.

Description

Invention Title
HUMAN NEURAL STEM CELL SECRETING A SMAC, PREPARATION METHOD AND USE THEREOF
Technical Field
The present invention relates to a human neural stem cell secreting SMAC, a preparation method thereof and a use thereof. More particularly, it relates to a human neural stem cell transformed by a SMAC-encoding nucleotide, a preparation method thereof and a use thereof.
Background Art Neural stem cells mainly exist in the nervous systems, which is continuous proliferation in an immature and undifferentiated state, and are defined by self- renewal and multipotency of differentiating both neurons and glia cells. Neural stem cells are found existing in various anatomical sites over fetal nervous systems of mammals including human beings. Recently, it was found out that neural stem cells exist in adult nervous systems not only in fetal ones. Throughout life, neural stem cells proliferate consistently in a specific brain region to generate new nerve cells. Further, they were reported to have plasticity to differentiate into various other cells or tissues, not only the nerve cells. Accordingly, interests in neural stem cells are increasing recently, not only with regard to basic researches on mechanisms of proliferation and differentiation of stem cells and development of nervous systems, but also with regard to the possibility of original cell and gene therapy of intractable tumors, particularly in neurological diseases, which are known not to be regulated once damaged, utilizing biological characteristics of the neural stem cells. At present, numerous drugs, proteins and neurotrophic factors are screened for the treatment of neurological diseases, and various therapies are actively developed through evaluation of therapeutic and nerve- protecting effects thereof in vivo and in vitro. But, there are few substantial results. Actually, there is no special therapy enabling clinically protecting and regenerating damaged nerve tissues, as yet. For the treatment of intractable neurological diseases, the development of "small molecules" such as drugs or neurotrophic factors is not sufficient, but a cell therapy by which dead or malfunctioning nerve cells are replaced to induce nerval regeneration is essential. With the recent development of stem cell biology, researches on human neural stem cells and therapeutic applications thereof are emerging as alternatives overcoming the safety and efficiency problems of existing gene therapies and critical points by using primary fetal tissue or cell and providing new cell and gene therapies for humans.
However, the current researches on neural stem cells are only in the earliest stages and require more basic researches. Further, several problems have to be solved for their clinical application. In particular, the mechanisms of survival, migration and differentiation of donor cells, expression of foreign genes and integration with the host nervous system during the transplantation of neural stem cells have to be elucidated, and it needs to be confirmed whether the differentiated nerve cells exhibit adequate nerve connections and links and functional improvements in the host nervous system. Cell death by apoptosis may occur either extracellularly (extrinsic pathway) or intracellularly (intrinsic pathway) . In the extrinsic apoptotic pathway, death receptors such as CD95 (APO-1/FAS) and TRAIL receptor, which are member of a tumor necrosis factor (TNF) receptor superfamily, are stimulated to activate caspases which conduct cell executions. In the intrinsic pathway, activation of caspases is initiated as apoptosis-inducing materials such as cytochrome C, apoptosis-inducing factor, SMAC (second mitochondria- derived activator of caspase) or endonuclease G are excreted from mitochondria into the cytoplasm. The reason why many malignant tumor cells proliferate without being affected by treatment is because the expression or function of various anti-apoptosis or pro-apoptosis molecules is not adequately controlled. Actually, expression of inhibitors of apoptosis proteins (IAPs) such as XIAP is enhanced greatly in many intractable and prognostically unfavorable tumors including malignant glioblastoma [Genes Dev. 13:239, 1999; Cell Death. Differ. 6:390, 1999]. SMAC is also excreted from mitochondria in response to the apoptosis-inducing stimulation. It is known as a protein that induces apoptosis by mainly be inhibiting the action of IAPs [Cell 102:33, 2000; Cell 102:43, 2000; Nature 410:112, 2001; Nature 406:855, 2000].
Disclosure Technical Problem
The inventors of the present invention have prepared human neural stem cells excreting SMAC through genetic manipulation, and have confirmed that the neural stem cells are very effective in treating tumors by enhancing the action of TRAIL expressing human neural stem cells, and thereby completing the present invention. Accordingly, an object of the present invention is to provide a human neural stem cell secreting SMAC, a preparation method thereof and a use thereof. Technical Solution
In an aspect to attain the object, the present invention provides a human neural stem cell transformed by a SMAC encoding nucleotide.
In another aspect, the present invention provides a preparation method of the neural stem cell.
In still another aspect, the present invention provides a composition for treating tumors comprising the neural stem cell.
Hereunder is given a more detailed description of the present invention.
The present invention is characterized in that a human neural stem cell genetically modified to secrete the tumor cell apoptosis-inducing SMAC for the first time .
As used herein, the human neural stem cell may preferably be one isolated from the brain of a human fetus. The brain may be the one selected from the group consisting of telencephalon, diencephalon, mesencephalon, cerebellum, medulla oblongata, pons or spinal cord. Preferably, the brain may be the telencephalon. The human neural stem cell secreting SMAC according to the present invention does not exhibit cytotoxicity, and grows on a plate in undifferentiated status (see FIG. 1 and FIG. 2) . Further, the neural stem cell of the present invention has the ability to express nestin or vimentin, which are neural stem cell markers, in 99% or more cells and to differentiate into such nerve cells as neuron, oligodendrocyte and astrocyte (see FIG. 3). When cultured along with tumor cells, the human neural stem cell secreting TRAIL and SMAC according the present invention, it is induced the apoptosis of the tumor cells
(see FIG. 10 and FIG. 11) . Also, when transplanted in tumor animal models (e.g., human glioblastoma animal model) , the neural stem cells of the present invention specifically enclose the boundary of the primary tumor mass and implant or distribute by the manner of infiltrating into the tumors. Also, they implant or distribute in the secondary tumor by specifically migrating along with tumor cells the metastasizing to the nearly nerve tissue. And, some of the neural stem cells of the present invention may differentiate into neurons or glia cells after being transplanted, and replace and regenerate the nerve cells damaged by tumors. In particular, the neural stem cells of the present invention excrete SMAC to assist synergically the action of TRAIL and induce apoptosis of nearby tumor cells, thereby reducing the volume of the tumors (see FIG. 11). On the other hand, they do not induce special damage to normal brain nerve tissues. The neural stem cells of the present invention may be prepared by transforming human neural stem cells using a SMAC encoding nucleotide. To transform the human neural stem cell using a SMAC encoding nucleotide refers to the introduction of a SMAC encoding nucleotide into human neural stem cells. The preparation method of a human neural stem cell secreting SMAC according to the present invention may comprise the steps of:
(a) inserting a SMAC encoding nucleotide into an expression vector; and
(b) introducing the expression vector into a human neural stem cell. The polynucleotide encoding the said SMAC may be used without limit, if the sequence is known as encoding SMAC for the skilled. Preferably, the said polynucleotide may comprise a sequence encoding SMAC, which contains amino acid sequence of SEQ ID NO: 1. More preferably, the said polynucleotide may comprise the sequence encoding polypeptide sequence of SEQ ID NO: 1. Most preferably, the said polynucleotide may comprise the sequence of SEQ ID NO: 2. In addtion, the said polynucleotide may be the sequence set forth in Genbank Accession Nos. NM__138929, NM_019887, NM_138930, AF_298770, AF_262240, but not limited thereto.
In addition, the said polynucleotide may comprise nucloetide sequence encoding functional equivalent of SMAC. The said functional equivalents means polypeptides which show at least 70% amino acid sequence homology with the amino acid sequence of SEQ ID NO: 2, preferably 80%, and more preferably 90% produced by as a result of addition, substitution, or deletion of amino acid and exhibit substantially identical physiological activity to the inventive SMAC.
The term "identical physiological activity" refer to activity which induce apoptosis of cancer cell by supproting the function of TRAIL. The said functional equivalents means polypeptides which have at least 70% amino acid sequence homology (i.e., identity) with the peptide of SEQ ID NO: 1, preferably at least 80%, and more preferably at least 90%, for example, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87 %, 88 %, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and 100% and exhibit substantially identical phisiological activity to the polypeptide of SEQ ID NO: 1. The said functional equivalent may be produced by as a result of addition, substitution, or deletion of a part of the amino acid of SEQ ID NO: 1. The substitution of the amino acid is preferably conservative substitution. The substitutions of the amino acid in nature are as follows; aliphatic amino acid(Gly, Ala, Pro), hydrophobic amino acid(Ile, Leu, VaI), aromatic amino acid(Phe, Tyr, Trp) , acidic amino acid(Asp, GIu), basic amino acid(His, Lys, Arg, GIn, Asn) and sufur containing amino acid(Cys, Met). In addition, the said functional equivalent may comprise the tranformants which are deleted a part of SMAC amino acid comprising amino acid sequence of SEQ ID NO: 1. The deletion and substitution of the said amino acid may occur preferably in the region which is no related to physiological activity of the inventive polypeptide. In addition, the said functional equivalent may comprise the tranformants which are added some amino acid in the sequence or termimals. Moreover, the range of the functional equvalent in the invention may comprise polypetide derivatives which maintain the inventive polypeptide backbone and physiological activity, but were modified in some chemical structures. For example, they may comprise modified chemical sturctures for changing stability, preservation, volatility, or solubility of the inventive polypeptide. In addition, amino acid encoding the SMAC may be prepared by the genetic engineering method known in the art (Sambrook, Fritsch and Maniatis, ΛMolecular Cloning, A labolatory Manual, Cold Spring Harbor laboratory press, 1989; Short Protocols in Molecular Biology, John Wiley and Sons, 1992) . For example, they comprise PCR amplification which amplify nucleotides from the genome, chemical synthesis, cDNA producing technique and the like.
Sequence identity and homology is defined by aligning the sequences (SEQ ID NO: 1) and the candidate sequence and introducing gaps, and the percentage of amino acid residues in that are identical with amino acid sequence of SEQ ID NO: 1. If necessary, to achieve the maximum percent sequence identity, any conservative substitutions is not considered as part of the sequence identity. In addition, none of N-terminal, C-terminal, or internal extensions, deletions, or insertions into the amino acid sequence of SEQ ID NO: 1 shall be constructed as affecting sequence identity or homology. Thus, sequence identity can be determined by standard methods that are commonly used to compare the similarity in position of the amino acids of two polypeptides. Using a computer program such as BLAST or FASTA, two polypeptides are aligned for optimal matching of their respective amino acids (either along the full length of one or both sequences or along a predetermined portion of one or both sequences). The programs provide a default opening penalty and a default gap penalty, and a scoring matrix such as PAM 250 (a standard scoring matrix; Dayhoff et al., in Atlas of Protein Sequence and Structure, vol 5, supp. 3, 1978) . For example, the percent identity can be calculated as: the total number of identical matches multiplied by 100 and then divided by sum of the length of a longer sequence within the matched span and the number of gaps introduced into longer sequences in order to align the two sequences.
The nuclotide encoding the SMAC may be inserted to a expression vector operably linked to sequence regulating expression of the of nucleic acid sequence. The term "operably linked" means that one nucleic acid fragment is linked to other nucleic acid fragment so that the function or expression thereof is affected by the other nucleic acid fragment. In addition, "expression control sequence" means a DNA sequence regulating expression of the of nucleic acid sequence operably linked in a specific host cell. The control sequence may comprise the promoter for initiating transcription, operator sequence for controlling transcrpition, a sequence encoding a suitable mRNA ribosome-binding site, and sequences controlling the termination transcription and translation. As the promoter, it may be constitutive promoter which constitutively induces the expression of a target gene, or inducible promoter which induces the expression of a target gene at a specific site and a specific time, and examples thereof include CMV promoter, CAG promoter (Hitoshi Niwa et al., Gene, 108:193-199, 1991; Monahan et al., Gene Therapy, 7:24-30, 200Oj, CaMV 35S promoter (Odell et al., Nature 313:810-812, 1985), Rsyn7 promoter (US Patent Application No. 08/991,601), rice actin promoter (McElroy et al., Plant Cell 2:163-171, 1990), ϋbiquitin promoter (Christensen et al., Plant MoI. Biol. 12:619-632, 1989), ALS promoter(US Patent Application No. 08/409,297). Also usable promoters are disclosed in US Patent No .5, 608 , 149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680; 5,268,463; and 5,608,142, etc.) Preferably, it may be the promoter which can induce expression of the target gene in the body.
A CAG promoter is one of a modified CMV promoter and consists of a cytomegalovirus immediate-early enhancer, a chicken β-actin promoter, a chimeric intron, and exon 1 and part of exon 2 of a rabbit β-globin gene [Hitoshi Niwa et al., Gene, 108:193-199, 1991; Monahan et al., Gene Therapy, 7:24-30, 2000]. The inventors of the present invention modified the previously known CAG promoter since it is not suited for the manufacture of adenovirus .
To describe in detail, the CAG promoter used in the present invention was introduced to the commercially available pShuttle vector. From the commercially available TriEX-1.1 Neo DNA vector, each of cytomegalovirus immediate-early enhancer, chicken β-actin promoter and rabbit β-globin terminator was cloned and inserted into the commercially available pShuttle vector in order to obtain a vector having a CAG promoter modified adequate for the manufacture of adenovirus (see FIG. 5) .
IRES and hrGFP were further cloned from the commercially available pShuttle-IRES-hrGFP-1 vector in order to manufacture a vector having a CAG promoter and expressing GFP (see FIG. 7) . Since the SMAC expressed by the human neural stem cell functions in the cytoplasm of the tumor cell, a structure enabling the expressed protein to move into the cytoplasm is essential. To this end, a protein transduction domain (PTD) is linked preferably in the upstream of the SMAC encoding nucleotide. The protein transduction domain is an oligopeptide consisting of several amino acid residues and capable of introducing itself and other polymer compounds such as oligonucleotide, peptide, protein and oligosaccharide, without requiring special receptors or consuming energy. The protein transduction domain is not limited thereto, but is, for example, a transduction domain of HIV-I TAT, an oligopeptide consisting of 5 to 12 arginine residues, an oligopeptide consisting of 5 to 12 lysine residues, PEP-I peptide, ANTP, VP22 protein, and so forth can be used [Morris et al., Nat. Biotechnol. , 19:1173-1175, 2001; Schwarze et al . , Trends. Cell Biol., 10:290-295, 2000; Vives et al., J. Biol. Chem. 272:16010-16017, 1997]. The PTD may be any one known in the related art. Preferably, one selected from the group consisting of TAT PTD (YGRKKRRQRRR) of HIV-I (human immunodeficiency virus type 1), an oligopeptide consisting of 9 arginine residues, an oligopeptide consisting of 10 lysine residues and PEP-I peptide (KETWWETWWTEWSQPKKKRKV) may be used [Yang et al., FEBS Letters, 532:36-44, 2002, Vives et al., J. Biol. Chem., 272:16010-16017, 1997, Nagahara et al., Nature Med., 4:1449-1452, 1998].
The transduction domain of HIV-I Tat is characterized by having signals for opening the lipid barrier of the cell to infiltrate. The hydrophobic domain of the PEP-I peptide binds with the hydrophobic moiety of the protein to infiltrate, thereby enhancing targeting efficiency of the cell membrane, whereas the hydrophilic domain facilitates transfer into the cytoplasm. Further, since the SMAC has to be excreted out of the human neural stem cell after expression so as to enter the cytoplasm of the tumor cell, it is preferable to link a secretion signal sequence to a TAT-SMAC encoding nucleotide. Preferably, the secretion signal sequence is linked in the upstream of the TAT-SMAC. The secretion signal sequence may be an Igκ-chain leader, a secretion signal sequence of seminal RNase, a SEC2 sequence (N-terminal 28 amino acids of human fibrillin- 1), a FIB sequence (nucleotides 208-303 derived from rat fibronectin mRNA sequence) or a signal peptide of FGF-4, but not limited thereto. Preferably, it may be an Igκ- chain leader. Preferably, the Igκ-chain leader may have a base sequence represented by SEQ ID NO 22
(atggagacagacacactcctgctatgggtactgctgctctgggttccaggttccac tggtgac) . More preferably, the Igκ-chain leader is cut off after excretion out of the cell, because it is not necessary any more. Preferably, the secretion signal sequence includes a signal cleavage site or is cut off after excretion out of the cell even though it does not include a signal cleavage site. In the secretion signal sequence, cleavage occurs between the last 20th and 21st amino acids of the Igκ-chain leader. That is, cleavage occurs between the last ggt and gac-3' of the sequence 5 ' -atg gag aca gac aca etc ctg eta tgg gta ctg ctg etc tgg gtt cca ggt tec act ggt gac-3'.
The DNA construct consisting of the secretion signal sequence, TAT and SMAC encoding nucleotide in sequence can be prepared by the cloning method well known in the related art, including PCR amplification, cutting of DNA using restriction enzymes, ligation and transformation (see Example 4).
As used herein, "expression vector" may be inserted nucleotide encoding structural gene and may be plasmid, viral vector, or other biological vehicle which express the said nucleotide and known in the art. Preferably, it may be viral vector.
The acceptable expression plasmids of the invention may comprise mammalian expression plasmids which are used in the art. For example, but not limited thereto, pRK5 (European Patent No. 307,247), pSV16B(PCT Publication No. WO91/08291) and pVL1392 (PharMingen) . The method which introduce plasmid DNA directly into a human cell, and FDA has approved to use for human (Nabel, E. G., et al., Science, 249:1285-1288, 1990). A plasmid DNA has advantage in respect of even purification.
In addition, the viral vectors may comprise, but not limited thereto, retrovirus vector, adenovirus vector, herpes virus vector, avipox virus vector, lenti virus and the like. All of the viral genes of the said retroviral vectors were deleted or modified, and consequently non-viral proteins of the said vectors were produced by the infected cells. The main advantages of the retroviral vectors for gene therapy are to transfer large amount of genes into cloned cells, to integrate genes specifically which are transferred to cellular DNA , and to prevent additional infection after gene transformation (Miller, A. D., Nature, 357:455-460, 1992). The retroviral vectors which are approved by the FDA is manufactured by using PA317 amphotrophic retroviral packaging cell (Miller, A. D. and Buttimore, C, Molec. Cell Biol., 6:2895-2902, 1986). For the non-retroviral vectors, there is the said adenovirus (Rosenfeld et al., Cell, 68:143-155, 1992; Jaffe et al., Nature Genetics, 1:372-378, 1992; Lemarchand et al., Proc. Natl. Acad. Sci. USA, 89:6482-6486, 1992). The main advantages of the adenovirus are to transfer large molecular DNA fragment (36kb) , and to transfect non-cloned cells with very high titer. In addition, herpes viruses could be used in gene therapy for human (Wolfe, J. H., et al., Nature Genetics, 1:379-384, 1992). In addition, viral vector which is known in the art may be used in the invention. Preferably, it may be adenovirus vector.
The preparation method for adenovirus by using the inventive expression vector, for example, may comprise, but not limited thereto, the method of which co- transfection with adenoviral backbone vector such as pAsEasy-1 (Stratagene) into BJ5183 E coli and inducing homologous recombination and amplify it from adenovirus producing cells such as 293A cells. The said praparation methods were described well in the following references: Benihoud, K., Yeh, P. and Perricaudet, M. (1999) Curr Opin Biotechnol 10(5):440-7, Berkner, K. L. (1988) Biotechniques 6(7): 616-29, He, T. C, Zhou, S., da Costa, L. T., Yu, J., Kinzler, K. W. et al. (1998) Proc Natl Acad Sci U S A 95 (5) :2509-14. , Hanahan, D. (1983) J MoI Biol 166 (4) : 557-80. , Jerpseth, B., Callahan, M. and Greener, A. (1997) Strategies 10 (2) : 37-38. , Bullock, W. 0., Fernandez, J. M. and Short, J. M. (1987) Biotechniques 5 (4) :376-378. , Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G. et al. , (1987) . Current Protocols in Molecular Biology. John Wiley and Sons, New York., Graham, F. L., Smiley, J., Russell, W. C. and Nairn, R. (1977) J Gen Virol 36 (1) : 59-74., Tollefson, A. E., Hermiston, T. W. and Wold, W. S. M. (1998) Methods in Molecular Medicine 21:1-9. The plasmid expression vector which comprise the said nucleic acid could be introduced to a target cell by, but not limited thereto, transient transfection, microinjection, transduction, cell fusion, calcium phosphate precipitation, liposome-mediated transfection,
DEAE Dextran-mediated transfection, polybrene-mediated transfection, electroporation, gene gun, and other methods which are well known in the art (Wu et al., J.
Bio. Chem., 267:963-967, 1992; Wu and Wu, J. Bio. Chem. , 263:14621-14624, 1988).
More preferably, the human neural stem cell secreting SMAC according to the present invention may be prepared by a method comprising the steps of: (a) preparing a recombinant viral vector including a DNA construct consisting of a secretion signal sequence, an HIV-derived protein transduction domain and a SMAC encoding nucleotide in sequence;
(b) transfecting a virus producing cell line with the recombinant viral vector to prepare a SMAC expressing recombinant virus; and
(c) infecting a human neural stem cell with the SMAC expressing recombinant virus.
First, a recombinant viral vector is prepared by inserting a DNA construct consisting of a secretion signal sequence, a protein transduction domain derived from HIV (human immunodeficiency virus) and a SMAC encoding nucleotide in sequence into a viral vector. The DNA construct consisting of a secretion signal sequence, an HIV-derived protein transduction domain and a TRAIL encoding nucleotide in sequence has been described above. The DNA construct may be inserted into a viral vector known in the related art as operably linked to an expression control sequence, e.g., promoter.
Then, a SMAC expressing recombinant virus is prepared by introducing the recombinant viral vector including the SMAC encoding nucleotide into a virus producing cell line. The virus producing cell line may be a cell line producing viruses corresponding to the employed viral vector. For instance, when an adenoviral vector is used, 293 cell line that produces adenovirus may be used.
Subsequently, a human neural stem cell is infected by the SMAC expressing recombinant adenovirus. The infection of the human neural stem cell with adenovirus can be performed by the method known in the related art. As a nonlimiting example, human neural stem cells (HFT13 cells) may be plated in growth factor containing N2 medium and infected by adding viral particles with adequate MOI (multiplicity of infection) to the medium 1 hour later. Here, the virus is kept in a refrigerator at -80 °C in 4% sucrose buffer (10 mM Tris, 4% sucrose, 2 mM MgCl2 in IxPBS) , and less than about 50 μL of viral solution per 1 mL of cell medium is added for the infection of the stem cell, depending on the corresponding titer and MOI. After 24 hours of infection, the cells are washed once with N2 medium, and growth factor containing N2 medium is added to further culture the stem cells.
Also, preferably, the neural stem cell may be one isolated from the brain of human fetus. The brain neural stem cell may be one isolated from telencephalon, diencephalon, mesencephalon, cerebellum, medulla oblongata, pons or spinal cord, and preferably from the telencephalon. The human neural stem cell may be purchased commercially or prepared by culturing cells isolated from the brain tissue of human fetus in neural stem cell growth factor containing medium (Example 1) . The neural stem cell growth factor may be bFGF (fibroblast growth factor-basic), LIF (leukemia inhibitory factor) or heparin. Preferably, 20 ng/mL bFGF, 10 ng/mL LIF and 8 μg/mL heparin may be used.
The human neural stem cell secreting SMAC according to the present invention may be grown and cultivated by the method known in the related art. The neural stem cell of the present invention is cultivated in a culture medium that supports the survival or growth of the wanted cell type. Occasionally, it is preferable to supply a culture medium in the form of free amino acid instead of serum. It is preferable to add an additive designed for consistent cultivation of nerve cells to the culture medium. For instance, N2 and B27 additives commercially available from Gibco may be used. During cultivation, it is preferable to monitor the status of the medium and the cells and exchange the medium. Also, it is preferable to perform subculturing when the neural stem cells grow to form neurospheres . Subculturing may be repeated every 7 or 8 days .
Preferably, the neural stem cells according to the present invention are cultivated as follows. N2 or B27 additives (Gibco) , neural stem cell growth inducing cytokines (e.g., bFGF, EGF, LIF, etc.) and heparin are added to a culture medium with known compositions (e.g., DMEM/F-12 or Neurobasal medium) . In general, serum is not added. In the medium, the neural stem cells grow into neurospheres. About half of the medium is replaced with fresh one every 3 to 4 days. When the number of the cells increases, the cells are dissociated every 7 to 8 days mechanically or using trypsin (0.05% trypsin/EDTA, Gibco) . Then, the cell suspension is plated on a new plate and cultivated further using the same medium [Gage et al., PNAS1 92(11): 879, 1995; McKay, Science, 276:66, 1997; Gage, Science, 287:1433, 2000; Snyder et al., Nature, 374:367, 1995; Weiss et al., Trends Neurosci. , 19:387, 1996] . The neural stem cells of the present invention may be differentiated into various nerve cells according to the methods known in the related art. In general, differentiation of the cells is carried out using a nutrient medium including an adequate substrate or differentiation reagent but without including a neural stem cell growth inducing cytokine. A preferred substrate is a solid surface coated with cationic charges, for example, poly-1-lysine and polyornithine. The substrate may be coated with extracellualr matrix components, for example, fibronectin and laminin. Other allowable extracellualr matrix includes Matrigel. In addition, a mixture of poly-1-lysine with fibronectin or laminin, or a combination substrate thereof may be used.
Adequate differentiation reagent includes a variety of growth factor, e.g., epidermal growth factor (EGF), transforming growth factor α (TGF-α) , all types of fibroblast growth factors (FGF-4, FGF-8 and bFGF) , platelet-derived growth factor (PDGF) , insulin-like growth factors (IGF-I and others), high-concentrated insulin, bone morphogenetic proteins (particularly, BMP-2 and BMP-4), retinoic acid (RA) and ligands that bind with the gpl30 receptor (e.g., LIF, CNTF and IL-6) , but is not limited thereto.
The neural stem cells of the present invention may be preserved in frozen status (cryopreservation) for long-term storage. In general, cryopreservation is performed as follows. When a sufficient quantity of neural stem cells is acquired through repeated subculturing, the resultant neurospheres are dissociated mechanically or using trypsin to obtain a single cell suspension. Then, the cell suspension is mixed with a cryopreserving solution consisting of 20-50% fetal bovine serum (Gibco) , 10-15% DMSO (Sigma) and cell culture medium, and moved into a freezing vial (NUNC) . The cells mixed with the cryopreserving solution are immediately transferred to a freezer of -70 °C, after kept at 4 °C, and moved to a liquid nitrogen tank after at least 24 hours for long-term storage [Gage et al., PNAS, 92(11) : 879, 1995; McKay, Science, 276:66, 1997; Gage, Science, 287:1433, 2000; Snyder et al., Nature, 374:367, 1995; Weiss et al., Trends Neurosci., 19:387, 1996].
The cryopreserved neural stem cells of the present invention may be thawed by the method known in the related art. The cryopreserved cells may be thawed by immersing the freezing vial in a water bath of 37 °C and shaking slowly. When about half of the cells in the freezing vial are thawed, the cell suspension is moved into a conical tube containing a neural stem cell medium, which is warmed to 37 0C. When all the cell suspension is transferred, centrifuge is carried out and the supernatant removed. The precipitated cell pellet is cautiously floated into the neural stem cell medium. Then, the cell suspension is moved to a 60 mm cell culture plate. Subsequently, neural stem cell growth inducing cytokine is added to the medium, and cultivation is carried out in a 5% CO2 incubator at 37 0C. In the following examples, neural stem cells isolated from the human brain tissue were grown, characterized and induced to differentiate.
Also, human glioblastoma cells were cultured and an animal model was established thereabout.
Further, in order to utilize SMAC as structural gene, a previously known SMAC gene was cloned by PCR, and TAT and the secretion signal sequence, Igκ-chain leader were inserted to prepare a structural gene construct. The structural gene construct was inserted into a recombinant expression vector for adenovirus to prepare a SMAC expressing recombinant expression vector, then, the recombinant expression vector was used to produce recombinant adenovirus. Further, a TRAIL expressing recombinant expression vector was prepared, and recombinant adenovirus was produced using the same.
Further, a human neural stem cell secreting SMAC and a human neural stem cell secreting both SMAC and TRAIL were produced utilizing the recombinant expression vector of the present invention, and growth and degree of protein expression thereof were investigated. As a result, it was understood that the SMAC or SMAC and TRAIL are secreted in the host cells transformed using the recombinant expression vector of the present invention.
But, the cells infected with both SMAC and TRAIL exhibited relatively lower growth and protein expression. Further, the effect of the SMAC expressing human neural stem cell of the present invention on the action of TRAIL was investigated. As a result, although the SMAC expressing human neural stem cell of the present invention could not kill tumor cells on its own, it provided advantageous effects by assisting the action of TRAIL.
Accordingly, the present invention provides a pharmaceutical composition for treating tumors comprising the human neural stem cells secreting SMAC which are transformed by a SMAC encoding nucleotide and human neural stem cells secreting TRAIL. The human neural stem cells secreting SMAC transformed by a SMAC encoding nucleotide according to the present invention can be utilized for kill tumor cells and/or reconstruct or regenerate nerve tissues in the human body, along with TRAILs or TRAIL secreting cells in human in need thereof. Particularly, the neural stem cell according to the present invention is very effective in treating tumors because it assists synergically the action of TRAIL. As used herein, "treatment" refers to any manner in which the symptoms of a condition are ameliorated or otherwise beneficially altered. Treatment also encompasses retardation of the progress of a disease and improvement, palliation and (partial or complete) remission of symptoms. Also, treatment may mean increased possibility of survival as compared to absence of the treatment. Treatment also encompasses prophylactic measures. Cases in need of treatment include those with existing diseases and those where prevention is required. Improvement of diseases means improvement or retardation of symptoms as compared to absence of the treatment. Typically, the treatment includes the administration of the neural stem cell of the present invention for killing tumor cells or regenerating tissues.
The human neural stem cell secreting SMAC according to the present invention is directly transplanted in the target tissue or transferred after being administered, thereby inducing apoptosis of tumor cells, reconstructing or regaining the functionally deficient region. For example, the human neural stem cell secreting SMAC according to the present invention may be directly transplanted in the parenchyma of the central nervous system or into the spinal canal, depending on the disease to be treated. Transplantation is performed using single cell suspensions or small aggregates with a density of IxIO5 to 1.5χlO5 cells per μL (US Patent No. 5,968,829).
The human neural stem cell secreting SMAC according to the present invention may be prepared as a form of pharmaceutical composition to be administered into human. The pharmaceutical composition of the invention may comprise pharmaceutically acceptable carriers. The term "pharmaceutically acceptable" refers to not be toxic when exposed to cell or human beings. The carriers may comprise, but not limited thereto, buffers, preservatives, alagesic, solubilizer, isotonic reagent, stabilizer, basis, excipient, lubricant, and the carriers which are well known in the art. The inventive pharmaceutical composition may be prepared into various preparations which is known in the art. For example, the injectable preparations may be prepared into single-dose ampule of multi-dose ampule. The general principle of the preparation of the inventive pharmaceutical composition are well described in the following references. Cell Therapy; Stem Cell Transplantation, Gene Therapy, and Cellular Immunotherapy, G. Morstyn amp; W. Sheridan Edit, Cambridge University Press, 1996; and Hematopoietic Stem Cell Therapy, E. D. Ball, J. Lister amp; P. Law, Churchill Livingstone, 2000. The inventive pharmaceutical composition may be packaged in a relevant container according to the instruction to achieve the purpose, for example, to reconstitute of damaged tissues by tumors and tumor treatment.
The tumors to which the pharmaceutical composition of the present invention can be applied include glioma, meningioma, pituitary adenoma, medulloblastoma, metastatic brain tumor, acoustic neuroma, prostatic cancer, malignant melanoma and neuroblastoma, but are not limited thereto. The glioma includes astrocytoma, oligodendroglioma, ependymoma, glioblastoma multiforme, etc. In particular, of the gliomas, malignant brain tumors such as glioblastoma multiforme are impossible to cure completely even with extensive operative treatments alongside adjuvant radiotherapies and chemotherapies. They are extremely prognostically unfavorable, mostly leading to deaths [Black et al . , Cancer of the Nervous System, Blackwell, Oxford 1997, Surawicz et al . , J. Neurooncol., 40:151, 1998]. The reason why they are so prognostically unfavorable is because the glioma cells are highly infiltrative and tend to migrate extensively over the entire brain tissues. Since they form tumor satellites away from the primary tumor mass, recurrences are not rare even when the primary tumor mass is removed by operation and other adjuvant treatments are performed. Therefore, for successful treatment and improvement of symptoms, development of a therapy targeting not only the primary tumor mass but also the metastatic tumor satellites is essential. Accordingly, the pharmaceutical composition of the present invention may be utilized as adjuvant therapy for the complete treatment of glioblastoma multiforme or other malignant brain tumors. Namely, the treatment method using the pharmaceutical composition of the present invention may be employed along with other therapies known in the related art such as chemotherapies, radiotherapies, surgical operations, drug administrations, and the like. Further, it may be employed as an alternative adjuvant therapy for treating tumors .
After being transplanted in the central nervous system (CNS) , the human neural* stem cell migrates specifically to the brain tumor site in response to the signals therefrom. In addition, when systemically administered through intravenous injection, it also migrates specifically to the sites of non-CNS tumors such as prostatic cancer, malignant melanoma and neuroblastoma [Brown et al., Human Gene Therapy, 14:1777, 2003]. Accordingly, the pharmaceutical composition of the present invention can be utilized effectively for the treatment of not only brain tumors but also systemic non- CNS tumors, including prostatic cancer, malignant melanoma, neuroblastoma and other malignant tumors.
In addition, based on the effect of the invention, the present invention provides the method for treating tumors which comprises administering SMAC secreting human neural stem cells which is transformed with SMAC-encoding nucleotide and TRAIL secreting human neural stem cells, as an active ingredient, to the subject in need.
As used herein, the "effective amount" refers to the amount effective in treating tumor, and the "subject" refers to mammals, particularlly, animals comprising human. The subject may be patient in need of treatment.
The inventive neural stem cell may be administered until the desired effect among the said effects were deduced, and may be administered via various routes which is well known in the art.
In addition, the present invention provides the use of SMAC secreting human neural stem cells which is transformed with SMAC-encoding nucleotide and TRAIL secreting human neural stem cells for preparing anti tumor reagents. The tumor, the inventive neural stem cell, and the effect thereof were described well previously.
Description of Drawings
FIG. 1 shows the microscopic images illustrating the proliferation and growth of human neural stem cells isolated from various brain tissues. HFT13: neural stem cells from the telencephalon HFD13: neural stem cells from the diencephalon HFM13: neural stem cells from the mesencephalon HFC13: neural stem cells from the cerebellum
FIG. 2 shows the graphs comparing the growth of human neural stem cells isolated from various brain tissues .
FIG. 3 shows the microscopic images illustrating the differentiation of human neural stem cells according to the present invention using various markers.
FIG. 4 shows the tumors induced in an animal model of human glioblastoma wherein U87MG or U343MG cells were transplanted, by staining with hematoxylin and CM-DiI.
FIGS. 5 to 8 show (a) the procedure of preparing a pShuttle-CAG vector, (b) a schematic diagram thereof, (c) the procedure of preparing pShuttle-CAG-IRES-hrGFP vector and (d) a schematic diagram thereof. FIGS. 9 and 10 show the cleavage maps of (a) the SMAC expressing recombinant adenoviral vector and (b) the TRAIL expressing recombinant adenoviral vector used in the present invention.
FIG. 11 shows the PCR result of the recombinant adenovirus produced from the SMAC expressing recombinant adenoviral vector for detecting the contamination of wild-type adenovirus. M: size marker Lane 1: negative control Lane 2: 293A (positive control) Lane 3: AdCAG-TAT-SMAC Lane 4 : AdCAG-TAT-SMAC
FIG. 12 shows the CCK-8 assay result for investigating the viability of human neural stem cells infected by the SMAC or GFP expressing recombinant viruses (AdCAG-TAT-SMAC or AdCAG-GFP) .
FIG. 13 shows the quantity of SMAC secreted from human neural stem cells infected by the SMAC or GFP expressing recombinant viruses (AdCAG-TAT-SMAC or AdCAG- GFP) .
FIG. 14 shows the quantity of SMAC and TRAIL secreted from human neural stem cells infected by the SMAC, TRAIL or GFP expressing recombinant viruses (AdCAG- TAT-SMAC, AdCAG-TRAIL or AdCAG-GFP) .
FIGS. 15 and 16 show (a) the microscopic images illustrating the apoptosis of human glioblastoma cell line (U87MG) co-cultured with the human neural stem cell culture medium infected by TRAIL, SMAC and GFP expressing recombinant viruses (AdCAG-TRAIL, AdCAG-TAT-SMAC and AdCAG-GFP) and (b) the viability of the human glioblastoma cell line co-cultured with the culture medium.
FIG. 17 compares the decrease of tumor size in glioblastoma (U87MG) animal model for the group to which human neural stem cells infected by TRAIL and SMAC expressing recombinant viruses (hNSCs-AdTRAIL + hNSCs- AdTAT-SMAC) were transplanted, the group to which human neural stem cells infected by TRAIL and GFP expressing recombinant viruses (hNSCs-AdTRAIL + hNSCs-AdGFP) were transplanted, and the group to which human neural stem cells infected only by GFP expressing recombinant viruses (hNSCs-AdGFP) were transplanted. Mode for Invention
Hereinafter, the present invention is described in further detail by the following examples.
However, the following examples are for the purpose of illustration only, and they do not limit the present invention.
Example 1
Isolation and culturing of human neural stem cells 1-1. Isolation of brain tissue
Under the approval of the IRB (Institution Review Board) of Severance Hospital and in accordance with the bioethical guideline of the MOHW (Ministry of Health & Welfare) , the research guideline of the Bioetchical Committee of the Stem Cell Research Center of the MOST
(Ministry of Science & Technology) and the guideline for management of human tissue research of Severance
Hospital, the dead body of a fetus that had been spontaneously aborted at 13th week of pregnancy was acquired with the prior written consent of the parents. The fetus was cleaned with cold sterilized H-H buffer (Hanks' balanced salt solution, 1* [Gibco] + HEPES, 10 mM [Gibco] in ddH2O, pH 7.4), and only the central nervous system was dissected under microscope. After removing all meninges and blood vessels, the tissues of telencephalon, diencephalon, mesencephalon, cerebellum, medulla oblongata, pons and spinal cord were isolated separately.
Each separated brain tissue was placed in a petri dish, and cut to a size of about 1 * 1 mm. After centrifuging at 950 rpm for 3 minutes, the supernatant was removed. The tissue was washed with H-H buffer, and centrifuge was repeated for 3 more times. After the last centrifuge, the supernatant was completely removed and the 2 mL of 0.1% trypsin (Gibco) and DNase I (Roche, 1 mg/dL) were added to the remaining tissue. After mixing well, the tissue was incubated in a 5% CO2 incubator of 37 °C for 30 minutes. Subsequently, 3 mL of serum containing medium (DMEM + 10% FBS + lxpenicillin/streptomycin/fungizone, Gibco) was added. The tissue was triturated with a serologic pipette (Falcon) into single cells. Then, after centrifuging and removing the supernatant, the resulting cell pellet was washed with H-H buffer. Then, centrifuge was performed again and the supernatant was removed.
1-2. Growth into neural stem cells
To the cell pellet of each brain tissue obtained in Example 1-1, 10 mL of N2 medium (D-MEM/F-12 [98% v/v] + N2 supplement [1% v/v] + penicillin/streptomycin [1% v/v] ; Gibco) was added and mixed slowly. About 4χlO6 to βχlθ6 cells were moved to a 100 mm tissue culture treated plate (Corning) . 20 ng/mL bFGF (recombinant human fibroblast growth factor-basic, R & D) , 10 ng/mL LIF (recombinant human leukemia inhibitory factor, Sigma) and 8 μg/mL heparin (Sigma) were added as neural stem cell growth factors and the cells were cultivated in a 5% CO2 incubator at 37 0C after shaking well. 24 hours later, 5 mL of the medium was discarded and 5 mL of fresh N2 medium was added. At the same time, 20 ng/mL bFGF, 10 ng/mL LIF and 8 μg/mL heparin were added and cultivation was continued. Exchange of the medium was performed every 3 to 4 days while monitoring the status of the medium and the cells, by replacing about half of the medium with fresh one and adding growth factors.
1-3. Subculturing
When the undifferentiated neural stem cells in Example 1-2 proliferated and began to form aggregates, neurospheres (FIG. 1), subculturing was performed every 7 to 8 days. Subculturing was carried out as follows. All the medium was removed from the cell culture plate. The cells were treated with 2 mL of 0.05% trypsin/EDTA (T/E, Gibco) , and reacted in a 5% CO2 incubator at 37 0C for 2 minutes and 30 seconds. Subsequently, 2.5 mL of trypsin inhibitor (T/I, soybean, Sigma, 1 mg/mL) was added and mixed well in order to stop the action of trypsin. The resulting cell suspension was moved into a 15 mL conical tube (Falcon) . Centrifuge was carried out and the supernatant was removed. After resuspending the cells with 3 mL of N2 medium, they were triturated with a serologic pipette until the neurospheres were dissociated into single cells. The cells were counted. The cell suspension including about 4χlO6 to 6χlO6 cells were moved to a new cell culture plate holding some of the existing medium, and N2 medium was further added to make the volume 10 mL. Then, after adding 20 ng/mL bFGF, 10 ng/mL LIF and 8 μg/mL heparin, cultivation was continued in a 5% CO2 incubator.
1-4. Cryopreservation
After acquiring a sufficient number of neural stem cells by continuing subculturing according to the method described in Example 1-3, some of the cells were cryopreserved. Cryopreservation was carried out as follows. The neurospheres were treated with 0.05% trypsin/EDTA and trypsin inhibitor, triturated and moved into a 15 mL tube. The cells were washed with 8 mL of H- H buffer. Centrifuge was carried out and the supernatant was removed. A previously prepared cryopreservation solution (N2 medium [40% v/v] + FBS [50% v/v] + DMSO [10% v/v, Sigma] ) of 4 0C was added to the cell pellet to softly resuspend the cells. The cell suspension was divided into 1.8 mL per each freezing vial (NUNC) . In general, the cells contained in one 10 mm cell culture plate were divided into 3 to 4 freezing vials. Then, the cells were transferred to a freezer of -70 °C as held in an ice bucket. Then, at least 24 hours later, they were moved to a liquid nitrogen tank for long-term storage.
1-5. Thawing of cryopreserved cells
The freezing vial containing the cryopreserved cells was immersed in a water bath of 37 °C and shaken slowly. When about half the cells were thawed, the cell suspension was moved to a conical tube containing 10 mL of N2 medium and preheated to 37 °C. Centrifuge was carried out and the supernatant was removed. The cell pellet was resuspended cautiously with 5 mL of N2 medium and transferred to a 60 mm cell culture plate. Subsequently, 20 ng/mL bFGF, 10 ng/mL LIF and 8 μg/mL heparin were added to the plate, and culturing was performed in a 5% CO2 incubator at 37 0C. When the cells grew to form neurospheres, subculturing was carried out in the manner described in Example 1-3. In general, the cells grew enough to be transferred to a 10 mm cell culture plate in about 10 days.
Example 2
In vitro analysis of human neural stem cells
2-1. Comparison of cell growth
The neural stem cells isolated from the human central nervous system and cultured into neurospheres in Example 1 were transferred to 100 mm cell culture plates, with 4χlO6 cells per each plate, and grown for 50 days.
The neural stem cells exhibited an exponential growth pattern (FIG. 2) . The neurospheres isolated from the diencephalon (HFD13 cells) increased about 1,850 times, and those isolated from the telencephalon (HFT13 cells) increased about 1,035 times. The neurospheres isolated from the cerebellum (HFC13 cells) , those isolated from the mesencephalon (HFM13 cells) and those isolated from the spinal cord (HFS13 cells) exhibited growth of about 453 times, 19 times and 12 times, respectively.
Thus, it was confirmed that the neural stem cells isolated from the forebrain, that is the diencephalon and the telencephalon, grow fast while those isolated from the mesencephalon and the spinal cord grow slowly and those isolated from the cerebellum exhibits an intermediate growth rate. The neurospheres of each the brain tissues was subcultured while separating every 7 to 10 days. The neurospheres from the telencephalon, the diencephalon, the cerebellum, the mesencephalon and the spinal cord could be subcultured for a period long time, with passage numbers of 42 (~1 year), 36 (-11 months), 30 (~9 months), 10 (~6 months) and 15 (~7 months), respectively. During the subculturing, no special change in cell morphologies or growth rate was observed. All the cells exhibited normal primary cell growth of dying through aging (not shown) . Also, no special change in cell growth pattern was observed when the neurospheres were thawed and cultured after long-term cryopreservation (not shown) . Chromosomal analysis was performed on the neural stem cells of the present invention. They showed normal 46, XY karyotype, and they showed normal karyotype in the case of long term subculturing (not shown).
2-2. Immunohistochemical analysis of neural stem cells using markers
The neurospheres growing in vitro were stained immunohistochemically. The neurospheres were moved to a chamber slide (NUNC) coated with 10 μg/mL poly-1-lysine (Sigma) and cultured for a day. When the neurospheres adhered to the slide, the medium was removed and the cells were washed once with cold IxPBS. The cells were fixed by treating with 4% paraformaldehyde (in Pipes buffer, Sigma) for 10 minutes. Then, after washing 3 times with IxPBS, the cells were reacted at room temperature for 1 hour in blocking solution (5% bovine serum albumin [BSA, Sigma] + 3% normal goat serum [NGS, Vector] + 0.3% Triton X-IOO [Sigma] in PBS). Subsequently, anti-human specific nestin antibody (1:200, Chemicon) or anti-vimentin antibody (1:80, Sigma) diluted in carrier solution (3% NGS + 0.3% Triton X-100 in PBS) was added and reaction was performed overnight at 4 °C. After washing the cells 3 times with IxPBS, species- specific secondary antibody conjugated with fluorescein (1:200, Vector) which is diluted in the aforesaid carrier solution, was added and reaction was performed for 1 hour at 37 °C. After washing 3 times with IxPBS, mounting medium (Vector) was dropped on the cells and a cover glass was put on. The cells were observed with an epifluorescent microscope (Olympus). It was identified that 99% or more of the cells expressed nestin or vimentin, which are markers of the neural stem cells. FIG. 3A shows the result for the neurospheres from the telencephalon (HFT13 cells) .
2-3. Analysis of differentiation pattern The differentiation pattern of the human neural stem cells growing while forming neurospheres was investigated immunohistochemically . The neurospheres were treated with 0.05% trypsin/EDTA to prepare single cell suspensions, which were moved to an 8-we11 chamber slide coated with 10 μg/mL poly-1-lysine (Sigma) . Then, they were cultured in N2 medium without including growth factor for a week. As a result, the cells adhered to the plate and differentiated into nerve cells. After removing the medium, the cells were washed once with cold IxPBS. The cells were fixed by treating with 4% paraformaldehyde (in Pipes buffer, Sigma) for 10 minutes. Subsequently, after washing 3 times with IxPBS, reaction was performed at room temperature for 1 hour in blocking solution (5% bovine serum albumin [BSA, Sigma] + 3% normal goat serum [NGS, Vector] + 0.3% Triton X-100 [Sigma] in PBS) . Then, various primary antibodies (Table 1) diluted in carrier solution (3% NGS + 0.3% Triton X- 100 in PBS) were added, and reaction was performed overnight at 4 0C.
Table 1 Primary antibodies used in analysis of differentiation pattern of human neural stem cells
Figure imgf000042_0001
The cells treated with the primary antibodies were washed 3 times with IxPBS, and, after adding specific secondary antibodies conjugated with fluorescein (1:200, Vector) diluted in the aforesaid carrier solution, reaction was performed at 37 °C for 1 hour. After washing 3 times with IxPBS, mounting medium (Vector) was dropped on the cells and a cover glass was put on. The cells were observed with an epifluorescent microscope (Olympus) .
As a result, although there were some differences depending on the site of the central nervous system where the stem cells were isolated and the passage number, the human neural stem cells exhibited multipotency of differentiation as they differentiated into various nerve cells and expressed various neurotransmitters (FIG. 3B). More specifically, the expression of TUJl, early neural marker, was observed in all the human neural stem cells derived from various sites of the central nervous system. This indicates that the neural stem cells can differentiate into medulliblasts . The level of expression of 04, early oligodendrocyte marker, was relatively low. This indicates only a few of the neural stem cells differentiate into oligodendrocytes. Recently, the cells expressing GFAP, which is known as the marker of astrocyte, one of glial cell, were reported to be neural stem cells or radial glial cells. All the human neural stem cells obtained from various parts of the central nervous system were identified to express GFAP. In particular, HFT13 cells exhibited very high degree of GFAP expression of 80% and 90-95% at early and late subculturing, respectively. The expression increased as subculturing continued.
The human neural stem cells of the present invention expressed various neurotransmitters after being differentiated. Particularly, GABA and glutamate were expressed in almost all cells. Also, it was identified that only a very small amount the human neural stem cells cultured according to the invention expressed choline acetyltransferase (choline AT) and tyrosine hydrolase (TH) . This indicates that they are hardly differentiated into dopamine-producing or cholinergic nerve cells.
Example 3
Culturing of human glioblastoma and establishment of animal model of human glioblastoma 3-1. Culturing of human glioblastoma
U87MG cell line, a kind of human glioblastoma, obtained from the ATCC (American Type Culture Collection) was cultured in RPMI 1640 medium (Gibco) containing 10% FBS and 1><P/S (penicillin/streptomycin; Gibco) . U343MG cell line (ATCC) , another kind of human glioblastoma, was cultured in DMEM medium (Gibco) containing 10% FBS and lχP/S. The cells were subcultured by treating with 0.05% trypsin/EDTA for 2 minutes and 30 seconds every 3 to 4 days. After the last subculturing, the U87MG or U343MG cells were treated with trypsin/EDTA to prepare a single cell suspension. The suspension was centrifuged at 950 rpm for 3 minutes and the supernatant was removed. The resultant cell pellet was resuspended by adding 5 mL of IxPBS containing 20 μg/mL CM-DiI (cell tracker, Molecular Probes) . Then, the cells were incubated for 3 minutes at 37 °C and for 10 minutes on ice, and stained with CM-DiI. After centrifuge, the resultant cell pellet was resuspended with 10 mL of IxPBS. After 3 times of centrifuging, -remaining CM-DiI was removed. Subsequently, after adjusting the number of the cells to 5χlO5 cells/4 μL (or 7xlO4 cells/4 μL) , the cells were resuspended with IxPBS. Such prepared cell suspension was stored in ice, until they were transplanted.
3-2. Establishment of animal model of human glioblastoma 6- to 8-week-old athymic nude mice (nu/nu; female) were anesthetized with xylazine (0.1 mg/10 g of body weight) and ketamine (0.5 mg/10 g of body weight) . The skin at the central part of the head was rinsed with 70% alcohol and incised. The head was fixed by placing on a stereotaxic apparatus. The location of the right corpus striatum was marked and a burr hole was made in the skull using a 1 mm drill bar (0.5 mm forward from the bregma, 2.5 mm lateral to the right side, 3 mm deep) . Then, the CM-DiI marked tumor cell suspension prepared in Example 3-1 was placed in a 10 μL Hamilton syringe. After mounting the syringe on the stereotaxic apparatus, 4 μL of the tumor cell suspension was slowly transplanted in the corpus striatum at a rate of 1 μL/min, using a microinjection pump (Stoelting) . After 3 minutes of stabilization, the syringe needle was slowly withdrawn for a duration of 3 minutes. The incision was treated with iodine ointment and sutured. The mouse was stabilized on a warm pad at 37 °C until it came out of the anesthesia. In order to prevent infection, cefazolin
(50 mg/kg/day, Yuhan Corporation) diluted in distilled water was injected subcutaneously for 3 days after the operation. One week after the cell transplantation, the brain was taken from the mouse after fixing with 4% paraformaldehyde (in Pipes buffer) , in order to confirm the establishment of an animal model of human glioblastoma. The brain was cryosected into 16 μm slices and stained with hematoxylin (Vector) . Then, the tumors marked by CM-DiI were observed under microscope. As seen in FIG. 4, very large tumors were observed in the right corpus striatum of the mouse to which the U87MG cells had been transplanted. Tumors were also found in the corpus striatum of the mouse to which the U343MG cells had been transplanted. Example 4
Preparation of SMAC expressing recombinant adenovirus 4-1. Preparation of modified pShuttle vector having CAG promoter In order to utilize recombinant adenovirus having CAG promoter, CMV immediate-early enhancer (CMV IE enhancer) , chicken β-actin promoter and rabbit β-globin terminator from pTriEX-1.1 Neo DNA (Novagen) vector, and IRES and hrGFP from pShuttle-IRES-hrGFP-1 (Stratagene) vector were cloned to the MCS (multi cloning site) of pShuttle vector (Stratagene) to prepare a pShuttle-CAG or a pShuttle-CAG-IRES-hrGFP vector (see FIGS. 5 and 7). A detailed description is given below.
First, the rabbit β-globin terminator was cloned between Sail and BgIII of the pShuttle vector as follows. Rabbit β-globin terminator was obtained from pTriEX-1.1 Neo vector (Novagen) through PCR using Pfu polymerase. The used primers [forward primer expressed by SEQ ID NO 4 (CTCGAGATCAATTCTCTAGCCAAT) and reverse primer expressed by SEQ ID NO 5 (GGATCCTTACATATGGGCATATGT)] included Xhol and BamHI restriction enzyme sequences for cloning of the pShuttle vector. PCR was carried out as follows: initial denaturation at 95 °C for 5 minutes; 35 cycles of denaturation at 94 °C for 45 seconds, annealing at 55 0C for 45 seconds and extension at 72 0C for 30 seconds; and final extension at 72 °C for 7 minutes. The amplified PCR product was cloned in the pGEM-T easy vector (Promega, Wisconsin, USA) . The pGEM-T easy vector in which the rabbit β-globin terminator had been inserted was cut with Xhol and BamRI , and the pShuttle vector was cut with Sail and BgIII. The two products were ligated. Here, Sail and Xhol, and BgIII and BamUI can be ligated with compatible cohesive ends. The ligated vector loses corresponding restriction enzyme sites. In this manner, the pShuttle vector having rabbit β-globin terminator (pShuttle-rabbit β-globin terminator) was cloned. Subsequently, CMV immediate-early enhancer and chicken β-actin promoter were cloned in the pShuttle vector having rabbit β-globin terminator as follows. In order to remove the Pad restriction enzyme site present between the chicken β-actin promoter and the MCS of the pTriEX-1.1 Neo vector, the pTriEX-1.1 Neo vector was cut with Pad and a blunt end was made using a Klenow fragment (Takara) . Then, after cutting with Smal, a modified pTriEX-1.1 Neo vector with the Pad restriction enzyme removed was obtained through self ligation. The modified pTriEX-1.1 Neo vector was cut with Fsel and polymerization was performed using a Klenow fragment to make a blunt end. Then, the CMV immediate-early enhancer and the chicken β-actin promoter portions were obtained by cutting with Xhol. The product obtained by cutting the pShuttle vector having rabbit β-globin terminator with Kpnl and Xhol was ligated with the CMV immediate- early enhancer and the chicken β-actin promoter to obtain the pShuttle vector (pShuttle-CAG) including CMV immediate-early enhancer, chicken β-actin promoter and rabbit β-globin terminator (see FIGS. 5 and 6).
IRES and hrGFP were cloned in the pShuttle-CAG vector as follows. IRES and hrGFP were obtained from a pShuttle-IRES-hrGFP-1 vector (Stratagene) by PCR using Pfu polymerase. The primers [forward primer (CTCGAGGACTACAAGGATGAC) of SEQ ID NO 6 and reverse primer (CTCGAGCACCCACTCGTGCAGGCTGCC) of SEQ ID NO 7] included a Xhol restriction enzyme sequence in front of IRES for cloning into the pShuttle-CAG vector. PCR was carried out by: initial denaturation at 95 0C for 5 minutes; 35 cycles of denaturation at 94 °C for 45 seconds, annealing at 55 0C for 45 seconds and extension at 72 0C for 1 minute; and final extension at 72 0C for 7 minutes. The amplified PCR product was cloned in the pGEM-T easy vector (Promega, Wisconsin, USA) . The pGEM-T easy vector was cut with EcoRI and polymerization was performed using a Klenow fragment. Then, IRES and hrGFP were obtained by cutting with Xhol. The product obtained by cutting the pShuttle-CAG vector with Xhol and EcoRM was ligated with IRES and hrGFP to obtain the pShuttle-CAG-IRES-hrGFP (see FIGS. 7 and 8) .
4-2. Preparation of SMAC expressing recombinant vector
A culture medium of SK-N-MC (ATCC number: HTB-10™) , which is a kind of human neuroblastoma cell line inducing apoptosis by TRAIL, was treated with 1000 ng/mL of rhTRAIL (Peprotech) to induce apoptosis. 12 hours later, RNAs were extracted from the cells using Trizol (Qiagen, USA) . cDNA was synthesized by reacting at 37 0C for 50 minutes, using M-MLV reverse transcriptase (Invitrogen, USA) and Oligo dT primer.
Using the synthesized cDNA as template and also using the forward primer (GCGGTTCCTATTGCACAGAAATCAG) of SEQ ID NO 8 and the reverse primer (CTCGAGAATCCTCACGCAGGTAGGC) of SEQ ID NO 9, the SMAC gene expressed by SEQ ID NO 2 was amplified by PCR. Here, the primers include the Xhol restriction enzyme sequence for easier cloning into the pSecTag2A vector (Invitrogen, USA) . PCR was carried out by: initial denaturation at 94 0C for 3 minutes; 35 cycles of denaturation at 94 °C for 30 seconds, annealing at 53 °C for 40 seconds and extension at 72 0C for 45 seconds; and final extension at 72 0C for 10 minutes. The amplified PCR product was cloned in the pGEM-T easy vector (Promega, Wisconsin, USA) (pGEM-T easy-SMAC) .
The full-length SMAC (SEQ ID NO 3) is a protein targeted to the mitochondria after being expressed and has a mitochondria targeting sequence (MTS) at the N- terminal. However, because the SMAC utilized in the present invention has to be located in the cytoplasm, the mitochondria targeting sequence needs to be removed. Hence, the SMAC sequence amplified by the PCR corresponds to SEQ ID NO 1 wherein the MTS (1st through 55th amino acids of SEQ ID NO 3) has been removed.
Further, for the SMAC of the present invention which has been expressed in the neural stem cell and secreted out of the cell to enter the cytoplasm of the target cell passing through the cell membrane, the protein transduction domain (TAT; YGRKKRRQRRR; SEQ ID NO 10) obtained from HIV and consisting of 11 amino acids was ligated to the N-terminal of the SMAC as follows. Using the pGEM-T easy-SMAC vector as template and also using the forward primer (AACGGAGGCAACGTAGACGCGGAGCGGTTC) of SEQ ID NO 11 and the reverse primer of SEQ ID NO 9, a part of the TAT sequence was extended at the 5 '-terminal of the SMAC sequence through PCR amplification. PCR was carried out as follows: initial denaturation at 94 0C for 3 minutes; 35 cycles of denaturation at 94 °C for 30 seconds, annealing at 55 °C for 30 seconds and 72 0C extension at 45 seconds; and final extension at 72 °C for 10 minutes. The amplified PCR product was cloned in the pGEM-T easy vector (Promega) . Using the resulting vector as template and also using the forward primer (AAGCTTAGGATATGGACGAAAGAAACGGAGGCAACGTAGAC) of SEQ ID NO 12 and the reverse primer of SEQ ID NO 9, PCR amplification was performed to extend the remaining TAT sequence. PCR was carried out by: initial denaturation at 94 0C for 3 minutes; 35 cycles of denaturation at 94 0C for 30 seconds, annealing at 53 0C for 40 seconds and extension at 72 0C for 45 seconds; and final extension at 72 0C for 10 minutes. The amplified PCR product was cloned in the pGEM-T easy vector (Promega) (pGEM-T easy- TAT-SMAC) . Subsequently, the SMAC of the present invention linked to TAT was cloned in the pSecTag2A vector
(Invitrogen) including an Igκ-chain leader which induces the extracellular secretion of proteins. That is, the pGEM-T easy-TAT-SMAC vector and the pSecTag2A vector were cut with HindiII and Xhol restriction enzymes, respectively, and the SMAC fragment of the present invention linked to TAT was ligated with the pSecTag2A vector to obtain an Igκ-chain leader-TAT-SMAC construct.
BgIII and Sail restriction enzyme sequences were linked to the both ends of the resultant Igκ-chain leader-TAT-SMAC construct by PCR in order to clone the construct in the adenovirus shuttle vector. PCR was performed using the pSecTag2A vector including TAT-SMAC as template and also using the forward primer (AGATCTGCCACCATGGAGACA) of SEQ ID NO 13 and the reverse primer (GTCGACTTACAGATCCTCTTCTG) of SEQ ID NO 14. PCR was carried out by: initial denaturation at 94 °C for 3 minutes; 35 cycles of denaturation at 94 °C for 30 seconds, annealing at 53 0C for 40 seconds and extension at 72 0C for 45 seconds; and final extension at 72 0C for 10 minutes. The amplified PCR product was cloned in the pGEM-T easy vector (Promega) (pGEM-T easy-IgK-TAT-SMAC) . Subsequently, the pGEM-T easy-IgK-TAT-SMAC vector was cut with BgIII and Sail restriction enzymes, and the IgK-TAT- SMAC fragment was inserted in the adenovirus shuttle vector pShuttle-CAG prepared in Example 4-1 and was named as "pShuttle-CAG-IgK-TAT-SMAC" (see FIG. 9) .
4-3. Preparation of SMAC expressing recombinant adenovirus (AdCAG-TAT-SMAC)
The resultant pShuttle-CAG-IgK-TAT-SMAC was cut with Pmel restriction enzyme and was introduced in E. coil BJ5183 along with the adenoviral backbone vector pAdEasy-1 (Stratagene) , in order to induce homologous recombination between the two vectors (pAd-CAG-IgK-TAT- SMAC) . Transformation of E. coil was carried out by electroporation using Gene Pulser (2.5 kV, 25 μF, 200 Ω, Bio-Rad, Hercules, CA, USA) .
Thus obtained pAd-CAG-IgK-TAT-SMAC was cut with Pad restriction enzyme, and transfected to the 293A cells (Invitrogen, CA), an adenovirus producing cell line, to amplify the viruses. The produced recombinant virus (AdCAG-TAT-SMAC) was isolated by performing cesium chloride ultracentrifugation with 80,000 rpm at 10 0C for 6 hours. Subsequently, after dialysis (Pierce, Rockford, IL, USA) in 4% sucrose buffer (10 mM Tris, 4% sucrose, 2 mM MgCl2 in IxPBS) and filtration with 0.4 μm filter, the viruses were stored at -70 °C until they were used. 4-4. TCID50 test
For quantitative analysis of the AdCAG-TAT-SMAC recombinant virus, TCID5O (tissue culture infectious dose 50, QBiogene) test was carried out using 293A cells. 293A cells were plated on a 96-well plate (NUNC), and were infected with recombinant viruses^ diluted to varying concentrations. After 1 week, the number of infected cells was counted and the TCID50 value was calculated by KABER statistical method (TCID 50 reference; QBiogene, CA, USA, AdenoVator applications manual) .
It was confirmed that the adenoviral vector was prepared as wanted, with the TCID50 value of the AdCAG- TAT-SMAC recombinant virus ranging from IxIO10 to 5><1010 PFU/mL.
4-5. Identification of contamination of wild-type adenovirus
In order to identify whether the wild-type adenovirus in the AdCAG-TAT-SMAC recombinant virus was contaminated, a primer was synthesized from the internal sequence of the El gene of the wild-type adenovirus and PCR was carried out. First, the genome of each recombinant virus was obtained through phenol/ethanol precipitation after treating the virus particles with lysis buffer (0.1% SDS, 10 mM Tris-Cl, 1 mM EDTA). Then, PCR was carried out using the resultant genome as template and also using the primers of SEQ ID NO 15
(TTTGTGTTACTCATAGCGCGT) and SEQ ID NO 16
(ATTCTTTCCCACCCTTAAGCC) (obtained by amplifying El gene of wild-type adenovirus) . In order to identify the extracted genome of the recombinant adenovirus, PCR was carried out using the primers of SEQ ID NO 13 and SEQ ID
NO 14 for the detection of the target TAT-SMAC gene. PCR was carried out by: initial denaturation at 94 °C for 3 minutes; 35 cycles of denaturation at 94 °C for 30 seconds, annealing at 53 °C for 40 seconds and extension at 72 °C for 45 seconds; and final extension at 72 0C for 10 minutes. The genome of 293A cells was used as positive control group. The genome of 293A cells was obtained by phenol/ethanol precipitation after treating the cells with digestion buffer (0.5% SDS, 100 mM NaCl, 10 mM Tris-Cl, 25 mM EDTA) . PCR result was confirmed through agarose gel electrophoresis.
As can be seen in FIG. 11, 340-bp El gene was detected in the 293A cells (lane 2), but it was not detected in the genome of the AdCAG-TAT-SMAC recombinant virus (lane 3) and the target gene (TAT-SMAC: 756 bp) was detected (lane 4).
Example 5 Preparation of TRAIL expressing recombinant adenovirus 5-1. Preparation of TRAIL expressing recombinant vector
First, TRAIL gene was amplified by PCR using the plasmid obtained from the cDNA library (Clontech, Cat. 634258) of the brain of human fetus as template. In order to prepare water-soluble TRAIL, the apoptogenic receptor binding moiety (95th through 281st in SEQ ID NO 17, SEQ ID NO 18) of the TRAIL (SEQ ID NO 17) excluding the transmembrane domain was amplified by PCR. The primers used (SEQ ID NO 19: GGTACCACCTCTGAGGAAACCATTTC and SEQ ID NO 20: CTCGAGGCCAACTAAAAAGGCCCCGA) included Kpnl and Xhol restriction enzyme sequence, respectively, for easier cloning in the pSecTag2A vector (Invitrogen) . PCR was carried out by: initial denaturation at 94 °C for 3 minutes; 35 cycles of denaturation at 94 °C for 30 seconds, annealing at 58 0C for 30 seconds and extension at 72 °C for 45 seconds; and final extension at 72 0C for 10 minutes. The amplified PCR product was cloned in the pGEM-T easy vector (Promega, Wisconsin, USA) .
For improvement of activation through trimerization of TRAIL, the isoleucine zipper domain (hereinafter, "ILZ") was cloned as follows. HindiII and Kpnl restriction enzyme sequences were linked at both ends of the sequence
(GGCATGAAGCAGATCGAGGACAAAATTGAGGAAATCCTGTCCAAGATTTACCACAT CGAGAACGAGATCGCCCGGATTAAGAAACTCATTGGCGAGGGC, SEQ ID NO 21) , which was obtained from reverse transcription of the known ILZ amino acid sequence, in order to synthesize an oligomer (Bioneer, Daejeon, Korea) . The synthesized oligomer was inserted in the pGEM-T vector. Then, ILZ and TRAIL genes were inserted in sequence in the pSecTag2A vector including the Igκ-chain leader which induces extracellular secretion of proteins. That is, first, the pGEM-T vector including ILZ was cut with ifindIII and Kpnl, and the cut ILZ was inserted in the pSecTag2A vector. Then, both ends of the pGEM-T easy vector having TRAIL gene were cut with Kpnl and Xhol , and the cut TRAIL gene was inserted in the aforesaid pSecTag2A vector including ILZ. The Igκ-chain leader is lost when TRAIL is expressed by the pSecTag2A vector and secreted out of the cell.
Such prepared IgK-ILZ-TRAIL construct was cloned in the modified pShuttle vector including CAG promoter (pShuttle-CAG-IRES-hrGFP) as follows. BgIII and Xhol restriction enzyme sites were linked at both ends of the IgK-ILZ-TRAIL construct through PCR. To this end, an oligonucleotide having base sequences of SEQ ID NO 23 (AGATCTATGGAGACAGACACACTCCT) and SEQ ID NO 20 was used as primer. PCR was carried out by: initial denaturation at 94 °C for 3 minutes; 35 cycles of denaturation at 94 0C for 30 seconds, annealing at 60 °C for 30 seconds and extension at 72 °C for 90 seconds; and final extension at 72 0C for 10 minutes. The amplified PCR product was cloned in the pGEM-T easy vector (Promega, Wisconsin, USA) . Subsequently, the vector was cut with BgIII and Xhol restriction enzymes and inserted into the adenovirus shuttle vector pShuttle-CAG-IRES-hrGFP. The resultant vector was named as pShuttle-CAG-IgK-ILZ-TRAIL-IRES-hrGFP (see FIG. 10) . In the pShuttle-CAG-IgK-ILZ-TRAIL-IRES- hrGFP vector, GFP gene is linked to IRES downstream of the TRAIL gene. Therefore, during the expression of TRAIL, GFP is also expressed spontaneously.
5-2. Preparation of TRAIL expressing recombinant adenovirus (AdCAG-TRAIL)
The recombinant adenovirus that expresses TRAIL by the CAG promoter was prepared as follows. The pShuttle-
CAG-IgK-ILZ-TRAIL-IRES-hrGFP vector was cut with Pmel restriction enzyme and introduced to E. coil BJ5183 along with the adenoviral backbone vector pAdEasy-1
(Stratagene) in order to induce homologous recombination between the two vectors (pAd-CAG-IgK-ILZ-TRAIL-IRES- hrGFP) . Transformation of E. coil was carried out by electroporation using Gene Pulser (2.5 kV, 25 μF, 200 Ω, Bio-Rad, Hercules, CA, USA) .
Thus obtained pAd-CAG-IgK-ILZ-TRAIL-IRES-hrGFP was cut with Pad restriction enzyme and transfected in 293A cells (Invitrogen, USA), which is an adenovirus producing cell line, in order to amplify the viruses. The produced recombinant viruses (AdCAG-TRAIL) were isolated by performing cesium chloride ultracentrifugation at 80,000 rpm, at 10 0C for 6 hours. Then, after performing dialysis (Pierce, Rockford, IL, USA) using 4% sucrose buffer (10 mM Tris, 4% sucrose, 2 mM MgCl2 in PBS) and filtering with 0.4 μm filter, they were kept at -70 0C until they were used.
5-3. Preparation of GFP expressing recombinant adenovirus (AdCAG-GFP)
The recombinant adenovirus that expresses GFP only by the CAG promoter (AdCAG-GFP, control virus) was prepared in the same manner of Examples 5-1 and 5-2, using the pShuttle-CAG-IRES-hrGFP vector prepared in Example 4-1.
Example 6
Investigation of response of human neural stem cells to
TRAIL and SMAC 6-1. Analysis of proliferation and growth of human neural stem cells infected by SMAC expressing recombinant adenovirus
It was observed whether the human neural stem cells infected by the recombinant viruses AdCAG-TAT-SMAC and AdCAG-GFP respectively proliferated and grew normally.
5 x 105 HFT13 cells were plated in a 6-well culture dish along with 1 mL of N2 medium including growth factor, per each well. One hour later, 50 MOI AdCAG-GFP and 50 and 100 MOI AdCAG-TAT-SMAC virus particles were directly added to each medium to infect the cells. 24 hours after the infection, the cells were washed once with 3 mL of N2 medium in order to remove the viruses, and grown further in 3 mL of N2 medium including growth factor. 2 days later, the cells were identified to express GFP and proliferate and grow while forming normal neurospheres (not shown) . Further, CCK-8 assay was carried out in order to quantitatively analyze the effect of the infection by the SMAC or GFP expressing recombinant adenovirus on the proliferation and growth of human neural stem cells. 5*104 HFT13 cells were plated in a 96-well culture dish along with 100 μL of N2 medium including growth factor, per each well. One hour later, 50 MOI AdCAG-GFP and 50 and 100 MOI AdCAG-TAT-SMAC virus particles were directly added to each medium to infect the cells. 24 hours after the infection, the cells were washed once with 100 μL of N2 medium in order to remove the viruses, and grown further in 100 μL of N2 medium including growth factor. 3 days later, the cells were treated with 10 μL of CCK-8 solution and absorbance was measured at 450 nm using a microplate reader 2 hours later. The well treated only with the CCK-8 solution served as blank control, and the HFT13 cells to which no virus had been added was named as 100% cell survival group. Each test group consisted of 3 wells, and test was carried out 3 times and then averaged. With the average viability of the HFT13 cells not infected by the virus being 100%, viability of the cells infected by AdCAG-GFP was 99.28 ± 1.98 % on the average, viability of the cells infected by 50 MOI AdCAG- TAT-SMAC was 96.22 ± 2.19 % on the average, and viability of the cells infected by 100 MOI AdCAG-TRAIL was 92.78 ± 1.97 % on the average (see FIG. 12).
Accordingly, it can be concluded that the expression of SMAC and GFP by the CMV and CAG promoters do not inhibit the proliferation and growth of human neural stem cells. Further, it can be seen that they are not significantly affected by the infection by adenovirus .
6-2. Analysis of proliferation and growth of human neural stem cells coinfected by TRAIL and SMAC expressing recombinant adenoviruses
It was observed whether the human neural stem cells coinfected by the recombinant viruses AdCAG-TRAIL and AdCAG-TAT-SMAC proliferated and grew normally while expressing TRAIL and SMAC.
5 x 105 HFT13 cells were plated in a 6-well culture dish along with 1 mL of N2 medium including growth factor, per each well. One hour later, the cells were directly infected by adding virus particles under the conditions of: infection with 50 MOI AdCAG-GFP; infection with 130 MOI AdCAG-TRAIL; infection with 100 MOI AdCAG- TAT-SMAC; coinfection with 65 MOI AdCAG-TRAIL and 50 MOI AdCAG-TAT-SMAC; and coinfection with 130 MOI AdCAG-TRAIL and 100 MOI AdCAG-TAT-SMAC. 24 hours after the infection, the cells were washed once with 3 mL of N2 medium in order to remove the viruses, and grown further in 3 mL of N2 medium including growth factor. 2 days later, it was identified that the human neural stem cells expressed GFP well and proliferated and grew well while forming normal neurospheres, except for the cells coinfected by 130 MOI AdCAG-TRAIL and 100 MOI AdCAG-TAT- SMAC, wherein the cells showed poor state and did not exhibit normal cell growth (not shown) .
Accordingly, it can be concluded that the spontaneous expression of TRAIL and SMAC by the CAG promoter does not inhibit the proliferation and growth of human neural stem cells significantly, but it affects the proliferation and growth of cells when the concentration of adenovirus is high.
Example 7
Quantitative analysis of expression of protein by human neural stem cells induced by recombinant adenovirus
7-1. Quantitative analysis of expression of SMAC by human neural stem cells infected by SMAC expressing recombinant adenovirus
In order to confirm whether the AdCAG-TAT-SMAC recombinant virus prepared in Example 4-2 secretes SMAC in the host cell, the AdCAG-TAT-SMAC and AdCAG-GFP viruses were infected in human neural stem cells (HFT13 cells) and the secretion of SMAC was quantitatively analyzed by ELISA (enzyme-linked immunosorbent assay) . To this end, 5*105 human neural stem cells (HFT13 cells) isolated from the telencephalon (Example 1) were plated in a 6-well culture dish along with 1 mL of N2 medium including growth factor. One hour later, 50, 75, 100 and 200 MOI AdCAG-GFP virus particles were directly added to each medium to infect the cells. 24 hours after the infection, the cells were washed once with 3 mL of N2 medium in order to remove the viruses, and grown further in 100 μL of N2 medium including growth factor. Then, the cells were cultured for 48 hours after adding 3 mL of N2 medium. -
For quantitative analysis of SMAC secreted from the neural stem cells infected by the recombinant virus, all the cell culture medium was collected and subjected to ELISA (R&D Systems Inc., USA). Anti-human SMAC antibody was diluted in phosphate buffer (PBS: 137 mM NaCl, 2.7 mM KCl, 8.1 mM Na2HPO4, 1.5 mM KH2PO4, pH 7.2-7.4) to 0.8 μg/mL and added to the 9β-well plate, 100 μL per each well. After keeping at room temperature for a day, the wells were washed 3 times with 400 μL of washing buffer (0.05% Tween-20 in PBS). 300 μL of block buffer (1% BSA, 5% sucrose, 0.05% NaN3, in PBS, pH 7.2-7.4) was added to each well and blocking was performed by incubating at room temperature for 1-2 hours. Then, after washing 3 times, each 100 μL of culture medium of the AdCAG-TAT- SMAC recombinant adenovirus and SMAC standard solution diluted to varying concentrations was respectively added to each well. After 2 hours of reaction at room temperature, each well was washed 3 times. Biotinylated anti-human SMAC antibody was diluted in IC Diluent #1 (1% BSA in PBS, pH7.2-7.4, 0.2 μm filtered) to 150 ng and, added to the well, 100 μL per each well. After 2 hours of reaction at room temperature, each well was washed 3 times. Avidin-horseradish peroxidase conjugate reagent was diluted in IC Diluent #1 and added to the well, 100 μL per each well. After 20 minutes of reaction at room temperature, each well was washed 3 times. To each well, 100 μL of substrate solution (tetramethylbenzidine [TMB] and hydrogen peroxide, R&D systems, USA) was added. After 20 minutes of reaction at room temperature in the absence of light, 50 μL of 2N sulfuric acid was added to stop the reaction. Then, absorbance was measured at 450 nm using a microplate reader (Molecular Devices, USA) .
As a result, the quantity of the SMAC protein measured 48 hours later after infecting with 50, 75, 100 and 200 MOI AdCAG-TAT-SMAC was 13.20 ± 0.46 (mean ± SD), 18.70 ± 0.12, 21.71 ± 0.29 and 26.55 ± 1.32 ng, respectively, based on the culture medium of 1,000,000 neural stem cells. Measurement result for the culture medium of HFT13 cells not infected by viruses and the culture medium of HFT13 cells infected by 50 MOI AdCAG- GFP was 0.57 and 0.59 ng, respectively (see FIG. 13).
These results show that the human neural stem cells infected by the SMAC expressing recombinant adenovirus secrete SMAC normally. This indicates that the recombinant expression vector of the present invention can be utilized as effective means of gene transfer to host cell mediated by adenovirus.
7-2. Quantitative analysis of expression of TRAIL and SMAC proteins by human neural stem cells coinfected by TRAIL and SMAC expressing recombinant adenoviruses
Experiment was performed as follows in order to identify how each of the TRAIL and SMAC proteins are expressed when human neural stem cells (HFT13) are coinfected by AdCAG-TAT-SMAC and AdCAG-TRAIL. 5><105 HFT13 cells were plated in a 6-well culture dish along with 1 mL of N2 medium including growth factor. One hour later, the cells were directly infected by adding virus particles under the conditions of: infection with 50 MOI AdCAG-GFP; infection with 130 MOI AdCAG-TRAIL/ infection with 100 MOI AdCAG-TAT-SMAC; coinfection with 65 MOI AdCAG-TRAIL and 50 MOI AdCAG-TAT-SMAC; and coinfection with 130 MOI AdCAG-TRAIL and 100 MOI AdCAG-TAT-SMAC. 24 hours after the infection, the cells were washed once with 3 mL of N2 medium in order to remove the viruses, and grown further after adding 3 mL of N2 medium including growth factor. For quantitative analysis of SMAC and TRAIL secreted from the neural stem cells infected by the recombinant viruses, all the cell culture medium was collected and subjected to ELISA for SMAC (R&D Systems Inc., Minneapolis, MN) and ELISA for TRAIL (BD, San Diego, CA) . ELISA for TRAIL was performed in the same manner of ELISA for SMAC, except for infecting the cells by adding 65, 130, 195 and 260 MOI AdCAG-TRAIL and 50 MOI AdCAG-GFP.
As a result, the quantity of the SMAC protein measured 48 hours later after infection was 22.97 ± 0.85 ng (mean ± SD) for infection with 100 MOI AdCAG-TAT-SMAC, 12.32 ± 0.25 ng for coinfection with 65 MOI AdCAG-TRAIL and 50 MOI AdCAG-TAT-SMAC, and 13.15 ± 0.19 ng for coinfection with 130 MOI AdCAG-TRAIL and 100 MOI AdCAG- TAT-SMAC, based on the culture medium of 1,000,000 neural stem cells. And, the quantity of the TRAIL protein measured 48 hours later after infection was 42.94 ± 0.15 ng (mean ± SD) for infection with 130 MOI AdCAG-TRAIL, 37.29 ± 0.92 ng for coinfection with 65 MOI AdCAG-TRAIL and 50 MOI AdCAG-TAT-SMAC, and 38.28 ± 0.73 ng for coinfection with 130 MOI AdCAG-TRAIL and 100 MOI AdCAG- TAT-SMAC, based on the culture medium of 1,000,000 neural stem cells (see FIG. 14) .
These results show that, although the expression of each of SMAC and TRAIL is not inhibited by the coinfection of human neural stem cells with AdCAG-TRAIL and AdCAG-TAT-SMAC viruses, the coinfection (130 MOI AdCAG-TRAIL + 100 MOI AdCAG-TAT-SMAC) results in poor cell growth due to the high concentration of infecting viruses and decreased expression of TRAIL and SMAC proteins, as compared to the infection with AdCAG-TRAIL or AdCAG-TAT-SMAC individually. When coinfection was carried out by reducing the concentration of infecting viruses in half (65 MOI AdCAG-TRAIL + 50 MOI AdCAG-TAT- SMAC) , the cell growth state was improved, but the expression of TRAIL and SMAC decreased further.
Example 8 Analysis of apoptosis of human glioblastoma induced by human neural stem cells infected by TRAIL and SMAC expressing recombinant adenoviruses
8-1. Analysis of apoptosis of human glioblastoma induced by human neural stem cells infected by each of TRAIL and SMAC expressing recombinant adenoviruses
In order to confirm whether the TRAIL or SMAC secreted from the human neural stem cells infected by
AdCAG-TRAIL or AdCAG-TAT-SMAC recombinant viruses, respectively, induces the apoptosis of human glioblastoma cells, the culture medium of the neural stem cells infected by each virus was cocultured with the glioblastoma cell line.
First, 5χlO5 HFT13 cells were plated in a 6-well plate dish along with the medium. One hour later, the cells were infected by directly adding each of 50 MOI
AdCAG-GFP, 130 MOI AdCAG-TRAIL and 100 MOI AdCAG-TAT-SMAC virus particles to the medium of each well. 24 hours later, the cells were washed with 3 mL of N2 medium and grown further in 5 mL of N2 medium including growth factor for 3 days. The culture medium was centrifuged at 1000 rpm for 3 minutes. Meanwhile, 2χlO5 U87MG cells were plated in a 12-well plate dish along with the medium. After culturing for 24 hours, the medium was removed, and 1.5 mL of each of the culture medium of the neural stem cells infected by the viruses was added to each well. Then, the apoptosis of the tumor cells was observed. As a result, the U87MG cells cocultured either with 0.75 mL of the medium of the HFT13 cells infected by AdCAG-TRAIL and with 0.75 mL of the medium of the HFT13 cells infected by AdCAG-GFP showed apoptosis pattern similar to when rhTRAIL was treated directly. Particularly, the U87MG cells cocultured with 0.75 mL the medium of the HFT13 cells infected by AdCAG-TRAIL and with 0.75 mL the medium of the HFT13 cells infected by AdCAG-TAT-SMAC exhibited faster apoptosis (see FIG. 15). In contrast, the U87MG cells cocultured with 0.75 mL the medium of the HFT13 cells infected by AdCAG-TAT- SMAC and with 75 mL the medium of the HFT13 cells infected by AdCAG-GFP, and the U87MG cells cocultured only with 1.5 mL the medium of the HFT13 cells infected by AdCAG-GFP did not exhibit apoptosis (see FIG. 15) . For quantitative analysis of the apoptosis, mitochondria mitochondrial dehydrogenase activity assay (Cell Counting Kit-8 [CCK-8 assay], Dojindo Laboratories, Tokyo, Japan) was carried out. 5χlO4 HFT13 cells were plated in a 96-well plate along with 100 μL of N2 medium including growth factor. 24 hours later, the media of the test and control groups were treated. 24 hours later, 10 μL of CCK-8 solution in which water-soluble tetrazolium salt and the electron carrier 1-methoxy PMS are diluted was added to each well. 2 hours later, absorbance was measured at 450 nm using a micro reader. The well treated only with the CCK-8 solution served as blank control, and the HFT13 cells to which no virus had been added was named as 100% cell survival group. Test was carried out 3 times and then averaged.
As a result, 49% or more of the U87MG cells cocultured with 0.75 mL the medium of the HFT13 cells infected by 130 MOI AdCAG-TRAIL and with 0.75 mL the medium of the HFT13 cells infected by AdCAG-GFP for 24 hours died. In contrast, 75% or more of the tumor cells died when the U87MG cells were cocultured with 0.75 mL the medium of the HFT13 cells infected by 130MOI AdCAG- TRAIL and with 0.75 mL the medium of the HFT13 cells infected by 100MOI AdCAG-TAT-SMAC for 24 hours. That is, more cells died when both the TRAIL and SMAC proteins were expressed. Meanwhile, only 1% or less of tumor cells died when the U87MG cells were cocultured only with 1.5 mL the medium of the HFT13 cells infected by AdCAG- GFP or cocultured with 0.75 mL the medium of the HFT13 cells infected by AdCAG-TAT-SMAC and with 0.75 mL the medium of the HFT13 cells infected by AdCAG-GFP (see FIG. 16) .
8-2. Analysis of apoptosis of human glioblastoma induced by human neural stem cells coinfected by TRAIL and SMAC expressing recombinant adenoviruses
In order to confirm whether the TRAIL and SMAC secreted from the human neural stem cells coinfected by AdCAG-TRAIL and AdCAG-TAT-SMAC recombinant viruses induce the apoptosis of human glioblastoma cells, the culture medium of the neural stem cells infected by the viruses was cocultured with the glioblastoma cell line.
HFT13 cells were plated in each well along with the medium as described above. One hour later, the cells were infected by directly adding the recombinant adenovirus particles of Example 8-1 to the medium of each well, alone or together. 24 hours later, the cells were washed with 3 mL of N2 medium and grown further in 5 mL of N2 medium including growth factor for 3 days. The culture medium was centrifuged at 1000 rpm for 3 minutes. Meanwhile, 2χlO5 U87MG cells were plated in a 12-well plate dish along with the medium. After culturing for 24 hours, the medium was removed, and 1.5 mL of each of the culture medium of the neural stem cells infected by the viruses was added to each well. Then, the apoptosis of the tumor cells was observed.
For quantitative analysis of the apoptosis, CCK-8 assay was carried out in the same manner as in Example 8- 1. As a result, 60% or more of the tumor cells died when the U87MG cells were cocultured with the medium of the HFT13 cells infected by 130 MOI AdCAG-TRAIL for 24 hours, 51% or more of the tumor cells died when the U87MG cells were cocultured with the medium of the HFT13 cells coinfected by 65 MOI AdCAG-TRAIL and 50 MOI AdCAG-TAT- SMAC, and 48% or more of the tumor cells died when the U87MG cells were cocultured with the medium of the HFT13 cells coinfected by 130 MOI AdCAG-TRAIL and 100 MOI AdCAG-TAT-SMAC. • In contrast, only 2% or less of tumor cells died when the U87MG cells were cocultured with the medium of the HFT13 cells infected by AdCAG-GFP or cocultured with the medium of the HFT13 cells infected by 100 MOI AdCAG-TAT-SMAC.
That is, the degree of apoptosis decreased when the human stem cells were coinfected by the TRAIL and SMAC expressing recombinant viruses than, as compared when they were infected by the TRAIL expressing recombinant virus only. This seems to be because the increase in the concentration of viruses results in poor growth of cells and decreased expression of TRAIL and SMAC, and, consequently, decreased apoptosis of tumor cells.
Example 9
Reduction of tumor size after transplantation of TRAIL expressing human neural stem cells in animal model of glioblastoma
For quantitative analysis of decrease of tumor size after transplantation of human neural stem cells that express TRAIL and SMAC by the CAG promoter, a brain tumor model was established as in Example 3-2, by transplanting U87MG cells in the right corpus striatum of athymic nude mouse at 7*104 cells/4 μL. 1 week later, neural stem cells were transplanted through the skull burr hole used for the transplantation of the tumor cells as follow. First, 3 days before the transplantation, human neural stem cells grown as neurospheres were plated in a culture plate as single cells by treating with 0.05% trypsin/EDTA
(Gibco) . 1 hour later, the neural stem cells were infected with the wanted virus. 24 hours later, the cells were washed once with N2 medium and grown further in N2 medium including growth factor for 2 more days. For transplantation, the cells were prepared into single cells by treating with 0.05% trypsin/EDTA (Gibco). Then, after washing 3 times with H-H buffer and staining with 0.05% Trypan blue, the cells were stored in ice until they were transplanted.
The neural stem cells transplanted in the brain tumor model were as follows. Human neural stem cells (5χlO5 cells/4 μL) infected by 50 MOI AdCAG-GFP and neural stem cells (5χlO5 cells/4 μL) infected by 130 MOI AdCAG- TRAIL were transplanted in combination (n = 7). In another test group, human neural stem cells (5*105 cells/4 μL) infected by 100 MOI AdCAG-TAT-SMAC and human neural stem cells (5><105 cells/4 μL) infected by 130 MOI AdCAG- TRAIL were transplanted in combination (n = 7) . In the control group, human neural stem cells (IxIO6 cells/8 μL) infected by 50 MOI AdCAG-GFP were transplanted (n = 7) .
10 days later, average tumor volume was measured for the test and control groups as follows. For quantitative evaluation of average tumor volume, all the slides holding the tumors of the test and control groups were stained with hematoxylin and tumor size was measured using MetaMorph Imaging System (Universal Imaging Corporation, PA, USA) .
10 days after the transplantation, the test animal was fixed with 4% paraformaldehyde (in 0. IM Pipes buffer) and the brain was picked out. The brain was immersed in 30% sucrose (in PBS) . After cryoprotection at 4 0C for 1-2 days, the brain was cryosected into 16 μm slices. The spacing between the brain tissue fragments on each slide was 96 μm. Then, the brain tissue was stored at - 20 °C before staining. After immersing the slide in IxPBS for 20 minutes, staining was performed for 4 minutes using hematoxylin solution. Subsequently, the slide was washed with flowing water and mounted with glycerol mounting medium. Following the staining, the image of the tumor mass was taken with a bright field microscope at xlOO. The region of the tumor mass determined using MetaMorph imaging system, and the area of the region was calculated by counting the number of pixels. The volume of the tumor mass was obtained by multiplying the area by the thickness of the tissue slice
(96 μm) . This procedure was performed for all the test and control groups, and average value was compared.
As a result, whereas the average tumor volume of the control group in the animal model of U87MG glioblastoma was 0.280 mm3, the average tumor volume of the test group to which TRAIL and GFP expressing neural stem cells had been transplanted was 0.066 mm3, and that of the test group to which TRAIL and SMAC expressing neural stem cells had been transplanted was 0.035 mm3. When the tumor volume of the control group was set as 100%, the tumor volume of the TRAIL and GFP expressing cells transplantation group was 23.55 ± 3.11% (mean± SEM) and that of the TRAIL and SMAC expressing cells transplantation group was 12.65 ± 0.71% (see FIG. 17) (*p < 0.01 as compared to the control group; **p < 0.05 between the test groups, Kruskal-Wallis test) . Accordingly, the transplantation of TRAIL and SMAC expressing human neural stem cells was more effective in reducing the brain tumor volume than the transplantation of TRAIL expressing neural stem cells alone (see FIG. 17) .
Industrial Applicability
As described, the SMAC secreting human neural stem cell of the invention which is transformed by a SMAC encoding nucleotide proliferates and grows on a plate in undifferentiated state, without inducing cytotoxicity, and is capable of differentiating into nerve cells such as neuron, oligodendrocyte and astrocyte in vivo and in vitro. Further, the neural stem cell of the present invention secretes SMAC in the human body and assists the action of TRAIL, thereby inducing apoptosis of tumor cells and reduction of tumor volume. Accordingly, the neural stem cell of the present invention can be effectively used for the treatment or prevention of tumors .

Claims

CLAIMS Claim 1
A human neural stem cell secreting SMAC which is transformed using a SMAC encoding nucleotide.
Claim 2
The neural stem cell according to claim 1, wherein the SMAC includes an amino acid sequence represented by SEQ ID NO 1.
Claim 3
The neural stem cell according to claim 1, wherein the transformation is mediated by a viral vector in which a SMAC-encoding nucleotide of SEQ ID NO 2 is inserted.
Claim 4
The neural stem cell according to claim 3, wherein the viral vector further includes a secretion signal sequence and a protein transduction domain.
Claim 5
The neural stem cell according to claim 3 or 4, wherein the viral vector is selected from the group consisting of retroviral vector, adenoviral vector, herpes viral vector, lentiviral vector and avipox viral vector. Claim 6
The neural stem cell according to claim 4, wherein the secretion signal sequence is an Igκ-chain leader.
Claim 7
The neural stem cell according to claim 4, wherein the protein transduction domain is a HIV-I (human immunodeficiency virus type 1) TAT.
Claim 8
The neural stem cell according to claim 3 or 4, wherein the viral vector includes a CAG promoter region.
Claim 9 The neural stem cell according to claim 3 or 4, wherein the viral vector has a cleavage map illustrated in FIG. βa.
Claim 10 A method for preparing the neural stem cell according to claim 1, comprising the steps of:
(a) preparing a recombinant viral vector including a DNA construct consisting of a secretion signal sequence, protein transduction domain and a SMAC encoding nucleotide in sequence;
(b) transfecting a virus producing cell line with the recombinant viral vector to prepare a SMAC expressing recombinant virus; and
(c) infecting a human neural stem cell with the SMAC expressing recombinant virus.
Claim 11
The method according to claim 10, wherein the secretion signal sequence is an Igκ-chain leader.
Claim 12 The method according to claim 10, wherein the protein transduction domain is HIV-I (human immunodeficiency virus type 1) TAT.
Claim 13 The method according to claim 10, wherein the SMAC includes an amino acid sequence represented by SEQ ID NO
1.
Claim 14 The method according to claim 10, wherein the viral vector is selected from the group consisting of retroviral vector, adenoviral vector, herpes viral vector, lentiviral vector and avipox viral vector.
Claim 15
The method according to claim 10, wherein the viral vector includes a CAG promoter region. Claim 16
The method according to claim 10, wherein the recombinant viral vector has a cleavage map illustrated in FIG. βa.
Claim 17
The method according to claim 10, wherein the human neural stem cell is prepared by culturing a cell obtained from the brain tissue of a human fetus in a medium including a neural stem cell growth factor.
Claim 18
The method according to claim 17, wherein the neural stem cell growth factor includes bFGF (fibroblast growth factor-basic) , LIF (leukemia inhibitory factor) and heparin.
Claim 19 A pharmaceutical composition for treating a tumor which includes the neural stem cell according to claim 1 and a TRAIL secreting human neural stem cell.
Claim 20 The pharmaceutical composition according to claim 19, wherein the tumor is selected from the group consisting of glioma, meningioma, pituitary adenoma, medulloblastoma, metastatic brain tumor, acoustic neuroma, prostatic cancer, malignant melanoma and neuroblastoma.
Claim 21
A method for treating a tumor which comprises administering the neural stem cell according to claim 1 and a TRAIL secreting human neural stem cell to a subject in need thereof an effective amount.
Claim 22
A use of the neural stem cell according to claim 1 and a TRAIL secreting human neural stem cell for a medicament of treatment for a tumor.
PCT/KR2007/001577 2007-03-30 2007-03-30 Human neural stem cell secreting a smac, preparation method and use thereof WO2008120832A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/KR2007/001577 WO2008120832A1 (en) 2007-03-30 2007-03-30 Human neural stem cell secreting a smac, preparation method and use thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/KR2007/001577 WO2008120832A1 (en) 2007-03-30 2007-03-30 Human neural stem cell secreting a smac, preparation method and use thereof

Publications (1)

Publication Number Publication Date
WO2008120832A1 true WO2008120832A1 (en) 2008-10-09

Family

ID=39808410

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2007/001577 WO2008120832A1 (en) 2007-03-30 2007-03-30 Human neural stem cell secreting a smac, preparation method and use thereof

Country Status (1)

Country Link
WO (1) WO2008120832A1 (en)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010105068A1 (en) * 2009-03-13 2010-09-16 The Trustees Of The University Of Pennsylvania Ox40/trail fusion proteins
CN104622903A (en) * 2015-01-20 2015-05-20 奥思达干细胞有限公司 Stem cell preparation for resisting malignant melanoma and preparation method of stem cell preparation
CN105062972A (en) * 2015-07-28 2015-11-18 浙江奥瑞健生物技术有限公司 Neural stem cells medium and method for performing human neural stem cells in-vitro long-term culture and amplification by using neural stem cells medium
US11007251B2 (en) 2015-12-17 2021-05-18 The Johns Hopkins University Ameliorating systemic sclerosis with death receptor agonists
CN113151158A (en) * 2021-05-19 2021-07-23 杭州憶盛医疗科技有限公司 Tissue stem cell separation and function evaluation system
US11084879B2 (en) 2016-04-07 2021-08-10 The Johns Hopkins University Compositions and methods for treating pancreatitis and pain with death receptor agonists
US11299528B2 (en) 2014-03-11 2022-04-12 D&D Pharmatech Inc. Long acting TRAIL receptor agonists for treatment of autoimmune diseases
CN115003156A (en) * 2019-11-20 2022-09-02 住友制药株式会社 Method for freezing cell aggregates

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [online] 26 July 2000 (2000-07-26), DU C. ET AL.: "Smac [Homo sapiens]", accession no. NCBI Database accession no. (AAF87716) *
DATABASE GENBANK 26 July 2000 (2000-07-26), DU C. ET AL.: "Homo sapiens Smac mRNA, complete cds: nuclear gene for mitochondrial product" *
EUM W.S. ET AL.: "HIV-1 Tat-mediated protein transduction of Cu,Zn-superoxide dismutase into pancreatic beta cells in vitro and in vivo", FREE RADIC BIOL. MED., vol. 37, no. 3, 1 August 2004 (2004-08-01), pages 339 - 349 *
PEI Z. ET AL.: "An oncolytic adenoviral vector of Smac increases antitumor activity of TRAIL against HCC in human cells and in mice", HEPATOLOGY, vol. 39, no. 5, May 2004 (2004-05-01), pages 1371 - 1381 *
TARASENKO Y.I. ET AL.: "Effect of growth factors on proliferation and phenotypic differentiation of human fetal neural stem cells", J. NEUROSCI. RES., vol. 78, no. 5, 1 December 2004 (2004-12-01), pages 625 - 636 *
YOSHIMURA K. ET AL.: "Successful immunogene therapy using colon cancer cells (colon 26) transfected with plasmid vector containing mature interleukin-18 cDNA and the Igkappa leader sequence", CANCER GENE THER., vol. 8, no. 1, January 2001 (2001-01-01), pages 9 - 16 *

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010105068A1 (en) * 2009-03-13 2010-09-16 The Trustees Of The University Of Pennsylvania Ox40/trail fusion proteins
US9221895B2 (en) 2009-03-13 2015-12-29 The Trustees Of The University Of Pennsylvania OX40/TRAIL fusion proteins
US11299528B2 (en) 2014-03-11 2022-04-12 D&D Pharmatech Inc. Long acting TRAIL receptor agonists for treatment of autoimmune diseases
CN104622903A (en) * 2015-01-20 2015-05-20 奥思达干细胞有限公司 Stem cell preparation for resisting malignant melanoma and preparation method of stem cell preparation
CN104622903B (en) * 2015-01-20 2018-10-09 奥思达干细胞有限公司 The stem cell medicine and preparation method thereof of anti-malignant mela noma
CN105062972A (en) * 2015-07-28 2015-11-18 浙江奥瑞健生物技术有限公司 Neural stem cells medium and method for performing human neural stem cells in-vitro long-term culture and amplification by using neural stem cells medium
CN105062972B (en) * 2015-07-28 2019-04-19 浙江奥瑞健生物技术有限公司 A kind of nerve stem cell culture medium and the human nerve stem cell longterm culture in vitro amplification method using its progress
US11007251B2 (en) 2015-12-17 2021-05-18 The Johns Hopkins University Ameliorating systemic sclerosis with death receptor agonists
US11084879B2 (en) 2016-04-07 2021-08-10 The Johns Hopkins University Compositions and methods for treating pancreatitis and pain with death receptor agonists
CN115003156A (en) * 2019-11-20 2022-09-02 住友制药株式会社 Method for freezing cell aggregates
CN113151158A (en) * 2021-05-19 2021-07-23 杭州憶盛医疗科技有限公司 Tissue stem cell separation and function evaluation system

Similar Documents

Publication Publication Date Title
KR101220516B1 (en) Human Adult Stem Cells Secreting Anti-MDM2 and Uses thereof
WO2008120832A1 (en) Human neural stem cell secreting a smac, preparation method and use thereof
US9029142B2 (en) Recombinant vectors and hosts comprising human glucokinase encoding gene
CN108441505B (en) Chimeric antigen receptor targeting ROR1 and application thereof
KR20110105399A (en) Feeder cell for target cell induction
JP2012524727A (en) Compositions and methods for modulating stem cells and uses thereof
US20200190535A1 (en) Adult stem cell line introduced with hepatocyte growth factor gene and neurogenic transcription factor gene with basic helix-loop-helix motif and uses thereof
US20040086494A1 (en) Immune privileged cells for delivery of proteins and peptides
US8895303B2 (en) Method of cell culture and method of treatment comprising a vEPO protein variant
CN108707619B (en) Chimeric antigen receptor targeting ROR1 and application thereof
CN110714018B (en) Chimeric antigen receptor targeting EGFRVIII and application thereof
KR101698984B1 (en) Composition for inducing dedifferentiation for induced pluripotent stem cells with Reptin and method for inducing induced pluripotent stem cells using the same
CA2558436A1 (en) Method of proliferating precursor cells
KR100814066B1 (en) Human neural stem cell secreting a TRAIL preparation method and use thereof
KR101269125B1 (en) Method for Proliferating Stem Cells Using Genes Activating Notch Signaling
EP1783210A1 (en) Productivity augmenting protein factors, novel cell lines and uses thereof
KR100808269B1 (en) Adenoviral recombinant shuttle vector comprising CAG promoter
KR20090056968A (en) Human neural stem cell secreting a smac, preparation method and use thereof
CN110564749B (en) Chimeric antigen receptor targeting EGFR and uses thereof
JP2004510741A (en) Induction of angiogenesis by administration of a polynucleotide encoding sphingosine kinase.
US20020031493A1 (en) Recombinant adenoviruses coding for glial-derived cell neurotrophic factor (gdnf)
EP4074329A1 (en) Induction of proliferous pancreatic islet precursor cell-like cells by transient expression of mycl and induction of differentiation into insulin-positive cells
US7795032B2 (en) Methods for proliferating cardiomyocytes and recombinant vectors therefor
CN116083367A (en) Method for preparing induced liver parenchymal cells and application thereof
JP2003250579A (en) Cell-specific expression replication vector

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07745740

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 1020097002273

Country of ref document: KR

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 07745740

Country of ref document: EP

Kind code of ref document: A1