CN113774031B - Replication type human adenovirus and application thereof - Google Patents

Abstract

The invention discloses a replication type human adenovirus and application thereof. The complete sequence of the vector is shown as SEQ ID NO. 21. The replication type human adenovirus of some examples of the invention can be directly injected into solid tumors after loading related nucleic acid sequences, including but not limited to H1299, skov-3, U251 and other tumors, and can be identified to replicate in tumor cells and directly kill the tumor cells, and infect surrounding tumor cells after the infected tumor cells are lysed; meanwhile, the composition has no killing effect on normal human cells and unexpected oncolytic effect.

Description

Replication type human adenovirus and application thereof

Technical Field

The invention relates to the field of gene therapy, in particular to a recombinant oncolytic adenovirus, a recombinant oncolytic adenovirus vector for preparing the recombinant oncolytic adenovirus and application thereof.

Background

Cancers are caused by either self-factors (genetic mutations, natural aging, etc.) or environmental factors (e.g., smoking, ultraviolet radiation, chemicals, viral infections, etc.). According to WHO reports, tumors are currently the second leading cause of death in the world, with nearly 1/6 of the world's deaths being caused by cancer. Global cancer deaths in 2018 reach 960 ten thousand. By 2025, the number of new cancer cases worldwide will be expected to be as high as 2449 thousands per year. Among them, lung cancer has the greatest number of deaths, followed by colorectal cancer, gastric cancer, liver cancer and breast cancer.

Classical methods of treating cancer are mainly surgery, chemotherapy, and radiotherapy. The surgical excision effect is limited, and the effect on metastatic cancer cells is not achieved; the side effects of radiotherapy and chemotherapy are large, and although target drugs improve the life quality of patients to a great extent, tolerance is a constant problem faced by chemotherapy. In recent years, immunotherapy has become a hotspot in the field of cancer treatment. The principle of the immunotherapy is to eliminate tumor cells by activating the immune system of the organism, and has the advantages of good curative effect, small side effect, relapse prevention and the like.

Oncolytic viruses have been rising again in the field of cancer therapy in recent years. Oncolytic viruses (oncotic viruses) are a class of viruses that have replication capacity and are capable of directly lysing tumor cells. As early as 1912, italian doctors found that a cervical cancer patient had tumor regressed after infection with rabies virus. China approves the first oncolytic adenovirus (H101) to be marketed in the world in 2005, but the clinical efficacy is not yet internationally approved. The virus knocks out most of the genes in E1B-55K and E3 regions. The E1B-55K protein can inhibit the expression of an anticancer gene P53 and prevent P53-mediated apoptosis of infected cells. Since the P53 protein in normal cells functions well and most tumors lose P53 function, deletion of the E1B-55K gene allows the virus to replicate specifically in tumor cells lacking functional P53. However, the E1B-55K protein is a protein necessary for export of viral mRNA from the nucleus, and thus, the replication ability and oncolytic ability of H101 are significantly reduced compared to the wild strain. In 2015, the FDA approved the first oncolytic virus therapy T-vec (herpes simplex virus-1) for the treatment of recurrent melanoma following surgical excision. As a third generation oncolytic virus, T-vec deletes the gamma 34.5 gene, so that the oncolytic virus has tumor cell targeting, and meanwhile, the oncolytic virus also carries GM-CSF (granulocyte-macrophage colony factor) to enhance the anti-tumor immunity.

Oncolytic viruses are an important branch of immunotherapy, which can kill tumor cells through a variety of different pathways of action and destroy the microenvironment of tumor immunosuppression to induce a long-term tumor-specific immune response, while also enhancing anti-tumor efficacy by carrying therapeutic genes to be specifically expressed in tumor cells for a long period of time. In addition, the experimental results of the combined administration of the oncolytic virus and other anticancer drugs, such as the combined immune checkpoint inhibitor, show good anti-tumor effect. In recent years, many viruses including vaccinia virus, reovirus, measles virus, herpes simplex virus, newcastle disease virus, and coxsackievirus have been tested clinically as oncolytic agents.

Adenovirus (adenoviruses) is a particle with no envelope and the diameter of 70-90 nm, and is formed by arranging 252 shell particles in a twenty-face body. The diameter of each shell particle is 7-9 nm. Within the capsid is a linear double stranded DNA molecule of about 4.7kb with inverted terminal repeats of about 100-600 bp in length at each end. Human adenoviruses (Human adenoviruses, HAdV) belong to the Adenoviridae family (Adenoviridae) and are classified into a-G7 subspecies according to immunological, biological and biochemical characteristics, with a total of 52 serotypes, and different serotypes have different organ affinities and cause corresponding clinical manifestations. Adenovirus can cause at least 3 infections following invasion of host cells: chronic, latent infection: usually in lymphocyte, the virus amount is very small when latent infection is carried out, and cell necrosis is not obvious, so that clinical infection is not obvious, and the mechanism of latent infection is not clear. Soluble infection: viruses undergo a replication process within cells, such as human epithelial cells, which cause cell death by lytic action. Tumor-like variation: at this time, the virus propagation is only carried out for the first few steps, and then adenovirus DNA is integrated with cell DNA and replicated, but infectious viruses are not produced, and the antigenicity of the adenovirus is stable.

Zhou, he Wanwan, zhu Zhennan, et al, J. Chinese journal of bioengineering, 2013,33 (12): 105-113, indicates that oncolytic adenoviruses are capable of specifically infecting tumor cells and completing an infection-replication cycle in the tumor cells, thereby specifically killing and lysing the tumor cells without damaging other normal cells and tissues, and thus are one of the most promising antitumor drugs at present. Different viruses have complex biological properties, and the viral resources which are fully familiar to human beings are still relatively deficient. Especially, most preclinical experimental data are derived from tumor transplantation models of human in vivo of immunodeficiency animals, and have great differences from human in vivo environment, biological characteristics of tissue cells and the like. There is no obvious commonality between the existing oncolytic adenoviruses, and it is difficult to determine whether the adenovirus has oncolytic effect based on the sequence of the adenovirus, but most adenoviruses are insensitive to tumor cells and do not have oncolytic property.

Disclosure of Invention

The invention aims to overcome at least one defect in the prior art and provides an oncolytic adenovirus vector and application thereof.

The technical scheme adopted by the invention is as follows:

in a first aspect of the invention, there is provided:

a replication competent human adenovirus having the full sequence set forth in SEQ ID No.:21, wherein the resistance selection gene can be replaced with a known selection gene.

In some examples, the full sequence of the replication competent human adenovirus is as set forth in SEQ ID No.: 21.

In some examples, the E1 and E3 regions of the virus are deleted.

In some examples, the virus is replicable in animal cells, human cells, or humans.

In some examples, the method of constructing a replication competent human adenovirus comprises:

s1) carrying out PCR amplification to obtain the left end and the right end of the NBOV1901 genome, connecting the two ends with a resistance vector plasmid A to obtain pT-NBOV1901 (L+R), linearizing, and recombining with the NBOV1901 genome to obtain a genome plasmid pNBOV1901;

s2) connecting left and right arms from SrfI to the whole E3 region to a resistance vector plasmid B, linearizing, and recombining with PacI digested NBOV1901 to obtain a genome plasmid pNBOV1901 delta E3-SrfI with SrfI removed to the whole E3 region;

s3) PCR amplification is carried out by taking NBOV1901 genome as a template to obtain E3gp19K upstream fragment: srfI to E3gp19K, and E3gp19K downstream fragments: e3gp19K to E3 region contains E3-14.7K gene fragment, three fragments of E3gp19K upstream fragment, E3gp19K downstream fragment and construction vector after enzyme digestion are recombined and connected between left and right arms of pNBOV1901 delta E3-SrfI, and are recombined with pNBOV1901 delta E3-SrfI after linearization to obtain genome plasmid pNBOV1901 delta E3gp19K with modified SrfI enzyme digestion site;

s4) connecting left and right arms of an E1 region obtained by PCR amplification to a resistance vector plasmid B, and recombining the linearized plasmid with pNBOV1901 delta E3gp19K digested by SrfI to obtain a genome plasmid pNBOV1901 delta E3gp19K delta E1 with the E1 region removed;

s5) PCR amplification to obtain the E1 region genome with the E1B19K, pRB gene removed, connecting the genome to a resistance vector plasmid B containing the left and right arms of the E1 region, linearizing, and recombining with the digested pNBOV1901 delta E3gp19K delta E1 to obtain a genome plasmid pNBOV1910 with the E1B19K, pRB gene knocked out, namely the replication type human adenovirus.

In some examples, the resistance vector plasmid a and the resistance vector plasmid B have different resistances.

In some examples, the resistance vector plasmid a and the resistance vector plasmid B are independently selected from an ampicillin resistance vector plasmid or a kanamycin resistance vector plasmid. These resistant plasmids are more mature, readily available, and lower in screening costs.

In some examples, comprising:

s1) carrying out PCR amplification to obtain the left end and the right end of the NBOV1901 genome, connecting the two ends with an ampicillin resistance vector plasmid to obtain pT-NBOV1901 (L+R), linearizing, and recombining with the NBOV1901 genome to obtain a genome plasmid pNBOV1901;

s2) PCR amplification to obtain a left arm and a right arm from SrfI to the whole E3 region, connecting the left arm and the right arm to a kanamycin resistance vector plasmid, and recombining the linearized arms with PacI digested NBOV1901 to obtain a genome plasmid pNBOV1901 delta E3-SrfI with SrfI removed to the whole E3 region;

s3) PCR amplification is carried out by taking NBOV1901 genome as a template to obtain E3gp19K upstream fragment: srfI to E3gp19K, and E3gp19K downstream fragments: e3gp19K to E3 region contains E3-14.7K gene fragment, three fragments of E3gp19K upstream fragment, E3gp19K downstream fragment and construction vector after enzyme digestion are recombined and connected between left and right arms of pNBOV1901 delta E3-SrfI, and are recombined with pNBOV1901 delta E3-SrfI after linearization to obtain genome plasmid pNBOV1901 delta E3gp19K with modified SrfI enzyme digestion site;

s4) carrying out PCR amplification to obtain left and right arms of an E1 region, connecting the left and right arms to a kanamycin resistance vector plasmid, and carrying out linearization and recombination with pNBOV1901 delta E3gp19K digested by SrfI to obtain genome plasmid pNBOV1901 delta E3gp19K delta E1 with the E1 region removed;

s5) PCR amplification to obtain E1 region genome with E1b19K, pRB gene removed, connecting the genome to kanamycin resistance carrier plasmid containing left and right arms of E1 region, linearizing, recombining with digested pNBOV1901 delta E3gp19K delta E1 to obtain genome plasmid pNBOV1910 with E1b19K, pRB gene knocked out.

In a second aspect of the invention, there is provided:

the use of a replication competent human adenovirus according to the first aspect of the invention as a recombinant oncolytic viral vector.

In some examples, the recombinant oncolytic viral vector is loaded with a nucleic acid sequence that expresses:

molecules having therapeutic effects on tumors;

biological reports trace molecules.

In some examples, the molecule having a therapeutic effect on a tumor is selected from the group consisting of a tumor suppressor, a tumor killer, a tumor microenvironment regulator, a tumor cell surface specific binding factor;

the biological reporter tracer molecule is selected from beta-galactosidase, secreted alkaline phosphatase, green fluorescent protein and luciferase.

In some examples, the recombinant oncolytic viral vector is further loaded with a nucleic acid sequence that expresses a tumor specific recognition factor.

In some examples, the tumor-specific recognition factor is selected from the group consisting of a tumor epitope-specific recognition factor, a tumor cell-selective replication factor.

These molecules or sequences may be known to those skilled in the art.

In some examples, the tumor is selected from lung cancer, liver cancer, stomach cancer, colorectal cancer, pancreatic cancer, ovarian cancer.

In some examples, at least one of the original E1 region and E3 region of the vector is used to integrate a foreign gene.

In a third aspect of the invention, there is provided:

a composition comprising a replication competent human adenovirus according to the first aspect of the invention.

In some examples, the composition includes: a) An immune modulator; b) An immunoregulatory cell; c) A radiation therapy; d) Phototherapy compounds; or e) at least one of a chemotherapeutic compound.

In some examples, the composition further comprises a pharmaceutically acceptable adjuvant, diluent or excipient.

In a fourth aspect of the invention, there is provided:

an oncolytic formulation comprising a replicating human adenovirus according to the first aspect of the invention.

In some examples, the replication competent human adenovirus is loaded with a nucleic acid sequence that expresses:

molecules having therapeutic effects on tumors;

biological reports trace molecules.

In some examples, the molecule having a therapeutic effect on a tumor is selected from the group consisting of a tumor suppressor, a tumor killer, a tumor microenvironment regulator, a tumor cell surface specific binding factor;

the biological reporter tracer molecule is selected from beta-galactosidase, secreted alkaline phosphatase, green fluorescent protein and luciferase.

In some examples, the recombinant oncolytic viral vector is further loaded with a nucleic acid sequence that expresses a tumor specific recognition factor.

In some examples, the tumor-specific recognition factor is selected from the group consisting of a tumor epitope-specific recognition factor, a tumor cell-selective replication factor.

In some examples, the tumor is selected from lung cancer, liver cancer, stomach cancer, colorectal cancer, pancreatic cancer, ovarian cancer.

In a fifth aspect of the invention, there is provided:

use of a composition according to the third aspect of the invention for the preparation of a formulation for the prevention or treatment of a tumour or tumour assay.

In some examples, the tumor is selected from breast cancer, brain cancer, lung cancer, nasopharyngeal cancer, head and neck cancer, kidney cancer, bladder cancer, liver cancer, esophageal cancer, stomach cancer, colorectal cancer, pancreatic cancer, ovarian cancer, skin cancer, prostate cancer, fallopian tube cancer, urinary tract cancer, genitourinary system cancer, endometriosis, cervical cancer, bone cancer, or metastatic lesions of cancer.

The beneficial effects of the invention are as follows:

the replication type human adenovirus of some examples of the invention can be directly injected into solid tumors after loading related nucleic acid sequences, including but not limited to H1299, skov-3, U251 and other tumors, and can be identified to replicate in tumor cells and directly kill the tumor cells, and infect surrounding tumor cells after the infected tumor cells are lysed; meanwhile, the composition has no killing effect on normal human cells and unexpected oncolytic effect.

The replication competent adenovirus of some examples of the invention has dual targeting for a variety of tumor cells H1299, U251, skov-3, etc.

Drawings

FIG. 1 shows the principle of genomic circularization of NBOV1901 using homologous recombination (A), and the results of cleavage identification of pNBOV1901 (B);

FIG. 2 is a schematic diagram of the genome of the region from SrfI to the whole E3 of the knockdown NBOV1901 (A), and the PCR and restriction characterization results of pNBOV1901. DELTA.E3-SrfI (B);

FIG. 3 is a schematic diagram of the gene (A) of the knock-out NBOV1901E3gp19K and the cleavage result (B) of pNBOV1901. DELTA.E3 gp19K;

FIG. 4 shows the results of PCR and cleavage assay (B) for the knockdown of NBOV1901E1 gene schematic (A) and pNBOV1901. DELTA.E3 gp19K;

FIG. 5 is a schematic diagram (A) of the gene knockout NBOV1901E1B19K, pRB and the cleavage result (B) of pNBOV 1910;

FIG. 6 shows the production and purification results of replication competent adenovirus NBOV1901 recombinant adenovirus;

FIG. 7 is a graph showing the results of two-way screening of replication competent adenovirus NBOV1901 recombinant adenovirus in various tumor cells;

FIG. 8 is the effect of non-core region engineering of replication competent adenovirus NBOV1901 recombinant adenovirus on oncolytic effect of H1299 cells;

FIG. 9 is an experimental result of replication competent adenovirus NBOV1901 recombinant adenovirus on H1299 mouse tumor model;

FIG. 10 shows the oncolytic effect of a conventional oncolytic adenovirus.

In FIGS. 1 to 5, M represents 15000bp DNA Marker.

Detailed Description

The novel adenovirus vector pNBOV1901 of the invention modifies an adenovirus NBOV1901 isolated from a human pharyngeal swab sample (GenBank of complete sequences: MH 558113.1). NBOV1901 is a novel human adenovirus, unlike the adenovirus reported so far. The E1A gene of adenovirus is an essential gene for regulating the cell cycle of the virus, and the cell cycle is enabled to enter the S phase from the G1 phase through the combination of CR2 binding site on the E1A gene and Rb protein of the cell. The tumor targeting adenovirus vector pNBOV1910 of the invention deletes E1A-CR2, so that the E1A of the virus cannot be combined with Rb protein of host cells. Thus, pNBOV1910 can only selectively replicate in cells in the dividing phase, such as tumor cells, but not in normal cells, thereby increasing the specificity and safety of oncolysis.

Adenovirus E1B19K is homologous to cellular Bcl-2 gene and can inhibit apoptosis by binding to Beclin-1. Whereas the E3gp19K protein can bind to the heavy chain of MHC class I molecules on the endoplasmic reticulum preventing their transport to the cell surface and can delay MHC I expression. Therefore, deleting these two genes can increase the tumor selectivity and the diffusion capacity of the virus in the tumor, and activate the host immune response, thereby enhancing the killing capacity of epidemic toxin to tumor cells.

The adenovirus transcription unit encodes a series of polypeptides with related functions, and the E1A unit encodes two major proteins that activate transcription and induce host cells into the S phase of the cell cycle; E1B encodes two proteins that block apoptosis; e2 encodes three proteins directly involved in DNA replication; e3 encodes a product that modulates the host's response to infection; later families of mRNAs are involved in the production and assembly of capsid components. The E4 product mediates transcription, RNA splicing and translational regulation; mRNA nuclei export and regulate DNA replication and apoptosis. Deletion of E1B19K and E3 does not affect adenovirus replication and makes room for insertion of foreign genes

A replicative adenovirus vector pNBOV1901 prepared by the method of: the NBOV1901 genome was circularized, and the E3gp19K, E1b19K, pRB gene was knocked out.

In some examples, the gene encoding the RGD peptide is introduced into an adenovirus plasmid, constituting a targeting backbone plasmid.

A method for preparing replication type human NBOV1901 type oncolytic adenovirus vector, which comprises the following steps:

s1) carrying out PCR amplification to obtain the left end and the right end of the NBOV1901 genome, connecting the two ends with an ampicillin resistance vector plasmid to obtain pT-NBOV1901 (L+R), linearizing, and recombining with the NBOV1901 genome to obtain a genome plasmid pNBOV1901;

s2) PCR amplification to obtain a left arm and a right arm from SrfI to the whole E3 region, connecting the left arm and the right arm to a kanamycin resistance vector plasmid, and recombining the linearized arms with PacI digested NBOV1901 to obtain a genome plasmid pNBOV1901 delta E3-SrfI with SrfI removed to the whole E3 region;

s3) PCR amplification is carried out by taking NBOV1901 genome as a template to obtain E3gp19K upstream fragment: srfI to E3gp19K, and E3gp19K downstream fragments: e3gp19K to E3 region contains E3-14.7K gene fragment, three fragments of E3gp19K upstream fragment, E3gp19K downstream fragment and construction vector after enzyme digestion are recombined and connected between left and right arms of pNBOV1901 delta E3-SrfI, and are recombined with pNBOV1901 delta E3-SrfI after linearization to obtain genome plasmid pNBOV1901 delta E3gp19K with modified SrfI enzyme digestion site;

s4) carrying out PCR amplification to obtain left and right arms of an E1 region, connecting the left and right arms to a kanamycin resistance vector plasmid, and carrying out linearization and recombination with pNBOV1901 delta E3gp19K digested by SrfI to obtain genome plasmid pNBOV1901 delta E3gp19K delta E1 with the E1 region removed;

s5) PCR amplification to obtain E1 region genome with E1b19K, pRB gene removed, connecting the genome to kanamycin resistance carrier plasmid containing left and right arms of E1 region, linearizing, recombining with digested pNBOV1901 delta E3gp19K delta E1 to obtain genome plasmid pNBOV1910 with E1b19K, pRB gene knocked out.

Ampicillin and kanamycin resistant vector plasmids can be replaced by other well-known selection plasmids, so long as efficient isolation of the product can be achieved.

In some examples, the specific method of step S1 is:

the NBOV1901 genome was used as a template, L-NBOV1901 and R-NBOV1901 at both right and left ends of the NBOV1901 genome were amplified by PCR as recombinant arms and ligated to the linearized T vector to obtain pT-NBOV1901 (L+R), ecoRI and BamHI were introduced between the right and left arms of pT-NBOV1901 (L+R) as cleavage sites, and EcoRI+BamHI was digested into pT-NBOV1901 (L+R) and linearized and recombined with the NBOV1901 genome to obtain pNBOV1901.

Further, in some examples, the specific method of step S1 is:

the NBOV1901 genome was amplified by PCR using the NBOV1901 genome as a template to obtain L-NBOV1901 and R-NBOV1901 at both left and right ends, and three-fragment recombination was performed on the L-NBOV1901 and R-NBOV1901 and the linearized T vector using Exnase recombinase to obtain pT-NBOV1901 (L+R), and EcoRI and BamHI were introduced between the left and right arms of pT-NBOV1901 (L+R) as cleavage sites, and pT-NBOV1901 (L+R) was linearized by EcoRI+BamHI double cleavage and recombined with NBOV1901 genome to obtain pNBOV1901.

In some examples, the specific method of step S2 is:

the NBOV1901 genome is used as a template, the left and right arm genes L-delta E3-SrfI and R-delta E3-SrfI from SrfI to the whole E3 region are obtained through PCR amplification and are connected to a linearized T vector to obtain pT-delta E3-SrfI (L+R), the linearized pT-delta E3-SrfI is recombined with the PacI digested pNBOV1901 genome to obtain a genome plasmid pNBOV1901 with delta E3-SrfI knocked out and unique enzyme digestion sites PacI are introduced at the delta E3-SrfI position.

Further, in some examples, the specific method of step S2 is:

the NBOV1901 genome is used as a template, homologous arms L-delta E3-SrfI and R-delta E3-SrfI at the left end and the right end of an E3-SrfI region are obtained through PCR amplification, and three fragments are connected by using an Exnase recombinase to obtain pVax-delta E3-SrfI. Homologous recombination is carried out on the linearized plasmid pNBOV1901 and PacI enzyme tangential, the E3-SrfI region gene is knocked out after ampicillin resistance screening, and the unique linearized enzyme cutting site swaI plasmid pNBOV1901 delta E3-SrfI is introduced.

In some examples, the specific method of step S3 is:

the NBOV1901 genome is used as a template, an E3gp19K upstream fragment (SrfI to E3gp 19K) and an E3gp19K downstream fragment (E3 gp19K to E3 region, comprising E3-14.7K gene fragments) are obtained through PCR amplification, the three fragments of the Exnase recombinase are recombined and connected between the left arm and the right arm of pVAX-delta E3-SrfI (L+R), a pVAX-delta E3gp19K vector plasmid is obtained, and after linearization, homologous recombination is carried out on the pNBOV1901 delta E3-SrfI genome plasmid digested by PacI, and the pNBOV1901 delta E3gp19K genome plasmid knocked out of E3gp19K is obtained through ampicillin resistance gene screening.

In some examples, the specific method of step S4 is:

the NBOV1901 genome is used as a template, an E1 gene homologous recombination arm L-delta E1 and R-delta E1 are obtained through PCR amplification and are connected to a linearized T vector to obtain pVAX-delta E1 (L+R), after linearization, the pVAX-delta E1 is subjected to homologous recombination with pNBOV1901 delta E3gp19K which is digested by SrfI, an E1 gene is knocked out through ampicillin resistance screening, and a unique linearized restriction site SrfI plasmid pNBOV1901 delta E3gp19K delta E1 is introduced into an E1 gene region.

Further, in some examples, the specific method of step S4 is:

the NBOV1901 genome is used as a template, the homologous recombination arms L-delta E1 and R-delta E1 of the E1 gene are obtained through PCR amplification, a skeleton of pVAX is obtained through PCR by using a pVAX vector as a template, three fragments are connected by using an Exnase recombinase to obtain pVAX-delta E3gp19K delta E1 (L+R), pVAX-delta E3gp19K delta E1 (L+R) is subjected to double digestion by using Bstz17I+SgrAI, pNBOV 1901delta E3gp19K is subjected to enzyme digestion by using SrfI, and the fragments recovered by the two enzyme digestion are subjected to homologous recombination to obtain a genome plasmid pNBOV1901 delta E3gp19K delta E1 with a unique enzyme digestion site SrfI.

In some examples, the specific method of step S5 is:

the NBOV1901 genome is taken as a template, the E1 region gene deleted from the E1b19K, pRB gene is obtained through PCR amplification, the gene is connected between the left arm and the right arm of pVAX-delta E3gp19K delta E1 (L+R), homologous recombination is carried out on the gene and the SrfI digested pNBOV1901 delta E3gp19K delta E1 genome after linearization, and the genome plasmid pNBOV1910 with the E1b19K, pRB gene knocked out is obtained through screening of an ampicillin resistance gene.

Further, in some examples, the specific method of step S5 is:

the NBOV1901 genome is used as a template, the E1 region gene deleted from the E1B19K, pRB gene is obtained by PCR amplification, pVAX-delta E3gp19K delta E1 (L+R) which is tangential to SrfI enzyme is recombined by using an Exnase recombinase to obtain pVAX-delta E1B19K_pRB, pVAX-delta E1B19K_pRB is digested by Bstz17I+SgrAI, pNBOV 1901delta E3gp19K delta E1 is digested by using SrfI, and fragments obtained by digestion of the two are subjected to homologous recombination and screening by using an ampicillin resistance gene to obtain a genome plasmid pNBOV1910 deleted from the E1B19K, pRB gene.

In some examples, the recombinant adenovirus vector pNBOV1910 was linearized using AsisI digestion, ethanol precipitation recovered, transfected 293 cells were subjected to virus rescue, amplification culture, and CsCl density gradient centrifugation to purify NBOV1910.

The term "foreign sequence" according to the present invention refers to any DNA sequence of non-NBOV 1901 adenovirus origin. It will be appreciated by those of ordinary skill in the art that the exogenous sequence may be an exogenous gene expression cassette, or an expression cassette for an shRNA or miRNA, or the like.

In the following examples, the exogenous gene expression cassette may comprise a eukaryotic promoter, exogenous gene coding sequence, transcription terminator, as understood by those skilled in the art. The foreign gene coding sequence can be, but is not limited to, the coding sequence of green fluorescent protein, other viral antigens, shRNA, etc.

In order that the technical contents of the present invention may be more clearly understood, the following embodiments are specifically described with reference to the accompanying drawings. It is to be understood that these examples are illustrative of the present invention and are not intended to limit the scope of the present invention. The experimental procedure, which does not address the specific conditions in the examples below, is generally followed by routine conditions, such as, for example, sambrook et al, molecular cloning: conditions described in the laboratory Manual (New York: coldSpring Harbor Laboratory Press, 1989) or as recommended by the manufacturer. The various chemicals commonly used in the examples are commercially available.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

Example 1: cyclization of NBOV1901 genome

1. Construction of shuttle plasmid pT-NBOV1901 (L+R) which circularizes NBOV1901 genome.

Referring to FIG. 1A, the left arm (L-NBOV 1901) and the right arm (R-NBOV 1901) of NBOV1901 genomes were obtained by PCR using the genome of NBOV1901 as a template.

L-NBOV1901 primer:

L-NBOV1901-F：gcgggatccgaattcttaatgcgatcgccatcatcaataatataccttat(SEQ ID NO.：1)

L-NBOV1901-R：tatctgcatgagcatgatgatatcctttgacccggaacgcgg(SEQ ID NO.：2)

PCR conditions: 95 ℃ for 3min;95 ℃ for 30s; 30s at 60 ℃;72 ℃,30s; cycles 28;72 ℃ for 5min; preserving at 12 ℃.

R-NBOV1901 primer:

R-NBOV1901-F：ccgcgttccgggtcaaaggatatcatcatgctcatgcagata(SEQ ID NO.：3)

R-NBOV1901-R：gaagcgagatcgaattcttagcgatcgccatcatcaataaatacctta(SEQ ID NO.：4)

PCR conditions: 95 ℃ for 3min;95 ℃ for 30s; 30s at 60 ℃;72 ℃ for 1min; cycles 28;72 ℃ for 5min; preserving at 12 ℃.

2. Construction of pNBOV1901.

pT-NBOV1901 (L+R) was digested with EcoRI+BamHI, then recombined with NBOV1901 genome co-transformed BJ5183 competent cells, resistance screening was performed on ampicillin resistance plates, the screening was performed to obtain monoclonal amplified and plasmid transformed XL competent cells, plasmid was extracted to obtain pNBOV1901, and different digestion patterns were used for identification (FIG. 1B), pNBOV1901 introduced two AsiI digestion sites on both sides of the genome, facilitating subsequent linearization of the genome of the modified NBOV1901 for virus rescue.

Example 2: construction of pNBOV1901ΔE3_SrfI plasmid by knock-out of SrfI to E3 region Gene

1. Construction of a shuttle plasmid pVax-. DELTA.E3_SrfI (L+R) with SrfI to E3 region gene knockout.

Referring to FIG. 2A, the left arm (L-. DELTA.E3_SrfI) and the right arm (R-. DELTA.E3_SrfI) of the SrfI to E3 region genes were obtained by PCR using the genome of NBOV1901 as a template.

L- ΔE3_SrfI primer:

L-ΔE3_SrfI-F：gatatacgcgtgtatac cttcccaggatggcaccca(SEQ ID NO.：5)

L-ΔE3_SrfI-R：gtaagtaatttattgtgtgtttatg ttaattaa ctgtgtgaccgctgctgt(SEQ ID NO.：6)

PCR conditions: 95 ℃ for 3min;95 ℃ for 30s; 30s at 60 ℃;72 ℃,30s; cycles 28;72 ℃ for 5min; preserving at 12 ℃.

R-. DELTA.E3 primer:

R-ΔE3_SrfI-F：acagcagcggtcacacag ttaattaa cataaacacacaataaattacttac(SEQ ID NO.：7)

R-ΔE3_SrfI-R：ccgcccagtagaagcgccggtg ccgcccgttttaatttccatgtt(SEQ ID NO.：8)

PCR conditions: 95 ℃ for 3min;95 ℃ for 30s; 30s at 60 ℃;72 ℃,50s; cycles 28;72 ℃ for 5min; preserving at 12 ℃.

Plasmid backbones obtained by double digestion of the pVax vector with L-DeltaE3_SrfI, R-DeltaE3_SrfI and Bstz17I+SgrAI were ligated in three fragments using the Exnase enzyme to obtain pVax-DeltaE3_SrfI (L+R).

2. Construction of pNBOV1901ΔE3_SrfI

pVax-delta E3_SrfI (L+R) is digested with Bstz17I+SgrAI, pNBOV1901 is digested with PacI, BJ5183 competent cells are transformed by the fragments recovered by the digestion of the two fragments together, recombination is carried out, resistance screening is carried out by an ampicillin resistance plate, the screened plasmid is extracted to transform XL competent cells after monoclonal amplification, plasmid is extracted to obtain pNBOV 1901delta E3_SrfI, different digestion modes are used for identification (figure 2B), and pNBOV 1901delta E3_SrfI introduces a unique digestion site PacI in a knocked-out gene region, so that subsequent cloning operation is facilitated.

Example 3: construction of pNBOV 1901.DELTA.E3 gp19K plasmid

1. A shuttle vector pVAX-delta E3gp19K was constructed to knock out E3gp19K.

Referring to FIG. 3A, PCR amplification yielded a gene fragment from SrfI (site) to the entire E3 region except E3gp19K, using NBOV1901 genome as a template.

E3gp19K upstream fragment P1-E3-SrfI delta E3gp19K:

E3gp19K-F1：gtcacagggtgcggtcgccaggacagggtataactcacct(SEQ ID NO.：9)

E3gp19K-R1：ggaatacaagcaagcggaaaa tcatcttggatgtcgcccccag(SEQ ID NO.：10)

PCR conditions: 95 ℃ for 3min;95 ℃ for 30s; 30s at 60 ℃;72 ℃,30s; cycles 28;72 ℃ for 5min; preserving at 12 ℃.

E3gp19K downstream fragment P2-E3-SrfI delta E3gp19K;

E3gp19K-F2：ctgggggcgacatccaagatga ttttccgcttgcttgtattcc(SEQ ID NO.：11)

E3gp19K-R2：ccgcccagtagaagcgccggtg ccgcccgttttaatttccatgtt(SEQ ID NO.：8)

and (3) performing three-fragment ligation on the P1-E3-SrfI delta E3gp19K, P2-E3-SrfI delta E3gp19K and the PacI digested pVAX-delta E3-SrfI (L+R) by using an Exnase enzyme to obtain pVAX-delta E3gp19K.

2. Construction of pNBOV 1901.DELTA.E3 gp19K plasmid

pVAX-delta E3gp19K was digested with Bstz17I+SgrAI, pNBOV 1901delta E3_SrfI was digested with PacI, the two digested fragments were co-transformed into BJ5183 competent cells for recombination, resistance screening with ampicillin resistance plates, the screening was performed to obtain monoclonal amplified and then plasmid transformed XL competent cells were extracted, plasmid was extracted to obtain pVAX-delta E3gp19K, and different digestion protocols were used for identification (FIG. 3B).

Example 4: construction of pNBOV 1901.DELTA.E3gp 19 K.DELTA.E1 plasmid

1. A shuttle vector pVAX-delta E3gp19K delta E1 (L+R) was constructed to knock out the E1 region gene.

Referring to FIG. 4A, the E1 gene homologous recombination arms L- ΔE1 and R- ΔE1 were obtained by PCR amplification using NBOV1901 genome as a template.

L- ΔE1 primer:

L-ΔE1-FW:cagatatacgcgtgtataccatcatcaataatatacct(SEQ ID NO.：12)

L-ΔE1-RW:agacagcaagacacttgctatcgatttttagtcccggtgttgga(SEQ ID NO.：13)

PCR conditions: 95 ℃ for 3min;95 ℃ for 30s; 30s at 60 ℃;72 ℃,30s; cycles 28;72 ℃ for 5min; preserving at 12 ℃.

R-. DELTA.E1 primer:

R-ΔE1-FW:tccaacaccgggactaaaaatcgatagcaagtgtcttgctgtct(SEQ ID NO.：14)

R-ΔE1-RW:gcccagtagaagcgccggtggaattcatctgaactcaaagcgtg(SEQ ID NO.：15)

PCR conditions: 95 ℃ for 3min;95 ℃ for 30s; 30s at 60 ℃;72 ℃,30s; cycles 28;72 ℃ for 5min; preserving at 12 ℃.

The plasmid skeletons obtained by double digestion of the pVax vector with M- ΔE1, R- ΔE1 and Bstz17I+SgrAI were ligated using the Exnase enzyme in three fragments to obtain pVAX- ΔE3gp19K ΔE1 (L+R).

2. Construction of pNBOV1901 ΔE3gp19K ΔE1.

pVAX-delta E3gp19K delta E1 (L+R) is digested with Bstz17I+SgrAI, pNBOV1901 delta E3gp19K is digested with SrfI, the fragments recovered by the digestion of the two fragments are co-transformed into BJ5183 competent cells for recombination, resistance screening is carried out by an ampicillin resistance plate, the plasmid transformed XL competent cells are extracted after screening and obtained by monoclonal amplification, the plasmid is extracted to obtain pNBOV1901 delta E3gp19K delta E1, different digestion modes are used for identification (FIG. 4B), and pNBOV1901 delta E3gp19K delta E1 is introduced into a unique digestion site SrfI in a knockout gene region, so that subsequent cloning operation is facilitated.

Example 5: construction of the vector pNBOV 1901.DELTA.E3gp 19 K.DELTA.E1B1K_pRB, pNBOV1910

1. Construction of a shuttle vector for the knockout of E1B19K, pRB, pVAX- ΔE1B1K_pRB.

Referring to FIG. 5A, the E1 region gene deleted of the E1b19K, pRB gene was obtained by PCR amplification using NBOV1901 genome as a template.

P1- ΔE1B1K_pRB primer:

P1-△E1B19K_pRB-FW：caacaccgggactaaaaatgagacatattatctgcc(SEQ ID NO.：16)

P1-△E1B19K_pRB-RW:atcctcgtcgtcactgggtgg atcgaccacctccggtacaa(SEQ ID NO.：17)

PCR conditions: 95 ℃ for 3min;95 ℃ for 30s; 30s at 60 ℃;72 ℃,30s; cycles 28;72 ℃ for 5min; preserving at 12 ℃.

P2- ΔE1B1K_pRB primer:

P2-△E1B19K_pRB-FW:ttgtaccggaggtggtcgat ccacccagtgacgacgaggat(SEQ ID NO.：18)

P2-△E1B19K_pRB-RW:gatgggtttcttcgctccat gaggtcaaatgtaaccaaga(SEQ ID NO.：19)

PCR conditions: 95 ℃ for 3min;95 ℃ for 30s; 30s at 60 ℃;72 ℃,30s; cycles 28;72 ℃ for 5min; preserving at 12 ℃.

P3- ΔE1B1K_pRB primer:

P3-△E1B19K_pRB-FW:tcttggttacatttgacctc atggagcgaagaaacccatc(SEQ ID NO.：20)

P3-△E1B19K_pRB-RW:tcttggttacatttgacctc atggagcgaagaaacccatc(SEQ ID NO.：20)

PCR conditions: 95 ℃ for 3min;95 ℃ for 30s; 30s at 60 ℃;72 ℃,30s; cycles 28;72 ℃ for 5min; preserving at 12 ℃.

pVAX-DeltaE1 (L+R) after cleavage of P1-DeltaE1B1K_pRB, P2-DeltaE1B11K_pRB, P3-DeltaE1B1K_pRB and SrfI is subjected to four-fragment ligation using an Exnase enzyme to obtain pVAX-DeltaE1B1K_pRB.

2. Construction of pNBOV 1901.DELTA.E3gp 19 K.DELTA.E1B1K_pRB

pVAX-DeltaE1B1K_pRB was digested with Bstz17I+SgrAI, pNBOV 1901DeltaE3gp 1KDeltaE1 was digested with SrfI, the two digested fragments were co-transformed into BJ5183 competent cells for recombination, resistance screening was performed with an ampicillin resistance plate, the screening was performed to obtain monoclonal amplified and then plasmid transformed XL competent cells were extracted, plasmid was extracted to obtain pNBOV1910, and the plasmids were identified using different digestion protocols (FIG. 5B).

pNBOV1910 is sequenced as set forth in SEQ ID NO.: 21.

Example 6: production and purification results of replication adenovirus NBOV1901 recombinant adenovirus

pNBOV1910 was linearized with AsisI and then subjected to virus rescue, stepwise expansion culture after virus rescue, and after PCR and restriction identification confirmation of the virus species, large expansion culture was performed, cells were collected, and the virus was purified by CsCl density gradient centrifugation, and the result was shown in FIG. 6, and the obtained virus was collected and stored at-80 ℃. As can be seen from the figure, pNBOV1910 retains the productivity of replication competent adenovirus NBOV1901 without reduction in replication capacity.

Example 7: tumor cell oncolytic effect of NBOV1910 and NBOV1901 in H1299 and the like at different doses

Each tumor cell in logarithmic growth phase was plated 5X 10≡3cell/well, cultured for 24h, and virus amount per wellTCID50 points 1250, 250, 50, 10, 2, 0 respectivelyThe virus dilution is carried out by gradient, 100 mu l of infected cells are added to each hole after dilution for incubation for 1h, and the tumor cell killing effect is measured by culturing for 24-72 hours (72 hpi) or 96 hpi.

The experimental results are shown in FIG. 7. The result of CCK-8 detection after 72 hours of virus inoculation shows that the effect of killing tumor cells is stronger along with the increase of the virus concentration. The NBOV1910 obtained by modification has good oncolytic effect and better oncolytic effect in certain dosage intervals.

Example 8: oncolytic effect of different doses of NBOV1901 delta E3 delta E1B19K_pRb, NBOV1910 and NBOV1901 on H1299 tumor cells

Each tumor cell in logarithmic growth phase is plated 5×10X103 cell/well, cultured for 24h, and virus amount per wellTCID50 points 1250, 250, 50, 10, 2, 0 respectivelyThe virus dilution was performed by gradient, 100. Mu.l of infected cells were added to each well after dilution and incubated for 1h, and the tumor cell killing effect was measured by culturing for 72 hours (72 hpi) or 96 hpi.

FIG. 8 shows the results of CCK-8 detection after 72h of virus inoculation, showing that the modification of the variable region of replication type oncolytic adenovirus NBOV1901 does not affect the oncolytic effect.

Example 9: in vivo antitumor effect of NBOV1910 and NBOV1901 mice

At 5-6 weeks of age using Balb/c_nude mouse modelBalb/c_nude mice were inoculated with 5X 10 bar 6 cells of H1299 cells at the thigh-to-dorsal abdomen interface or at the anterior-to-posterior subcostal skin laxity. When the tumor grows to 200mm ³ When using 1X 10 ¹¹ VP virus was injected intratumorally with PBS, NBOV1910 and NBOV1901, respectively, and then tumor size and tumor clearance were observed.

The experimental results are shown in fig. 9, which shows that the treatment groups NBOV1910 and NBOV01 can obviously inhibit the growth of tumors and have the potential of treating the tumors.

FIG. 10 shows the oncolytic effect of the existing oncolytic adenoviruses (see Taki M, kagawa S, nishizaki M, et al enhanced oncolysis by a tropism-modified telomerase-specific replication-selective adenoviral agent OBP-405 ('Telomelysin-RGD') [ J ]. Oncogene,2005,24 (19): 3130-3140.), and it is seen that NBOV1910, NBOV1901 have better effects on non-small cell lung cancer cells.

SEQUENCE LISTING

<110> Guangzhou Enbao biomedical technology Co., ltd

<120> a replication competent adenovirus and use thereof

<130>

<160> 21

<170> PatentIn version 3.5

<210> 1

<211> 50

<212> DNA

<213> Artificial primers

<400> 1

gcgggatccg aattcttaat gcgatcgcca tcatcaataa tataccttat 50

<210> 2

<211> 42

<212> DNA

<213> Artificial primers

<400> 2

tatctgcatg agcatgatga tatcctttga cccggaacgc gg 42

<210> 3

<211> 42

<212> DNA

<213> Artificial primers

<400> 3

ccgcgttccg ggtcaaagga tatcatcatg ctcatgcaga ta 42

<210> 4

<211> 48

<212> DNA

<213> Artificial primers

<400> 4

gaagcgagat cgaattctta gcgatcgcca tcatcaataa atacctta 48

<210> 5

<211> 36

<212> DNA

<213> Artificial primers

<400> 5

gatatacgcg tgtatacctt cccaggatgg caccca 36

<210> 6

<211> 51

<212> DNA

<213> Artificial primers

<400> 6

gtaagtaatt tattgtgtgt ttatgttaat taactgtgtg accgctgctg t 51

<210> 7

<211> 51

<212> DNA

<213> Artificial primers

<400> 7

acagcagcgg tcacacagtt aattaacata aacacacaat aaattactta c 51

<210> 8

<211> 45

<212> DNA

<213> Artificial primers

<400> 8

ccgcccagta gaagcgccgg tgccgcccgt tttaatttcc atgtt 45

<210> 9

<211> 40

<212> DNA

<213> Artificial primers

<400> 9

gtcacagggt gcggtcgcca ggacagggta taactcacct 40

<210> 10

<211> 43

<212> DNA

<213> Artificial primers

<400> 10

ggaatacaag caagcggaaa atcatcttgg atgtcgcccc cag 43

<210> 11

<211> 43

<212> DNA

<213> Artificial primers

<400> 11

ctgggggcga catccaagat gattttccgc ttgcttgtat tcc 43

<210> 12

<211> 38

<212> DNA

<213> Artificial primers

<400> 12

cagatatacg cgtgtatacc atcatcaata atatacct 38

<210> 13

<211> 44

<212> DNA

<213> Artificial primers

<400> 13

agacagcaag acacttgcta tcgattttta gtcccggtgt tgga 44

<210> 14

<211> 44

<212> DNA

<213> Artificial primers

<400> 14

tccaacaccg ggactaaaaa tcgatagcaa gtgtcttgct gtct 44

<210> 15

<211> 44

<212> DNA

<213> Artificial primers

<400> 15

gcccagtaga agcgccggtg gaattcatct gaactcaaag cgtg 44

<210> 16

<211> 36

<212> DNA

<213> Artificial primers

<400> 16

caacaccggg actaaaaatg agacatatta tctgcc 36

<210> 17

<211> 41

<212> DNA

<213> Artificial primers

<400> 17

atcctcgtcg tcactgggtg gatcgaccac ctccggtaca a 41

<210> 18

<211> 41

<212> DNA

<213> Artificial primers

<400> 18

ttgtaccgga ggtggtcgat ccacccagtg acgacgagga t 41

<210> 19

<211> 40

<212> DNA

<213> Artificial primers

<400> 19

gatgggtttc ttcgctccat gaggtcaaat gtaaccaaga 40

<210> 20

<211> 40

<212> DNA

<213> Artificial primers

<400> 20

tcttggttac atttgacctc atggagcgaa gaaacccatc 40

<210> 21

<211> 32767

<212> DNA

<213> adenovirus

<400> 21

catcatcaat aatatacctt attttggatt gaagccaata tgataatgag ggggtggagt 60

ttgtgacgtg gcgcggggcg tgggaacggg gcgggtgacg tagtagtgtg gcggaagtgt 120

gatgttgcaa gtgtggcgga acacatgtaa gcgacggatg tggtaaaagt gacgtttttg 180

gtgtgcgccg gtgtacacgg gaagtgacaa ttttcgcgcg gttttaggcg gatgttgtag 240

taaatttggg cgtaaccgag taagatttgg ccattttcgc gggaaaactg aataagagga 300

agtgaaatct gaataattct gtgttactca tagcgcgtaa tatttgtcta gggccgcggg 360

gactttgacc gtttacgtgg agactcgccc aggtgttttt ctcaggtgtt ttccgcgttc 420

cgggtcaaag ttggcgtttt attattatag tcagctgacg cgtagtgtat ttatacccgg 480

tgagttcctc aagaggccac tcttgagtgc cagcgagtag agttttctcc tccgagccgc 540

tccaacaccg ggactaaaaa tgagacatat tatctgccac ggaggtgtta ttaccgaaga 600

aatggccgcc agtcttttgg accagctgat cgaagaggta ctggctgata atcttccacc 660

tcctagccat tttgaaccac ctacccttca cgaactgtat gatttagacg tgacggcccc 720

cgaagatccc aacgaggagg cggtttcgca gatttttccc gactctgtaa tgttggcggt 780

gcaggaaggg attgacttac tcacttttcc gccggcgccc ggttctccgg agccgcctca 840

cctttcccgg cagcccgagc agccggagca gagagccttg ggtccggttt ctatgccaaa 900

ccttgtaccg gaggtggtcg atccacccag tgacgacgag gatgaagagg gtgaggagtt 960

tgtgttagat tatgtggagc agcccgggca cggttgcagg tcttgtcatt atcaccggag 1020

gaatacgggg gacccagata ttatgtgttc gctttgctat atgaggacct gtggcatgtt 1080

tgtctacagt aagtgaaatt atgggcagtg ggtgatagag tggtgggttt ggtgtggtaa 1140

tttttttttt aatttttgca gttttgtggt ttaaagaatt ttgtattgta attttttaaa 1200

aggtcctgtg tctgaacctg agcctgagcc cgagccagaa ccggagcctg caagacctac 1260

tcggcgtcct aaaatggtgc ctgctatcct gagacgcccg acatcacctg tgaccagaga 1320

atgcaatagt agtacggata gctgtgactc cggtccttct aacacacctc ctgagataca 1380

cccggtggtc ccgctgtgcc ccattaaacc agttgccgtg agagttggtg ggcgtcgcca 1440

ggctgtggaa tgtatcgagg acttgcttaa cgagcctggg caacctttgg acttgagctg 1500

taaacgcccc aggccataag gtgtaaacct gtgattgcgt gtgtggttaa cgcctttgtt 1560

tgctgaatga gttgatgtaa gtttaataaa aagggtgaga taatgtttaa cttgcatggc 1620

gtgttaaatg gggcggggct taaagggtat ataatgcgcc gtgggctaat cttggttaca 1680

tttgacctca tggagcgaag aaacccatct gagcgggggg tacctgctgg attttctggc 1740

catgcatctg tggagagcgg tggtgagaca caagaatcgc ctgctactgt tgtcttccgt 1800

ccgcccggca ataataccga cggaggagca gcagcagcag cagcagcagc aggaggaagc 1860

caggcggcgg cggcggcagg agcagagccc atggaacccg agagccggcc tggaccctcg 1920

ggaatgaatg ttgtacaggt ggctgaactg tttccagaac tgagacgcat tttaaccatt 1980

aacgaggatg ggcagggact aaagggggta aagagggagc ggggggcttc tgaggctata 2040

gaggaggcta ggaatctaac ttttagctta atgaccagac accgtcctga gtgtgttact 2100

tttcagcaga ttaaggataa ttgtgctaat gagcttgatc tgctggcgca gaagtattcc 2160

atagagcagc tgaccactta ctggctgcag ccaggggatg attttgagga ggctattagg 2220

gtatatgcaa aggtggcact taggccagat tgcaagtaca agattagcaa acttgtaaat 2280

atcaggaatt gttgctacat ttctgggaac ggggccgagg tggagataga tacggaggat 2340

agggtggcct ttagatgtag catgataaat atgtggccgg gggtgcttgg catggacggg 2400

gtggttttta tgaatgtgag gtttactggc cccaatttta gcggtacggt tttcctggcc 2460

aataccaacc ttatcctaca cggtgtaagc ttctatgggt ttaacaatac ctgcgtggaa 2520

gcctggaccg atgtaagggt tcggggctgt gccttttact tctgctggaa gggggtggtg 2580

tgtcgcccca aaagcagggc ttcaattaag aaatgcctct ttgaaaggtg taccttgggt 2640

atcctgtctg agggtaactc cagggtgcgc cacaatgtgg cctccgactg tggttgcttc 2700

atgctagtga aaagcgtggc tgtgattaag cataacatgg tgtgtggcaa ctgcgaggac 2760

agggcctctc agatgctgac ctgctcggac ggcaactgtc acctgctgaa gaccattcac 2820

gtagccagcc actctcgcaa ggcctggcca gtgtttgagc acaacatatt gacccgctgt 2880

tccttgcatt tgggtaacag gaggggggtg ttcctacctt accaatgcaa tttgagtcac 2940

actaagatat tgcttgagcc cgagagcatg tccaaggtga acctgaacgg ggtgtttgac 3000

atgaccatga agatctggaa ggtgctgagg tacgatgaga cccgcaccag gtgcagaccc 3060

tgcgagtgtg gcggtaaaca tattaggaac cagcctgtga tgctggatgt gaccgaggag 3120

ctgaggcccg atcacttggt gctggcctgc acccgcgctg agtttggctc tagcgatgaa 3180

gatacagatt gaggtactga aatgtgtggg cgtggcttaa gggtgggaaa gaatatataa 3240

ggtggggggt ctcatgtagt tttgtatctg ttttgcagca gccgccgcca tgagcaccaa 3300

ctcgtttgat ggaagcattg tgagctcata tttgacaaca cgcatgcccc catgggccgg 3360

ggtgcgtcag aatgtgatgg gctccagcat tgatggtcgc cccgtcctgc ccgcaaactc 3420

tactaccttg acctacgaga ccgtgtctgg aacgccgttg gagactgcag cctccgccgc 3480

cgcttcagcc gctgcagcca ccgcccgcgg gattgtgact gactttgctt tcctgagccc 3540

gcttgcaagc agtgcagctt cccgttcatc cgcccgcgat gacaagttga cgactctttt 3600

ggcacaattg gattctttga cccgggaact taatgtcgtt tctcagcagc tgttggagct 3660

gcgccagcag gtttctgccc tgaaggcttc ctcccctccc aatgcggttt aaaacataaa 3720

taaaaaccag actctgtttg gatttggatc aagcaagtgt cttgctgtct ttatttaggg 3780

gttttgcgcg cgcggtaggc ccgggaccag cggtctcggt cgttgagggt cctgtgtatt 3840

ttttccagga cgtggtagag gtggctctgg atgttcagat acatgggcat aagcccgtct 3900

ctggggtgga ggtagcacca ctgcagagct tcatgctgcg gggtggtgtt gtagatgatc 3960

cagtcgtagc aggagcgctg ggcgtggtgc ctaaaaatgt ccttcagaag caagctgatt 4020

gccaggggca ggcccttggt gtaagtgttt acaaagcggt taagctggga tgggtgcata 4080

cgtggggata tgagatgcat cttggactgt atttttaggt tggctatgtt cccagccata 4140

tccctcctgg gattcatgtt gtgcagaacc accagcacag tgtatccggt gcacttggga 4200

aatttgtcat gtagcttaga aggaaatgcg tggaagaact tggagacgcc cttgtgacct 4260

ccaagatttt ccatgcattc gtccataatg atggcaatgg gcccacgggc ggcggcctgg 4320

gcgaagatat ttctgggatc actaacgtca tagttgtgtt ccaggataag atcgtcatag 4380

gccattttta caaagcgcgg gcggagggtg ccagactgcg gtatgatggt tccatccggt 4440

ccaggggcgt agttaccctc acagatttgc atttcccacg ctttgagttc agatgggggg 4500

atcatgtcta cctgcggggc gatgaagaaa acggtttccg gggtagggga gatcagctgg 4560

gaagaaagca cgttcctgag cagctgcgac ttaccgcagc cggtgggccc gtaaatcaca 4620

cctattaccg gctgcaactg gtagttaaga gagctgcagc tgccgtcatc cctgagcagg 4680

ggggccactt cgttaagcat gtccctgact cgcatgtttt ccctgaccaa atccgccaga 4740

aggcgctcgc cgcccagcga tagcagttct tgcaaggaag caaagttttt caacggtttg 4800

aggccgtccg ccgtaggcat gcttttgagc gtttgaccaa gcagttccag gcggtcccac 4860

agctcggtca cgtgctctac ggcatctcga tccagcatat ctcctcgttt cgcgggttgg 4920

ggcggctttc gctgtacggc agtagtcggt gctcgtccag acgggccagg gtcatgtctt 4980

tccacgggcg cagggtcctc gtcagcgtag tctgggtcac ggtgaagggg tgcgctccgg 5040

gctgcgcgct ggccagggtg cgcttgaggc tggtcctgct ggtgctgaag cgctgccggt 5100

cttcgccctg cgcgtcggcc aggtagcatt tgaccatggt gtcatagtcc agcccctccg 5160

cggcgtggcc cttggcgcgc agcttgccct tggaggaggc gccgcacgag gggcagtgca 5220

gacttttgag ggcgtagagc ttgggcgcga gaaataccga ttccggggag taggcatccg 5280

cgccgcaggc cccgcagacg gtctcgcatt ccacgagcca ggtgagctct ggccgttcgg 5340

ggtcaaaaac caggtttccc ccatgctttt tgatgcgttt cttacctctg gtttccatga 5400

gccggtgtcc acgctcggtg acgaaaaggc tgtccgtgtc cccgtataca gacttgagag 5460

gcctgtcctc gagcggtgtt ccgcggtcct cctcgtatag aaactcggac cactctgaga 5520

cgaaggctcg cgtccaggcc agcacgaagg aggctaagtg ggaggggtag cggtcgttgt 5580

ccactagggg gtccactcgc tccagggtgt gaagacacat gtcgccctct tcggcatcaa 5640

ggaaggtgat tggtttgtag gtgtaggcca cgtgaccggg tgttcctgaa ggaggggtat 5700

aaaagggggt gggggcgcgt tcgtcctcac tctcttccgc atcgctgtct gcgagggcca 5760

gctgttgggg tgagtactcc ctctcaaaag cgggcatgac ttctgcgcta aggttgtcag 5820

tttccaaaaa cgaggaggat ttgatgttca cctggcccgc ggtgatgcct ttgagggtgg 5880

ccgcgtccat ctggtcagaa aagacaatct ttttgttgtc aagcttggtg gcaaacgacc 5940

cgtagagggc gttggacagc aacttggcaa tggagcgcag ggtttggttt ttgtcgcgat 6000

cggcacgctc cttggccgcg atgtttagct gcacgtattc acgcgcaacg caccgccatt 6060

cgggaaagac ggtggtgcgc tcgtcgggca ccaggcgcac gcgccaaccg cggttgtgca 6120

gggtgacaag gtcaacgctg gtggctacct ctccgcgtag gcgctcgttg gtccagcaga 6180

ggcggccgcc cttgcgcgag caaaatggcg gtagggggtc tagctgcgtc tcgtctgggg 6240

ggtccgcgtc cacggtaaag acccctggca gcaggcgcgc gtcgaagtag tctatcttgc 6300

atccttgcaa gtctagcgcc tgctgccatg cgcgggctgc aagcgcgcgc tcgtatgggt 6360

tgagtggggg accccatggc atggggtggg tgagcgcgga ggcgtacatg ccgcaaatgt 6420

cgtaaacgta gaggggctcc ctgagtattc caagatatgt agggtagcat cttccaccgc 6480

ggatgctggc gcgcacgtaa tcgtatagtt cgtgcgaggg agcgaggagg tcgggaccga 6540

ggttgctacg ggcgggctgc tctgctcgga agacgatctg cctgaagatg gcatgcgagt 6600

tggatgatat ggttggacgc tggaagacgt tgaagctagc gtctgtgaga cctaccgcgt 6660

cacgcacgaa ggaggcgtag gagtcgcgca gcttgttgac cagctcggcg gtgacctgca 6720

cgtctagggc gcagtagtcc agggtttcct tgatgatgtc atacttatcc tgtccctttt 6780

ttttccacag ctcgcggttg aggacaaact cttcgcggtc tttccagtac tcttggatcg 6840

gaaacccgtc ggcctccgaa cggtaagagc ctagcatgta gaactggttg acggcctggt 6900

aggcgcagca tcccttttct acgggtagcg cgtatgcctg tgcggccttc cggagcgagg 6960

tgtgggtgag cgcaaaggtg tccctgacca tgactttgag gtactggtat ttgaagtcaa 7020

tgtcgtcgca tccgccctgc tcccagagca aaaagtccgt gcgctttttg gaacgcgggt 7080

ttggcagggc gaaggtgaca tcgttgaaga gtatctttcc cgcgcgaggc ataaagttgc 7140

gtgtgatgcg gaagggtccc ggcacctcgg aacggttgtt aattacctgg gcggcgagca 7200

cgatctcgtc aaagccgttg atgttatggc ccacgatgta aagttccaag aagcgcgggg 7260

tgcccttgat ggagggcaat tttttaagtt cctcgtaggt gagctcttca ggggagctga 7320

gcccgtgctc tgacagggcc cagtctgcaa gatgagggtt ggaagcgacg aatgagctcc 7380

acaggtcacg ggccattagc gtctgcagct ggtcgcgaaa ggttctaaac tggcgaccta 7440

tggccatttt ttctggggtg atgcagtaga aggtaagcgt gtcttgttcc cagcggtccc 7500

atccaagttc cacggctagg tctctcgcgg cggttactag aggctcatct ccgccgaact 7560

tcatgaccag catgaagggc acgagctgct tcccaaaggc ccccatccaa gtataggtct 7620

ctacatcgta ggtgacaaag agacgctcgg tgcgaggatg cgagccgatc gggaagaact 7680

ggatctcccg ccaccagttg gaggagtggc tgttgatgtg gtgaaagtag aagtccctgc 7740

gacgggccga acactcgtgc tggcttttgt aaaaacgtgc gcagtactgg cagcggtgca 7800

cgggctgtac atcctgcacg aggttgacct gacgaccgcg cacaaggaag cagagtggga 7860

atttgagccc ctcgcctggc gggtttggct ggtggtcttc tacttcggct gcttgtcctt 7920

gaccgtctgg ctgctcgagg ggagttacgg tggatcgtac caccacgccg cgcgagctca 7980

aagtccagat gtccgcgcgc ggcggtcgga gcttgatgac aacatcgcgc agatgggagc 8040

tgtccatggt ctggagctcc cgcggcgtca ggtcaggcgg gagctcttgc aggtttacct 8100

cgcatagacg ggtgagggcg cgggctaggt ccaggtgata cctgatttcc aggggctggt 8160

tggtggcggc gtcgatggct tgcaagaggc cgcatccccg cggcgcgact acggtaccgc 8220

gcggcgggcg gtgggccgcg gggttgtcct gggatgcatc taaaagcggt gacgcgggcg 8280

ggcccccgga ggtagggggg gctccggacc cgccgggaga gggggcaggg gcacgtcggc 8340

gccgcgcgcg ggcaggagct ggtgctgcgc gcggaggttg ctggcgaacg cgacgacgcg 8400

gcggttgatc tcctgaatct ggcgcctctg cgtgaagacg acgggcccgg tgagcttgaa 8460

cctgaaagag agttcgacag aatcaatttc ggtgtcgttg acggcggcct ggcgcaaaat 8520

ctcctgcacg tctcctgagt tgtcttgata ggcgatctcg gccatgaact gctcgatctc 8580

ttcctcctgg agatctccgc gtccggctcg ctccacggtg gcggcgaggt cgttggagat 8640

gcgggccatg agctgcgaga aggcgttgag gcctccctcg ttccagacgc ggctgtagac 8700

cacgccccct tcggcatcgc gggcgcgcat gaccacctgc gcgagattga gctccacgtg 8760

ccgggcgaag acggcgtagt tgcgcaggcg ctgaaagagg tagttgaggg tggtggcggt 8820

gtgttctgcc acgaagaagt acataaccca gcgccgcaac gtggattcgt tgatatcccc 8880

caaggcctca aggcgctcca tggcctcgta gaagtccacg gcgaagttga aaaactggga 8940

gttgcgcgcc gacacggtca actcttcctc cagaagacgg atgagctcgg cgacagtgtc 9000

gcgcacctcg cgctcaaagg ctacaggggc ctcctcttct tcttcaatct cctcttccat 9060

aagggcctcc ccttcttctt cttccggtgg cggtggggga ggggcgcggc ggcgacgacg 9120

gcgcaccggg aggcggtcga caaagcgctc gatcatctcc ccgcggcgac ggcgcatggt 9180

ctcggtgacg gcgcggccgt tctcgcgggg gcgcagttgg aagacgccgc ccgtcatgtc 9240

ccggttatgg gttggcgggg tgctgccgtg cggcagggat acggcgctaa cgatgcatct 9300

caacaattgc tgtgtaggta ctccgccgcc gagggacctg agcgagtccg catcgaccgg 9360

atcggaaaac ctctcgagaa aggcgtctaa ccagtcacag tcgcaaggta ggctgagcac 9420

cgtggcgggc ggcagcgggc ggcggtcggg gttgtttctg gcggaggtgc tgctgatgat 9480

gtaattaaag taggcggtct tgagacggcg gatggtcgac agaagcacca tgtccttggg 9540

tccggcctgc tgaatgcgca ggcggtcggc catgccccag gcttcgtttt gacatcggcg 9600

caggtctttg tagtagtctt gcatgagcct ttctaccggc acttcttctt ctccttcctc 9660

ttgtcctgca tctcttgcat ctatcgctgc ggcggcggcg gagtttggcc gtaggtggcg 9720

ccctcttcct cccatgcgtg tgaccccgaa gcccctcagc ggttgaagca gggccaggtc 9780

ggcgacaacg cgctcggcta atatggcctg ctgcacctgc gtgagggtag actggaagtc 9840

atccatgtcc acaaagcggt ggtatgcgcc cgtgttgatg gtgtaagtgc agttggccat 9900

aacggaccag ttaacggtct ggtgacccgg ctgcgagagc tcggtgtacc tgagacgcga 9960

gtaagccctt gagtcaaaga cgtagtcgtt gcaagtccgc accaggtact ggtatcccac 10020

caaaaagtgc ggcggcggct ggcggtagag gggccagcgt agggtggccg gggctccggg 10080

ggcgaggtct tccaacataa ggcgatgata tccgtagatg tacctggaca tccaggtgat 10140

gccggcggcg gtggtggagg cgcgcgggaa gtcgcggacg cggttccaga tgttgcgcag 10200

cggcaaaaag tgctccatgg tcgggacgct ctggccggtc aggcgcgcgc agtcgttgac 10260

gctctagacc gtgcaaaagg agagcctgta agcgggcact cttccgtggt ctggtggata 10320

aattcgcaag ggtatcatgg cggacgaccg gggttcgaac cccggatccg gccgtccgcc 10380

gtgatccatg cggttaccgc ccgcgtgtcg aacccaggtg tgcgacgtca gacaacgggg 10440

gagtgctcct tttggcttcg ttccaggcgc ggcggctgct gcgctagctt ttttggccac 10500

tggccgcgcg cggcgtaagc ggttaggctg gaaagcgaaa gcattaagtg gctcgctccc 10560

tgtagccgga gggttatttt ccaagggttg agtcgcggga cccccggttc gagtctcggg 10620

ccggccggac tgcggcgaac gggggtttgc ctccccgtca tgcaagaccc cgcttgcaaa 10680

ttcctccgga aacagggacg agcccctttt ttgcttttcc cagatgcatc cggtgctgcg 10740

gcagatgcgc ccccctcctc agcagcggca agagcaagag cagcggcaga catgcagggc 10800

accctcccct cctcctaccg cgtcaggagg ggcgacatcc gcggctgacg cggcggcaga 10860

tggtgattac gaacccccgc ggcgccgggc ccgtcactac ctggacttgg aggaggggga 10920

gggcctggcg cggctaggag cgccctctcc tgagcggcac ccaagggtgc agctgaagcg 10980

tgacacgcgc gaggcgtacg tgccgcggca gaacctgttt cgcgaccgcg agggagagga 11040

gcccgaggag atgcgggatc gaaagtttca cgcggggcgc gagctgcggc atggcctgaa 11100

ccgcgagcgg ttgctgcgcg aggaggactt tgagcccgac gcgcggaccg ggattagtcc 11160

cgcgcgcgca cacgtggcgg ccgccgacct ggtaaccgcg tacgagcaga cggtgaacca 11220

ggagattaac tttcaaaaaa gctttaacaa ccacgtgcgc acgcttgtgg cgcgcgagga 11280

ggtggctata ggactgatgc atctgtggga ctttgtaagc gcgctggagc aaaacccaaa 11340

tagcaagccg ctcatggcgc agctgttcct tatagtacag cacagcaggg acaacgaggc 11400

attcagggat gcgctgctaa acatagtaga gcccgagggt cgctggctgc tcgatttgat 11460

aaacattctg cagagcatag tggtgcagga gcgcagcttg agcctggctg acaaggtggc 11520

cgccattaac tattccatgc tcagtctggg caagttttac gcccgcaaga tataccatac 11580

cccttacgtt cccatagaca aggaggtaaa gatcgagggg ttctacatgc gcatggcgct 11640

gaaggtgctt accttgagcg acgacctggg cgtttaccgc aacgagcgca tccacaaggc 11700

cgtgagcgtg agccggcggc gcgagctcag cgaccgcgag ctgatgcaca gcctgcaaag 11760

ggccctggct ggcacgggca gcggcgatag agaggccgag tcctactttg acgcgggcgc 11820

tgacctgcgc tgggccccaa gccgacgcgc cctggaggca gctggggccg gacctgggct 11880

ggcggtggca cccgcgcgcg ctggcaacgt cggcggcgtg gaggaatatg acgaggacga 11940

tgagtacgag ccagaggacg gcgagtacta agcggtgatg tttctgatca gatgatgcaa 12000

gacgcaacgg acccggcggt gcgggcggcg ctgcagagcc agccgtccgg ccttaactcc 12060

acggacgact ggcgccaggt catggaccgc atcatgtcgc tgactgcgcg caaccctgac 12120

gcgttccggc agcagccgca ggccaaccgg ctctccgcaa ttctggaagc ggtggtcccg 12180

gcgcgcgcaa accccacgca cgagaaggtg ctggcgatcg taaacgcgct ggccgaaaac 12240

agggccatcc ggcccgatga ggccggccta gtctacgacg cgctgcttca gcgcgtggct 12300

cgttacaaca gcggcaacgt gcagaccaac ctggaccggc tggtggggga tgtgcgcgag 12360

gccgtggcgc agcgtgagcg cgcgcaacag cagggcaacc tgggctccat ggttgcacta 12420

aacgccttcc tgagtacaca gcccgccaac gtgccgcggg gacaggagga ctacaccaac 12480

tttgtgagcg cactgcggct aatggtgact gagacaccgc aaagtgaggt gtaccagtcc 12540

gggccagact attttttcca gaccagtaga caaggcctgc agaccgtaaa cctgagccag 12600

gctttcaaga acttgcaggg gctgtggggg gtgcgggctc ccacaggcga ccgcgcgacc 12660

gtgtctagct tgctgacgcc caactcgcgc ctgttgctgc tgctaatagc gcccttcacg 12720

gacagtggca gcgtgtcccg ggacacatac ctaggtcact tgctgacact gtaccgcgag 12780

gccataggtc aggcgcatgt ggacgagcat actttccagg agattacaag tgtcagccgc 12840

gcgctggggc aggaggacac gggcagcctg gaggcaaccc tgaactacct gctgaccaac 12900

cggcggcaga agatcccctc gttgcacagt ttaaacagcg aggaggagcg catcttgcgc 12960

tatgtgcagc agagcgtgag ccttaacctg atgcgcgacg gggtaacgcc cagcgtggcg 13020

ctggacatga ccgcgcgcaa catggaaccg ggcatgtatg cctcaaaccg gccgtttatc 13080

aatcgcctaa tggactactt gcatcgcgcg gccgccgtga accccgagta tttcaccaat 13140

gccatcttga acccgcactg gctaccgccc cctggtttct acaccggggg atttgaggtg 13200

cccgagggta acgatggatt cctctgggac gacatagacg acagcgtgtt ttccccgcaa 13260

ccgcagaccc tgctagagtt gcaacagcgc gagcaggcag aggcggcgct gcgaaaggaa 13320

agctttcgca ggccaagcag cttgtccgat ctaggcgctg cggccccgcg gtcagatgct 13380

agtagcccat ttccaagctt gatagggtct cttaccagca ctcgcaccac ccgcccgcgc 13440

ctgctgggcg aggaggagta cctaaacaac tcgctgctgc agccgcagcg cgaaaagaac 13500

ctgcctccgg cgtttccgaa caacgggata gagagcctag tggacaagat gagtagatgg 13560

aagacgtatg cgcaggagca cagggatgtg cccggcccgc gcccgcccac ccgtcgtcaa 13620

aggcacgacc gtcagcgggg tctggtgtgg gaggacgatg actcggcaga cgacagcagc 13680

gtcctggatt tgggagggag tggcaacccg tttgcgcacc ttcgccccag gctggggaga 13740

atgttttaaa aaaaaaaaaa agcatgatgc aaaataaaaa actcaccaag gccatggcac 13800

cgagcgttgg ttttcttgta ttccccttag tatgcggcgc gcggcgatgt atgaggaagg 13860

tcctcctccc tcctacgaga gcgtggtgag cgcggcgcca gtggcggcgg cgctgggttc 13920

ccccttcgat gctcccctgg acccgccgtt cgtgcctccg cggtacctgc ggcctaccgg 13980

ggggagaaac agcatccgtt actctgagtt ggcaccccta ttcgacacca cccgtgtgta 14040

ccttgtggac aacaagtcaa cggatgtggc atccctgaac taccagaacg accacagcaa 14100

ctttctaacc acggtcattc aaaacaatga ctacagcccg ggggaggcaa gcacacagac 14160

catcaatctt gacgaccggt cgcactgggg cggcgacctg aaaaccatcc tgcataccaa 14220

catgccaaat gtgaacgagt tcatgtttac caataagttt aaggcgcggg tgatggtgtc 14280

gcgctcgctt actaaggaca aacaggtgga gctgaaatat gagtgggtgg agttcacgct 14340

gcccgagggc aactactccg agaccatgac catagacctt atgaacaacg cgatcgtgga 14400

gcactacttg aaagtgggca ggcagaacgg ggttctggaa agcgacatcg gggtaaagtt 14460

tgacacccgc aacttcagac tggggtttga cccagtcact ggtcttgtca tgcctggggt 14520

atatacaaac gaagccttcc atccagacat cattttgctg ccaggatgcg gggtggactt 14580

cacccacagc cgcctgagca acttgttggg catccgcaag cggcaaccct tccaggaggg 14640

ctttaggatc acctacgatg acctggaggg tggtaatatt cccgcactgt tggatgtgga 14700

cgcctaccag gcaagcttga aagatgacac cgaacagggc gggggtggcg caggcggcgg 14760

caacaacagt ggcagcggcg cggaagagaa ctccaacgcg gcagccgcgg caatgcagcc 14820

ggtggaggac atgaacgatc atgccattcg cggcgacacc tttgccacac gggcggagga 14880

gaagcgcgct gaggccgagg cagcggccga agctgccgcc cccgctgcgg aggctgcaca 14940

acccgaggtc gagaagcctc agaagaaacc ggtgattaaa cccctgacag aggacagcaa 15000

gaaacgcagt tacaacctaa taagtaatga cagcaccttc acccagtacc gcagctggta 15060

ccttgcatac aactacggcg accctcaggc cgggatccgc tcatggaccc tgctttgcac 15120

tcctgacgta acctgcggct cggagcaggt atactggtcg ttgcccgaca tgatgcaaga 15180

ccccgtgacc ttccgctcca cgagccagat cagcaacttt ccggtggtgg gcgccgagct 15240

gttgcccgtg cactccaaga gcttctacaa cgaccaggcc gtctactccc agctcatccg 15300

ccagtttacc tctctgaccc acgtgttcaa tcgctttccc gagaaccaga ttttggcgcg 15360

cccgccagcc cccaccatca ccaccgtcag tgaaaacgtt cctgctctca cagatcacgg 15420

gacgctaccg ctgcgcaaca gcatcggagg agtccagcga gtgaccatta ctgacgccag 15480

acgccgcacc tgcccctacg tttacaaggc cctgggcata gtctcgccgc gcgtcctatc 15540

gagccgcact ttttgagcaa gcatgtccat ccttatatcg cccagcaata acacaggctg 15600

gggcctgcgc ttcccaagca agatgtttgg cggggccaag aagcgctccg accaacaccc 15660

agtgcgcgtg cgcgggcact accgcgcgcc ctggggcgcg cacaaacgcg gccgcactgg 15720

gcgcaccacc gtcgatgacg ccatcgacgc ggtggtggag gaggcgcgca actacacgcc 15780

cacgccgccg ccagtgtcca ccgtggacgc ggccattcag accgtggtgc gcggagcccg 15840

gcgctacgct aaaatgaaga gacggcgaag gcgcgtagca cgtcgccacc gccgccgacc 15900

cggcactgcc gcccaacgcg cggcggcggc cctgcttaac cgcgcacgtc gcaccggccg 15960

acgggcggcc atgcgagccg ctcgaaggct ggccgcgggt attgtcactg tgccccccag 16020

gtccaggcga cgagcggccg ccgcagcagc cgcggccatt agtgctatga ctcagggtcg 16080

caggggcaac gtgtactggg tgcgcgactc ggttagcggc ctgcgcgtgc ccgtgcgcac 16140

ccgccccccg cgcaactaga ttgcaataaa aaactactta gactcgtact gttgtatgta 16200

tccagcggcg gcggcgcgca tcgaagctat gtccaagcgc aaaatcaaag aagagatgct 16260

ccaggtcatc gcgccggaga tctatggccc cccgaagaag gaagagcagg attacaagcc 16320

ccgaaagcta aagcgggtca aaaagaaaaa gaaagatgat gatgatgaac ttgacgacga 16380

ggtggaactg ttgcacgcga ccgcgcccag gcggcgggta cagtggaaag gtcgacgcgt 16440

aagacgtgtt ttgcgacccg gcaccaccgt agtctttacg cccggtgagc gctccacccg 16500

cacctacaag cgcgtgtatg atgaggtgta cggcgacgag gacttgcttg agcaggccaa 16560

cgagcgcctc ggggagtttg cctacggaaa gcggcataag gacatgctgg cgttgccgct 16620

ggacgagggc aacccaacac ctagcctaaa gcccgtgaca ctgcagcagg tgctgcccgc 16680

gcttgcaccg tccgaagaaa agcgcggcct aaagcgcgag tctggtgact tggcgcccac 16740

cgtgcagctc atggtgccca agcgccagcg actggaagat gtcttggaaa aaatgaccgt 16800

ggagcctggg ctggagcccg aggtccgcgt gcgaccaatc aagcaggtgg caccgggact 16860

gggcgtgcag accgtggacg ttcagatacc caccaccagt agcactagta ttgccactgc 16920

cacagagggc atggagacac aaacgtcccc ggtcgcctcg gcggtggcag atgccgcggt 16980

gcaggcggcc gctgcggccg cgtccaaaac ctctacggag gtgcaaacgg acccgtggat 17040

gtttcgcgtt tcagcccccc ggcgtccgcg ccgttcgagg aagtacggcg ccgccagcgc 17100

gctactgccc gaatatgccc tacatccttc catcgcgcct acccccggct atcgtggcta 17160

cacctaccgc cccagaagac gagcaactac ccgacgccga accaccactg gaacccgccg 17220

ccgccgtcgc cgtcgccagc ccgtgctggc cccgatttcc gtgcgcaggg tggctcgcga 17280

aggaggcagg accctggtgc tgccaacagc gcgctaccac cccagcatcg tttaaaagcc 17340

ggtctttgtg gttcttgcag atatggccct cacctgccgc ctccgtttcc cggtgccggg 17400

attccgagga agaatgcacc gtaggagggg catggccggc cacggcctga cgggcggcat 17460

gcgtcgtgcg caccaccggc ggcggcgcgc gtcgcaccgt cgcatgcgcg gcggtatcct 17520

gcccctcctt attccactga tcgccgcggc gattggcgcc gtgcccggaa ttgcatccgt 17580

ggccttgcag gcgcagagac actgattaaa aacaagttgc atgtggaaaa atcaaaataa 17640

aaagtctgga ctctcacgct cgcttggtcc tgtaactatt ttgtagaatg gaagacatca 17700

actttgcgtc tctggccccg cgacacggct cgcgcccgtt catgggaaac tggcaagata 17760

tcggcaccag caatatgagc ggtggcgcct tcagctgggg ctcgctgtgg agcggcatta 17820

aaaatttcgg ttccaccgtt aagaactatg gcagcaaggc ctggaacagc agcacaggcc 17880

aaatgctgag ggacaagttg aaagagcaaa atttccaaca aaaggtggta gatggcctgg 17940

cctctggcat tagcggggtg gtggacctgg ccaaccaggc agtgcaaaat aagattaaca 18000

gtaagcttga tcaccgccct cccgtagagg agccttcacc ggccgtggag acagtgttgc 18060

cagatgggcg tggcgaaaag cgcccgcgcc ccgacaggga agagactctg gtgacacaaa 18120

tcgacgagcc tccctcgtac gaggaggcgc taaagcaagg cctgcccacc acccgtccca 18180

tcgcgcccat ggctaccgga gtgttgggcc agcacacacc tgtaacgctg gacctgcctc 18240

cccccgctga cacccagcag aaacctgtgc tgccagggcc gtccgccgtt gttgtaaccc 18300

gccctagccg cgcgtccctg cgccgtgccg ccagcggtcc gcgatcgttg cggcccgtag 18360

ccagtggcaa ctggcaaagc acactgaaca gcatcgtggg tctgggggtg caatccctaa 18420

agcgccgacg atgcttttga atagctaacg tgtcgtatgt gtgtcatgta tgcgtccatg 18480

tcgccgccag aggagctgct gagtcgccgc gcgcccgctt tccaagatgg ctaccccttc 18540

gatgatgccg cagtggtctt acatgcacat ctcgggccag gacgcctcgg agtacctgag 18600

ccccgggctg gtgcagttcg cccgcgccac cgagacgtac ttcagcctga ataacaagtt 18660

tagaaacccc acggtggcgc ctacgcacga cgtgaccaca gaccggtctc agcgtttgac 18720

gctgcggttt atccccgtgg accgcgagga taccgcatac tcgtacaagg cgcggtttac 18780

cctggctgtg ggtgacaacc gtgtgcttga catggcttcc acatactttg acattcgcgg 18840

cgtgctggac cggggcccca cttttaaacc ctactccggc actgcctaca acgctctagc 18900

ccccaagggc gctcccaatt cctgcgagtg ggaacaagaa gaaccaactc aggaaatggc 18960

tgaagaactt gaagatgagg aggaggcaga ggaggaggag gcagaggagg aggcagaagc 19020

accacaagct gatcagaagg ttaagaagac tcatgtatat gctcaggctc ctttggcagg 19080

ggaaaaaatt accgccaatg gcttacaaat agtttctgat acccaaactg aaggcaatcc 19140

agtttttgcc gatcccactt atcaacctga acctcaggtt ggagaatctc agtggaatga 19200

agctgaagca actgcatctg gaggcagagt actaaaaaag actactccca tgaaaccatg 19260

ctacggatcg tatgccagac ctacaaataa aaatgggggt caaggtatac tagtagcaaa 19320

caaccaaggt gctctagagt ctaaagttga aatgcagttt tttgccccct ctggcactgc 19380

catgaatgaa agaaatgctg ttcagccaag tattgttttg tacagtgagg atgttaatat 19440

ggaaactcct gatactcaca tttcatacaa accaagcaaa actgatgaaa actctaaggc 19500

tatgttgggt caacaagcaa tgccaaacag acccaattac atcgctttta gggacaattt 19560

tattggcctt atgtattaca acagcactgg taacatgggt gtccttgctg gacaagcatc 19620

acagctaaat gccgtggtag acttgcagga cagaaacaca gagctgtcat atcaactttt 19680

gcttgattct attggcgata gaaccagata cttttccatg tggaatcagg ctgtagacag 19740

ctatgatcca gatgtcagaa tcattgaaaa tcatggaact gaggatgagt tgccaaatta 19800

ctgcttccca cttggcggta taggggtaac tgacacctac caaggtataa aatcaaacgg 19860

aaacggtaat cctcaaaact ggaccaaaaa tgacgatttt gcggcacgta atgaaatagg 19920

tgtgggaaac aactttgccc tggagattaa ccttaatgcc aacctatgga gaaatttcct 19980

ctactccaac attgcactgt acctgcctga caagctaaaa tacactccta caaatgtgga 20040

aatatctccc aaccctaatt catacgatta tatgaacaaa cgagtggtgg ctcccgggtt 20100

ggtggattgc tacattaacc ttggagcgcg ttggtcattg gactacatgg acaacgtcaa 20160

cccctttaac catcaccgca atgcgggcct acgctaccgc tccatgttgc tgggcaacgg 20220

tcgctacgtg ccctttcaca tccaggttcc tcagaagttt tttgccatta agaacctcct 20280

actcttgccg ggctcataca cctacgagtg gaacttcagg aaagatgtta acatggtcct 20340

acaaagctcc ctaggaaacg acctaagagt tgacggagcc agcattaagt ttgacagcat 20400

ttgcctctac gccacctttt ttccgatggc ccacaacacc gcctcaacgc ttgaagccat 20460

gcttagaaac gacaccaacg accaatcctt taacgactac ctatccgccg ccaacatgct 20520

ttaccccata cccgccaacg ccaccaacgt gcccatctct atcccctcgc gcaactgggc 20580

ggctttccga ggctgggcct ttacgcgcct taagactaag gaaaccccat ccctgggttc 20640

cggctacgac ccttactata cctactctgg ctccataccc tacctagacg gaacctttta 20700

ccttaatcac accttcaaaa aggtggccat cacctttgac tcttctgtta gctggcctgg 20760

caatgaccgt ctgcttaccc ccaacgagtt tgagatcaag cgttcagttg acggagaggg 20820

ctacaacgtt gcccaatgca acatgaccaa agactggttc ttggtacaga tgctagccaa 20880

ctacaacata ggctaccagg gcttttatat cccagaaagc tataaggacc gcatgtactc 20940

cttctttaga aacttccagc ccatgagccg tcaggtggtg gacgatacca aatacaagga 21000

ctaccaacag gtgggcatcc tccaccagca caataactct ggctttgttg gttacctcgc 21060

tcccaccatg cgagagggac aggcctaccc cgccaacttc ccctacccgc ttataggcaa 21120

gaccgcggtt gacagtatta cccagaaaaa gtttctttgc gaccgcaccc tttggcgcat 21180

tccattctcc agtaacttta tgtccatggg tgcactcaca gacctgggcc aaaaccttct 21240

ctatgcaaac tccgcccacg cgctagatat gacttttgag gtggatccca tggacgagcc 21300

cacccttctt tatgttttgt ttgaagtctt tgacgtggtc cgtgtgcacc agccgcaccg 21360

cggcgtcatc gagaccgtgt acctgcgcac gcccttctcg gctggcaacg ccacaacata 21420

aagaagcaag caacatcaac aacagctgcc gccatgggct ccagtgagca ggaactaaaa 21480

gccattgtca aagatcttgg ttgtgggcca tattttttgg gcacctatga caagcgcttc 21540

ccaggctttg tttccccaca caagctcgcc tgcgccatag ttaacacggc cggtcgcgag 21600

actgggggcg tacactggat ggcctttgcc tggaacccgc gctcaaaaac atgctacctc 21660

tttgagccct ttggcttttc tgaccaacgt ctcaagcagg tttaccagtt tgagtacgag 21720

tcactcctgc gccgtagcgc cattgcctct tcccccgacc gctgtataac gctggaaaag 21780

tccacccaaa gcgtgcaggg gcccaactcg gccgcctgtg gcctattctg ctgcatgttt 21840

ctccacgcct ttgccaactg gccccaaact cccatggatc acaaccccac catgaacctt 21900

attaccgggg tacccaactc catgcttaac agtccccagg tacagcccac cctgcgtcgc 21960

aaccaggaac agctctacag cttcctggag cgccactcgc cctacttccg cagccacagt 22020

gcgcagatta ggagcgccac ttctttttgt cacttgaaaa acatgtaaaa ataatgtact 22080

aggagacact ttcaataaag gcaaatgttt ttatttgtac actctcgggt gattatttac 22140

ccccaccctt gccgtctgcg ccgtttaaaa atcaaagggg ttctgccgcg catcgctatg 22200

cgccactggc agggacacgt tgcgatactg gtgtttagtg ctccacttaa actcaggcac 22260

aaccatccgc ggcagctcgg tgaagttttc actccacagg ctgcgcacca tcaccaacgc 22320

gtttagcagg tcgggtgccg atatcttgaa gtcgcagttg gggcctccgc cctgcgcgcg 22380

cgagttgcga tacacagggt tgcagcactg gaacactatt agcgccgggt ggtgcacgct 22440

ggccagcacg ctcttgtcgg agatcagatc cgcgtccagg tcctccgcgt tgctcagggc 22500

gaacggagtc aactttggta gctgccttcc caaaaagggt gcatgcccag gctttgagtt 22560

gcactcgcac cgtagtggca tcagaaggtg accgtgcccg gtctgggcgt taggatacag 22620

cgcctgcatg aaagccttga tctgcttaaa agccacctga gcctttgcgc cttcagagaa 22680

gaacatgccg caagacttgc cggaaaactg attggccgga caggccgcgt catgcacgca 22740

gcaccttgcg tcggtgttgg agatctgcac cacatttcgg ccccaccggt tcttcacgat 22800

cttggccttg ctagactgct ccttcagcgc gcgctgcccg ttttcgctcg tcacatccat 22860

ttcaatcacg tgctccttat ttatcataat gctcccgtgt agacacttaa gctcgccttc 22920

gatctcagcg cagcggtgca gccacaacgc gcagcccgtg ggctcgtggt gcttgtaggt 22980

tacctctgca aacgactgca ggtacgcctg caggaatcgc cccatcatcg tcacaaaggt 23040

cttgttgctg gtgaaggtca gctgcaaccc gcggtgctcc tcgtttagcc aggtcttgca 23100

tacggccgcc agagcttcca cttggtcagg cagtagcttg aagtttgcct ttagatcgtt 23160

atccacgtgg tacttgtcca tcaacgcgcg cgcagcctcc atgcccttct cccacgcaga 23220

cacgatcggc aggctcagcg ggtttatcac cgtgctttca ctttccgctt cactggactc 23280

ttccttttcc tcttgcgtcc gcataccccg cgccactggg tcgtcttcat tcagccgccg 23340

caccgtgcgc ttacctccct tgccgtgctt gattagcacc ggtgggttgc tgaaacccac 23400

catttgtagc gccacatctt ctctttcttc ctcgctgtcc acgatcacct ctggggatgg 23460

cgggcgctcg ggcttgggag aggggcgctt ctttttcttt ttggacgcaa tggccaaatc 23520

cgccgtcgag gtcgatggcc gcgggctggg tgtgcgcggc accagcgcat cttgtgacga 23580

gtcttcttcg tcctcggact cgagacgccg cctcagccgc ttttttgggg gcgcgcgggg 23640

aggcggcggc gacggcgacg gggacgacac gtcctccatg gttggtggac gtcgcgccgc 23700

accgcgtccg cgctcggggg tggtttcgcg ctgctcctct tcccgactgg ccatttcctt 23760

ctcctatagg cagaaaaaga tcatggagtc agtcgagaag gaggacagcc taaccgcccc 23820

ctttgagttc gccaccaccg cctccaccga tgccgccaac gcgcctacca ccttccccgt 23880

cgaggcaccc ccgcttgagg aggaggaagt gattatcgag caggacccag gttttgtaag 23940

cgaagacgac gaggatcgct cagtaccaac agaggataaa aagcaagacc aggacgacgc 24000

agaggcaaac gaggaacaag tcgggcgggg ggaccaaagg catggcgact acctagatgt 24060

gggagacgac gtgctgttga agcatctgca gcgccagtgc gccattatct gcgacgcgtt 24120

gcaagagcgc agcgatgtgc ccctcgccat agcggatgtc agccttgcct acgaacgcca 24180

cctgttctca ccgcgcgtac cccccaaacg ccaagaaaac ggcacatgcg agcccaaccc 24240

gcgcctcaac ttctaccccg tatttgccgt gccagaggtg cttgccacct atcacatctt 24300

tttccaaaac tgcaagatac ccctatcctg ccgtgccaac cgcagccgag cggacaagca 24360

gctggccttg cggcagggcg ctgtcatacc tgatatcgcc tcgctcgacg aagtgccaaa 24420

aatctttgag ggtcttggac gcgacgagaa acgcgcggca aacgctctgc aacaagaaaa 24480

cagcgaaaat gaaagtcact gtggagtgct ggtggaactt gagggtgaca acgcgcgcct 24540

agccgtgctg aaacgcagca tcgaggtcac ccactttgcc tacccggcac ttaacctacc 24600

ccccaaggtt atgagcacag tcatgagcga gctgatcgtg cgccgtgcac gacccctgga 24660

gagggatgca aacttgcaag aacaaaccga ggagggccta cccgcagttg gcgatgagca 24720

gctggcgcgc tggcttgaga cgcgcgagcc tgccgacttg gaggagcgac gcaagctaat 24780

gatggccgca gtgcttgtta ccgtggagct tgagtgcatg cagcggttct ttgctgaccc 24840

ggagatgcag cgcaagctag aggaaacgtt gcactacacc tttcgccagg gctacgtgcg 24900

ccaggcctgc aaaatttcca acgtggagct ctgcaacctg gtctcctacc ttggaatttt 24960

gcacgaaaac cgcctcgggc aaaacgtgct tcattccacg ctcaagggcg aggcgcgccg 25020

cgactacgtc cgcgactgcg tttacttatt tctgtgctac acctggcaaa cggccatggg 25080

cgtgtggcag cagtgcctgg aggagcgcaa cctgaaggag ctgcagaagc tgctaaagca 25140

aaacttgaag gacctatgga cggccttcaa cgagcgctcc gtggccgcgc acctggcgga 25200

cattatcttc cccgaacgcc tgcttaaaac cctgcaacag ggtctgccag acttcaccag 25260

tcaaagcatg ttgcaaaact ttaggaactt tatcctagag cgttcaggaa ttctgcccgc 25320

cacctgctgt gcgcttccta gcgactttgt gcccattaag taccgtgaat gccctccgcc 25380

gctttggggt cactgctacc ttctgcagct agccaactac cttgcctacc actccgacat 25440

catggaagac gtgagcggtg acggcctact ggagtgtcac tgtcgctgca acctatgcac 25500

cccgcaccgc tccctggtct gcaattcgca actgcttagc gaaagtcaaa ttatcggtac 25560

ctttgagctg cagggtccct cgcctgacga aaagtccgcg gctccggggt tgaaactcac 25620

tccggggctg tggacgtcgg cttaccttcg caaatttgta cctgaggact accacgccca 25680

cgagattagg ttttacgaag accaatcccg cccgccaaat gcggagctta ccgcctgcgt 25740

cattacccag ggccacatcc ttggccaatt gcaagccatc aacaaagccc gccaagagtt 25800

tctgctacga aagggacggg gggtttacct ggacccccag tccggcgagg agctcaaccc 25860

aatccccccg ccgccgcagc cctatcagca gccgcgggcc cttgcttccc aggatggcac 25920

ccaaaaagaa gctgcagctg ccgccgccgc cacccacgga cgaggaggaa tactgggaca 25980

gtcaggcaga ggaggttttg gacgaggagg aggagatgat ggaagactgg gacagcctag 26040

acgaagcttc cgaggccgaa gaggtgtcag acgaaacacc gtcaccctcg gtcgcattcc 26100

cctcgccggc gccccagaaa ttggcaaccg ttcccagcat cgctacaacc tccgctcctc 26160

aggcgccgcc ggcactgccc gttcgccgac ccaaccgtag atgggacacc actggaacca 26220

gggccggtaa gtctaagcag ccgccgccgt taacccaaga gcaacaacag cgccaaggct 26280

accgctcgtg gcgcgggcac aagaacgcca tagttgcttg cttgcaagac tgtgggggca 26340

acatctcctt cgcccgccgc tttcttctct accatcacgg cgtggccttc ccccgtaaca 26400

tcctgcatta ctaccgtcat ctctacagcc cctactgcac cggcggcagc ggcagcggca 26460

gcaacagcag cggtcacaca gaagcaaagg cgaccggata gcaagactct gacaaagccc 26520

aagaaatcca cagcggcggc agcagcagga ggaggagcgc tgcgtctggc gtccaacgaa 26580

cccgtatcga cccgcgagct tagaaacagg atttttccca ctctgtatgc tatatttcaa 26640

caaagcaggg gccaagaaca agagctaaaa ataaaaaaca ggtctctgcg ctccctcacc 26700

cgcagctgcc tgtatcacaa aagcgaagat cagcttcggc gcacgctgga agacgcggag 26760

gctctcttca gcaaatactg cgcgctgact cttaaggact agtttcgcgc cctttctcaa 26820

atttaagcgc gaaaactacg tcatctccag cggccacacc cggcgccagc acctgtcgtc 26880

agcgccatta tgagcaagga aattcccacg ccctacatgt ggagttacca gccacaaatg 26940

ggacttgcgg ctggagctgc ccaagactac tcaacccgaa taaactacat gagcgcggga 27000

ccccacatga tatcccgggt caacggaatc cgcgcccacc gaaaccgaat tctcctcgaa 27060

caggcggcta ttaccaccac acctcgtaat aaccttaatc cccgtagttg gcccgctgcc 27120

ctggtgtacc aggaaagtcc cgctcccacc actgtggtac ttcccagaga cgcccaggcc 27180

gaagttcaga tgactaactc aggggcgcag cttgcgggcg gctttcgtca cagggtgcgg 27240

tcgccaggac agggtataac tcacctgaaa atcagagggc gaggtattca gctcaacgac 27300

gagtcggtga gctcctctct tggtctccgt ccggacggga catttcagat cggcggcgct 27360

ggccgctctt catttacgcc ccgtcaggcg atcctaactc tgcagacctc gtcctcggag 27420

ccgcgctccg gaggcattgg aactctacaa tttattgagg agttcgtgcc ttcagtttac 27480

ttcaacccct tttctggacc tcccggccac tacccggacc agtttattcc caactttgac 27540

gcggtgaaag actcggcgga cggctacgac tgaatgacca gtggagaggc agagcaactg 27600

cgcctgacac acctcgacca ctgccgccgc cacaagtgct ttgcccgcgg ctccggtgag 27660

ttttgttact ttgaattgcc cgaagagcat atcgagggcc cggcgcacgg cgtccggctc 27720

accacccagg tagagcttac acgtagcctg attcgggagt ttaccaagcg ccccctgcta 27780

gtggagcggg agcggggtcc ctgtgttctg accgtggttt gcaactgtcc taaccctgga 27840

ttacatcaag atctttgttg tcatctctgt gctgagtata ataaatacag aaattagaat 27900

ctactggggc tcctgtcgcc atcctgtgaa cgccaccgtt tttacccacc caaagcagac 27960

caaagcaaac ctcacctccg gtttgcacaa gcgggccaat aagtacctta cctggtactt 28020

taacggctct tcatttgtaa tttacaacag tttccagcga gacgaagtaa gtttgccaca 28080

caaccttctc ggcttcaact acaccgtcaa gaaaaacacc accaccaccc tcctcacctg 28140

ccgggaacgt acgagtgcgt caccggttgc tgcgcccaca cctacagcct gagcgtaacc 28200

agacattact cccatttttc caaaacagga ggtgagctca actcccggaa ctcaggtcaa 28260

aaaagcattt tgcggggtgc tgggattttt taattaagta tatgagcaat tcaagtaact 28320

ctacaagctt gtctaatttt tctggaattg gggtcggggt tatccttact cttgtaattc 28380

tgtttattct tatactagca cttctgtgcc ttagggttgc cgcctgctgc acgcacgttt 28440

gtacctattg tcagcttttt aaacgctggg ggcgacatcc aagatgagat taaatgagac 28500

atgattcctc gagttcttat attattgacc cttgttgcgc ttttctgtgc gtgctctaca 28560

ttggccgcgg tcgctcacat cgaagtagat tgcatcccac ctttcacagt ttacctgctt 28620

tacggatttg tcacccttat cctcatctgc agcctcgtca ctgtagtcat cgccttcatt 28680

cagttcattg actgggtttg tgtgcgcatt gcgtacctca ggcaccatcc gcaatacaga 28740

gacaggacta tagctgatct tctcagaatt ctttaattat gaaacggagt gtcatttttg 28800

ttttgctgat tttttgcgcc ctacctgtgc tttgctccca aacctcagcg cctcccaaaa 28860

gacatatttc ctgcagattc actcaaatat ggaacattcc cagctgctac aacaaacaga 28920

gcgatttgtc agaagcctgg ttatacgcca tcatctctgt catggttttt tgcagtacca 28980

tttttgccct agccatatat ccataccttg acattggctg gaatgccata gatgccatga 29040

accaccctac tttcccagtg cccgctgtca taccactgca acaggttatt gccccaatca 29100

atcagcctcg ccccccttct cccaccccca ctgagattag ctactttaat ttgacaggtg 29160

gagatgactg aatctctaga tctagaattg gatggaatta acaccgaaca gcgcctacta 29220

gaaaggcgca aggcggcgtc cgagcgagaa cgcctaaaac aagaagttga agacatggtt 29280

aacctacacc agtgtaaaag aggtatcttt tgtgtggtca agcaggccaa acttacctac 29340

gaaaaaacca ctaccggcaa ccgcctcagc tacaagctac ccacccagcg ccaaaaactg 29400

gtgcttatgg tgggagaaaa acctatcacc gtcacccagc actcggcaga aacagagggc 29460

tgcctgcact tcccctatca gggtccagag gacctctgca ctcttattaa aaccatgtgt 29520

ggtattagag atcttattcc attcaactaa cataaacaca caataaatta cttacttaaa 29580

atcagtcagc aaatctttgt ccagcttatt cagcatcacc tcctttcctt cctcccaact 29640

ctggtatctc agccgccttt tagctgcaaa ctttctccaa agtttaaatg ggatgtcaaa 29700

ttcctcatgt tcttgtccct ccgcacccac tatcttcata ttgttgcaga tgaaacgcgc 29760

cagaccgtct gaagacacct tcaaccccgt gtatccatat gacacagaaa ccgggcctcc 29820

aactgtgccc tttcttaccc ctccatttgt ttcacccaat ggtttccaag aaagtccccc 29880

tggagttctc tctctacgcg tctccgaacc tttggacacc tcccacggca tgcttgcgct 29940

taaaatgggc agcggtctta ccctagacaa ggccggaaac ctcacctccc aaaatgtaac 30000

cactgttact cagccactta aaaaaacaaa gtcaaacata agtttggaca cctccgcacc 30060

acttacaatt acctcaggcg ccctaacagt ggcaaccacc gctcctctga tagttactag 30120

cggcgctctt agcgtacagt cacaagcccc actgaccgtg caagactcca aactaagcat 30180

tgctactaaa gggcccatta cagtgtcaga tggaaagcta gccctgcaaa catcagcccc 30240

cctctctggc agtgacagcg acacccttac tgtaactgca acacccccgc taactactgc 30300

cacgggtagc ttgggcatta acatggaaga tcctatttat gtaaataatg gaaaaatagg 30360

aattaaaata agcggtcctt tgcaagtagc acaaaactcc gatacactaa cagtagttac 30420

tggaccaggt gtcaccgttg aacaaaactc ccttagaacc aaagttgcag gagctattgg 30480

ttatgattca tcaaacaaca tggaaattaa aacgggcggt ggcatgcgta taaataacaa 30540

cttgttaatt ctagatgtgg attacccatt tgatgctcaa acaaaactac gtcttaaact 30600

ggggcaggga cccctgtata ttaatgcatc tcataacttg gacataaact ataacagagg 30660

cctatacctt tttaatgcat caaacaatac taaaaaactg gaagttagca taaaaaaatc 30720

cagtggacta aactttgata atactgccat agctataaat gcaggaaagg gtctggagtt 30780

tgatacaaac acatctgagt ctccagatat caacccaata aaaactaaaa ttggctctgg 30840

cattgattac aatgaaaacg gtgccatgat tactaaactt ggagcgggtt taagctttga 30900

caactcaggg gccattacaa taggaaacaa aaatgatgac aaacttaccc tgtggacaac 30960

cccagaccca tctcctaact gcagaattca ttcagataat gactgcaaat ttactttggt 31020

tcttacaaaa tgtgggagtc aagtactagc tactgtagct gctttggctg tatctggaga 31080

tctttcatcc atgacaggca ccgttgcaag tgttagtata ttccttagat ttgaccaaaa 31140

cggtgttcta atggagaact cctcacttaa aaaacattac tggaacttta gaaatgggaa 31200

ctcaactaat gcaaatccat acacaaatgc agttggattt atgcctaacc ttctagccta 31260

tccaaaaacc caaagtcaaa ctgctaaaaa taacattgtc agtcaagttt acttgcatgg 31320

tgataaaact aaacctatga tacttaccat tacacttaat ggcactagtg aatccacaga 31380

aactagcgag gtaagcactt actctatgtc ttttacatgg tcctgggaaa gtggaaaata 31440

caccactgaa acttttgcta ccaactctta caccttctcc tacattgccc aggaataaag 31500

aatcgtaaac ctgttgcatg ttatgtttca acgtgtttat ttttcaattg cagaaaattt 31560

caagtcattt ttcattcagt agtatagccc caccaccaca tagcttatac agatcaccgt 31620

accttatcaa actcacagaa ccctagtatt caacctgcca cctccctccc aacacacaga 31680

gtacacagtc ctttctcccc ggctggcctt aaaaagcatc atatcatggg taacagacat 31740

attcttaggt gttatattcc acacggtttc ctgtcgagcc aaacgctcat cagtgatatt 31800

aataaactcc ccgggcagct cacttaagtt catgtcgctg tccagctgct gagccacagg 31860

ctgctgtcca acttgcggtt gcttaacggg cggcgaagga gaagtccacg cctacatggg 31920

ggtagagtca taatcgtgca tcaggatagg gcggtggtgc tgcagcagcg cgcgaataaa 31980

ctgctgccgc cgccgctccg tcctgcagga atacaacatg gcagtggtct cctcagcgat 32040

gattcgcacc gcccgcagca taaggcgcct tgtcctccgg gcgcagcagc gcaccctgat 32100

ctcacttaaa tcagcacagt aactgcagca cagcaccaca atattgttca aaatcccaca 32160

gtgcaaggcg ctgtatccaa agctcatggc ggggaccaca gaacccacgt ggccatcata 32220

ccacaagcgc aggtagatta agtggcgacc cctcataaac acgctggaca taaacattac 32280

ctcttttggc atgttgtaat tcaccacctc ccggtaccat ataaacctct gattaaacat 32340

ggcgccatcc accaccatcc taaaccagct ggccaaaacc tgcccgccgg ctatacactg 32400

cagggaaccg ggactggaac aatgacagtg gagagcccag gactcgtaac catggatcat 32460

catgctcgtc atgatatcaa tgttggcaca acacaggcac acgtacatac acttcctcag 32520

gattacaagc tcctcccgcg tcagaaccat atcccaggga acaacccatt cctgaatcag 32580

cgtaaatccc acactgcagg gaagacctcg cacgtaactc acgttgtgca ttgtcaaagt 32640

gttacattcg ggcagcagcg gatgatcctc cagtatggta gcgcgggttt ctgtctcaaa 32700

aggaggtaga cgatccctac tgtacggagt gcgccgagac aaccgagatc gtgttggtcg 32760

tagtgtc 32767

Claims (5)

1. An application of replication type human adenovirus in preparing a preparation for treating tumor, which is characterized in that the nucleotide sequence of the replication type human adenovirus is shown as SEQ ID NO: 21;

the construction method of the replication type human adenovirus comprises the following steps:

s1) carrying out PCR amplification to obtain the left end and the right end of the NBOV1901 genome, connecting the two ends with a resistance vector plasmid A to obtain pT-NBOV1901 (L+R), linearizing, and recombining with the NBOV1901 genome to obtain a genome plasmid pNBOV1901; the full sequence GenBank number of the NBOV1901 genome is: MH 558113.1;

s2) connecting left and right arms from SrfI to the whole E3 region to a resistance vector plasmid B, linearizing, and recombining with PacI digested NBOV1901 to obtain a genome plasmid pNBOV1901 delta E3-SrfI with SrfI removed to the whole E3 region;

s3) PCR amplification is carried out by taking NBOV1901 genome as a template to obtain E3gp19K upstream fragment: srfI to E3gp19K, and E3gp19K downstream fragments: e3gp19K to E3 region contains E3-14.7K gene fragment, three fragments of E3gp19K upstream fragment, E3gp19K downstream fragment and construction vector after enzyme digestion are recombined and connected between left and right arms of pNBOV1901 delta E3-SrfI, and are recombined with pNBOV1901 delta E3-SrfI after linearization to obtain genome plasmid pNBOV1901 delta E3gp19K with modified SrfI enzyme digestion site;

s4) connecting left and right arms of an E1 region obtained by PCR amplification to a resistance vector plasmid B, and recombining the linearized plasmid with pNBOV1901 delta E3gp19K digested by SrfI to obtain a genome plasmid pNBOV1901 delta E3gp19K delta E1 with the E1 region removed;

s5) carrying out PCR amplification to obtain an E1 region genome with the E1B19K, pRB gene removed, connecting the genome to a resistance vector plasmid B containing left and right arms of the E1 region, linearizing, and recombining with pNBOV1901 delta E3gp19K delta E1 after enzyme digestion to obtain a genome plasmid pNBOV1910 with the E1B19K, pRB gene knocked out, namely the replication type human adenovirus;

the primer sequence for removing the E1 region genome of the E1b19K, pRB gene obtained by PCR amplification is shown as SEQ ID NO: 16-SEQ ID NO: shown at 20;

the resistance vector plasmid a and the resistance vector plasmid B have different resistances;

the tumor is non-small cell lung cancer.

2. A composition for treating non-small cell lung cancer, comprising: comprising the replication competent human adenovirus of claim 1.

3. The composition of claim 2, wherein the composition comprises: a) An immune modulator; b) An immunoregulatory cell; c) A radiation therapy; d) Phototherapy compounds; or e) at least one of a chemotherapeutic compound.

4. The composition of claim 2, wherein the composition further comprises a pharmaceutically acceptable adjuvant, diluent or excipient.

5. The application of the composition in preparing a preparation for treating tumors is characterized in that: the composition according to any one of claims 2 to 4; the tumor is non-small cell lung cancer.