KR100814066B1 - Human neural stem cell secreting a TRAIL preparation method and use thereof - Google Patents

Abstract

The present invention relates to human neural stem cells secreting TRAIL, a method and a use thereof, and more particularly to human neural stem cells secreting TRAIL, transformed with a nucleic acid encoding TRAIL, a method and use thereof It is about. The neural stem cells of the present invention proliferate and grow in undifferentiated state on a plate without inducing cytotoxicity, and have the ability to differentiate into neural cells such as neuronal cells, oligodendrocytes and astrocytic cells in and outside the body. In addition, the neural stem cells of the present invention secrete TRAIL in human in vivo to induce apoptosis of tumor cells and induce a decrease in tumor volume. Therefore, the neural stem cells of the present invention can be usefully used for the treatment or prevention of tumors.

Neural stem cells, TRAIL, tumor

Description

Human neural stem cell secreting a TRAIL, preparation method and use etc.

Figure 1 is a result of observing the growth and growth form of human neural stem cells derived from various brain tissues under a microscope.

HFT13: Brain Stem-derived Neural Stem Cells

HFD13: neural stem cells derived from hepatic brain

HFM13: mesenchymal stem cells

HFC13: Neural Stem Cells from Cerebellum

Figure 2 is a graph comparing the growth curve of human neural stem cells derived from various brain tissues.

Figure 3 is a result of observing the differentiation pattern of human neural stem cells isolated in the present invention using various markers under a microscope.

Figure 4 shows the results of tumor formation in hematoxylin and CM-DiI staining in human glioblastoma animal model prepared by transplanting U87MG or U343MG cells.

FIG. 5 shows a schematic diagram (A) of some DNA constructs in TRAIL or GFP expressing recombinant adenovirus vectors and PCR results (B) examining contamination of wild-type adenoviruses from recombinant adenoviruses produced from the vectors.

M: size marker

lane 1: voice control

lane 2: 293A (positive control)

lane 3: AdCMV-GFP

lane 4: AdCMV-TRAIL

lane 5: AdCAG-GFP

lane 6: AdCAG-TRAIL-noGFP

lane 7: AdCAG-TRAIL

lane 8: AdCMV-GFP

lane 9: AdCMV-TRAIL

lane 10: AdCAG-GFP

lane 11: AdCAG-TRAIL-noGFP

lane 12: AdCAG-TRAIL

6A to 6E show cleavage maps of the recombinant adenovirus vectors used in the present invention.

7A to 7B illustrate the fabrication process of pShuttle-CAG and pShuttle-CAG-IRES-hrGFP vectors according to the present invention.

8 is a graph (A) showing the results of measuring the amount of TRAIL secreted from human neural stem cells (hNSCs) infected with TRAIL or GFP expressing recombinant virus (AdCMV-TRAIL or AdCMV-GFP) expressed by CMV or CAG; Immunohistochemical analysis of the expression of TRAIL in the human neural stem cells (B).

9 shows the results of microscopic observation of the growth patterns of human neural stem cells treated with recombinant human TRAIL (rhTRAIL) at different concentrations (A) and the viability of human neural stem cells by recombinant human TRAIL treatment ( B).

10A to 10B show microscopic observations of growth patterns of human neural stem cells (hNSCs) infected with TRAIL or GFP expressing recombinant virus (AdCMV-GFP or AdCMV-TRAIL, AdCAG-GFP or AdCAG-TRAIL) (A) and Survival of human neural stem cells by the infection of the recombinant virus was examined by CCK-8 assay (B, C).

11A-11B show human glioblastoma cell lines co-cultured with conditioned media from hNSCs infected with TRAIL or GFP expressing recombinant virus (AdCMV-GFP or AdCMV-TRAIL, AdCAG-GFP or AdCAG-TRAIL). U87MG and U343MG) were observed under the microscope (A) and the survival of the human glioblastoma cell line by coculture with the culture medium of the human neural stem cells (B, C).

12 shows human glioblastoma cell line (U87MG) co-cultured with culture media of human neural stem cell cultures or human neural stem cells untreated with TRAIL or GFP expressing recombinant virus (AdCMV-TRAIL or AdCMV-GFP), and recombinant human TRAIL The human glioblastoma cell line (U87MG), which was directly treated, was observed by TUNEL staining.

Figure 13 shows the results of grafting, migration and distribution of donor cells in vivo after transplanting human neural stem cells infected with TRAIL expressing recombinant virus (AdCMV-TRAIL) into a glioblastoma animal model.

A and D: primary glioblastoma (red, arrow) stained with CM-DiI formed in the nude right mouse striatum

B and E: engraftment and distribution of transplanted TRAIL-expressing human neural stem cells (green, arrow) that specifically migrate and infiltrate the tumor border and penetrate into the tumor

C: composite of A and B photos

F: Collage of D and E Photos

G: Secondary glioblastoma (red, arrowhead) metastasized to the immediate periphery of primary glioblastoma (red, arrow) stained with CM-DiI formed in the nude right striatum

H: The engraftment and distribution of the transplanted TRAIL-expressing human neural stem cells (green), which specifically migrate to the site of secondary glioma, surrounding the border of the tumor and penetrate into the tumor (arrowhead)

I: Synthesis of G and H Photos

J: Secondary glioblastoma (red, arrowhead) that has spread far to the periphery of the third ventricle (V3) away from the site of primary glioblastoma

K: The engraftment and distribution of the transplanted TRAIL-expressing human neural stem cells (green), which specifically migrate to the site of secondary glioma, surrounding the border of the tumor and penetrate into the tumor (arrowhead)

L: Collage of J and K Photos

Figure 14 is the result of observing the differentiation form of TRAIL expressing human neural stem cells transplanted into a glioblastoma animal model.

A, E and I: Transplanted TRAIL expressing human neural stem cells (green, arrow) show engraftment by specific migration to glioblastoma site

B, F and J: Graft cells express immature neural stem cell marker human nestin (hNestin (blue)), astrocyte marker GFAP (blue) and mature neuronal cell marker NeuN (blue), respectively

C, G, and K: Synthesis of A and B photos, E and F photos, and I and K photos, respectively

D, H and L: Synthesized C, G, and K images, respectively, under the Texas Red filter of a fluorescence microscope at the same location, with red representing tumor cells of glioblastoma

15 is a result of observing the death of tumor cells after transplanting human neural stem cells infected with TRAIL expressing recombinant virus (AdCMV-TRAIL) into a glioblastoma animal model.

A: Primary human glioblastoma (red) stained with CM-DiI formed in the right striatum of nude mice

B: TRAIL-expressing human neural stem cells (green) transplanted into a glioblastoma animal model specifically migrated, engrafted and distributed around the glioblastoma border and penetrated into the tumor.

C: composite of A and B photos

D: Primary human glioblastoma (red) stained with CM-DiI, formed on the right striatum of nude mice

E: Increased expression of TRAIL at the site of glioblastoma (green)

F: Collage of D and E Photos

G: TUNEL staining at the same site as D photo shows the death of tumor cells (brown) and the empty space (white) due to the death of tumor cells (100-fold magnification).

H: Magnification of G picture (200x magnification), well observed tumor cell death (brown color) and empty space (white color)

I: Magnification of the area pointed by the arrowheads in D-F photographs (400-fold magnification). Apoptosis (brown, arrowheads) is also observed at the migration site of tumor cells.

Figure 16 shows the control group (U87MG + vehicle; DE to reduce the tumor size in the glioblastoma animal model (U87MG + hNSCs-AdCMV-TRAIL; AC) transplanted with human neural stem cells infected with TRAIL expressing recombinant virus (AdCMV-TRAIL) ), And the result observed.

The present invention relates to human neural stem cells secreting TRAIL, a method and a use thereof, and more particularly to human neural stem cells secreting TRAIL, transformed with a nucleic acid encoding TRAIL, a method and use thereof It is about.

Neural stem cells are primordial cells that exist mainly in the nervous system, show self-renew, which continue to proliferate in an immature and undifferentiated state, and multipotency of differentiation to differentiate into neurons and glia. Is defined as a cell. Neural stem cells exist in various anatomical regions throughout the fetal nervous system of mammals, including humans. Recently, neural stem cells exist not only in the fetus but also in the adult nervous system. Throughout life, neural stem cells continue to proliferate in specific areas of the brain. Creating new neurons. In addition, it has been reported that neural stem cells have a plasticity of differentiation that can be differentiated not only into neurons but also into various other types of cells or tissues. Therefore, in addition to the recent research on the proliferation, differentiation mechanism and development of the nervous system of stem cells using such neural stem cells, new cells using the biological characteristics of neural stem cells in intractable tumors, especially neurological diseases, which are known to not regenerate once damaged. And the possibility of gene therapy is increasing.

At present, numerous new therapeutic drugs, proteins and neurotrophic factors for neurological diseases have been searched, and various treatments have been actively developed through evaluation of therapeutic effects and neuroprotective effects in vivo and outside, but there are still few visible results. Indeed, there is no specific treatment to protect and regenerate clinically damaged nerve tissue. On the other hand, for the treatment of intractable nervous system diseases, the development of 'small molecules' such as the therapeutic drug and neurotrophic factors is not sufficient, and cell therapy that induces nerve regeneration by replacing neurons that have already died or show dysfunction It is essential. Therefore, with the recent development of stem cell science, it is possible to overcome the problems of safety and efficiency of conventional gene therapy, and to limit the limitation of primary fetal tissue or cell use, and to provide new cell and gene therapy for human body. Research and therapeutic applications are emerging.

However, current neural stem cell research is still in the early stages of the world, so a lot of basic research is required and various problems must be solved for actual clinical application. In particular, the transplantation of neural stem cells into living organisms requires the identification of donor cells engraftment, migration, differentiation, external gene expression and integration into the host nervous system. It should be ascertained that improvements are made.

On the other hand, TRAIL (Tumor necrosis factor-related apoptosis-inducing ligand) is one of the tumor necrosis factor protein superfamily, which causes apoptosis in various tumor cells but has no toxic effect in normal cells. (Sheridan et al ., Science, 277: 818, 1997; Ashkenazi et al ., J. Clin . Investig ., 104: 155, 1997; Walczak et al. , Nat Med ., 5: 157, 1999). However, the tumor treatment method using TRAIL developed so far has revealed that TRAIL has a tumor decay effect, and there are many problems in clinical application. When TRAIL is administered, a therapeutically inappropriate concentration is supplied, which may cause toxic effects of normal cells due to overdose. In addition, water-soluble TRAIL protein disappears after about 5 hours in the body and shows an extremely short time of action (Walczak et al ., Nat. Med ., 5: 157, 1999). As well as lethal immunorejection when adenoviruses are administered (Dewey et al ., Nat. Med ., 5: 1256, 1999). In particular, effective targeting cannot be expected for secondary and metastatic tumors, and clinically significant therapeutic effects cannot be expected.

Accordingly, the present inventors have repeatedly studied to effectively treat tumors by using TRAIL, and manufactured by genetically manipulating human neural stem cells that secrete TRAIL, and confirmed that the neural stem cells were very effective in treating tumors. The invention has been completed.

Accordingly, it is an object of the present invention to provide human neural stem cells that secrete TRAIL, a method of producing and use thereof.

In order to achieve the above object, the present invention provides a human neural stem cell secreting TRAIL, transformed with a nucleic acid encoding TRAIL.

In order to achieve another object of the present invention, the present invention provides a method for producing the neural stem cells.

In order to achieve another object of the present invention, the present invention provides a composition for treating tumors containing the neural stem cells.

Hereinafter, the present invention will be described in detail.

The present invention is characterized in that it provides for the first time a human neural stem cell genetically engineered to secrete TRAIL, a tumor cell death inducing substance.

Human neural stem cells provided in the present invention may be preferably derived from the brain of a human fetus. The brain may be any one selected from the group consisting of cerebellum, hepatic brain, midbrain, cerebellum, soft water, pontoon and spinal cord, preferably may be derived from the brain. Human neural stem cells secreting TRAIL according to the present invention do not exhibit cytotoxicity and continue to proliferate and grow undifferentiated on plates (FIGS. 1 and 2). In addition, the neural stem cells of the present invention express the neural stem cell markers, such as the nestin (nestin) or non-mentin (vimentin) in more than 99% of cells, and can differentiate into neurons, such as neuronal cells, oligodendrocytes and astrocytes Have the capability (FIG. 3). Human neural stem cells secreting TRAIL according to the present invention induce apoptosis of tumor cells when co-cultured with tumor cells (FIGS. 11 and 12). In addition, when the neural stem cells of the present invention are transplanted into a tumor animal model (e.g., a human glioblastoma brain tumor animal model), they are engrafted and distributed in a manner of specifically enclosing the boundary of the primary mass in vivo and infiltrating into the mass. It specifically migrates along tumor cells that metastasize to surrounding nerve tissue and engrafts and distributes to secondary masses (FIGS. 13 and 14). In addition, some of the neural stem cells of the present invention can differentiate into neurons or glial cells in the transplanted tumor site to replace and regenerate nerve cells damaged by the tumor (FIG. 14). In particular, the neural stem cells of the present invention secrete TRAIL in vivo to induce apoptosis of surrounding tumor cells (FIG. 15), thus inducing a decrease in tumor volume (FIG. 16). On the other hand, it does not cause any special damage to normal brain tissue.

Neural stem cells of the present invention having such characteristics can be prepared by transforming human neural stem cells with a nucleic acid encoding TRAIL. Transformation of human neural stem cells with nucleic acids encoding TRAIL refers to the introduction of nucleic acids encoding TRAIL into human neural stem cells. Human neural stem cells secreting TRAIL according to the present invention may comprise the following steps:

(a) inserting a nucleic acid encoding TRAIL into an expression vector; And

(b) introducing the expression vector into human neural stem cells.

The nucleic acid encoding TRAIL may be used without limitation as long as it has a nucleotide sequence encoding TRAIL known in the art. Preferably it may have a base sequence encoding TRAIL comprising the amino acid sequence represented by SEQ ID NO: 1. More preferably, the nucleic acid may have a nucleotide sequence encoding a polypeptide consisting of an amino acid sequence represented by SEQ ID NO: 1, and most preferably may have a nucleotide sequence represented by SEQ ID NO: 2. In addition, the nucleic acid may have a nucleotide sequence encoding TRAIL having an amino acid sequence represented by SEQ ID NO: 3. In addition, the nucleic acid may have a nucleotide sequence disclosed in GenBank Accession Nos. NM_003810, BC020220, BC032722, CR456895, AY408450, and U37518, but is not limited thereto.

In addition, the nucleic acid may have a nucleotide sequence encoding a functional equivalent of TRAIL. The term 'functional equivalent' means at least 70%, preferably 80%, more preferably 90% or more of TRAIL comprising the amino acid sequence represented by SEQ ID NO: 1 as a result of the addition, substitution, or deletion of an amino acid. It refers to a polypeptide having homology and having substantially the same physiological activity as TRAIL of the present invention. Here, "substantially homogeneous physiological activity" means activity that induces the death of tumor cells. The functional equivalent includes, for example, an amino acid sequence variant in which some of the amino acids of TRAIL including the amino acid sequence represented by SEQ ID NO: 1 are substituted, deleted or added. Substitutions of amino acids are preferably conservative substitutions. Examples of conservative substitutions of amino acids present in nature are as follows; Aliphatic amino acids (Gly, Ala, Pro), hydrophobic amino acids (Ile, Leu, Val), aromatic amino acids (Phe, Tyr, Trp), acidic amino acids (Asp, Glu), basic amino acids (His, Lys, Arg, Gln, Asn ) And sulfur-containing amino acids (Cys, Met). Deletion of amino acids is preferably located in portions not directly involved in the catalytic activity of TRAIL of the present invention. The functional equivalent of TRAIL also includes polypeptide derivatives in which some chemical structures of the polypeptide have been modified while maintaining the basic skeleton of TRAIL and its physiological activity. For example, this includes structural modifications for altering the stability, shelf life, volatility or solubility of the polypeptide of the present invention. In addition, nucleic acids encoding the TRAIL can be prepared by genetic recombination methods known in the art (Sambrook, Fritsch and Maniatis, 'Molecular Cloning, A laboratory Manual, Cold Spring Harbor laboratory press, 1989; Short Protocols in Molecular Biology , John Wiley and Sons, 1992). For example, there are techniques for producing PCR amplification, chemical synthesis or cDNA sequences to amplify nucleic acids from the genome.

The nucleic acid encoding the TRAIL can be operably linked to an expression control sequence and inserted into the expression vector. 'Operably linked' as used herein means that one nucleic acid fragment is combined with another nucleic acid fragment so that its function or expression is affected by another nucleic acid fragment. In addition, "expression control sequence" refers to a DNA sequence that controls the expression of a nucleic acid sequence operably linked in a particular host cell. Such regulatory sequences include promoters for initiating transcription, any operator sequence for regulating transcription, sequences encoding suitable mRNA ribosomal binding sites, and sequences that control termination of transcription and translation. The promoter may be a promoter (constitutive promoter) to induce the expression of the gene of interest at all times at all times, for example, CMV promoter, CAG promoter (Hitoshi Niwa et al., Gene, 108: 193-199, 1991; Monahan et al., Gene Therapy, 7: 24-30, 2000 ) , CaMV 35S promoter (Odell et al ., Nature 313: 810-812, 1985), Rsyn7 promoter (US patent application Ser. No. 08 / 991,601) Rice actin promoter (McElroy et al ., Plant Cell 2: 163-171, 1990), ubiquitin promoter (Christensen et al ., Plant Mol. Biol. 12: 619-632, 1989), ALS promoter ( US patent application Ser. No. 08 / 409,297. In addition, U.S. Patents 5,608,149; The promoters disclosed in 5,608,144 5,604,121 5,569,597 5,466,785, 5,399,680 5,268,463, 5,608,142, and the like can all be used. Preferably, a promoter that can induce the expression of a gene of interest in vivo can be used.

Among them, the CAG promoter is a modified CMV promoter, cytomegalovirus immediate-early enhancer, chicken β-actin promoter, chimeric intron, exon 1 (exon 1) and exon 2 of the rabbit β-globin gene (Hitoshi Niwa et al., Gene, 108: 193-199, 1991; Monahan et al. , Gene Therapy, 7: 24-30, 2000). Since the CAG promoter of such a known configuration and sequence was not suitable for the production of adenoviruses, the present inventors modified it to be suitable for the production of adenoviruses.

In detail, the CAG promoter used in the present invention was inserted into a commercial vector pShuttle vector through the following process. Cytomegalovirus immediate-early enhancer, chicken β-actin promoter, and rabbit β-globin terminator from the commercial vector TriEX-1.1 Neo DNA vector ) Were cloned and inserted into the commercial vector pShuttle vector, respectively, to prepare a vector having a CAG promoter modified to be suitable for adenovirus production (see FIG. 7A).

IRES and hrGFP were additionally cloned from the commercial vector pShuttle-IRES-hrGFP-1 vector to further have a CAG promoter, and a vector expressing GFP was further prepared (see FIG. 7B).

TRAIL is generally a transmembrane protein with receptor binding domains extending out of the cell membrane, and soluble TRAIL containing receptor-binding domains has been found to be homotrimers (Cha et al., Immunity , 11: 253). -261, 1999; Hymowitz et al., Mol Cell , 4: 563-571, 1999; Hymowitz et al., Biochemistry, 39: 633-640, 2000). This homologous triplex structure is essential for TRAIL to cause cell death. Therefore, in order to facilitate trimerization of TRAIL, it is desirable to link the leucine zipper or the isoleucine zipper (ILZ) domain upstream of the nucleic acid encoding TRAIL. . It is known to cause the trimerization of TRAIL very effectively despite its small size (Harbury et al., Nature 371: 80-83, 1994). The leucine or isoleucine zipper domain can be used without limitation so long as it is known in the art. Preferably, an isoleucine zipper domain having an amino acid sequence represented by SEQ ID NO: 4 can be used.

In addition, since TRAIL is a cytokine that is active by binding to cell surface receptors of tumor cells, it is preferable to connect a secretion signal sequence to a nucleotide encoding TRAIL. At this time, the secretory signal sequence is preferably linked upstream of the leucine zipper or isoleucine zipper domain. The secretory signal sequence is an Igκ- chain leader, a secretory signal sequence of seminal RNase, SEC2 sequence (N-terminal 28 amino acids of human fibrillin-1), FIB sequence (nucleotides 208-303 derived from rat fibronectin mRNA sequence) or a signal peptide of FGF-4, but is not limited thereto. Preferably an Igκ- chain leader. The Igκ- chain leader may preferably have a nucleotide sequence represented by SEQ ID NO: 5.

TRAIL secreted out of cells is known to induce apoptosis more effectively when cleaved (Kim et al., Biochem . Biophys . Res. Commun ., 321: 930-935, 2004). It is desirable to have a signal cleavage site therein or have a property that is cleaved when secreted out of the cell without having a special signal cleavage site. The Igκ- chain leader in the secretion signal sequence is truncated between the last 20 and 21st amino acids when secreted out of the cell even without a special signal cleavage sequence. That is, the 5'-atg gag aca gac aca ctc ctg cta tgg gta ctg ctg ctc tgg gtt cca ggt tcc act ggt gac-3 'sequence (SEQ ID NO: 5) is cut between the last ggt and gac-3'.

As described above, DNA constructs in which secretory signal sequences, leucine or isoleucine zippers, and nucleic acids encoding TRAIL are sequentially connected are known in the art including PCR amplification, cleavage of DNA using restriction enzymes, ligation, and transformation. It can be prepared by a known general cloning method (Example <4-1>). A schematic diagram of the DNA construct is shown in FIG. 5A.

In addition, in the present invention, the expression vector refers to a plasmid, viral vector or other medium known in the art that can insert a nucleic acid encoding TRAIL and can express the nucleic acid in a host cell. Preferably it may be a viral vector.

As the plasmid, mammalian expression plasmids known in the art may be used. For example, but not limited to, pRK5 (European Patent No. 307,247), pSV16B (International Patent Publication No. 91/08291), pVL1392 (PharMingen), and the like are representative. Nucleic acid delivery method using such a plasmid vector is a method for delivering plasmid DNA directly to human cells, which can be used by a person approved by the FDA (Nabel, EG, et al ., Science , 249: 1285-1288, 1990). Plasmid DNA has the advantage that it can be homogeneously purified unlike viral vectors.

In addition, the viral vectors include, but are not limited to, retrovirus vectors, adenovirus vectors, herpes virus vectors, abipoxvirus vectors, lentivirus vectors, and the like. The retroviral vector is constructed such that all of the viral genes have been removed or altered so that non-viral proteins are made in the cell infected by the viral vector. The main advantages of retroviral vectors for gene therapy are to deliver large quantities of genes in cloned cells, to correctly integrate genes transferred into cellular DNA, and to not cause subsequent infections after gene transfection (Miller, AD, Nature). , 357: 455-460, 1992). FDA-certified retroviral vectors were prepared using PA317 ampotropic retrovirus package cells (Miller, AD and Buttimore, C., Molec . Cell Biol . , 6: 2895-2902, 1986). Non-retroviral vectors include adenoviruses as mentioned above (Rosenfeld et al ., Cell , 68: 143-155, 1992; Jaffe et al ., Nature Genetics , 1: 372-378, 1992; Lemarchand et al ., Proc . Natl . Acad . Sci . USA , 89: 6482-6486, 1992). The main advantage of adenoviruses is that they carry large amounts of DNA fragments (36 kb genomes) and have the ability to infect non-replicating cells with very high titers. Herpes viruses can also be usefully used for human gene therapy (Wolfe, JH, et al ., Nature Genetics , 1: 379-384, 1992). In addition, suitable known viral vectors can be used in the present invention. Preferably it can be inserted into an adenovirus vector.

Expression vectors comprising nucleic acids according to the invention are methods known in the art, such as, but not limited to, transient transfection, microinjection, transduction, cell fusion, calcium phosphate precipitation Methods, liposome-mediated transfection, DEAE Dextran-mediated transfection, polybrene-mediated transfection, electroporation ), Gene guns and other known methods for introducing nucleic acids into cells can be introduced into neural stem cells (Wu et al ., J. Bio. Chem ., 267: 963-967, 1992; Wu and Wu, J. Bio. Chem . , 263: 14621-14624, 1988).

More preferably, human neural stem cells secreting TRAIL according to the present invention can be prepared by a manufacturing method comprising the following steps.

(a) preparing a recombinant viral vector comprising a DNA construct sequentially linked with a secretory signal sequence, a leucine or isoleucine zipper and a nucleic acid encoding TRAIL; And

(b) transfecting said recombinant viral vector with a virus producing cell line to produce a TRAIL expressing recombinant virus; And

(c) infecting human neural stem cells with the TRAIL expressing recombinant virus.

First, a recombinant viral vector is prepared by inserting into the viral vector a DNA construct in which a secretory signal sequence, a leucine or isoleucine zipper and a nucleic acid encoding TRAIL are sequentially linked. The DNA constructs to which the secretory signal sequence, the leucine or isoleucine zipper and the nucleic acid encoding TRAIL are sequentially linked are as described above. The DNA construct may be operably linked to expression control sequences, such as promoters, and inserted into viral vectors known in the art.

Then, a recombinant virus vector containing a nucleic acid encoding TRAIL is introduced into a virus producing cell line to produce a recombinant virus expressing TRAIL. The virus producing cell line may be a cell line producing a virus corresponding to the used viral vector. For example, when an adenovirus vector is used, 293 cells, which are adenovirus producing cell lines, may be used.

Then, a recombinant adenovirus vector expressing TRAIL is infected with human neural stem cells. In addition, the neural stem cells may be preferably derived from the brain of a human fetus. The brain may be any one selected from the group consisting of cerebellum, hepatic brain, midbrain, cerebellum, soft water, pontoon and spinal cord, preferably may be derived from the brain. The human neural stem cells may be purchased and used commercially, preferably cells obtained from the brain tissue of the human fetus may be prepared by culturing in a medium to which the neural stem cell growth factor is added (Example 1). The neural stem cell growth factor may use bFGF (fibroblast growth factor-basic), LIF (leukemia inhibitory factor) and heparin (heparin). Preferably 20 ng / ml bFGF, 10 ng / ml LIF and 8 μg / ml heparin can be used.

Human neural stem cells secreting TRAIL according to the present invention can be proliferated and cultured according to methods known in the art. The neural stem cells of the present invention are cultured in a culture medium that supports the survival or proliferation of the desired cell type. It is often desirable to use cultures that supply nutrition with free amino acids instead of serum. It is desirable to supplement the culture with an additive developed for the continuous culture of neurons. For example, there are N2 and B27 additives commercially available from Gibco. It is preferable to replace the medium while observing the state of the medium and the cells during the culture. In addition, if the neural stem cells continue to proliferate and unite with each other to form neurospheres (neurospheres) it is preferable to perform subculture. Passage can be done approximately every 7-8 days.

Preferred culturing methods of neural stem cells according to the present invention are as follows: N2 or B27 additive (Gibco), neural stem cell proliferation-producing cytoplasm in a specific medium (eg, DMEM / F-12 or Neurobasal medium) whose composition is known Add caine (e.g. bFGF, EGF, LIF, etc.) and heparin. Generally no serum is added. Neural stem cells are proliferated and cultured in the form of neurospheres in the medium. Change the half of the medium to a new one every 3-4 days. As the cell count increases, cells are dissociated every 7-8 days using mechanical methods or trypsin (0.05% trypsin / EDTA, Gibco). The cell suspension is then plated in new plates and subsequently grown in culture in the medium of this composition (Gage et al. PNAS , 92 (11): 879, 1995; McKay. Science, 276: 66, 1997; Gage., Science, 287: 1433, 2000; Snyder et al . Nature, 374: 367, 1995; Weiss et al . Trends Neurosci ., 19: 387, 1996).

In addition, the neural stem cells of the present invention can be differentiated into a variety of neurons according to conventional methods known in the art. Differentiation is generally carried out in a culture environment that contains a nutrient broth without the addition of neural stem cell proliferation-inducing cytokines to the cell medium and with the addition of an appropriate substrate or differentiation reagent. Suitable substrates are suitable for positively coated solid surfaces such as poly-L-lysine and polyornithine. The substrate may be coated with extracellular matrix components such as fibronectin and laminin. Other acceptable extracellular matrices include Matrigel. Other suitable are combinatorial substrates in which poly-L-lysine is mixed with fibronectin, laminin, or mixtures thereof.

Suitable differentiation reagents include various types of growth factors, such as epidermal growth factor (EGF), transforming growth factor α (TGF-α), and any form of fibroblast growth factor (FGF-4, FGF-8 and bFGF). Receptors complexed with platelet-derived growth factor (PDGF), insulin-like growth factor (IGF-1, etc.), high concentrations of insulin, bone forming proteins (especially BMP-2 and BMP-4), retinic acid (RA) and gp130 Ligands for (eg, LIF, CNTF, and IL-6), including but not limited to.

In addition, the neural stem cells of the present invention can be cryopreserved according to methods known in the art for long-term storage. In general cryopreservation, when passage is continued to obtain a sufficient number of neural stem cells, mechanical methods or trypsin may be used to break down the neurospheres to form a single cell suspension. Thereafter, the cell suspension was mixed with a freeze stock consisting of 20-50% fetal bovine serum (Gibco), 10-15% DMSO (Sigma) and cell medium, and then placed in a freezing vial (NUNC). Busy. Cells mixed in the cryopreservation solution are immediately transferred to a -70 ° C freezer, stored at 4 ° C, and transferred to a liquid nitrogen tank for at least 24 hours for long-term storage (Gage et al. PNAS , 92 (11): 879, 1995; McKay. Science, 276: 66, 1997; Gage., Science, 287: 1433, 2000; Snyder et al . Nature, 374: 367, 1995; Weiss et al . Trends Neurosci ., 19: 387, 1996).

In addition, cryopreserved neural stem cells of the present invention can be thawed according to methods known in the art. To thaw frozen cells, immerse the frozen glass bottle in a 37 ° C constant temperature bath and shake slowly. When the cells in the frozen vial are half dissolved, transfer the cell suspension to a conical tube containing neural stem cell medium, which is warmed to 37 ° C. in advance. Transfer all cell suspensions and centrifuge to remove supernatant. The precipitated cell pellet is carefully suspended with neural stem cell medium. Transfer the cell suspension to a 60 mm cell culture plate. Thereafter, neural stem cell proliferation-induced cytokines are added to the medium and subsequently cultured in a 37 ° C., 5% CO 2 incubator.

Human neural stem cells secreting TRAIL, transformed with a nucleic acid encoding TRAIL according to the present invention, can be used for killing tumor cells, reconstructing and / or regenerating neural tissues in humans in need thereof. In particular, neural stem cells according to the present invention is very effective in the treatment of tumors. The term 'treatment' refers to alleviation of symptoms, reduction in the extent of disease, maintenance of a disease that does not worsen, delay in the progression of the disease, improvement or palliation of the disease state, or (partial or complete) remission. Include. Treatment can also mean increased survival compared to the expected survival if untreated. Treatment includes simultaneously prophylactic measures in addition to therapeutic means. Cases in need of treatment include those already with the disease and cases in which the disease should be prevented. Alleviation of a disease is when the clinical manifestations of the undesired disease are delayed or the progress of the disease is delayed or prolonged compared to the untreated situation. Treatment typically involves administering neural stem cells of the invention for the death or tumor regeneration of tumor cells.

Human neural stem cells secreting TRAIL according to the present invention are administered in a manner of direct transplantation or migration to a desired tissue site to induce the death of tumor cells or to reconstruct or regenerate a functionally deficient site. For example, human neural stem cells that secrete TRAIL of the present invention, depending on the disease to be treated, are directly transplanted into the milk tissue or intramedullary region of the central nervous system. Transplantation is performed using single cell suspensions or small aggregates of 1 × 10 5 -1.5 × 10 5 cell density per μl (US Pat. No. 5,968,829).

Human neural stem cells secreting TRAIL according to the present invention may be supplied in the form of a pharmaceutical composition for administration into a human. The pharmaceutical composition of the present invention may further include a pharmaceutically acceptable carrier. The term 'pharmaceutically acceptable' refers to a cell or human being exposed to the composition, which is not toxic. The carrier can be used without limitation so long as it is known in the art such as buffers, preservatives, analgesics, solubilizers, isotonic agents, stabilizers, bases, excipients, lubricants, preservatives and the like. The pharmaceutical compositions of the present invention can be prepared according to techniques commonly used in the form of various formulations. For example, injectables can be prepared in the form of unit dose ampoules or multiple dose inclusions. For general principles of pharmaceutical formulations of the pharmaceutical compositions according to the invention, reference may be made to Cell Therapy; Stem Cell Transplantation, Gene Therapy, and Cellular Immunotherapy, G. Morstyn amp; Edited by W. Sheridan, Cambridge University Press, 1996; And Hematopoietic Stem Cell Therapy, E. D. Ball, J. Lister amp; P. Law, Churchill Livingstone, 2000. The pharmaceutical compositions of the present invention may be packaged in suitable containers according to the indicated instructions for the desired purpose, for example for the treatment of tumors in vivo and for the reconstitution of tissue damaged by the tumor.

Tumors to which the pharmaceutical composition of the present invention may be applied include, but are not limited to, glioma, meningioma, pituitary adenoma, medulloblastoma, metastatic brain tumor, auditory neuroma, prostate cancer, malignant melanoma and neuroblastoma.

The glioma includes astrocytoma, oligodendrionic glioblastoma, superplastic cell tumor, polymorphic glioblastoma, and the like. In particular, malignant brain tumors such as glioblastoma multiforme among gliomas are practically incurable despite extensive surgical resection, adjuvant radiation and chemotherapy, and usually die, resulting in extremely poor prognosis (Black et al. , Cancer of the Nervous System, Blackwell, Oxford 1997, Surawicz et al., J. Neurooncol ., 40: 151, 1998). These poor prognosis factors include glioma cells that are extremely invasive and migrate extensively throughout the normal brain tissue, and are spread from the primary tumor mass to distant sites, leading to 'tumor satellites'. Because of the formation of the primary tumor itself surgically resection and other adjuvant therapy, even if combined with the recurrence easily after surgery. Therefore, the development of therapies that target metastatic satellite tumor lesions as well as primary mass sites is essential for successful treatment and improvement of prognosis. Accordingly, the pharmaceutical compositions of the present invention can be used as highly adjuvant therapeutics for the complete treatment of malignant brain tumors, such as glioblastoma multiforme. That is, the treatment method using the pharmaceutical composition of the present invention can be used in combination with other treatment methods known in the art, such as chemotherapy treatment, radiation therapy, surgical surgery, drug administration and the like. In addition, it can be used as adjuvant therapy for other treatment methods for tumors.

In addition, human neural stem cells are transplanted into the central nervous system and then engrafted and distributed by specifically migrating to the brain tumor site in response to signals expressed in the brain tumor site, and when administered systemically through intravenous injection, other than the central nervous system. It has been shown to migrate specifically to non-neurologic tumors, ie prostate cancer, malignant melanoma and neuroblastoma, which occurred in the area (Brown et al ., Human Gene Therapy, 14: 1777, 2003). Therefore, the pharmaceutical composition of the present invention can be effectively used for the treatment of non-neurologic tumors such as prostate cancer, malignant melanoma, neuroblastoma and other malignant tumors that occur systemically as well as brain tumors.

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited to the following examples.

< Example  1>

Isolation and Culture of Human Neural Stem Cells

<1-1> Isolation of Brain Tissue

After being approved by Severance Hospital Institution Review Board (IRB), they were aborted at 13 weeks of pregnancy following the Bioethics Act of the Ministry of Health and Welfare, the Research Guidelines of the Cell Applied Research Project Division of the Ministry of Science and Technology, and the Human Tissue Research and Management Guidelines of Sinchon Severance Hospital. The corpse of the dead fetus was obtained with the consent of the guardian in advance. Fetal carcasses were washed with sterile cold HH buffer (Hanks' balanced salt solution, 1 × [GIBCO] + HEPES, 10 mM [GIBCO] in ddH ₂ O, pH 7.4) and dissected only the central nervous system under a microscope. Subsequently, the cerebrospinal fluid and blood vessels were removed and the brain, liver, midbrain, cerebellum, softening and pons, and tissues of the spinal cord were separated separately.

Each isolated brain tissue was placed in a petri dish and cut to a size of about 1 × 1 mm. The supernatant was removed by centrifugation at 950 rpm for 3 minutes. The tissue was washed again with H-H buffer and the centrifugation was repeated three times. After the last centrifugation, all supernatants were removed, and 2 ml of 0.1% trypsin (Gibco) and DNase I (Roche, 1 mg / dL) were added to the remaining tissues and mixed well. The reaction was carried out at 37 ° C. and 5% CO 2 incubator for 30 minutes. After 30 minutes, 3 ml of serum-containing medium (DMEM + 10% FBS + 1 × penicillin / streptomycin / fungizone) (both from Gibco) was added. Serologic pipettes (Falcon) were used to slowly break down the tissue and dissociate to single cell level. Thereafter, the supernatant was removed by centrifugation, and the cell pellet was washed with H-H buffer. After centrifugation again, the supernatant was removed.

<1-2> Proliferation into Neural Stem Cells

In the cell pellet of each brain tissue obtained in Example <1-1>, N2 medium (D-MEM / F-12 [98% volume (v) / volume (v)) + N2 supplement [1% v / v ] + Penicillin / Streptomycin [1% v / v]; all manufactured by GIBCO) 10 ml were added and mixed slowly. About 4 × 10 6 -10 × 10 6 cells were transferred to a tissue culture treated 100 mm plate, Corning. 20 ng / ml recombinant human fibroblast growth factor-basic (R & D), 10 ng / ml recombinant human leukemia inhibitory factor (Sigma), and 8 μg / ml heparin (Sigma) were added as neural stem cell growth factors, respectively. After shaking well back and forth, and incubated in 37 ℃, 5% CO2 incubator. After 24 hours, 5 ml of medium was discarded and 5 ml of fresh N2 medium was added. At the same time 20 ng / ml bFGF, 10 ng / ml LIF and 8 μg / ml heparin were added and the culture continued. Medium exchange was performed every 3-4 days while observing the state of the medium and cells. At this time, only about half of the medium was replaced with fresh medium and growth factors were added together.

<1-3> Subculture

When the undifferentiated neural stem cells continued to proliferate through the Example <1-2> and clustered with each other to form cell masses, ie, neurospheres (FIG. 1), subcultures were usually performed every 7-8 days. . Subculture was performed in the following manner: All medium was removed from the cell culture plates. Cells were treated with 2 ml of 0.05% trypsin / EDTA (T / E, Gibco) and reacted for 2 minutes and 30 seconds in a 37 ° C., 5% CO ₂ incubator. After that, 2.5 ml of trypsin inhibitor (T / I, Soybean, Sigma, 1 mg / ml) was added and mixed well to stop the action of trypsin. The cell suspension was transferred to a 15 ml cornical tube (Falcon). The supernatant was removed by centrifugation. The cells were resuspended with 3 ml of N2 medium and then crushed with a serum pipette until neurospheres dissociated into single cells. After measuring the cell number, the cell suspension containing about 4 × 10 ⁶ to 6 × 10 ⁶ cells was transferred to a new cell culture plate containing some of the existing medium, and the total amount of 10 ml was added by adding insufficient N2 medium. The medium was made. And 20 ng / ml bFGF, 10 ng / ml LIF and 8 μg / ml heparin were added followed by further incubation in a 5% CO ₂ incubator.

<1-4> cryopreservation ( cryopreservation )

According to the method described in Example <1-3>, some cells were cryopreserved when a sufficient number of neural stem cells were obtained by continuing passage. Cryopreservation was carried out in the following way: Neurospheres treated with 0.05% trypsin / EDTA and trypsin inhibitor in turn were crushed and transferred to 15 ml tubes as cell passage. Cells were washed by adding 8 ml of H-H buffer. The supernatant was removed by centrifugation. Cells were gently resuspended by adding a 4 ° C. cryopreservation solution (N2 medium [40% v / v] + FBS [50% v / v] + DMSO [10% v / v, Sigma]) prepared in advance to the cell pellet. . The cell suspension was dispensed in 1.8 ml into one freezing vial (NUNC). The cells usually contained in one 10 mm cell culture plate were dispensed into 3-4 freeze vials. Then, it was transferred to a freezer at -70 ℃ while stored in an ice bucket (ice bucket), and at least 24 hours later transferred to a liquid nitrogen tank for long-term storage.

<1-5> Thawing of Cryopreserved Cells

When thawing the cryopreserved cells, the frozen glass bottles were immersed in a 37 ° C. water bath and slowly shaken. When the cells were thawed halfway, the cell suspension was transferred to a conical tube containing 10 ml of N2 medium previously warmed to 37 ° C. The supernatant was removed by centrifugation. The cell pellet was carefully suspended with 5 ml of N2 medium and transferred to 60 mm cell culture plates. Thereafter, 20 ng / ml bFGF, 10 ng / ml LIF and 8 μg / ml heparin were added to the plates, followed by incubation in a 37 ° C., 5% CO ₂ incubator. When cells grew while forming neurospheres, they were passaged again according to the method described in Example <1-3>. Usually, after 10 days, they grow enough to be transferred to a 10 mm cell culture plate.

< Example  2>

In Vitro Characterization of Human Neural Stem Cells

<2-1> Comparative study of characteristics of cell proliferation

In Example 1, 4 x 10 ⁶ neural stem cells, which were separated and cultured from various anatomical regions of the human central nervous system and grown in the form of neurospheres, were transferred to 100 mm cell culture plates and propagated for 50 days. As a result, neural stem cells showed exponential growth (FIG. 2). Among them, the number of cells in hepatocyte-derived neurospheres (HFD13 cells) increased about 1,850 times compared to the number of cells in the early stage of culture, and in the case of tumor-derived neurons (HFT13 cells), about 1,035 times increased. Cerebellum-derived neurospheres (HFC13 cells), midbrain-derived neurospheres (HFM13 cells), and spinal cord-derived neurospheres (HFS13 cells) were increased by about 453, 19, and 12-fold, respectively.

From the above results, the neural stem cells extracted from the whole brain of the human fetus at 13 weeks gestation, that is, the hepatic and cerebrum, proliferated rapidly, whereas the neural stem cells extracted from the midbrain and the spinal cord grew slowly, and the growth rate of the cerebellum-derived stem cells was increased. It was confirmed to be medium. As a result of continuous passage of the neurospheres of each brain tissue once every 7-10 days, the brain, liver, cerebellum, midbrain and spinal cord-derived neurospheres were passage number 42 (about 1 year), 36 ( Long term cultures were possible up to about 11 months), 30 (about 9 months), 10 (about 6 months) and 15 (about 7 months). No particular morphological changes or growth rate of cells were observed during each passage. Finally, all cells showed normal primary cell growth patterns that died through the aging process (not shown). It was also confirmed that each neurosphere was cryopreserved in liquid nitrogen for a long time and thawed again and then cultured in the same manner to continue to proliferate or differentiate in vitro without changing cell growth characteristics (results not shown). As a result of the chromosome test of the neural stem cells of the present invention, the normal 46, XY karyotype was shown, and even in long-term passage culture showed normal chromosomal karyotype (result not shown).

<2-2> of neural stem cells Marker argument  Immunohistochemical Analysis Using

Neurospheres proliferating in vitro were stained by immunohistochemistry. Neurospheres were transferred to 10 μg / ml poly-L-lysine (Sigma) coated chamber slides (NUNC) and incubated for 1 day. Once the neurospheres adhered to the bottom of the slide, the medium was removed and washed once with cold 1 × PBS. Cells were fixed by treatment with 4% paraformaldehyde (in Pipes buffer) (Sigma) for 10 minutes. After washing three times with 1 × PBS, cells were blocked with blocking solution (5% bovine serum albumin [BSA, Sigma] + 3% normal goat serum [NGS, Vector] + 0.3% Triton X-100 [Sigma]). in PBS) for 1 hour at room temperature. Then anti-human specific Nestin antibody (1: 200, Chemicon) or anti-mentinine diluted in carrier solution (3% NGS + 0.3% Triton X-100 in PBS) An antibody (anti-Vimentin antibody, 1:80, Sigma) was added and reacted overnight at 4 ° C. After washing the cells three times with 1 × PBS, the diluted secondary antibody (species specific secondary antibodies conjugated with fluorescein, 1: 200, Vector) was added to the carrier solution and reacted for 1 hour at 37 ℃. After washing three times with 1 × PBS, the cells were loaded with mounting media (Vector) and covered with over glass. Then, it was observed with an fluorescence microscope (Epifluorescent microscope, Olympus). As a result, it was confirmed that more than 99% of cells express nestin or non-mentin, which are markers of neural stem cells. The results of the cerebellum derived neurospheres (HFT13 cells) are typically shown in FIG. 3A.

<2-3> Differentiation Pattern Analysis

Differentiation patterns of human neural stem cells proliferating while forming neurospheres were examined by immunohistochemistry. Each neurosphere was treated with 0.05% trypsin / EDTA to prepare a single cell suspension and transferred to 10 μg / ml poly-L-lysine (Sigma) coated 8 well chamber slides. Thereafter, the cells were incubated for one week in N2 medium containing no growth factor. As a result, the cells adhered to the plate bottom and showed differentiated neuronal morphology. The medium was removed and washed once with cold 1 × PBS. Cells were fixed by treatment with 4% paraformaldehyde (in Pipes buffer) (Sigma) for 10 minutes. After washing 3 times with 1 × PBS, blocking solution (5% bovine serum albumin [BSA, Sigma] + 3% normal goat serum [NGS, Vector] + 0.3% Triton X-100 [Sigma] in PBS) for 1 hour at room temperature. Thereafter, various primary antibodies (Table 1) diluted in respective ratios were added to a carrier solution (carrier solution, 3% NGS + 0.3% Triton X-100 in PBS) and reacted overnight at 4 ° C.

Primary antibodies used to analyze differentiation patterns of human neural stem cells Antibody Name Dilution ratio (antibody: carrier solution) manufacturer One Anti-TUJ1 (β-tubulin III) mouse antibody 1: 150 Sigma 2 Anti-O4 mouse antibody 1:30 Chemicon 3 Anti-human specific glial fibrillary acidic protein (GFAP) mouse antibody 1: 200 Terntern monoclonals 4 Anti-GFAP rabbit antibody 1: 400 Sigma 5 Anti-GABA rabbit antibody 1: 500 Sigma 6 Anti-Glutamate Rabbit Antibody 1: 500 Sigma 7 Anti-TH (Tyrosine hydroxylase) rabbit antibody 1:50 Chemicon 8 Anti-choline acetyltransferase Gout Antibody 1: 200 Chemicon 9 Anti-NF (pan-neurofilament) mouse antibody 1: 500 Sternberger 10 Anti-NF-M (neurofilament-M) rabbit antibody 1: 1000 Chemicon 11 Anti-NF-H (neurofilament-H) rabbit antibody 1: 1000 Chemicon

After washing the cells treated with the primary antibody three times again with 1 × PBS, the diluted secondary antibody (specific secondary antibodies conjugated with fluorescein, 1: 200, Vector) was added to the carrier solution for 1 hour at 37 ° C. Reacted. After washing three times with 1 × PBS, the cells were loaded with mounting media (Vector) and covered with over glass. Then, it was observed with an fluorescence microscope (Epifluorescent microscope, Olympus).

As a result, there were some differences according to the anatomical location and the number of passages of the central nervous system from which the stem cells were extracted.However, in differentiation conditions, human neural stem cells differentiate into various neurons and express various neurotransmitters. Pluripotency was shown (FIG. 3B).

More specifically, the expression of early neuronal marker TUJ1 was observed in all human neural stem cells derived from each anatomical position of the central nervous system. This shows that the neural stem cells can differentiate into neuronal cells. In addition, O4, an early oligodendrocyte marker, was generally low in expression, indicating that a small number of neural stem cells differentiated into oligodendrocytes.

Recently, it has been reported that GFAP-expressing cells, known as markers of astrocytes, a type of glial cells, are neural stem cells or radial glial cells thereof. All human neural stem cells from each anatomical location of the central nervous system have been shown to express GFAP. In particular, GFAP expression rates of HFT13 cells were significantly higher at 80% and 90-95% at early and late passages, respectively, and increased as passage continued.

Meanwhile, human neural stem cells cultured in the present invention expressed various neurotransmitters during differentiation, in particular GABA and glutamate were expressed in almost all cells. In addition, human neural stem cells cultured in this method express only a small number of cells under differentiation conditions, choline acetyltransferase (choline AT) and tyrosine hydrolase (TH), which do not differentiate well into dopaminergic or cholinergic neurons. Seemed.

< Example  3>

human Glioblastoma  Culture and human Glioblastoma  Establish an animal model

<3-1> human Glioblastoma  culture

U87MG cell line, a type of human polymorphic glioblastoma purchased from the American Type Culture Collection (ATCC), was cultured in RPMI 1640 medium (Gibco) to which 10% FBS and 1 × P / S (penicillin / streptomycin; Gibco) were added. Another human glioblastoma U343MG cell line (ATCC) was cultured in DMEM medium (Gibco) to which 10% FBS and 1x P / S was added. These cells were passaged every 2-4 days with 0.05% trypsin / EDTA for 2 minutes 30 seconds. After the last subculture, U87MG or U343MG cells were treated with trypsin / EDTA to make single cell suspensions. The suspension was centrifuged at 950 rpm for 3 minutes to remove supernatant. Cells were resuspended by adding 5 ml of 1 × PBS containing 20 μg / ml CM-DiI (Cell Tracker, Molecular Probes) to the cell pellet. The cells were then stained with CM-DiI for 3 minutes at 37 ° C. and 10 minutes on ice. Cell pellets obtained by centrifugation were resuspended with 10 ml of 1 × PBS and centrifuged again three times to remove the remaining CM-DiI. Cells were then adjusted to 5 × 10 5 cells / 4 μl to resuspend the cells in 1 × PBS. The cell suspension thus prepared was stored on ice until in vivo transplantation.

<3-2> human Glioblastoma  Establish an animal model

Athymic nude mice (nu / nu; female) of 6-8 weeks of age were anesthetized with xylazine (0.1 mg / 10 g of body weight) and ketamine (0.5 mg / 10 g of body weight). I was. The median skin of the head was disinfected and dissected with 70% alcohol. The head was fixed to a stereotaxic apparatus. After marking the position on the right stratus (corpus striatum) (0.5 mm forward from Brema, 2.5 mm to the right side, 3 mm deep), a hole in the skull with a 1 mm drill bar Pierced Thereafter, the suspension of the CM-DiI-labeled tumor cell suspension prepared in Example <3-1> was placed in a 10 μl Hamilton syringe. After the syringe was fixed to the stereotactic device, 4 μl of the suspension of tumor cells was slowly implanted into the striatum at the position using a micro injection pump (Stolting) at a rate of 1 μl / min. After transplantation, the cells were stabilized for 3 minutes. Again, the syringe needle was slowly removed over three minutes. The surgical site was disinfected and sutured with iodine ointment. Mice were stabilized on 37 ° C. warm pads until anesthesia awoke. To prevent infection, cephazoline (cepazolin, 50 mg / kg / day, Yuhan Corporation) was diluted in distilled water for 3 days after surgery, and the mice were injected subcutaneously.

To confirm the establishment of a human glioblastoma animal model, one week after cell transplantation, the mice were fixed with 4% paraformaldehyde (in Pipes buffer) and brains were extracted. The extracted brain was cryosectioned to 16 μm and stained with hematoxylin (Vector). Thereafter, tumors labeled with CM-DiI were observed under a microscope. As a result, as shown in FIG. 4, when the U87MG cells were transplanted, very large tumors were formed in the right striatum of the mouse, and even when the U343MG cells were transplanted, the tumors were formed in the striatum.

< Example  4>

TRAIL or Gfp  Expression recombination Adenovirus  making

<4-1> CMV  TRAIL expression recombination by promoter Of adenovirus (AdCMV-TRAIL)  making

First, the TRAIL gene was amplified by PCR using a plasmid obtained from a human fetal brain cDNA library (Clontech, Cat. 634258) as a template. To prepare a water soluble TRAIL, the apoptogenic receptor binding moiety (95-281 of SEQ ID NO: 3, SEQ ID NO: 1) excluding the transmembrane domain in TRAIL of SEQ ID NO: 3 was amplified by PCR . At this time, primers (SEQ ID NO: 6 and SEQ ID NO: 7) used includes the easy each Kpn Ⅰ and Xho Ⅰ restriction enzyme sequences therein for cloned into the pSecTag2A vector (Invitrogen). PCR reactions were initially denatured at 94 ° C. for 3 minutes; 35 cycles of denaturation at 94 ° C. for 30 seconds, annealing at 58 ° C. for 30 seconds and extension at 72 ° C. for 45 seconds; And final elongation at 72 ° C. for 10 minutes. The amplified PCR product was cloned into pGEM-T easy vector (Promega, Wisconsin, USA).

In order to enhance the activity through trimerization of TRAIL, the isoleucine zipper domain (hereinafter referred to as 'ILZ') was cloned in the following manner: the amount of sequence (SEQ ID NO: 8) obtained by reverse translation of the amino acid sequence of known ILZ An oligomer was synthesized by linking the restriction enzyme sequences of Hin dIII and Kpn I to the ends (Bioneer, Daejeon). The synthesized oligomer was inserted into the pGEM-T vector.

Thereafter, the ILZ and TRAIL genes were sequentially inserted into a pSecTag2A vector containing an Igκ-chain leader that induces extracellular secretion of the protein. That is, first, the cutting insert ILZ the pGEM-T vector by Hin dⅢ and Kpn Ⅰ, was inserted into the cut ILZ the pSecTag2A vector. Further, after cutting the two ends of TRAIL is inserted into pGEM-T easy vector gene Kpn Ⅰ and Xho Ⅰ, it was inserted into the cut TRAIL gene in the pSecTag2A the ILZ is inserted. After TRAIL expressed from the pSecTag2A vector is secreted out of the cell, the Igκ-chain leader disappears.

In order to clone the thus prepared Igk chain leader-ILZ-TRAIL construct into an adenovirus shuttle vector, Bgl II and Xho I restriction enzyme sequences were linked by PCR at both ends of the construct. At this time, an oligonucleotide having a nucleotide sequence represented by SEQ ID NO: 9 and SEQ ID NO: 7 was used as a primer. PCR reactions were initially denatured at 94 ° C. for 3 minutes; 35 cycles of denaturation at 94 ° C. for 30 seconds, annealing at 60 ° C. for 30 seconds and elongation at 72 ° C. for 90 seconds; And final elongation at 72 ° C. for 10 minutes. The amplified PCR product was cloned into pGEM-T easy vector (Promega, Wisconsin, USA). The vector was then digested with Bgl II and Xho I restriction enzymes and inserted into the adenovirus shuttle vector pShuttle-CMV-hrGFP vector (Stratagene). The prepared vector was named 'pShuttle-CMV-Igκ-ILZ-TRAIL-IRES-hrGFP' (FIG. 6A). In the vector, the GFP gene is linked to the downstream of the TRAIL gene by IRES so that when TRAIL is expressed, GFP is naturally expressed together.

The pShuttle-CMV-Igκ-ILZ-TRAIL-IRES-hrGFP was cleaved with Pme I restriction enzyme and co-introduced into E. coli BJ5183 together with pAdEasy-1 (Stratagene), an adenoviral backbone vector. Homologous recombination between two vectors was induced (pAd-CMV-Igκ-ILZ-TRAIL-IRES-hrGFP). Transformation of E. coli was performed by electroporation using a transgene (Gene Pulser, 2.5 kV, 25 μF, 200 μs) (Bio-Rad, Hercules, CA, USA).

The pAd-CMV-Igκ-ILZ-TRAIL-IRES-hrGFP thus obtained was digested with Pac I restriction enzyme and then transfected into 293A cells (Invitrogen, CA), an adenovirus producing cell line, to amplify the virus. Produced recombinant virus (AdCMV-TRAIL) was purified by performing calcium chloride ultracentrifugation (calcium chloride ultracentrifugation) for 6 hours at 10 ℃ at 80,000 rpm. After dialysis (Pierce, Rockford, IL, USA) in 4% sucrose buffer (10 mM Tris, 4% sucrose, 2 mM MgCl ₂ in PBS), filtered with a 0.4 μm filter and stored at -70 ° C until use. It was.

<4-2> CMV  By promoter Gfp  Expression recombination Of adenovirus (AdCMV-GFP)  making

Recombinant adenovirus (AdCMV-GFP, control virus) expressing only GFP was prepared in the same manner as in Example <4-1> using pShuttle-CMV-hrGFP vector (Stratagene).

<4-3> CAG  Modified Including Promoter pShuttle  The making of the vector

CMV immediate early enhancer (CMV ie enhancer) taken from pTriEX-1.1 Neo DNA (Novagen) vector at multi cloning site (MCS) of pShuttle vector (stratagene) to use recombinant adenovirus with CAG promoter PShuttle-CAG or pShuttle by cloning IRES and hrGFP from chicken β-actin promoter, rabbit β-globin terminator and pShuttle-IRES-hrGFP-1 (stratagene) vector -CAG-IRES-hrGFP vector was made (see FIGS. 7A and 7B). This will be described in detail as follows.

First, the rabbit β-globin terminator was cloned between Sal I and Bgl II of the pShuttle vector in the following manner: from the pTriEX-1.1 Neo vector (Novagen), the rabbit β-globin terminator was subjected to PCR using pfu polymerase. Got it. The primers (forward primer: CTCGAGATCAATTCTCTAGCCAAT (SEQ ID NO: 12); reverse primer: GGATCCTTACATATGGGCATATGT (SEQ ID NO: 13)) include Xho I and Bam HI restriction enzyme sequences for cloning into a pShuttle vector. PCR reactions were initially denatured at 95 ° C. for 5 minutes; 35 cycles of denaturation at 94 ° C. for 45 seconds, annealing at 55 ° C. for 45 seconds and extension at 72 ° C. for 30 seconds; And final elongation at 72 ° C. for 7 minutes. The amplified PCR product was cloned into pGEM-T easy vector (Promega, Wisconsin, USA). The pGEM-T easy vector containing the rabbit β-globin terminator was digested with Xho I and Bam HI, and the pShuttle vector was digested with Sal I and Bgl II to link each product. Sal I and Xho I, Bgl II, and Bam HI are complementary cohesive ends, respectively, and can be linked to each other and the linked vectors lose their restriction sites. In this way, the pShuttle vector (pShuttle-rabbit β globin terminator) containing the rabbit β-globin terminator was cloned.

Next, the CMV immediate early enhancer and chicken β-actin promoter portion were cloned into the pShuttle vector containing the rabbit β-globin terminator in the following manner: between the chicken β-actin promoter and the MCS of the pTriEX-1.1 Neo vector. In order to remove the Pac I restriction enzyme, pTriEX-1.1 Neo vector was cut with Pac I and blunt ends were made using klenow fragement (Takara). This was again cleaved with Sma I and self ligation to obtain a modified pTriEX-1.1 Neo vector without a Pac I restriction enzyme site. The modified pTriEX-1.1 Neo vector was cleaved with Fse I, polymerized with a Klenow fragment to make a blunt end, and further cleaved with Xho I to obtain CMV immediate early enhancer and chicken β-actin promoter. Prior made rabbit connect the product obtained by cutting the vector with Kpn pShuttle Ⅰ and Xho Ⅰ β- globin terminator, including those with the CMV immediate early enhancer and chicken β- actin promoter portion (ligation) to, CMV immediate early enhancer, chicken A pShuttle vector (pShuttle-CAG) containing a β-actin promoter and a rabbit β-globin terminator was completed (see FIG. 7A).

IRES and hrGFP were cloned into the pShuttle-CAG vector by the following method: IRES and hrGFP portions of pShuttle-IRES-hrGFP-1 (Stratagene) vectors were obtained by PCR using pfu polymerase. The primer (forward primer: CTCGAGGACTACAAGGATGAC (SEQ ID NO: 14); reverse primer: CTCGAGCACCCACTCGTGCAGGCTGCC (SEQ ID NO: 15)) contains the Xho I restriction enzyme sequence in front of the IRES for cloning into a pShuttle-CAG vector. PCR reactions were initially denatured at 95 ° C. for 5 minutes; 35 cycles of denaturation at 94 ° C. for 45 seconds, annealing at 55 ° C. for 45 seconds and extension at 72 ° C. for 1 minute; And final elongation at 72 ° C. for 7 minutes. The amplified PCR product was cloned into pGEM-T easy vector (Promega, Wisconsin, USA). The pGEM-T easy vector was cleaved with Eco RI, polymerized with Klenow pieces, and further cleaved with Xho I to obtain IRES and hrGFP moieties. pShuttle-CAG-IRES-hrGFP was completed by ligation of the product obtained by cleaving the pShuttle-CAG vector with Xho I and Eco RV and the above IRES and hrGFP moieties (see FIG. 7B).

<4-4> CAG  TRAIL expressing recombinant adenovirus (AdCAG-TRAIL) by promoter of  making

A modified pShuttle vector (pShuttle-CAG or pShuttle-CAG-IRES-hrGFP) comprising a CAG promoter in the following manner, wherein the Igk-ILZ-TRAIL construct inserted into pSecTag2A described in Example <4-1> is used Cloned in: Bgl II and Xho I restriction enzyme sites were linked by PCR to both ends of the Igk-ILZ-TRAIL construct. At this time, an oligonucleotide having a nucleotide sequence represented by SEQ ID NO: 9 and SEQ ID NO: 7 was used as a primer. PCR reactions were initially denatured at 94 ° C. for 3 minutes; 35 cycles of denaturation at 94 ° C. for 30 seconds, annealing at 60 ° C. for 30 seconds and elongation at 72 ° C. for 90 seconds; And final elongation at 72 ° C. for 10 minutes. The amplified PCR product was cloned into pGEM-T easy vector (Promega, Wisconsin, USA). Subsequently, the vector was digested with Bgl II and Xho I restriction enzymes and inserted into pShuttle-CAG and pShuttle-CAG-IRES-hrGFP, which are adenovirus shuttle vectors, respectively, and these were 'pShuttle-CAG-Igκ-ILZ-TRAIL' and It was named 'pShuttle-CAG-Igκ-ILZ-TRAIL-IRES-hrGFP'. In the pShuttle-CAG-Igκ-ILZ-TRAIL-IRES-hrGFP vector, the GFP gene is linked by IRES downstream of the TRAIL gene so that GFP is naturally expressed when TRAIL is expressed.

The recombinant adenovirus expressing TRAIL by the CAG promoter is the same method as in Example <4-1> using pShuttle-CAG-Igκ-ILZ-TRAIL or pShuttle-CAG-Igκ-ILZ-TRAIL-IRES-hrGFP. Were prepared and these viruses were named AdCAG-TRAIL-noGFP or AdCAG-TRAIL.

<4-5> CAG  By promoter Gfp  Expression recombination Of adenovirus (AdCAG-GFP)  making

Recombinant adenovirus (AdCAG-GFP, control virus) expressing only GFP by the CAG promoter was prepared using the pShuttle-CAG-IRES-hrGFP vector prepared in Example <4-3>. Prepared in the same manner.

The adenoviruses prepared and named in the present invention are thus summarized as follows. AdCMV-TRAIL prepared using pShuttle-CMV-Igκ-ILZ-TRAIL-IRES-hrGFP vector; AdCMV-GFP prepared using pShuttle-CMV-hrGFP vector; AdCAG-TRAIL prepared using a pShuttle-CAG-Igκ-ILZ-TRAIL-IRES-hrGFP vector; AdCAG-TRAIL-noGFP prepared using a pShuttle-CAG-Igκ-ILZ-TRAIL vector; Those prepared using the pShuttle-CAG-IRES-hrGFP vector were named AdCAG-GFP, respectively.

<4-6> TCID50  Test

To quantify AdCMV-TRAIL, AdCMV-GFP, AdCAG-TRAIL and AdCAG-GFP recombinant viruses prepared in Examples <4-1>, <4-2>, <4-4> and <4-5> TCID 50 (Tissue Culture Infectious Dose 50, QBiogene) test was performed using 293A cells. 293A cells were plated in 96 well plates (NUNC) and infected with serially diluted recombinant virus, respectively. After 1 week, the number of infected wells was added to calculate the TCID 50 value using the KABER statistical method (TCID 50 reference; QBiogene, CA, USA.AdenoVator applications manual). As a result, the TCID50 value of the AdCMV-TRAIL, AdCMV-GFP, AdCAG-TRAIL and AdCAG-GFP recombinant viruses all showed an average of 1-5 × 10 ¹⁰ PFU / ml.

<4-7> wild type Adenovirus  Check for contamination

To confirm the contamination of wild-type adenovirus in AdCMV-TRAIL, AdCMV-GFP, AdCAG-TRAIL, AdCAG-TRAIL-noGFP and AdCAG-GFP recombinant viruses, the E1 gene of wild type adenovirus removed from the two recombinant adenoviruses PCR was performed by synthesizing primers from internal sequences. First, the genome of each recombinant virus was obtained by phenol / ethanol precipitation method after breaking the virus particles with lysis buffer (0.1% SDS, 10mM Tris-Cl, 1mM EDTA). Subsequently, PCR was performed using primers of SEQ ID NO: 10 and SEQ ID NO: 11 (amplifying the E1 gene of wild type adenovirus) to obtain each genome as a template and to determine whether the wild type adenovirus was contaminated, and extracted recombinant adenosine. Forward primer: ATGGTGAGCAAGCAGATCCTGA (SEQ ID NO: 16); reverse primer: CACCCACTCGTGCAGGCTGCCC (SEQ ID NO: 17) and sequence for detecting the TRAIL gene PCR was performed using primers Nos. 9 and 7. PCR reactions were initially denatured at 94 ° C. for 3 minutes; 35 cycles of denaturation at 94 ° C. for 30 seconds, annealing at 55 ° C. for 30 seconds and elongation at 72 ° C. for 30 seconds; And final elongation at 72 ° C. for 10 minutes. At this time, the 293A cell genome was used as a positive control. The 293A cell genome was obtained by phenol / ethanol precipitation after breaking cells with digestion buffer (0.5% SDS, 100 mM NaCl, 10 mM Tris-Cl, 25 mM EDTA). PCR reaction results were confirmed by agarose gel electrophoresis.

As a result, as shown in Figure 5B, 340 bp E1 gene was detected in 293A cells (lane 2), but AdCMV-TRAIL, AdCMV-GFP, AdCAG-TRAIL, AdCAG-TRAIL-noGFP and AdCAG-GFP recombinant virus genome Was not detected (lane 3 to lane 7), and each target gene (GFP: 717 bp, TRAIL :) was detected in the AdCMV-TRAIL, AdCMV-GFP, AdCAG-TRAIL, AdCAG-TRAIL-noGFP and AdCAG-GFP recombinant viral genomes. 778 bp) was detected to confirm that the extracted viral genome (lane 8 to lane 12).

< Example  5>

TRAIL or Gfp  Expression recombination Adenovirus  Infection of human neural stem cells

In order to confirm whether the AdCMV-TRAIL and AdCAG-TRAIL recombinant viruses produced in Examples <4-1> and <4-4> secrete TRAIL in the host cell, the following experiment was performed.

<5-1> ELISA analysis

After infecting the AdCMV-TRAIL, AdCMV-GFP, AdCAG-TRAIL and AdCAG-GFP virus to human neural stem cells (HFT13 cells), the secreted TRAIL was quantified by ELISA (enzyme-linked immunosorbent assay) method.

To this end, 5 × 10 ⁵ brain-derived human neural stem cells (HFT13 cells) isolated in Example 1 were plated in 1-well culture dish (NUNC) together with 1 ml of growth factor-containing N2 medium. After 1 hour AdCMV-TRAIL of 100, 200 and 300 multiplicity of infection, AdCMV-GFP of 50 MOI, AdCAG-TRAIL of 65, 130, 195 and 260 multiplicity of infection and AdCAG- of 50 MOI, respectively GFP viral particles were added to the medium to infect the cells. After 24 hours of infection, each well was washed once with 3 ml N2 medium to remove the virus. Thereafter, 3 ml of growth factor-containing N2 medium was added to culture the cells. 48 hours after culturing the virus-infected cells were observed under a fluorescence microscope to confirm that the expression of GFP in the neural stem cells (results not shown).

In order to quantify the TRAIL secreted from the recombinant virus-infected neural stem cells, all cell cultures were collected and subjected to ELISA (BD, San Diego, CA) for TRAIL. The anti-human TRAIL monoclonal antibody was diluted 1: 250 in coating buffer (0.1 M sodium carbonate / bicarbonate, pH 9.5 in distilled water) and 100 μl was dispensed into each well of a 96 well plate (NUNC). . And it reacted at 4 degreeC for one day. Wells were washed three times with wash buffer (1 × PBS with 0.05% Tween-20). Assay diluent (1 × PBS with 10% FBS, pH 7.0) was added to each well and blocked for 1 hour at room temperature. After washing three more times, 100 μl of the culture solution of AdCMV-TRAIL or AdCMV-GFP recombinant adenovirus and its serial dilutions were dispensed into each well and reacted at room temperature for 2 hours. After the reaction was completed, each well was washed five times. Dilute the biotinylated anti-human TRAIL monoclonal antibody with the avidin-horseradish peroxidase conjuate reagent in an assay diluent. Aliquots were made and reacted at room temperature for 1 hour. Finally, the cells were washed 7 times, and 100 μl of substrate solution (Tetramethylbenzidine [TMB] and hydrogen peroxide, BD, USA) was dispensed into each well to block light and allowed to react at room temperature for 30 minutes. 50 μl of 2N sulfuric acid was added to stop the reaction. Then, the absorbance was measured at 450-570 nm with a microplate reader (Molecular Devices). As a result, the measured TRAIL amounts were 10.3 ± 2.29 (Mean ± SD), 28.5 ± 1.39 and 40.7 ± 2.90 ng, respectively, from 1 million neural stem cell cultures after 48 hours when AdCMV-TRAIL was infected with 100, 200 and 300 MOI, respectively. And 48.88 ± 3.68 (Mean ± SD), 48.88 ± 3.13, 51.42 ± 6.63 and 53.76 ± 4.38 from 48 million neuronal stem cell cultures after 48 hours when AdCAG-TRAIL was infected with 65, 130, 195 and 260 MOI, respectively. ng (FIG. 8A). Values of less than 0.01 ng were measured in HFT13 cells (control) without virus infection, HFT13 cell cultures infected with AdCMV-GFP and HFT13 cell cultures infected with AdCAG-GFP.

Therefore, it was confirmed that the recombinant adenovirus of the present invention can effectively secrete TRAIL in host cells. In particular, the use of the CAG promoter was found to express a greater amount of TRAIL at less MOI than when using the CMV promoter.

<5-2> Immunohistochemical Analysis

In Example <5-1>, TRAIL expression in HFT13 cells infected with AdCMV-TRAIL was confirmed by immunohistochemical analysis. Each 1 × 10 ⁵ of HFT13 cells with 400 μl of growth factor-containing N2 medium were coated on a poly-L-lysine (PLL) coated 8-well chamber slide (PLL-coated 8-well chamber slide). Plated to wells. Thereafter, 300 MOI of AdCMV-TRAIL and 50 MOI of AdCMV-GFP virus were infected in the same manner as in Example <5-1>. Media was removed 2 days after virus infection and washed once with cold 1 × PBS. The cells were then fixed for 15 minutes at room temperature with cold 4% paraformaldehyde (in Pipes buffer). Wash three times with 1 × PBS and wash in blocking solution (5% bovine serum albumin [BSA, Sigma] + 3% normal goat serum [NGS, Vector] + 0.3% Triton X-100 [Sigma] in PBS) at room temperature. It was left for time. Anti-human TRAIL antibodies (R & D, Minneapolis, MN, USA) were diluted 1:20 in the blocking solution, treated to cells and reacted at 4 ° C. for 1 day. Cells were washed same as above. Subsequently, biotinylated anti-mouse immunoglobulin G (biotinylated anti-mouse immunoglobulin G, Vector) was diluted 1: 180 in the blocking solution, treated to cells, and reacted at 37 ° C for 1 hour. After the cells were washed again, streptavidin-Texas Red (Molecular Probes) was diluted 1: 250 in the blocking solution, treated the cells and reacted at 37 ° C for 1 hour. Thereafter, the cells were washed in the same manner as above, and then mounted in a mounting medium (Vector) for fluorescence microscopy added with DAPI. HFT13 cells without virus infection were used as controls. As observed under fluorescence microscope (BX51, Olympus), TRAIL was stained very strongly in AdCMV-TRAIL virus infected cells, while TRAIL was not stained in cells infected or infected with AdCMV-GFP (FIG. 8B).

From these results, it was confirmed that TRAIL is normally secreted from TRAIL-expressing recombinant adenovirus-infected human neural stem cells, which shows that adenovirus-mediated gene delivery to human neural stem cells can be efficiently used.

< Example  6>

Investigation of human neural stem cell response to TRAIL

<6-1> Growth and Growth Analysis of TRAIL Treated Human Neural Stem Cells

In order to investigate the response of human neural stem cells to TRAIL, recombinant human TRAIL (rhTRAIL) was used. First, 5 × 10 ⁵ HFT13 cells were plated with medium in each well of a 6 well culture dish. After 24 hours, 30, 90 and 150 ng / ml of rhTRAIL (PeproTech, Rocky Hill, NJ, USA) were added to the wells, respectively. Cells were incubated for one week in a 37 ° C., 5% CO ₂ incubator to observe cell survival and growth. As a result, human neural stem cells showed normal proliferation and growth, even when exposed to high concentrations of rhTRAIL, forming neurospheres similarly to those without rhTRAIL treatment (FIG. 9A).

To objectively assess the survival of TRAIL-treated human neural stem cells, mitochondrial dehydrogenase activity assay (Cell Counting Kit-8 [CCK-8 assay], Dojindo Laboratories, Tokyo, Japan ) Was performed. 5 × 10 ⁴ HFT13 cells were plated in each well of a 96 well plate with 100 μl of N2 medium containing growth factors. After 24 hours rhTRAIL was treated at a concentration of 30 ng / ml. After 6 days, 10 μl of water-soluble tetrazolium salt and CCK-8 solution of 1-methoxy PMS, which is an electron carrier, were added to each well. After 2 hours, the absorbance was measured at 450 nm using a micro reader. At this time, the blank control group was a well treated with only CCK-8 solution in the cell medium, and the HFT13 cell culture group without rhTRAIL was expressed as 100% survival. All experiments were repeated three times under the same conditions to obtain an average value. As a result, it was shown that the average cell viability was 98.8% even when treated with 30 ng / ml rhTRAIL compared to the group not treated with rhTRAIL (Fig. 9B). From this, it was confirmed that rhTRAIL did not affect the proliferation and growth of human neural stem cells.

<6-2> recombination Adenovirus  Proliferation and Growth Analysis of Infected Human Neural Stem Cells

Then, the inventors observed whether human neural stem cells infected with AdCMV-TRAIL, AdCMV-GFP, AdCAG-TRAIL and AdCAG-GFP recombinant viruses, respectively, proliferated and grown normally.

5 x 10 ⁵ HFT13 cells were plated in each well of a 6 well culture dish with 1 ml of N2 medium containing growth factors. After one hour, 100 MOI of AdCMV-TRAIL, 50 MOI of AdCMV-GFP, 130 and 260 MOI of AdCAG-TRAIL and 50 MOI of AdCAG-GFP virus particles were added directly to the medium to infect cells. Twenty four hours after infection, the cells were washed once with 3 ml N2 medium to remove the virus, and cultured in 3 ml N2 medium containing growth factors. After 2 days of culture, cells were observed to proliferate and grow, expressing GFP in each and forming normal neurospheres (FIG. 10A).

Then, to quantitatively analyze the effects of TRAIL or GFP expressing recombinant adenovirus on the proliferation and growth of human neural stem cells, a CCK-8 assay was performed. 5 × 10 ⁴ HFT13 cells were plated in each well of a 96 well plate with 100 μl of growth factor-containing N2 medium. After 1 hour, 100 MOI of AdCMV-TRAIL, 50 MOI of AdCMV-GFP, 130 and 260 MOI of AdCAG-TRAIL and 50 MOI of AdCAG-GFP virus particles were added directly to the medium to infect cells. 24 hours after infection, the cells were washed once with 100 μl of N2 medium to remove the virus, and continued incubation in 100 μl of growth factor-containing N2 medium. After 3 days, 10 μl of CCK-8 solution was treated, and after 2 hours, the absorbance was measured at 450 nm with a microplate reader. The blank control group was a well treated with only CCK-8 solution in the culture, and the virus-free HFT13 cell culture group was expressed as 100% cell survival group. Each experimental group was tested with three wells, and the same experiment was repeated three times to obtain an average value. With 100% non-viral HFT13 cell growth, AdCMV-GFP infected cells averaged 96.69%, 100MOI AdCMV-TRAIL infected cells averaged 98.16%, 200MOI AdCMV-TRAIL infected cells averaged 94.32%, AdCAG- GFP infected cells averaged 102.00%, 130MOI of AdCAG-TRAIL infected cells on average 95.93%, and 260MOI of AdCAG-TRAIL infected cells on average of 94.16% viability.

From the above results, it was confirmed that the expression of TRAIL and GFP by CMV and CAG promoters did not inhibit the proliferation and growth of human neural stem cells and was not significantly affected by adenovirus infection itself.

< Example  7>

Recombination Adenovirus  Human caused by infected human neural stem cells Glioblastoma  Apoptosis Assay

To confirm whether TRAIL secreted from human neural stem cells infected with AdCMV-TRAIL or AdCAG-TRAIL recombinant virus induced death of human glioblastoma cells, co-culture of virus-infected neural stem cell cultures and glioblastoma cell lines was performed.

First, 5 × 10 ⁵ HFT13 cells were plated with medium in each well of a 6 well plate dish. After 1 hour cells were infected with 50 MOI of AdCMV-GFP or 100, 200 and 300 MOI of AdCMV-TRAIL virus, 50 MOI of AdCAG-GFP or 65, 130, 195 and 260 MOI of AdCAG-TRAIL virus. After 24 hours, cells were washed with 3 ml of N2 medium and continued incubation in 5 ml of growth factor-containing N2 medium for 3 days. The cell culture was centrifuged for 3 minutes at 1000 rpm. Meanwhile, 2 × 10 ⁵ U87MG or U343MG cells were plated with medium in each well of a 12 well plate dish. After incubation for 24 hours, the medium was removed and 1.5 mL of the prepared neural stem cell culture solution was added to each well, and the tumor cells were killed. As a result, U87MG and U343MG cells co-cultured with medium of HFT13 cells infected with AdCMV-TRAIL or AdCAG-TRAIL showed apoptosis very fast, similar to when directly treated with rhTRAIL (FIG. 11A). On the other hand, glioblastoma cells co-cultured with the medium of HFT13 cells not infected with virus, the medium of HFT13 cells infected with AdCMV-GFP, or the medium of HFT13 cells infected with AdCAG-GFP did not show death (FIG. 11A).

In order to quantify the degree of such apoptosis, CCK-8 assay was performed in the same manner as in Example <6-1>. As a result, at least 24% of HFT13 cell medium and U87MG cells infected with 260 MOI of AdCAG-TRAIL recombinant virus were killed at least 63% of tumor cells and at least 91% of tumor cells were cocultured with U343MG cells. By comparison, at least 54% of tumor cells were killed when co-cultured with HFT13 cell medium and U87MG cells infected with 300 MOI of AdCMV-TRAIL recombinant virus for 24 hours, and at least 85% of tumor cells when co-cultured with U343MG cells. More apoptosis was observed with low MOI in expression by CAG promoter. Only co-culture with HFT13 cell medium infected with AdCMV-GFP or AdCAG-GFP showed less than 7% of tumor cells killed (FIGS. 11B and 11C).

< Example  8>

Mechanism Analysis of Apoptosis

The death of tumor cells by human neural stem cells infected with AdCMV-TRAIL or AdCAG-TRAIL recombinant virus observed in Example 7 was investigated by apoptosis. Glioblastoma cell lines were treated with 30 ng / ml of rhTRAIL or co-cultured with human neural stem cell cultures infected with AdCMV-TRAIL or AdCMV-GFP virus. Thereafter, terminal deoxynucleotidyl transferase-mediated dUTP nick end-labelling (TUNEL) (TUNEL assay kit, Roche, Mannheim, Germany) was performed. 1 x 10 ⁵ U87MG or U343MG cells were plated in each well of a PLL-coated 8 well chamber slide for TUNEL staining, respectively. Media of virus-infected HFT13 cells, media of HFT13 cells infected with AdCMV-GFP, media of HFT13 cells infected with AdCMV-TRAIL, and rhTRAIL 30 ng / ml were treated, respectively. The timing of TUNEL staining was determined by observing apoptosis under brightfield microscope. U343MG cells began staining 4 hours after treatment and U87MG cells 7 hours after treatment. After removing the media of tumor cells, the cells were washed once with cold 1 × PBS. Cells were fixed for 15 minutes at room temperature with 4% paraformaldehyde (in Pipes buffer). The cells were washed three times with 1 × PBS and then treated with blocking solution (3% H ₂ O ₂ in methanol) for 10 minutes at room temperature. Thereafter, a permeabilization solution (0.1% Triton X-100 in 0.1% sodium citrate) was treated for 2 minutes. The cells were washed three times with 1 × PBS, and then reacted at 37 ° C. for one hour by adding TUNEL enzyme. The cells were washed three times and then mounted with fluorescence microscope mounting medium added with DAPI. Then, observation was carried out under a fluorescence microscope.

As a result, in the case of AdCMV-TRAIL-infected neural stem cell medium or rhTRAIL-treated U87MG cells, a very large number of cells showed positive TUNEL staining (green), whereas in AdCMV-GFP-infected neural stem cell medium or virus In the case of U87MG cells treated with the uninfected neural stem cell medium, the positive cells were not observed by TUNEL staining (FIG. 12). U343MG cells also showed similar results. From the above results, it was confirmed that human glioblastoma cell lines responded to TRAIL secreted not only from rhTRAIL but also from neural stem cells infected with AdCMV-TRAIL, and induced cell death by apoptosis.

< Example  9>

Glioblastoma  TRAIL Expression in Animal Models Transplantation of Human Neural Stem Cells and Analysis of Exogenous Gene Expression, Engraftment, Distribution, Migration and Differentiation of Donor Cells in Vivo

After expression of TRAIL in human neural stem cells infected with AdCMV-TRAIL virus, the cells were transplanted into human glioblastoma animal models to investigate the expression level, engraftment, distribution, migration and differentiation of foreign genes in donor cells. .

<9-1> Transplantation of TRAIL Expressing Human Neural Stem Cells

First, human neural stem cells cultured in the neurosphere state were treated with 0.05% trypsin / EDTA (Gibco) 3 days before transplantation and plated in a single cell state in a new culture plate. One hour later, 100 MOI of AdCMV-TRAIL was infected with the cells. After 24 hours, cells were washed once with N2 medium, and further incubated in growth factor-added N2 medium for 2 days. 0.05% trypsin / EDTA (Gibco) was treated for transplantation into single cells. Then, washed three times with HH buffer. Cells were stained with 0.05% trypan blue and stored on ice until transplanted. The U87MG cell line labeled with CM-DiI was implanted into the right mouse right nucleus in the same manner as in the surgical procedure for producing the animal model described in Example <3-2>. One week later, 4 μl (5 × 10 ⁵ cells) of TRAIL expressing HFT13 neural stem cells were injected through a skull burr hole into which tumor cells were injected. After 10 days, the animals were analyzed.

<9-2> In Vivo Analysis of Donor Cells

a) microscopic observation

After fixing the experimental animals prepared in Example <8-1> with 4% paraformaldehyde (in 0.1M Pipes buffer), the brain was extracted. The extracted brain was immersed in 30% sucrose (in PBS). After 1-2 days at 4 ℃ cryoprotection (cryoprotection), and was frozen at 16 ㎛. The brain tissue sections were placed on a slide and observed under a fluorescence microscope. As a result, TRAIL-expressing (green) donor cells showed engraftment and distribution in the form of infiltration into the mass surrounding the border of CM-DiI (red) primary mass formed on the right striatum of the animal (Fig. 13 AF). TRAIL-expressing neural stem cells transplanted into tumor animal models also migrated specifically to the primary mass as well as to the surrounding secondary mass (GI in FIG. 13). It showed engraftment around tumor cells (JL of FIG. 13).

b) Immunohistochemistry  analysis

Method described in Example <5-2> using an anti-TRAIL antibody to determine whether human neural stem cells infected with AdCMV-TRAIL express GAIL as well as TRFP at the tumor site after transplantation into the skull of a tumor model animal As stained by immunohistochemistry. As a result, it was confirmed that TRAIL is widely expressed in a region where neural stem cells were specifically engrafted at the mass site (A-F of FIG. 14).

c) Immunofluorescence Staining  analysis

In order to evaluate the differentiation state of donor cells, immunofluorescent staining was performed using marker neurons of various neurons. GFP-expressing donor cells (green) engrafted around the border of the mass (red) formed in the striatum of the model animal expressed human nestin (blue), a marker of immature neural stem cells. A large number of cells are present in undifferentiated state (AD of FIG. 14). Some GFP-expressing donor cells expressed GFAP (blue) at the tumor site and showed differentiation into astrocytic cells (EH in FIG. 14), and some transplanted cells expressed NeuN, a marker of neuronal cells inside the tumor, to neuronal cells. Differentiation was shown (HK in FIG. 14).

The above results indicate that TRAIL-expressing human neural stem cells have been transplanted to the intracranial striatum of the glioblastoma model animal and remain as undifferentiated neural stem cells, but some of the donor cells have been shown to have a short period of 10 days after transplantation. It showed the possibility of regenerating neurons of host animals destroyed by masses by differentiating into neurons and glial cells at the border or inside.

d) TUNEL  dyeing

TUNEL staining was performed to determine whether TRAIL expressed in transplanted donor cells induces tumor cell death at the tumor site. TUNEL staining was performed using the TUNEL Assay Kit (Roche, Mannheim, Germany). Slides with brain tissue sections attached were washed once with 1 × PBS and fixed for 20 minutes at room temperature with 4% paraformaldehyde (in 0.1 M Pipes). The fixed cells were washed three times with 1 × PBS and then left for 10 minutes at room temperature with blocking solution (3% H 2 O 2 in methanol). Permeate solution (0.1% Triton X-100 in 0.1% sodium citrate) was treated for 2 minutes. After washing the cells twice, TUNEL enzyme was added and reacted at 37 ° C for 1 hour. After washing the cells three times again, the converter-peroxidase solution (converter-peroxidase solution) was added to react for 30 minutes at 37 ℃. Cells were washed three times and then developed for 7 minutes with Novaed substrates (Vector). Then, control staining was performed with hematoxylin (Vector) for 4 minutes. Cells were last washed and then mounted with glycerol mounting medium (Dako). As a result, many cells showing death (dark brown color) were observed at the tumor sites showing TRAIL staining positive (DF in FIG. 15) under bright field microscope, and the density of the actual tumor cells was significantly reduced (FIG. 15). GH). TUNEL staining positive killer cells were observed not only in the primary mass site but also in the area where tumor cells showing metastasis from the primary site to the surrounding tissue were located (arrows in D-F and I in FIG. 15).

From the results obtained in a) to d), when human neural stem cells infected with AdCMV-TRAIL were transplanted into a brain tumor animal model, the donor cells penetrated into the mass and specifically surrounded the boundary of the primary mass. In addition, they adhered to tumor cells that metastasize to the surrounding nerve tissues, and showed specific migration. In addition, it was confirmed that human neural stem cells infected with AdCMV-TRAIL express TRAIL in vivo to induce tumor cell death and regenerate damaged neurons, thereby treating primary, secondary or metastatic refractory brain tumors.

< Example  10>

Glioblastoma  TRAIL Expression Reduction of Tumor Size after Transplantation of Human Neural Stem Cells in Animal Models

<10-1> CMV  Reduction of Tumor Size After Transplantation of Human Neural Stem Cells Expressing TRAIL by a Promoter

In the case of transplanting human neural stem cells infected with AdCMV-TRAIL into a brain tumor animal model, TRAIL was expressed in vivo to induce tumor cell death by TUNEL staining in Example <9-2>. Therefore, after transplanting neural stem cells infected with AdCMV-TRAIL to the glioblastoma site according to the method described in Example <9-1>, it was examined whether the tumor size actually decreased. To this end, immunohistochemical staining was performed according to the same method as in Example <5-2>. As a result, a large mass (red) was formed in the right striatum of the brain in the control group transplanted with only stem cells instead of stem cells in the glioblastoma model animal (FIG. 16), whereas the experimental group transplanted with TRAIL (green) expressing human neural stem cells was donated. The cells showed engraftment in the form of specifically enclosing the border of the mass formed in the right striatum and penetrating into the mass, and the actual tumor size was also significantly reduced compared to the control (AC in FIG. 16).

Then, in order to quantitatively evaluate the extent of tumor size reduction, all the slides containing the tumor were stained with hematoxylin in the experimental group and the control group, and then the tumor size was measured by the MetaMorph Imaging System (Universal Imaging Corporation, PA). , USA). To this end, AdCMV-TRAIL-infected human neural stem cells were implanted into the brain tumor animal model (n = 8), and only the control medium was implanted (n = 7). After 10 days of implantation, the brains of the animals were treated in the same manner as in a) of Example <8-2>, and frozen and cut to 16 탆 thickness. Each brain tissue section spacing on the slide was 96 μm each. The brain tissues were then stored at -20 ° C until stained. Slides were immersed in 1 × PBS for 20 minutes and stained for 4 minutes in hematoxylin solution. The slides were then washed in running water and mounted with glycerol mounting medium. After staining, the slides containing the mass sites were photographed at 100 × magnification under bright field microscope. The metamorphic imaging system was used to designate the mass site area, convert the number of pixels of the designated area into area, and multiply the thickness of the tissue section (96 μm) to determine the volume of the final mass. This was done for all experimental and control groups to compare the mean values.

As a result, in the U87MG glioblastoma animal model, the mean tumor volume of the control group was 2.40 mm ³ , whereas the mean tumor volume of the experimental group was 1.57 mm ³ . As a result of converting the tumor volume of the control group to 100%, it was confirmed that the tumor volume of the experimental group was 65.4 ± 5.2% (mean ± SEM) and significantly decreased (p <0.05, non-paired t test).

<10-2> CAG Reduction of Tumor Size After Transplantation of Human Neural Stem Cells Expressing TRAIL by a Promoter

In order to quantitatively evaluate the extent of tumor size reduction after transplantation of TRAIL-expressing human neural stem cells by CAG promoter, U87MG cell brain tumor model was established and 100 MOI AdCAG-TRAIL infected human neural stem cells were transplanted (n = 7), control group was implanted with cell medium only (n = 7). After 10 days, the average tumor volume was measured in all experimental and control groups in the same manner as in Example <10-1>.

As a result, in the U87MG glioblastoma animal model, the mean tumor volume of the control group was 2.80 mm ³ , whereas the mean tumor volume of the experimental group was 0.66 mm ³ . As a result of converting the tumor volume of the control group into 100%, the tumor volume of the experimental group was 23.43 ± 3.09% (mean ± SEM), which is the tumor volume of the experimental group using the CMV promoter in Example <10-1>. Compared with the decrease of 65.4 ± 5.2%, it was significantly decreased (p <0.01, non-paired t test).

As described above, human neural stem cells secreting TRAIL, transformed with a nucleic acid encoding TRAIL provided by the present invention, proliferate and grow in undifferentiated state on a plate without inducing cytotoxicity, and neurons in and outside the body. Have the ability to differentiate into neurons such as cells, oligodendrocytes and astrocytes. In addition, the neural stem cells of the present invention secrete TRAIL in human in vivo to induce atoposis of tumor cells and induce a decrease in tumor volume. Some donor cells of the neural stem cells of the present invention transplanted into a tumor human model can differentiate into neurons or glial cells in the transplanted tumor site to replace and regenerate neuronal cells damaged by the tumor. Therefore, the neural stem cells of the present invention can be usefully used for the treatment or prevention of tumors.

Attach sequence list electronic file

Claims (21)

A human neural stem cell that secretes TRAIL, transformed by a viral vector comprising a CAG promoter region and a nucleic acid encoding a tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) operably linked thereto. According to claim 1, Neural stem cells, characterized in that it has a characteristic selected from the group consisting of (a) to (e): (a) expresses nestin and vimentin; (b) has the ability to differentiate into any one selected from the group consisting of neuronal cells, oligodendrocytes and astrocytic cells; (c) engrafted and distributed in a manner of specifically enclosing the border of the primary mass in a human body and infiltrating into the mass; (d) specifically migrate along tumor cells that metastasize in vivo in humans to engraft and distribute to secondary masses; And (e) induce apoptosis of tumor cells in humans in vivo. The neural stem cell of claim 1, wherein the TRAIL comprises an amino acid sequence represented by SEQ ID NO: 1. delete The neural stem cell of claim 1, wherein the viral vector further comprises a leucine or isoleucine zipper domain and a secretion signal sequence. The neural stem cell of claim 1, wherein the viral vector is selected from the group consisting of a retroviral vector, an adenovirus vector, a herpesvirus vector, a lentivirus vector, and an abipoxvirus vector. The neural stem cell of claim 5, wherein the secretory signal sequence is an Igκ-chain leader. delete delete The neural stem cell of claim 1, wherein the viral vector has a cleavage map shown in FIG. 6D or 6E. (a) preparing a recombinant viral vector comprising a DNA construct sequentially linked to a CAG promoter and a secretory signal sequence operably linked thereto, a leucine or isoleucine zipper and a nucleic acid encoding TRAIL; And (b) transfecting said recombinant viral vector with a virus producing cell line to produce a TRAIL expressing recombinant virus; And (c) a method for producing neural stem cells of claim 1, comprising the step of infecting human neural stem cells in animals or in vitro with the TRAIL expressing recombinant virus. 12. The method of claim 11, wherein the secretion signal sequence is an Igκ-chain leader. The method of claim 11, wherein the TRAIL comprises an amino acid sequence represented by SEQ ID NO: 1. The method of claim 11, wherein the viral vector is selected from the group consisting of a retroviral vector, an adenovirus vector, a herpesvirus vector, a lentiviral vector and an abipoxvirus vector. delete delete 12. The method of claim 11, wherein said viral vector has a cleavage map shown in FIG. 6D or 6E. The method of claim 11, wherein the human neural stem cells are prepared by culturing cells obtained from brain tissue of a human fetus in a medium to which neural stem cell growth factor is added. The method of claim 18, wherein the neural stem cell growth factors are fibroblast growth factor-basic (bFGF), leukemia inhibitory factor (LIF), and heparin. A pharmaceutical composition for treating a tumor containing the neural stem cells of claim 1. 21. The composition of claim 20, wherein the tumor is any one selected from the group consisting of glioma, meningioma, pituitary adenoma, medulloblastoma, metastatic brain tumor, auditory neuroma, prostate cancer, malignant melanoma and neuroblastoma. .

Images