CN113774031A - Replicative human adenovirus and application thereof - Google Patents

Abstract

The invention discloses a replicative human adenovirus and application thereof. The complete sequence of the vector is shown as SEQ ID No.: shown at 21. After being loaded with related nucleic acid sequences, the replicative human adenovirus of some embodiments of the present invention can be directly injected into solid tumors, including but not limited to H1299, Skov-3, U251, etc., and is identified as being capable of replicating in tumor cells and directly killing tumor cells, and infecting the surrounding tumor cells after the infected tumor cells are lysed; meanwhile, the medicament has no killing effect on normal human cells and has unexpected oncolytic effect.

Description

Replicative human adenovirus and application thereof

Technical Field

The invention relates to the field of gene therapy, in particular to a recombinant oncolytic adenovirus, a recombinant oncolytic adenovirus vector for preparing the recombinant oncolytic adenovirus and application thereof.

Background

Cancer is caused by self factors (genetic mutations, natural aging, etc.) or environmental factors (e.g., smoking, ultraviolet radiation, chemicals, viral infections, etc.). According to WHO reports that tumors are the second leading cause of death in the world after cardiovascular diseases, 1/6 deaths worldwide are caused by cancer. The number of cancer deaths worldwide in 2018 reaches 960 ten thousand. By 2025, the number of new cancer cases worldwide will be as high as 2449 million per year. Among them, lung cancer is the most fatal, followed by colorectal cancer, gastric cancer, liver cancer and breast cancer.

The classical approaches to cancer treatment are mainly surgery, chemotherapy, and radiotherapy. The surgical resection effect is limited, and the effect on metastatic cancer cells is not good; radiotherapy and chemotherapy have great side effects, and although target drugs improve the life quality of patients to a great extent, tolerance is a problem in chemotherapy. In recent years, immunotherapy has become a hot spot in the field of cancer treatment. The principle of immunotherapy is to destroy tumor cells by activating the body's own immune system, and has the advantages of good therapeutic effect, less side effects, prevention of recurrence, etc.

In recent years, oncolytic viruses have been renewed in the field of cancer therapy. Oncolytic viruses (oncolytic viruses), a class of viruses that are replication competent and capable of directly lysing tumor cells. As early as 1912, Italian doctors discovered that a patient with cervical cancer had a tumor regressed after infection with rabies virus. China approved the first oncolytic adenovirus (H101) in the world to be marketed in 2005, but the clinical efficacy is not internationally recognized at present. Most genes in E1B-55K and E3 regions are knocked out by the virus. The E1B-55K protein can inhibit the expression of an anticancer gene P53 and prevent P53-mediated apoptosis of infected cells. Since the P53 protein in normal cells is intact, most tumors lose P53 function, deletion of the E1B-55K gene allows the virus to replicate specifically in tumor cells that lack functional P53. However, the E1B-55K protein is a protein necessary for the export of viral mRNA from the nucleus, and therefore, the replication ability and oncolytic ability of H101 are significantly reduced as compared with the wild strain. In 2015, the FDA approved the first oncolytic virus therapy T-vec (herpes simplex virus-1) for the treatment of melanoma that recurs after surgical resection. As a third generation oncolytic virus, the T-vec deletes the gamma 34.5 gene, so that the T-vec has tumor cell targeting property, and simultaneously carries GM-CSF (granulocyte-macrophage colony factor) to enhance the anti-tumor immunity.

Oncolytic virus is an important branch of immunotherapy, and can kill tumor cells through a plurality of different action ways, destroy the microenvironment for tumor immunosuppression to induce long-term tumor specific immune response, and meanwhile, can be specifically expressed in the tumor cells for a long time by carrying therapeutic genes, thereby enhancing the anti-tumor curative effect. In addition, the experimental results of the combined administration of the oncolytic virus and other anti-cancer drugs, such as the combination of an immune checkpoint inhibitor and the like, show good anti-tumor effects. In recent years, many viruses including vaccinia virus, reovirus, measles virus, herpes simplex virus, newcastle disease virus and coxsackievirus have been clinically tested as oncolytic agents.

Adenovirus (adenovirus) is a particle without an envelope and with the diameter of 70-90 nm, and consists of 252 capsomeres arranged in a icosahedron shape. The diameter of each shell particle is 7-9 nm. The capsid is a linear double-stranded DNA molecule containing about 4.7kb, and two ends of the linear double-stranded DNA molecule are respectively provided with an inverted terminal repetitive sequence with the length of about 100-600 bp. Human adenoviruses (HAdV) belong to the family of Adenoviridae, and are divided into A-G7 subspecies according to different immunological, biological and biochemical characteristics, and the total number of the serotypes is 52, and different serotypes have different organ affinities and cause corresponding clinical manifestations. Adenovirus can cause at least 3 infections after invading host cells: chronic, latent infection: it is usually generated in lymphocytes, and the amount of virus released during latent infection is very small, and cell necrosis is not obvious, so clinical infection is not obvious, and the mechanism of latent infection is not clear. Soluble infection: viruses undergo a replicative process in cells such as human epithelial cells, causing cell death by cytolytic action. Tumor-like variation: in this case, the virus propagation is performed only for the first few steps, and then the adenovirus DNA is integrated with the cell DNA and replicated, but no infectious virus is produced, and the adenovirus is relatively stable in antigenicity.

Zhou Wan, He Wan, Chaba, et al, clinical research progress of oncolytic adenovirus targeted cancer therapy [ J ] J, J.Bioengineering, China, 2013,33(12):105-113. it is pointed out that oncolytic adenovirus can specifically infect tumor cells and complete infection-replication cycle in tumor cells, thereby specifically killing and lysing tumor cells without damaging other normal cells and tissues, and thus becomes one of the most promising antitumor drugs at present. Different viruses have complex biological characteristics, and the resources of the viruses which are completely familiar to human beings are still relatively deficient. Especially, most of preclinical experimental data are from a human tumor transplantation model in an immunodeficient animal, and have great differences from human in vivo environment, biological characteristics of tissue cells and the like. The existing oncolytic adenoviruses have no obvious commonality, and whether the oncolytic adenovirus has an oncolytic effect or not is difficult to determine based on the sequence of the adenovirus, but most adenoviruses are insensitive to tumor cells and have no oncolytic characteristic.

Disclosure of Invention

The invention aims to overcome at least one defect in the prior art and provides an oncolytic adenovirus vector and application thereof.

The technical scheme adopted by the invention is as follows:

in a first aspect of the present invention, there is provided:

a replicative human adenovirus, the complete sequence of which is as set forth in SEQ ID No.: 21, the resistance-screening gene may be replaced with a known screening gene.

In some examples, the full sequence of the replicative human adenovirus is as set forth in SEQ ID No.: shown at 21.

In some examples, regions E1 and E3 of the virus are deleted.

In some examples, the virus may replicate in animal cells, human cells, or humans.

In some examples, the method of constructing the replicative human adenovirus comprises:

s1) carrying out PCR amplification to obtain the left and right ends of the NBOV1901 genome, connecting the two ends to a resistant vector plasmid A to obtain pT-NBOV1901(L + R), and recombining the linearized product with the NBOV1901 genome to obtain a genome plasmid pNBOV 1901;

s2) carrying out PCR amplification to obtain a plasmid B which is connected to a resistant vector from the SrfI to the left arm and the right arm of the whole E3 region, carrying out linearization and recombination with NBOV1901 digested by PacI to obtain a genome plasmid pNBOV 1901. delta. E3-SrfI from which SrfI is removed to the whole E3 region;

s3) using NBOV1901 genome as a template, and obtaining an E3gp19K upstream fragment by PCR amplification: SrfI to E3gp19K, and E3gp19K downstream fragments: the E3gp 19K-E3 region contains an E3-14.7K gene fragment, an E3gp19K upstream fragment, an E3gp19K downstream fragment and a construction vector after enzyme digestion are connected between the left arm and the right arm of pNBOV1901 delta E3-SrfI in a recombination mode, linearization and pNBOV1901 delta E3-SrfI are carried out in a recombination mode, and a genome plasmid pNBOV1901 delta E3gp19K with a modified SrfI enzyme digestion site is obtained;

s4) carrying out PCR amplification to obtain a left arm and a right arm of an E1 region, connecting the left arm and the right arm to a resistant vector plasmid B, carrying out linearization, and recombining the linearized left arm and the right arm with SrfI enzyme-cut pNBOV 1901. delta. E3gp19K to obtain a genome plasmid pNBOV 1901. delta. E3gp 19K. delta. E1 with the E1 region removed;

s5) carrying out PCR amplification to obtain E1 region genome with E1B19K and pRB genes removed, connecting the E1 region genome to a resistant vector plasmid B containing the left arm and the right arm of the E1 region, carrying out linearization and recombination with enzyme-digested pNBOV1901 delta E3gp19K delta E1 to obtain genome plasmid pNBOV1910 with E1B19K and pRB genes removed, namely the replicative human adenovirus.

In some examples, the resistance vector plasmid a and the resistance vector plasmid B have different resistances.

In some examples, the resistance vector plasmid a and the resistance vector plasmid B are independently selected from an ampicillin resistance vector plasmid or a kanamycin resistance vector plasmid. These resistant plasmids are more mature, easily available, and less costly to screen.

In some examples, include:

s1) carrying out PCR amplification to obtain the left end and the right end of an NBOV1901 genome, connecting the two ends to an ampicillin resistance vector plasmid to obtain pT-NBOV1901(L + R), and recombining the linearized product with the NBOV1901 genome to obtain a genome plasmid pNBOV 1901;

s2) carrying out PCR amplification to obtain the left and right arms from the SrfI to the whole E3 region, connecting the left and right arms to a kanamycin-resistant vector plasmid, carrying out linearization, and then carrying out recombination with NBOV1901 digested by PacI enzyme to obtain a genome plasmid pNBOV 1901. delta. E3-SrfI with SrfI removed to the whole E3 region;

s3) using NBOV1901 genome as a template, and obtaining an E3gp19K upstream fragment by PCR amplification: SrfI to E3gp19K, and E3gp19K downstream fragments: the E3gp 19K-E3 region contains an E3-14.7K gene fragment, an E3gp19K upstream fragment, an E3gp19K downstream fragment and a construction vector after enzyme digestion are connected between the left arm and the right arm of pNBOV1901 delta E3-SrfI in a recombination mode, linearization and pNBOV1901 delta E3-SrfI are carried out in a recombination mode, and a genome plasmid pNBOV1901 delta E3gp19K with a modified SrfI enzyme digestion site is obtained;

s4) carrying out PCR amplification to obtain the left arm and the right arm of an E1 region, connecting the left arm and the right arm to a kanamycin resistance carrier plasmid, carrying out linearization, and recombining the linearized plasmid and SrfI enzyme-cut pNBOV1901 delta E3gp19K to obtain a genome plasmid pNBOV1901 delta E3gp19K delta E1 with the E1 region removed;

s5) carrying out PCR amplification to obtain a genome of the E1 region with E1b19K and pRB genes removed, connecting the genome to a kanamycin-resistant vector plasmid containing the left arm and the right arm of the E1 region, and recombining the linearized genome with the digested pNBOV1901 delta E3gp19K delta E1 to obtain a genome plasmid pNBOV1910 with E1b19K and pRB genes removed.

In a second aspect of the present invention, there is provided:

use of a replicative human adenovirus according to the first aspect of the invention as a recombinant oncolytic viral vector.

In some examples, the recombinant oncolytic viral vector is loaded with a nucleic acid sequence that expresses:

molecules having a therapeutic effect on tumors;

a biological reporter molecule.

In some examples, the molecule having a therapeutic effect on a tumor is selected from the group consisting of a tumor suppressor factor, a tumor killer factor, a tumor microenvironment modulator, a tumor cell surface specific binding factor;

the biological report tracer molecule is selected from beta-galactosidase, secreted alkaline phosphatase, green fluorescent protein and luciferase.

In some examples, the recombinant oncolytic viral vector is further loaded with a nucleic acid sequence expressing a tumor-specific recognition factor.

In some examples, the tumor specific recognition factor is selected from the group consisting of a tumor epitope specific recognition factor, a tumor cell selective replication factor.

These molecules or sequences may be known to those skilled in the art.

In some examples, the tumor is selected from lung cancer, liver cancer, stomach cancer, colorectal cancer, pancreatic cancer, ovarian cancer.

In some examples, at least one of the regions of the pro-E1 region and the E3 region of the vector is used for integration of a foreign gene.

In a third aspect of the present invention, there is provided:

a composition comprising a replication competent human adenovirus according to the first aspect of the invention.

In some examples, the composition includes: a) an immune modulating agent; b) an immune regulatory cell; c) a radioactive treatment; d) a phototherapeutic compound; or e) a chemotherapeutic compound.

In some examples, the composition further comprises a pharmaceutically acceptable adjuvant, diluent or excipient.

In a fourth aspect of the present invention, there is provided:

an oncolytic formulation comprising a replicative human adenovirus according to the first aspect of the present invention.

In some examples, the replicative human adenovirus is loaded with nucleic acid sequences that express:

molecules having a therapeutic effect on tumors;

a biological reporter molecule.

In some examples, the molecule having a therapeutic effect on a tumor is selected from the group consisting of a tumor suppressor factor, a tumor killer factor, a tumor microenvironment modulator, a tumor cell surface specific binding factor;

the biological report tracer molecule is selected from beta-galactosidase, secreted alkaline phosphatase, green fluorescent protein and luciferase.

In some examples, the recombinant oncolytic viral vector is further loaded with a nucleic acid sequence expressing a tumor-specific recognition factor.

In some examples, the tumor specific recognition factor is selected from the group consisting of a tumor epitope specific recognition factor, a tumor cell selective replication factor.

In some examples, the tumor is selected from lung cancer, liver cancer, stomach cancer, colorectal cancer, pancreatic cancer, ovarian cancer.

In a fifth aspect of the present invention, there is provided:

use of a composition as described in the third aspect of the invention in the manufacture of a medicament for the prophylaxis or treatment of a tumour or for the detection of a tumour.

In some examples, the tumor is selected from breast cancer, brain cancer, lung cancer, nasopharyngeal cancer, head and neck cancer, kidney cancer, bladder cancer, liver cancer, esophageal cancer, gastric cancer, colorectal cancer, pancreatic cancer, ovarian cancer, skin cancer, prostate cancer, fallopian tube cancer, urinary tract cancer, genitourinary system cancer, endometriosis, cervical cancer, bone cancer, or metastatic lesions of the cancer.

The invention has the beneficial effects that:

after being loaded with related nucleic acid sequences, the replicative human adenovirus of some embodiments of the present invention can be directly injected into solid tumors, including but not limited to H1299, Skov-3, U251, etc., and is identified as being capable of replicating in tumor cells and directly killing tumor cells, and infecting the surrounding tumor cells after the infected tumor cells are lysed; meanwhile, the medicament has no killing effect on normal human cells and has unexpected oncolytic effect.

The replicative human adenovirus of some embodiments of the invention has dual targeting to multiple tumor cells H1299, U251, Skov-3, and the like.

Drawings

FIG. 1 shows the principle of genome cyclization of NBOV1901 by homologous recombination (A), and the result of restriction enzyme identification of pNBOV1901 (B);

FIG. 2 is a schematic diagram of genome of the entire E3 region from SrfI by knocking out NBOV1901 (A), and the PCR and enzyme digestion identification result of pNBOV 1901. DELTA.E 3-SrfI (B);

FIG. 3 is a schematic diagram (A) of NBOV1901E3gp19K gene knock-out and a result (B) of enzyme digestion of pNBOV 1901. DELTA.E 3gp 19K;

FIG. 4 shows the PCR and enzyme digestion identification results (B) of NBOV1901E1 gene knock-out schematic (A) and pNBOV 1901. DELTA.E 3gp 19K;

FIG. 5 shows the schematic diagram (A) of the NBOV1901E1B19K knock-out and pRB gene and the cleavage result (B) of pNBOV 1910;

FIG. 6 shows the production and purification of a recombinant adenovirus NBOV1901 of a replicative adenovirus;

FIG. 7 shows the results of bidirectional screening of replication competent adenovirus NBOV1901 recombinant adenovirus in various tumor cells;

FIG. 8 shows the effect of modification of the non-core region of replicative adenovirus NBOV1901 recombinant adenovirus on the oncolytic effect of H1299 cells;

FIG. 9 shows the experimental results of replication competent adenovirus NBOV1901 recombinant adenovirus in H1299 mouse tumor model;

FIG. 10 is a graph showing the oncolytic effect of a conventional oncolytic adenovirus.

In FIGS. 1 to 5, M represents a 15000bp DNA Marker.

Detailed Description

The novel adenovirus vector pNBOV1901 of the invention is transformed into an adenovirus NBOV1901 (complete sequence GenBank: MH558113.1) isolated from a human throat swab sample. NBOV1901 is a novel human adenovirus different from the adenovirus reported at present. The E1A gene of adenovirus is the essential gene for virus to regulate cell cycle, and the cell cycle is shifted from G1 stage to S stage by binding CR2 binding site on E1A gene with Rb protein of cell. The tumor targeting adenovirus vector pNBOV1910 deletes E1A-CR2, so that E1A of the virus cannot be combined with Rb protein of a host cell. Therefore, pNBOV1910 can selectively replicate only in cells in the mitotic phase, such as tumor cells, but not in normal cells, thereby increasing the specificity and safety of oncolytic lysis.

Adenovirus E1B19K is homologous to the cellular Bcl-2 gene and inhibits apoptosis by binding to Beclin-1. And the E3gp19K protein can be combined with the heavy chain of MHC I molecules on the endoplasmic reticulum to prevent the MHC I molecules from being transported to the cell surface, and can delay the expression of MHC I. Therefore, the deletion of the two genes can improve the tumor selectivity and the diffusion capacity of the virus in tumors and activate the host immune response, thereby enhancing the killing capacity of the epidemic viruses on tumor cells.

The adenovirus transcription unit encodes a series of polypeptides with related functions, the E1A unit encodes two major proteins which activate transcription and induce the host cell to enter the S phase of the cell cycle; E1B encodes two proteins that block apoptosis; e2 encodes three proteins directly involved in DNA replication; e3 encodes a product that modulates the host's response to infection; the later family of mRNAs is involved in the production and assembly of capsid components. The E4 product mediates transcriptional, RNA splicing, and translational regulation; mRNA nuclear export and regulates DNA replication and apoptosis. Deletion of E1B19K and E3 did not affect adenovirus replication and allowed room for insertion of foreign genes

A replication-competent adenovirus vector pNBOV1901, which is prepared by the following method: the NBOV1901 genome was circularized, and E3gp19K, E1b19K, and pRB genes were knocked out.

In some examples, a gene encoding an RGD peptide is introduced into an adenovirus plasmid to construct a targeting backbone plasmid.

A preparation method of a replication type human NBOV1901 type oncolytic adenovirus vector comprises the following steps:

s1) carrying out PCR amplification to obtain the left end and the right end of an NBOV1901 genome, connecting the two ends to an ampicillin resistance vector plasmid to obtain pT-NBOV1901(L + R), and recombining the linearized product with the NBOV1901 genome to obtain a genome plasmid pNBOV 1901;

s2) carrying out PCR amplification to obtain the left and right arms from the SrfI to the whole E3 region, connecting the left and right arms to a kanamycin-resistant vector plasmid, carrying out linearization, and then carrying out recombination with NBOV1901 digested by PacI enzyme to obtain a genome plasmid pNBOV 1901. delta. E3-SrfI with SrfI removed to the whole E3 region;

s3) using NBOV1901 genome as a template, and obtaining an E3gp19K upstream fragment by PCR amplification: SrfI to E3gp19K, and E3gp19K downstream fragments: the E3gp 19K-E3 region contains an E3-14.7K gene fragment, an E3gp19K upstream fragment, an E3gp19K downstream fragment and a construction vector after enzyme digestion are connected between the left arm and the right arm of pNBOV1901 delta E3-SrfI in a recombination mode, linearization and pNBOV1901 delta E3-SrfI are carried out in a recombination mode, and a genome plasmid pNBOV1901 delta E3gp19K with a modified SrfI enzyme digestion site is obtained;

s4) carrying out PCR amplification to obtain the left arm and the right arm of an E1 region, connecting the left arm and the right arm to a kanamycin resistance carrier plasmid, carrying out linearization, and recombining the linearized plasmid and SrfI enzyme-cut pNBOV1901 delta E3gp19K to obtain a genome plasmid pNBOV1901 delta E3gp19K delta E1 with the E1 region removed;

s5) carrying out PCR amplification to obtain a genome of the E1 region with E1b19K and pRB genes removed, connecting the genome to a kanamycin-resistant vector plasmid containing the left arm and the right arm of the E1 region, and recombining the linearized genome with the digested pNBOV1901 delta E3gp19K delta E1 to obtain a genome plasmid pNBOV1910 with E1b19K and pRB genes removed.

Ampicillin-resistant vector plasmid and kanamycin-resistant vector plasmid may be replaced with other known selection plasmids as long as efficient isolation of the product can be achieved.

In some examples, the specific method of step S1 is:

NBOV1901 genome is used as a template, L-NBOV1901 and R-NBOV1901 at the left and right ends of the NBOV1901 genome are obtained by PCR amplification and are connected to a linearized T vector by using recombination arms to obtain pT-NBOV1901(L + R), EcoRI and BamHI are introduced between the left and right arms of pT-NBOV1901(L + R) to be used as enzyme cutting sites, and the EcoRI and BamHI double-enzyme-cutting pT-NBOV1901(L + R) is linearized and recombined with NBOV1901 genome to obtain pNBOV 1901.

Further, in some examples, the specific method of step S1 is:

NBOV1901 genome is used as a template, L-NBOV1901 and R-NBOV1901 at the left and right ends of the NBOV1901 genome are obtained by PCR amplification, pT-NBOV1901(L + R) is obtained by three-fragment recombination of L-NBOV1901, R-NBOV1901 and a linearized T vector by using an Exnase recombinase, EcoRI and BamHI are introduced between the left and right arms of pT-NBOV1901(L + R) to be used as enzyme cutting sites, and pT-NBOV1901(L + R) is subjected to double digestion by EcoRI and BamHI and then recombined with NBOV1901 genome to obtain pNBOV 1901.

In some examples, the specific method of step S2 is:

NBOV1901 genome is used as a template, PCR amplification is carried out to obtain left-arm genes L-delta E3-SrfI and R-delta E3-SrfI from SrfI to the whole E3 region, the left-arm genes L-delta E3-SrfI and the R-delta E3-SrfI are connected to a linearized T vector to obtain pT-delta E3-SrfI (L + R), and the linearized gene is recombined with PacI digested pNBOV1901 genome to obtain genome plasmid pNBOV 1901-delta E3-SrfI which knocks out delta E3-SrfI and introduces unique restriction enzyme site PacI at the delta E3-SrfI position.

Further, in some examples, the specific method of step S2 is:

taking NBOV1901 genome as a template, performing PCR amplification to obtain L-delta E3-SrfI and R-delta E3-SrfI of homology arms at the left and right ends of an E3-SrfI region, and performing three-segment connection by using an Exnase recombinase to obtain pVax-delta E3-SrfI. After linearization, carrying out homologous recombination with PacI enzyme digestion linearized pNBOV1901, and obtaining a plasmid pNBOV1901 delta E3-SrfI with E3-SrfI region gene knocked out and unique linearized enzyme digestion site swaI introduced at the same time after ampicillin resistance screening.

In some examples, the specific method of step S3 is:

taking NBOV1901 genome as a template, performing PCR amplification to obtain an E3gp19K upstream fragment (SrfI to E3gp19K) and an E3gp19K downstream fragment (E3gp19K to E3 region containing E3-14.7K gene fragment), recombining the three fragments of an Exnase recombinase to be connected between the left and right arms of pVAX-delta E3-SrfI (L + R) to obtain a pVAX-delta E3gp19K vector plasmid, performing homologous recombination with PacI digested pNBOV1901 delta E3-SrfI genome plasmid after linearization, and screening by using an ampicillin resistance gene to obtain a pNBOV1901 delta E3gp19K genome plasmid with E3gp19K knocked out.

In some examples, the specific method of step S4 is:

taking NBOV1901 genome as a template, performing PCR amplification to obtain an E1 gene homologous recombination arm L-delta E1 and R-delta E1, connecting the E1 gene homologous recombination arm L-delta E1 and R-delta E1 to a linearized T vector to obtain pVAX-delta E1(L + R), performing homologous recombination with SrfI digested pNBOV1901 delta E3gp19K, screening ampicillin resistance to obtain a plasmid pNBOV1901 delta E3gp19K delta E1 with E1 gene knocked out and unique SrfI linearized digestion sites introduced into an E1 gene region.

Further, in some examples, the specific method of step S4 is:

taking NBOV1901 genome as a template, performing PCR amplification to obtain an E1 gene homologous recombination arm L-delta E1 and R-delta E1, taking a pVAX vector as a template, performing three-fragment connection on a framework of the pVAX obtained by PCR by using an Exnase recombinase to obtain pVAX-delta E3gp19K delta E1(L + R), performing double enzyme digestion on the pVAX-delta E3gp19K delta E1(L + R) by using Bstz17I + SgrAI, performing enzyme digestion linearization on pNBOV1901 delta E3gp19K by using SrfI, performing homologous recombination on fragments recovered by enzyme digestion of the two to obtain a genome plasmid pNBOV1901 delta E3gp19K delta E1 with E1 gene knocked out and only introduced into the SrfI.

In some examples, the specific method of step S5 is:

taking NBOV1901 genome as a template, performing PCR amplification to obtain E1 region gene lacking E1b19K and pRB gene, connecting the E1 region gene between the left arm and the right arm of pVAX-delta E3gp19K delta E1(L + R), performing linearization, performing homologous recombination with SrfI digested pNBOV1901 delta E3gp19K delta E1 genome, and screening ampicillin resistance genes to obtain genome plasmid pNBOV1910 in which E1b19K and pRB gene are knocked out.

Further, in some examples, the specific method of step S5 is:

using NBOV1901 genome as a template, performing PCR amplification to obtain E1 region gene lacking E1B19K and pRB gene, recombining pVAX-delta E3gp19K delta E1(L + R) subjected to linearization by SrfI digestion with an Exnase recombinase to obtain pVAX-delta E1B19K _ pRB, performing double digestion on pVAX-delta E1B19K _ pRB by Bstz17I + SgrAI, performing linearization by pNBOV1901 delta E3gp19K delta E1 by SrfI, performing homologous recombination on fragments recovered by the two digestions, and screening ampicillin resistance gene to obtain genome pNBOV1910 lacking E1B19K and pRB gene.

In some examples, the recombinant adenoviral vector pNBOV1910 is linearized using AsisI digestion, recovered by ethanol precipitation, transfected 293 cells are virus rescued, cultured for amplification, and purified by CsCl density gradient centrifugation to yield NBOV 1910.

The term "foreign sequence" according to the present invention refers to any DNA sequence of non-NBOV 1901 adenovirus origin. It will be understood by those skilled in the art that the exogenous sequence may be an exogenous gene expression cassette, or may be an expression cassette for shRNA or miRNA, etc.

In the following examples, the exogenous gene expression cassette may comprise a eukaryotic promoter, an exogenous gene coding sequence, a transcription terminator, as understood by those skilled in the art. The exogenous gene coding sequence can be, but is not limited to, the coding sequence of green fluorescent protein, other virus antigens, shRNA and the like.

In order to clearly understand the technical contents of the present invention, the following embodiments are described in detail with reference to the accompanying drawings. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the Laboratory Manual (New York: Cold spring Harbor Laboratory Press,1989), or according to the manufacturer's recommendations. The various chemicals used in the examples are commercially available.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

Example 1: circularization of NBOV1901 genome

1. A shuttle plasmid pT-NBOV1901(L + R) was constructed which circularizes the NBOV1901 genome.

Referring to FIG. 1A, the left arm (L-NBOV1901) and the right arm (R-NBOV1901) of the NBOV1901 genome were obtained by PCR using the genome of NBOV1901 as a template.

L-NBOV1901 primer:

L-NBOV1901-F：gcgggatccgaattcttaatgcgatcgccatcatcaataatataccttat(SEQ ID NO.：1)

L-NBOV1901-R：tatctgcatgagcatgatgatatcctttgacccggaacgcgg(SEQ ID NO.：2)

PCR conditions were as follows: at 95 ℃ for 3 min; at 95 ℃ for 30 s; 30s at 60 ℃; 72 ℃ for 30 s; cycles 28; 72 ℃ for 5 min; storing at 12 deg.C.

R-NBOV1901 primer:

R-NBOV1901-F：ccgcgttccgggtcaaaggatatcatcatgctcatgcagata(SEQ ID NO.：3)

R-NBOV1901-R：gaagcgagatcgaattcttagcgatcgccatcatcaataaatacctta(SEQ ID NO.：4)

PCR conditions were as follows: at 95 ℃ for 3 min; at 95 ℃ for 30 s; 30s at 60 ℃; 72 ℃ for 1 min; cycles 28; 72 ℃ for 5 min; storing at 12 deg.C.

2. pNBOV1901 was constructed.

pT-NBOV1901(L + R) is subjected to enzyme digestion linearization by using EcoRI + BamHI, then is recombined with genome cotransformation BJ5183 competent cells of NBOV1901, an ampicillin resistance panel is subjected to resistance screening, after screening to obtain single clone amplification, plasmid transformation XL competent cells are extracted, plasmid extraction pNBOV1901 is obtained, different enzyme digestion modes are used for identification (figure 1B), two AsisiI enzyme digestion sites are introduced to the pNBOV1901 on two sides of the genome, and the modified genome of NBOV1901 can be conveniently subjected to subsequent linearization for virus rescue.

Example 2: knock-out of SrfI to E3 region genes, construction of pNBOV 1901. delta. E3_ SrfI plasmid

1. A shuttle plasmid pVax-delta E3_ SrfI (L + R) with gene knockout of SrfI to E3 regions was constructed.

Referring to FIG. 2A, the left arm (L-. DELTA.E 3-SrfI) and the right arm (R-. DELTA.E 3-SrfI) of the SrfI to E3 region gene were obtained by PCR using the genome of NBOV1901 as a template.

L- Δ E3_ SrfI primer:

L-ΔE3_SrfI-F：gatatacgcgtgtatac cttcccaggatggcaccca(SEQ ID NO.：5)

L-ΔE3_SrfI-R：gtaagtaatttattgtgtgtttatg ttaattaa ctgtgtgaccgctgctgt(SEQ ID NO.：6)

PCR conditions were as follows: at 95 ℃ for 3 min; at 95 ℃ for 30 s; 30s at 60 ℃; 72 ℃ for 30 s; cycles 28; 72 ℃ for 5 min; storing at 12 deg.C.

R-Delta E3 primer:

R-ΔE3_SrfI-F：acagcagcggtcacacag ttaattaa cataaacacacaataaattacttac(SEQ ID NO.：7)

R-ΔE3_SrfI-R：ccgcccagtagaagcgccggtg ccgcccgttttaatttccatgtt(SEQ ID NO.：8)

PCR conditions were as follows: at 95 ℃ for 3 min; at 95 ℃ for 30 s; 30s at 60 ℃; 72 ℃ for 50 s; cycles 28; 72 ℃ for 5 min; storing at 12 deg.C.

Plasmid frameworks obtained by double digestion of the pVax vector with L-delta E3_ SrfI, R-delta E3_ SrfI and Bstz17I + SgrAI were ligated together in three fragments using the enzyme Exnase to obtain pVax-delta E3_ SrfI (L + R).

2. Construction of pNBOV 1901. DELTA.E 3_ SrfI

The method comprises the following steps of carrying out double enzyme digestion on pVax-delta E3_ SrfI (L + R) by using Bstz17I + SgrAI, carrying out enzyme digestion on pNBOV1901 by using PacI, carrying out cotransformation on BJ5183 competent cells by using fragments recovered by enzyme digestion of the two by using a Bstz17 + SgrAI, carrying out resistance screening by using an ampicillin resistance plate, extracting plasmids of the screened monoclones after amplification to transform XL competent cells, extracting plasmids to obtain pNBOV1901 delta E3_ SrfI, carrying out identification by using different enzyme digestion modes (figure 2B), introducing unique enzyme digestion PacI into a knockout gene region by using the pNBOV1901 delta E3_ SrfI, and facilitating subsequent cloning operation.

Example 3: construction of pNBOV 1901. delta. E3gp19K plasmid

1. A shuttle vector pVAX-delta E3gp19K for knocking out E3gp19K is constructed.

Referring to FIG. 3A, gene fragments from SrfI (site) to the entire E3 region except E3gp19K were obtained by PCR amplification using NBOV1901 genome as template.

E3gp19K upstream fragment P1-E3-SrfI Δ E3gp 19K:

E3gp19K-F1：gtcacagggtgcggtcgccaggacagggtataactcacct(SEQ ID NO.：9)

E3gp19K-R1：ggaatacaagcaagcggaaaa tcatcttggatgtcgcccccag(SEQ ID NO.：10)

PCR conditions were as follows: at 95 ℃ for 3 min; at 95 ℃ for 30 s; 30s at 60 ℃; 72 ℃ for 30 s; cycles 28; 72 ℃ for 5 min; storing at 12 deg.C.

A downstream fragment P2-E3-SrfI delta E3gp19K of E3gp 19K;

E3gp19K-F2：ctgggggcgacatccaagatga ttttccgcttgcttgtattcc(SEQ ID NO.：11)

E3gp19K-R2：ccgcccagtagaagcgccggtg ccgcccgttttaatttccatgtt(SEQ ID NO.：8)

P1-E3-SrfI delta E3gp19K, P2-E3-SrfI delta E3gp19K and PacI enzyme-digested pVAX-delta E3-SrfI (L + R) are subjected to three-fragment ligation by using an Exnase enzyme to obtain pVAX-delta E3gp 19K.

2. Construction of pNBOV 1901. delta. E3gp19K plasmid

pVAX-Delta E3gp19K was digested with Bstz17I + SgrAI, pNBOV1901 Delta E3_ SrfI with PacI, the fragments recovered by both digestions were co-transformed into BJ5183 competent cells for recombination, resistance selection was performed with ampicillin resistant plates, the plasmid was extracted after the selection was monoclonally amplified and transformed into XL competent cells, the plasmid was extracted to obtain pVAX-Delta E3gp19K, and the cells were identified using different digestion methods (FIG. 3B).

Example 4: construction of pNBOV 1901. DELTA.E 3gp 19K. DELTA.E 1 plasmid

1. Constructing a shuttle vector pVAX-delta E3gp19K delta E1(L + R) for knocking out E1 region genes.

Referring to FIG. 4A, NBOV1901 genome was used as template, and E1 gene homologous recombination arms L- Δ E1 and R- Δ E1 were obtained by PCR amplification.

L- Δ E1 primer:

L-ΔE1-FW:cagatatacgcgtgtataccatcatcaataatatacct(SEQ ID NO.：12)

L-ΔE1-RW:agacagcaagacacttgctatcgatttttagtcccggtgttgga(SEQ ID NO.：13)

PCR conditions were as follows: at 95 ℃ for 3 min; at 95 ℃ for 30 s; 30s at 60 ℃; 72 ℃ for 30 s; cycles 28; 72 ℃ for 5 min; storing at 12 deg.C.

R-Delta E1 primer:

R-ΔE1-FW:tccaacaccgggactaaaaatcgatagcaagtgtcttgctgtct(SEQ ID NO.：14)

R-ΔE1-RW:gcccagtagaagcgccggtggaattcatctgaactcaaagcgtg(SEQ ID NO.：15)

PCR conditions were as follows: at 95 ℃ for 3 min; at 95 ℃ for 30 s; 30s at 60 ℃; 72 ℃ for 30 s; cycles 28; 72 ℃ for 5 min; storing at 12 deg.C.

Plasmid skeletons obtained by double enzyme digestion of the pVax vector by M-delta E1, R-delta E1 and Bstz17I + SgrAI are subjected to three-fragment ligation by using an Exnase enzyme to obtain pVAX-delta E3gp 19K-delta E1(L + R).

2. pNBOV 1901. DELTA.E 3gp 19K. DELTA.E 1 was constructed.

pVAX-delta E3gp19K delta E1(L + R) is subjected to double enzyme digestion by Bstz17I + SgrAI, p NBOV1901 delta E3gp19K is subjected to enzyme digestion by SrfI, fragments recovered by enzyme digestion of the two are subjected to cotransformation by BJ5183 competent cells for recombination, an ampicillin resistance plate is used for resistance screening, a plasmid obtained by screening is extracted after single clone amplification is carried out and transformed into XL competent cells, a plasmid is extracted to obtain pNBOV1901 delta E3gp19K delta E1, different enzyme digestion modes are used for identification (figure 4B), and the unique enzyme digestion site SrfI is introduced into a knockout gene region by pNBOV1901 delta E3gp19K delta E1, so that the subsequent cloning operation is convenient.

Example 5: construction of vector pNBOV 1901. DELTA.E 3gp 19K. DELTA.E 1B19K _ pRB, i.e., pNBOV1910

1. Constructing a shuttle vector pVAX-delta E1B19K _ pRB of which E1B19K and pRB genes are knocked out.

Referring to FIG. 5A, the E1 region gene lacking E1b19K and pRB gene was obtained by PCR using NBOV1901 genome as a template.

P1- Δ E1B19K _ pRB primer:

P1-△E1B19K_pRB-FW：caacaccgggactaaaaatgagacatattatctgcc(SEQ ID NO.：16)

P1-△E1B19K_pRB-RW:atcctcgtcgtcactgggtgg atcgaccacctccggtacaa(SEQ ID NO.：17)

PCR conditions were as follows: at 95 ℃ for 3 min; at 95 ℃ for 30 s; 30s at 60 ℃; 72 ℃ for 30 s; cycles 28; 72 ℃ for 5 min; storing at 12 deg.C.

P2- Δ E1B19K _ pRB primer:

P2-△E1B19K_pRB-FW:ttgtaccggaggtggtcgat ccacccagtgacgacgaggat(SEQ ID NO.：18)

P2-△E1B19K_pRB-RW:gatgggtttcttcgctccat gaggtcaaatgtaaccaaga(SEQ ID NO.：19)

PCR conditions were as follows: at 95 ℃ for 3 min; at 95 ℃ for 30 s; 30s at 60 ℃; 72 ℃ for 30 s; cycles 28; 72 ℃ for 5 min; storing at 12 deg.C.

P3- Δ E1B19K _ pRB primer:

P3-△E1B19K_pRB-FW:tcttggttacatttgacctc atggagcgaagaaacccatc(SEQ ID NO.：20)

P3-△E1B19K_pRB-RW:tcttggttacatttgacctc atggagcgaagaaacccatc(SEQ ID NO.：20)

PCR conditions were as follows: at 95 ℃ for 3 min; at 95 ℃ for 30 s; 30s at 60 ℃; 72 ℃ for 30 s; cycles 28; 72 ℃ for 5 min; storing at 12 deg.C.

P1-delta E1B19K _ pRB, P2-delta E1B19K _ pRB, P3-delta E1B19K _ pRB and SrfI digested pVAX-delta E1(L + R) were ligated with an Exnase enzyme in four fragments to obtain pVAX-delta E1B19K _ pRB.

2. Construction of pNBOV 1901. DELTA.E 3gp 19K. DELTA.E 1B19K _ pRB

pVAX-DELTA E1B19K _ pRB was digested simultaneously with Bstz17I + SgrAI and pNBOV1901 DELTA E3gp19K DELTA E1 with SrfI, the fragments thus digested were co-transformed into BJ5183 competent cells for recombination, resistance-screened using an ampicillin resistance plate, the plasmid was extracted after the screening was amplified to transform into XL competent cells, and pNBOV1910 was extracted and identified using a different digestion method (FIG. 5B).

Sequencing, pNBOV1910 as in SEQ ID No.: shown at 21.

Example 6: production and purification results of replication-competent adenovirus NBOV1901 recombinant adenovirus

pNBOV1910 was linearized with AsisI and then virus rescued, gradually expanded and cultured after virus rescue, and after PCR and enzyme digestion identification confirmation, expanded and cultured, cells were collected, and virus was purified by CsCl density gradient centrifugation, and the results are shown in FIG. 6, and the collected virus was stored at-80 ℃. As can be seen from the figure, pNBOV1910 retained replicative adenovirus NBOV1901 productivity and replication ability was not reduced.

Example 7: the tumor cell oncolytic effects of NBOV1910, NBOV1901 at different doses on H1299 and the like

Plating each tumor cell in logarithmic growth phase with 5 × 10^3 cells/well, culturing for 24h, each hole with virus amountTCID50 point 1250, 250, 50, 10, 2, 0, respectivelyThe virus was diluted in a gradient, 100. mu.l of infected cells were added to each well after dilution and incubated for 1h, and the killing effect of tumor cells was measured by culturing for 24-72 hours (72hpi) or 96 hpi.

The results of the experiment are shown in FIG. 7. The result of CCK-8 detection after 72h of virus inoculation shows that the killing effect on tumor cells is stronger along with the increase of the virus concentration. The modified NBOV1910 has good oncolytic effect and has better oncolytic effect in certain dosage intervals.

Example 8: the oncolytic effect of NBOV1901 delta E3 delta E1B19K _ pRb, NBOV1910 and NBOV1901 on H1299 tumor cells at different doses

Each tumor cell in logarithmic growth phase was plated at 5X 10^3 cells/well, culturing for 24h, the amount of virus per wellTCID50 point 1250, 250, 50, 10, 2, 0, respectivelyThe virus was diluted in a gradient, 100. mu.l of infected cells were added to each well after dilution and incubated for 1h, and the tumor cell killing effect was measured by culturing for 72 hours (72hpi) or 96 hpi.

FIG. 8 shows the result of CCK-8 assay after 72h of virus inoculation, which shows that the modification of the variable region of replication type oncolytic adenovirus NBOV1901 does not affect the oncolytic effect.

Example 9: anti-tumor effects in NBOV1910 and NBOV1901 mice

5 x 10^6 cells of H1299 cells were seeded on the thigh-to-dorsoventral junction or on the skin laxity under the hind-costal area of the forelegs of 5-6 weeks old Balb/c _ nude mice using the Balb/c _ nude mouse model. When the tumor grows to 200mm³When using 1X 10¹¹VP virus was injected intratumorally with PBS, NBOV1910 and NBOV1901, respectively, and then tumor size and tumor clearance were observed.

The experimental results are shown in fig. 9, which shows that the treatment groups NBOV1910 and NBOV01 can significantly inhibit the growth of tumors and have the potential of treating the tumors.

FIG. 10 shows the oncolytic effect of the existing oncolytic adenovirus (see Taki M, Kagawa S, Nishizaki M, et al, enhanced oncolysis by a tropism-modified telemerase-specific reproducibility-selective adoptive agent OBP-405 ('Telomelysin-RGD') [ J ]. Oncogene,2005,24(19): 3130-.

SEQUENCE LISTING

<110> Guangzhou Enbao biomedical science and technology Co., Ltd

<120> replicative human adenovirus and application thereof

<130>

<160> 21

<170> PatentIn version 3.5

<210> 1

<211> 50

<212> DNA

<213> Artificial primer

<400> 1

gcgggatccg aattcttaat gcgatcgcca tcatcaataa tataccttat 50

<210> 2

<211> 42

<212> DNA

<213> Artificial primer

<400> 2

tatctgcatg agcatgatga tatcctttga cccggaacgc gg 42

<210> 3

<211> 42

<212> DNA

<213> Artificial primer

<400> 3

ccgcgttccg ggtcaaagga tatcatcatg ctcatgcaga ta 42

<210> 4

<211> 48

<212> DNA

<213> Artificial primer

<400> 4

gaagcgagat cgaattctta gcgatcgcca tcatcaataa atacctta 48

<210> 5

<211> 36

<212> DNA

<213> Artificial primer

<400> 5

gatatacgcg tgtatacctt cccaggatgg caccca 36

<210> 6

<211> 51

<212> DNA

<213> Artificial primer

<400> 6

gtaagtaatt tattgtgtgt ttatgttaat taactgtgtg accgctgctg t 51

<210> 7

<211> 51

<212> DNA

<213> Artificial primer

<400> 7

acagcagcgg tcacacagtt aattaacata aacacacaat aaattactta c 51

<210> 8

<211> 45

<212> DNA

<213> Artificial primer

<400> 8

ccgcccagta gaagcgccgg tgccgcccgt tttaatttcc atgtt 45

<210> 9

<211> 40

<212> DNA

<213> Artificial primer

<400> 9

gtcacagggt gcggtcgcca ggacagggta taactcacct 40

<210> 10

<211> 43

<212> DNA

<213> Artificial primer

<400> 10

ggaatacaag caagcggaaa atcatcttgg atgtcgcccc cag 43

<210> 11

<211> 43

<212> DNA

<213> Artificial primer

<400> 11

ctgggggcga catccaagat gattttccgc ttgcttgtat tcc 43

<210> 12

<211> 38

<212> DNA

<213> Artificial primer

<400> 12

cagatatacg cgtgtatacc atcatcaata atatacct 38

<210> 13

<211> 44

<212> DNA

<213> Artificial primer

<400> 13

agacagcaag acacttgcta tcgattttta gtcccggtgt tgga 44

<210> 14

<211> 44

<212> DNA

<213> Artificial primer

<400> 14

tccaacaccg ggactaaaaa tcgatagcaa gtgtcttgct gtct 44

<210> 15

<211> 44

<212> DNA

<213> Artificial primer

<400> 15

gcccagtaga agcgccggtg gaattcatct gaactcaaag cgtg 44

<210> 16

<211> 36

<212> DNA

<213> Artificial primer

<400> 16

caacaccggg actaaaaatg agacatatta tctgcc 36

<210> 17

<211> 41

<212> DNA

<213> Artificial primer

<400> 17

atcctcgtcg tcactgggtg gatcgaccac ctccggtaca a 41

<210> 18

<211> 41

<212> DNA

<213> Artificial primer

<400> 18

ttgtaccgga ggtggtcgat ccacccagtg acgacgagga t 41

<210> 19

<211> 40

<212> DNA

<213> Artificial primer

<400> 19

gatgggtttc ttcgctccat gaggtcaaat gtaaccaaga 40

<210> 20

<211> 40

<212> DNA

<213> Artificial primer

<400> 20

tcttggttac atttgacctc atggagcgaa gaaacccatc 40

<210> 21

<211> 32767

<212> DNA

<213> adenovirus

<400> 21

catcatcaat aatatacctt attttggatt gaagccaata tgataatgag ggggtggagt 60

ttgtgacgtg gcgcggggcg tgggaacggg gcgggtgacg tagtagtgtg gcggaagtgt 120

gatgttgcaa gtgtggcgga acacatgtaa gcgacggatg tggtaaaagt gacgtttttg 180

gtgtgcgccg gtgtacacgg gaagtgacaa ttttcgcgcg gttttaggcg gatgttgtag 240

taaatttggg cgtaaccgag taagatttgg ccattttcgc gggaaaactg aataagagga 300

agtgaaatct gaataattct gtgttactca tagcgcgtaa tatttgtcta gggccgcggg 360

gactttgacc gtttacgtgg agactcgccc aggtgttttt ctcaggtgtt ttccgcgttc 420

cgggtcaaag ttggcgtttt attattatag tcagctgacg cgtagtgtat ttatacccgg 480

tgagttcctc aagaggccac tcttgagtgc cagcgagtag agttttctcc tccgagccgc 540

tccaacaccg ggactaaaaa tgagacatat tatctgccac ggaggtgtta ttaccgaaga 600

aatggccgcc agtcttttgg accagctgat cgaagaggta ctggctgata atcttccacc 660

tcctagccat tttgaaccac ctacccttca cgaactgtat gatttagacg tgacggcccc 720

cgaagatccc aacgaggagg cggtttcgca gatttttccc gactctgtaa tgttggcggt 780

gcaggaaggg attgacttac tcacttttcc gccggcgccc ggttctccgg agccgcctca 840

cctttcccgg cagcccgagc agccggagca gagagccttg ggtccggttt ctatgccaaa 900

ccttgtaccg gaggtggtcg atccacccag tgacgacgag gatgaagagg gtgaggagtt 960

tgtgttagat tatgtggagc agcccgggca cggttgcagg tcttgtcatt atcaccggag 1020

gaatacgggg gacccagata ttatgtgttc gctttgctat atgaggacct gtggcatgtt 1080

tgtctacagt aagtgaaatt atgggcagtg ggtgatagag tggtgggttt ggtgtggtaa 1140

tttttttttt aatttttgca gttttgtggt ttaaagaatt ttgtattgta attttttaaa 1200

aggtcctgtg tctgaacctg agcctgagcc cgagccagaa ccggagcctg caagacctac 1260

tcggcgtcct aaaatggtgc ctgctatcct gagacgcccg acatcacctg tgaccagaga 1320

atgcaatagt agtacggata gctgtgactc cggtccttct aacacacctc ctgagataca 1380

cccggtggtc ccgctgtgcc ccattaaacc agttgccgtg agagttggtg ggcgtcgcca 1440

ggctgtggaa tgtatcgagg acttgcttaa cgagcctggg caacctttgg acttgagctg 1500

taaacgcccc aggccataag gtgtaaacct gtgattgcgt gtgtggttaa cgcctttgtt 1560

tgctgaatga gttgatgtaa gtttaataaa aagggtgaga taatgtttaa cttgcatggc 1620

gtgttaaatg gggcggggct taaagggtat ataatgcgcc gtgggctaat cttggttaca 1680

tttgacctca tggagcgaag aaacccatct gagcgggggg tacctgctgg attttctggc 1740

catgcatctg tggagagcgg tggtgagaca caagaatcgc ctgctactgt tgtcttccgt 1800

ccgcccggca ataataccga cggaggagca gcagcagcag cagcagcagc aggaggaagc 1860

caggcggcgg cggcggcagg agcagagccc atggaacccg agagccggcc tggaccctcg 1920

ggaatgaatg ttgtacaggt ggctgaactg tttccagaac tgagacgcat tttaaccatt 1980

aacgaggatg ggcagggact aaagggggta aagagggagc ggggggcttc tgaggctata 2040

gaggaggcta ggaatctaac ttttagctta atgaccagac accgtcctga gtgtgttact 2100

tttcagcaga ttaaggataa ttgtgctaat gagcttgatc tgctggcgca gaagtattcc 2160

atagagcagc tgaccactta ctggctgcag ccaggggatg attttgagga ggctattagg 2220

gtatatgcaa aggtggcact taggccagat tgcaagtaca agattagcaa acttgtaaat 2280

atcaggaatt gttgctacat ttctgggaac ggggccgagg tggagataga tacggaggat 2340

agggtggcct ttagatgtag catgataaat atgtggccgg gggtgcttgg catggacggg 2400

gtggttttta tgaatgtgag gtttactggc cccaatttta gcggtacggt tttcctggcc 2460

aataccaacc ttatcctaca cggtgtaagc ttctatgggt ttaacaatac ctgcgtggaa 2520

gcctggaccg atgtaagggt tcggggctgt gccttttact tctgctggaa gggggtggtg 2580

tgtcgcccca aaagcagggc ttcaattaag aaatgcctct ttgaaaggtg taccttgggt 2640

atcctgtctg agggtaactc cagggtgcgc cacaatgtgg cctccgactg tggttgcttc 2700

atgctagtga aaagcgtggc tgtgattaag cataacatgg tgtgtggcaa ctgcgaggac 2760

agggcctctc agatgctgac ctgctcggac ggcaactgtc acctgctgaa gaccattcac 2820

gtagccagcc actctcgcaa ggcctggcca gtgtttgagc acaacatatt gacccgctgt 2880

tccttgcatt tgggtaacag gaggggggtg ttcctacctt accaatgcaa tttgagtcac 2940

actaagatat tgcttgagcc cgagagcatg tccaaggtga acctgaacgg ggtgtttgac 3000

atgaccatga agatctggaa ggtgctgagg tacgatgaga cccgcaccag gtgcagaccc 3060

tgcgagtgtg gcggtaaaca tattaggaac cagcctgtga tgctggatgt gaccgaggag 3120

ctgaggcccg atcacttggt gctggcctgc acccgcgctg agtttggctc tagcgatgaa 3180

gatacagatt gaggtactga aatgtgtggg cgtggcttaa gggtgggaaa gaatatataa 3240

ggtggggggt ctcatgtagt tttgtatctg ttttgcagca gccgccgcca tgagcaccaa 3300

ctcgtttgat ggaagcattg tgagctcata tttgacaaca cgcatgcccc catgggccgg 3360

ggtgcgtcag aatgtgatgg gctccagcat tgatggtcgc cccgtcctgc ccgcaaactc 3420

tactaccttg acctacgaga ccgtgtctgg aacgccgttg gagactgcag cctccgccgc 3480

cgcttcagcc gctgcagcca ccgcccgcgg gattgtgact gactttgctt tcctgagccc 3540

gcttgcaagc agtgcagctt cccgttcatc cgcccgcgat gacaagttga cgactctttt 3600

ggcacaattg gattctttga cccgggaact taatgtcgtt tctcagcagc tgttggagct 3660

gcgccagcag gtttctgccc tgaaggcttc ctcccctccc aatgcggttt aaaacataaa 3720

taaaaaccag actctgtttg gatttggatc aagcaagtgt cttgctgtct ttatttaggg 3780

gttttgcgcg cgcggtaggc ccgggaccag cggtctcggt cgttgagggt cctgtgtatt 3840

ttttccagga cgtggtagag gtggctctgg atgttcagat acatgggcat aagcccgtct 3900

ctggggtgga ggtagcacca ctgcagagct tcatgctgcg gggtggtgtt gtagatgatc 3960

cagtcgtagc aggagcgctg ggcgtggtgc ctaaaaatgt ccttcagaag caagctgatt 4020

gccaggggca ggcccttggt gtaagtgttt acaaagcggt taagctggga tgggtgcata 4080

cgtggggata tgagatgcat cttggactgt atttttaggt tggctatgtt cccagccata 4140

tccctcctgg gattcatgtt gtgcagaacc accagcacag tgtatccggt gcacttggga 4200

aatttgtcat gtagcttaga aggaaatgcg tggaagaact tggagacgcc cttgtgacct 4260

ccaagatttt ccatgcattc gtccataatg atggcaatgg gcccacgggc ggcggcctgg 4320

gcgaagatat ttctgggatc actaacgtca tagttgtgtt ccaggataag atcgtcatag 4380

gccattttta caaagcgcgg gcggagggtg ccagactgcg gtatgatggt tccatccggt 4440

ccaggggcgt agttaccctc acagatttgc atttcccacg ctttgagttc agatgggggg 4500

atcatgtcta cctgcggggc gatgaagaaa acggtttccg gggtagggga gatcagctgg 4560

gaagaaagca cgttcctgag cagctgcgac ttaccgcagc cggtgggccc gtaaatcaca 4620

cctattaccg gctgcaactg gtagttaaga gagctgcagc tgccgtcatc cctgagcagg 4680

ggggccactt cgttaagcat gtccctgact cgcatgtttt ccctgaccaa atccgccaga 4740

aggcgctcgc cgcccagcga tagcagttct tgcaaggaag caaagttttt caacggtttg 4800

aggccgtccg ccgtaggcat gcttttgagc gtttgaccaa gcagttccag gcggtcccac 4860

agctcggtca cgtgctctac ggcatctcga tccagcatat ctcctcgttt cgcgggttgg 4920

ggcggctttc gctgtacggc agtagtcggt gctcgtccag acgggccagg gtcatgtctt 4980

tccacgggcg cagggtcctc gtcagcgtag tctgggtcac ggtgaagggg tgcgctccgg 5040

gctgcgcgct ggccagggtg cgcttgaggc tggtcctgct ggtgctgaag cgctgccggt 5100

cttcgccctg cgcgtcggcc aggtagcatt tgaccatggt gtcatagtcc agcccctccg 5160

cggcgtggcc cttggcgcgc agcttgccct tggaggaggc gccgcacgag gggcagtgca 5220

gacttttgag ggcgtagagc ttgggcgcga gaaataccga ttccggggag taggcatccg 5280

cgccgcaggc cccgcagacg gtctcgcatt ccacgagcca ggtgagctct ggccgttcgg 5340

ggtcaaaaac caggtttccc ccatgctttt tgatgcgttt cttacctctg gtttccatga 5400

gccggtgtcc acgctcggtg acgaaaaggc tgtccgtgtc cccgtataca gacttgagag 5460

gcctgtcctc gagcggtgtt ccgcggtcct cctcgtatag aaactcggac cactctgaga 5520

cgaaggctcg cgtccaggcc agcacgaagg aggctaagtg ggaggggtag cggtcgttgt 5580

ccactagggg gtccactcgc tccagggtgt gaagacacat gtcgccctct tcggcatcaa 5640

ggaaggtgat tggtttgtag gtgtaggcca cgtgaccggg tgttcctgaa ggaggggtat 5700

aaaagggggt gggggcgcgt tcgtcctcac tctcttccgc atcgctgtct gcgagggcca 5760

gctgttgggg tgagtactcc ctctcaaaag cgggcatgac ttctgcgcta aggttgtcag 5820

tttccaaaaa cgaggaggat ttgatgttca cctggcccgc ggtgatgcct ttgagggtgg 5880

ccgcgtccat ctggtcagaa aagacaatct ttttgttgtc aagcttggtg gcaaacgacc 5940

cgtagagggc gttggacagc aacttggcaa tggagcgcag ggtttggttt ttgtcgcgat 6000

cggcacgctc cttggccgcg atgtttagct gcacgtattc acgcgcaacg caccgccatt 6060

cgggaaagac ggtggtgcgc tcgtcgggca ccaggcgcac gcgccaaccg cggttgtgca 6120

gggtgacaag gtcaacgctg gtggctacct ctccgcgtag gcgctcgttg gtccagcaga 6180

ggcggccgcc cttgcgcgag caaaatggcg gtagggggtc tagctgcgtc tcgtctgggg 6240

ggtccgcgtc cacggtaaag acccctggca gcaggcgcgc gtcgaagtag tctatcttgc 6300

atccttgcaa gtctagcgcc tgctgccatg cgcgggctgc aagcgcgcgc tcgtatgggt 6360

tgagtggggg accccatggc atggggtggg tgagcgcgga ggcgtacatg ccgcaaatgt 6420

cgtaaacgta gaggggctcc ctgagtattc caagatatgt agggtagcat cttccaccgc 6480

ggatgctggc gcgcacgtaa tcgtatagtt cgtgcgaggg agcgaggagg tcgggaccga 6540

ggttgctacg ggcgggctgc tctgctcgga agacgatctg cctgaagatg gcatgcgagt 6600

tggatgatat ggttggacgc tggaagacgt tgaagctagc gtctgtgaga cctaccgcgt 6660

cacgcacgaa ggaggcgtag gagtcgcgca gcttgttgac cagctcggcg gtgacctgca 6720

cgtctagggc gcagtagtcc agggtttcct tgatgatgtc atacttatcc tgtccctttt 6780

ttttccacag ctcgcggttg aggacaaact cttcgcggtc tttccagtac tcttggatcg 6840

gaaacccgtc ggcctccgaa cggtaagagc ctagcatgta gaactggttg acggcctggt 6900

aggcgcagca tcccttttct acgggtagcg cgtatgcctg tgcggccttc cggagcgagg 6960

tgtgggtgag cgcaaaggtg tccctgacca tgactttgag gtactggtat ttgaagtcaa 7020

tgtcgtcgca tccgccctgc tcccagagca aaaagtccgt gcgctttttg gaacgcgggt 7080

ttggcagggc gaaggtgaca tcgttgaaga gtatctttcc cgcgcgaggc ataaagttgc 7140

gtgtgatgcg gaagggtccc ggcacctcgg aacggttgtt aattacctgg gcggcgagca 7200

cgatctcgtc aaagccgttg atgttatggc ccacgatgta aagttccaag aagcgcgggg 7260

tgcccttgat ggagggcaat tttttaagtt cctcgtaggt gagctcttca ggggagctga 7320

gcccgtgctc tgacagggcc cagtctgcaa gatgagggtt ggaagcgacg aatgagctcc 7380

acaggtcacg ggccattagc gtctgcagct ggtcgcgaaa ggttctaaac tggcgaccta 7440

tggccatttt ttctggggtg atgcagtaga aggtaagcgt gtcttgttcc cagcggtccc 7500

atccaagttc cacggctagg tctctcgcgg cggttactag aggctcatct ccgccgaact 7560

tcatgaccag catgaagggc acgagctgct tcccaaaggc ccccatccaa gtataggtct 7620

ctacatcgta ggtgacaaag agacgctcgg tgcgaggatg cgagccgatc gggaagaact 7680

ggatctcccg ccaccagttg gaggagtggc tgttgatgtg gtgaaagtag aagtccctgc 7740

gacgggccga acactcgtgc tggcttttgt aaaaacgtgc gcagtactgg cagcggtgca 7800

cgggctgtac atcctgcacg aggttgacct gacgaccgcg cacaaggaag cagagtggga 7860

atttgagccc ctcgcctggc gggtttggct ggtggtcttc tacttcggct gcttgtcctt 7920

gaccgtctgg ctgctcgagg ggagttacgg tggatcgtac caccacgccg cgcgagctca 7980

aagtccagat gtccgcgcgc ggcggtcgga gcttgatgac aacatcgcgc agatgggagc 8040

tgtccatggt ctggagctcc cgcggcgtca ggtcaggcgg gagctcttgc aggtttacct 8100

cgcatagacg ggtgagggcg cgggctaggt ccaggtgata cctgatttcc aggggctggt 8160

tggtggcggc gtcgatggct tgcaagaggc cgcatccccg cggcgcgact acggtaccgc 8220

gcggcgggcg gtgggccgcg gggttgtcct gggatgcatc taaaagcggt gacgcgggcg 8280

ggcccccgga ggtagggggg gctccggacc cgccgggaga gggggcaggg gcacgtcggc 8340

gccgcgcgcg ggcaggagct ggtgctgcgc gcggaggttg ctggcgaacg cgacgacgcg 8400

gcggttgatc tcctgaatct ggcgcctctg cgtgaagacg acgggcccgg tgagcttgaa 8460

cctgaaagag agttcgacag aatcaatttc ggtgtcgttg acggcggcct ggcgcaaaat 8520

ctcctgcacg tctcctgagt tgtcttgata ggcgatctcg gccatgaact gctcgatctc 8580

ttcctcctgg agatctccgc gtccggctcg ctccacggtg gcggcgaggt cgttggagat 8640

gcgggccatg agctgcgaga aggcgttgag gcctccctcg ttccagacgc ggctgtagac 8700

cacgccccct tcggcatcgc gggcgcgcat gaccacctgc gcgagattga gctccacgtg 8760

ccgggcgaag acggcgtagt tgcgcaggcg ctgaaagagg tagttgaggg tggtggcggt 8820

gtgttctgcc acgaagaagt acataaccca gcgccgcaac gtggattcgt tgatatcccc 8880

caaggcctca aggcgctcca tggcctcgta gaagtccacg gcgaagttga aaaactggga 8940

gttgcgcgcc gacacggtca actcttcctc cagaagacgg atgagctcgg cgacagtgtc 9000

gcgcacctcg cgctcaaagg ctacaggggc ctcctcttct tcttcaatct cctcttccat 9060

aagggcctcc ccttcttctt cttccggtgg cggtggggga ggggcgcggc ggcgacgacg 9120

gcgcaccggg aggcggtcga caaagcgctc gatcatctcc ccgcggcgac ggcgcatggt 9180

ctcggtgacg gcgcggccgt tctcgcgggg gcgcagttgg aagacgccgc ccgtcatgtc 9240

ccggttatgg gttggcgggg tgctgccgtg cggcagggat acggcgctaa cgatgcatct 9300

caacaattgc tgtgtaggta ctccgccgcc gagggacctg agcgagtccg catcgaccgg 9360

atcggaaaac ctctcgagaa aggcgtctaa ccagtcacag tcgcaaggta ggctgagcac 9420

cgtggcgggc ggcagcgggc ggcggtcggg gttgtttctg gcggaggtgc tgctgatgat 9480

gtaattaaag taggcggtct tgagacggcg gatggtcgac agaagcacca tgtccttggg 9540

tccggcctgc tgaatgcgca ggcggtcggc catgccccag gcttcgtttt gacatcggcg 9600

caggtctttg tagtagtctt gcatgagcct ttctaccggc acttcttctt ctccttcctc 9660

ttgtcctgca tctcttgcat ctatcgctgc ggcggcggcg gagtttggcc gtaggtggcg 9720

ccctcttcct cccatgcgtg tgaccccgaa gcccctcagc ggttgaagca gggccaggtc 9780

ggcgacaacg cgctcggcta atatggcctg ctgcacctgc gtgagggtag actggaagtc 9840

atccatgtcc acaaagcggt ggtatgcgcc cgtgttgatg gtgtaagtgc agttggccat 9900

aacggaccag ttaacggtct ggtgacccgg ctgcgagagc tcggtgtacc tgagacgcga 9960

gtaagccctt gagtcaaaga cgtagtcgtt gcaagtccgc accaggtact ggtatcccac 10020

caaaaagtgc ggcggcggct ggcggtagag gggccagcgt agggtggccg gggctccggg 10080

ggcgaggtct tccaacataa ggcgatgata tccgtagatg tacctggaca tccaggtgat 10140

gccggcggcg gtggtggagg cgcgcgggaa gtcgcggacg cggttccaga tgttgcgcag 10200

cggcaaaaag tgctccatgg tcgggacgct ctggccggtc aggcgcgcgc agtcgttgac 10260

gctctagacc gtgcaaaagg agagcctgta agcgggcact cttccgtggt ctggtggata 10320

aattcgcaag ggtatcatgg cggacgaccg gggttcgaac cccggatccg gccgtccgcc 10380

gtgatccatg cggttaccgc ccgcgtgtcg aacccaggtg tgcgacgtca gacaacgggg 10440

gagtgctcct tttggcttcg ttccaggcgc ggcggctgct gcgctagctt ttttggccac 10500

tggccgcgcg cggcgtaagc ggttaggctg gaaagcgaaa gcattaagtg gctcgctccc 10560

tgtagccgga gggttatttt ccaagggttg agtcgcggga cccccggttc gagtctcggg 10620

ccggccggac tgcggcgaac gggggtttgc ctccccgtca tgcaagaccc cgcttgcaaa 10680

ttcctccgga aacagggacg agcccctttt ttgcttttcc cagatgcatc cggtgctgcg 10740

gcagatgcgc ccccctcctc agcagcggca agagcaagag cagcggcaga catgcagggc 10800

accctcccct cctcctaccg cgtcaggagg ggcgacatcc gcggctgacg cggcggcaga 10860

tggtgattac gaacccccgc ggcgccgggc ccgtcactac ctggacttgg aggaggggga 10920

gggcctggcg cggctaggag cgccctctcc tgagcggcac ccaagggtgc agctgaagcg 10980

tgacacgcgc gaggcgtacg tgccgcggca gaacctgttt cgcgaccgcg agggagagga 11040

gcccgaggag atgcgggatc gaaagtttca cgcggggcgc gagctgcggc atggcctgaa 11100

ccgcgagcgg ttgctgcgcg aggaggactt tgagcccgac gcgcggaccg ggattagtcc 11160

cgcgcgcgca cacgtggcgg ccgccgacct ggtaaccgcg tacgagcaga cggtgaacca 11220

ggagattaac tttcaaaaaa gctttaacaa ccacgtgcgc acgcttgtgg cgcgcgagga 11280

ggtggctata ggactgatgc atctgtggga ctttgtaagc gcgctggagc aaaacccaaa 11340

tagcaagccg ctcatggcgc agctgttcct tatagtacag cacagcaggg acaacgaggc 11400

attcagggat gcgctgctaa acatagtaga gcccgagggt cgctggctgc tcgatttgat 11460

aaacattctg cagagcatag tggtgcagga gcgcagcttg agcctggctg acaaggtggc 11520

cgccattaac tattccatgc tcagtctggg caagttttac gcccgcaaga tataccatac 11580

cccttacgtt cccatagaca aggaggtaaa gatcgagggg ttctacatgc gcatggcgct 11640

gaaggtgctt accttgagcg acgacctggg cgtttaccgc aacgagcgca tccacaaggc 11700

cgtgagcgtg agccggcggc gcgagctcag cgaccgcgag ctgatgcaca gcctgcaaag 11760

ggccctggct ggcacgggca gcggcgatag agaggccgag tcctactttg acgcgggcgc 11820

tgacctgcgc tgggccccaa gccgacgcgc cctggaggca gctggggccg gacctgggct 11880

ggcggtggca cccgcgcgcg ctggcaacgt cggcggcgtg gaggaatatg acgaggacga 11940

tgagtacgag ccagaggacg gcgagtacta agcggtgatg tttctgatca gatgatgcaa 12000

gacgcaacgg acccggcggt gcgggcggcg ctgcagagcc agccgtccgg ccttaactcc 12060

acggacgact ggcgccaggt catggaccgc atcatgtcgc tgactgcgcg caaccctgac 12120

gcgttccggc agcagccgca ggccaaccgg ctctccgcaa ttctggaagc ggtggtcccg 12180

gcgcgcgcaa accccacgca cgagaaggtg ctggcgatcg taaacgcgct ggccgaaaac 12240

agggccatcc ggcccgatga ggccggccta gtctacgacg cgctgcttca gcgcgtggct 12300

cgttacaaca gcggcaacgt gcagaccaac ctggaccggc tggtggggga tgtgcgcgag 12360

gccgtggcgc agcgtgagcg cgcgcaacag cagggcaacc tgggctccat ggttgcacta 12420

aacgccttcc tgagtacaca gcccgccaac gtgccgcggg gacaggagga ctacaccaac 12480

tttgtgagcg cactgcggct aatggtgact gagacaccgc aaagtgaggt gtaccagtcc 12540

gggccagact attttttcca gaccagtaga caaggcctgc agaccgtaaa cctgagccag 12600

gctttcaaga acttgcaggg gctgtggggg gtgcgggctc ccacaggcga ccgcgcgacc 12660

gtgtctagct tgctgacgcc caactcgcgc ctgttgctgc tgctaatagc gcccttcacg 12720

gacagtggca gcgtgtcccg ggacacatac ctaggtcact tgctgacact gtaccgcgag 12780

gccataggtc aggcgcatgt ggacgagcat actttccagg agattacaag tgtcagccgc 12840

gcgctggggc aggaggacac gggcagcctg gaggcaaccc tgaactacct gctgaccaac 12900

cggcggcaga agatcccctc gttgcacagt ttaaacagcg aggaggagcg catcttgcgc 12960

tatgtgcagc agagcgtgag ccttaacctg atgcgcgacg gggtaacgcc cagcgtggcg 13020

ctggacatga ccgcgcgcaa catggaaccg ggcatgtatg cctcaaaccg gccgtttatc 13080

aatcgcctaa tggactactt gcatcgcgcg gccgccgtga accccgagta tttcaccaat 13140

gccatcttga acccgcactg gctaccgccc cctggtttct acaccggggg atttgaggtg 13200

cccgagggta acgatggatt cctctgggac gacatagacg acagcgtgtt ttccccgcaa 13260

ccgcagaccc tgctagagtt gcaacagcgc gagcaggcag aggcggcgct gcgaaaggaa 13320

agctttcgca ggccaagcag cttgtccgat ctaggcgctg cggccccgcg gtcagatgct 13380

agtagcccat ttccaagctt gatagggtct cttaccagca ctcgcaccac ccgcccgcgc 13440

ctgctgggcg aggaggagta cctaaacaac tcgctgctgc agccgcagcg cgaaaagaac 13500

ctgcctccgg cgtttccgaa caacgggata gagagcctag tggacaagat gagtagatgg 13560

aagacgtatg cgcaggagca cagggatgtg cccggcccgc gcccgcccac ccgtcgtcaa 13620

aggcacgacc gtcagcgggg tctggtgtgg gaggacgatg actcggcaga cgacagcagc 13680

gtcctggatt tgggagggag tggcaacccg tttgcgcacc ttcgccccag gctggggaga 13740

atgttttaaa aaaaaaaaaa agcatgatgc aaaataaaaa actcaccaag gccatggcac 13800

cgagcgttgg ttttcttgta ttccccttag tatgcggcgc gcggcgatgt atgaggaagg 13860

tcctcctccc tcctacgaga gcgtggtgag cgcggcgcca gtggcggcgg cgctgggttc 13920

ccccttcgat gctcccctgg acccgccgtt cgtgcctccg cggtacctgc ggcctaccgg 13980

ggggagaaac agcatccgtt actctgagtt ggcaccccta ttcgacacca cccgtgtgta 14040

ccttgtggac aacaagtcaa cggatgtggc atccctgaac taccagaacg accacagcaa 14100

ctttctaacc acggtcattc aaaacaatga ctacagcccg ggggaggcaa gcacacagac 14160

catcaatctt gacgaccggt cgcactgggg cggcgacctg aaaaccatcc tgcataccaa 14220

catgccaaat gtgaacgagt tcatgtttac caataagttt aaggcgcggg tgatggtgtc 14280

gcgctcgctt actaaggaca aacaggtgga gctgaaatat gagtgggtgg agttcacgct 14340

gcccgagggc aactactccg agaccatgac catagacctt atgaacaacg cgatcgtgga 14400

gcactacttg aaagtgggca ggcagaacgg ggttctggaa agcgacatcg gggtaaagtt 14460

tgacacccgc aacttcagac tggggtttga cccagtcact ggtcttgtca tgcctggggt 14520

atatacaaac gaagccttcc atccagacat cattttgctg ccaggatgcg gggtggactt 14580

cacccacagc cgcctgagca acttgttggg catccgcaag cggcaaccct tccaggaggg 14640

ctttaggatc acctacgatg acctggaggg tggtaatatt cccgcactgt tggatgtgga 14700

cgcctaccag gcaagcttga aagatgacac cgaacagggc gggggtggcg caggcggcgg 14760

caacaacagt ggcagcggcg cggaagagaa ctccaacgcg gcagccgcgg caatgcagcc 14820

ggtggaggac atgaacgatc atgccattcg cggcgacacc tttgccacac gggcggagga 14880

gaagcgcgct gaggccgagg cagcggccga agctgccgcc cccgctgcgg aggctgcaca 14940

acccgaggtc gagaagcctc agaagaaacc ggtgattaaa cccctgacag aggacagcaa 15000

gaaacgcagt tacaacctaa taagtaatga cagcaccttc acccagtacc gcagctggta 15060

ccttgcatac aactacggcg accctcaggc cgggatccgc tcatggaccc tgctttgcac 15120

tcctgacgta acctgcggct cggagcaggt atactggtcg ttgcccgaca tgatgcaaga 15180

ccccgtgacc ttccgctcca cgagccagat cagcaacttt ccggtggtgg gcgccgagct 15240

gttgcccgtg cactccaaga gcttctacaa cgaccaggcc gtctactccc agctcatccg 15300

ccagtttacc tctctgaccc acgtgttcaa tcgctttccc gagaaccaga ttttggcgcg 15360

cccgccagcc cccaccatca ccaccgtcag tgaaaacgtt cctgctctca cagatcacgg 15420

gacgctaccg ctgcgcaaca gcatcggagg agtccagcga gtgaccatta ctgacgccag 15480

acgccgcacc tgcccctacg tttacaaggc cctgggcata gtctcgccgc gcgtcctatc 15540

gagccgcact ttttgagcaa gcatgtccat ccttatatcg cccagcaata acacaggctg 15600

gggcctgcgc ttcccaagca agatgtttgg cggggccaag aagcgctccg accaacaccc 15660

agtgcgcgtg cgcgggcact accgcgcgcc ctggggcgcg cacaaacgcg gccgcactgg 15720

gcgcaccacc gtcgatgacg ccatcgacgc ggtggtggag gaggcgcgca actacacgcc 15780

cacgccgccg ccagtgtcca ccgtggacgc ggccattcag accgtggtgc gcggagcccg 15840

gcgctacgct aaaatgaaga gacggcgaag gcgcgtagca cgtcgccacc gccgccgacc 15900

cggcactgcc gcccaacgcg cggcggcggc cctgcttaac cgcgcacgtc gcaccggccg 15960

acgggcggcc atgcgagccg ctcgaaggct ggccgcgggt attgtcactg tgccccccag 16020

gtccaggcga cgagcggccg ccgcagcagc cgcggccatt agtgctatga ctcagggtcg 16080

caggggcaac gtgtactggg tgcgcgactc ggttagcggc ctgcgcgtgc ccgtgcgcac 16140

ccgccccccg cgcaactaga ttgcaataaa aaactactta gactcgtact gttgtatgta 16200

tccagcggcg gcggcgcgca tcgaagctat gtccaagcgc aaaatcaaag aagagatgct 16260

ccaggtcatc gcgccggaga tctatggccc cccgaagaag gaagagcagg attacaagcc 16320

ccgaaagcta aagcgggtca aaaagaaaaa gaaagatgat gatgatgaac ttgacgacga 16380

ggtggaactg ttgcacgcga ccgcgcccag gcggcgggta cagtggaaag gtcgacgcgt 16440

aagacgtgtt ttgcgacccg gcaccaccgt agtctttacg cccggtgagc gctccacccg 16500

cacctacaag cgcgtgtatg atgaggtgta cggcgacgag gacttgcttg agcaggccaa 16560

cgagcgcctc ggggagtttg cctacggaaa gcggcataag gacatgctgg cgttgccgct 16620

ggacgagggc aacccaacac ctagcctaaa gcccgtgaca ctgcagcagg tgctgcccgc 16680

gcttgcaccg tccgaagaaa agcgcggcct aaagcgcgag tctggtgact tggcgcccac 16740

cgtgcagctc atggtgccca agcgccagcg actggaagat gtcttggaaa aaatgaccgt 16800

ggagcctggg ctggagcccg aggtccgcgt gcgaccaatc aagcaggtgg caccgggact 16860

gggcgtgcag accgtggacg ttcagatacc caccaccagt agcactagta ttgccactgc 16920

cacagagggc atggagacac aaacgtcccc ggtcgcctcg gcggtggcag atgccgcggt 16980

gcaggcggcc gctgcggccg cgtccaaaac ctctacggag gtgcaaacgg acccgtggat 17040

gtttcgcgtt tcagcccccc ggcgtccgcg ccgttcgagg aagtacggcg ccgccagcgc 17100

gctactgccc gaatatgccc tacatccttc catcgcgcct acccccggct atcgtggcta 17160

cacctaccgc cccagaagac gagcaactac ccgacgccga accaccactg gaacccgccg 17220

ccgccgtcgc cgtcgccagc ccgtgctggc cccgatttcc gtgcgcaggg tggctcgcga 17280

aggaggcagg accctggtgc tgccaacagc gcgctaccac cccagcatcg tttaaaagcc 17340

ggtctttgtg gttcttgcag atatggccct cacctgccgc ctccgtttcc cggtgccggg 17400

attccgagga agaatgcacc gtaggagggg catggccggc cacggcctga cgggcggcat 17460

gcgtcgtgcg caccaccggc ggcggcgcgc gtcgcaccgt cgcatgcgcg gcggtatcct 17520

gcccctcctt attccactga tcgccgcggc gattggcgcc gtgcccggaa ttgcatccgt 17580

ggccttgcag gcgcagagac actgattaaa aacaagttgc atgtggaaaa atcaaaataa 17640

aaagtctgga ctctcacgct cgcttggtcc tgtaactatt ttgtagaatg gaagacatca 17700

actttgcgtc tctggccccg cgacacggct cgcgcccgtt catgggaaac tggcaagata 17760

tcggcaccag caatatgagc ggtggcgcct tcagctgggg ctcgctgtgg agcggcatta 17820

aaaatttcgg ttccaccgtt aagaactatg gcagcaaggc ctggaacagc agcacaggcc 17880

aaatgctgag ggacaagttg aaagagcaaa atttccaaca aaaggtggta gatggcctgg 17940

cctctggcat tagcggggtg gtggacctgg ccaaccaggc agtgcaaaat aagattaaca 18000

gtaagcttga tcaccgccct cccgtagagg agccttcacc ggccgtggag acagtgttgc 18060

cagatgggcg tggcgaaaag cgcccgcgcc ccgacaggga agagactctg gtgacacaaa 18120

tcgacgagcc tccctcgtac gaggaggcgc taaagcaagg cctgcccacc acccgtccca 18180

tcgcgcccat ggctaccgga gtgttgggcc agcacacacc tgtaacgctg gacctgcctc 18240

cccccgctga cacccagcag aaacctgtgc tgccagggcc gtccgccgtt gttgtaaccc 18300

gccctagccg cgcgtccctg cgccgtgccg ccagcggtcc gcgatcgttg cggcccgtag 18360

ccagtggcaa ctggcaaagc acactgaaca gcatcgtggg tctgggggtg caatccctaa 18420

agcgccgacg atgcttttga atagctaacg tgtcgtatgt gtgtcatgta tgcgtccatg 18480

tcgccgccag aggagctgct gagtcgccgc gcgcccgctt tccaagatgg ctaccccttc 18540

gatgatgccg cagtggtctt acatgcacat ctcgggccag gacgcctcgg agtacctgag 18600

ccccgggctg gtgcagttcg cccgcgccac cgagacgtac ttcagcctga ataacaagtt 18660

tagaaacccc acggtggcgc ctacgcacga cgtgaccaca gaccggtctc agcgtttgac 18720

gctgcggttt atccccgtgg accgcgagga taccgcatac tcgtacaagg cgcggtttac 18780

cctggctgtg ggtgacaacc gtgtgcttga catggcttcc acatactttg acattcgcgg 18840

cgtgctggac cggggcccca cttttaaacc ctactccggc actgcctaca acgctctagc 18900

ccccaagggc gctcccaatt cctgcgagtg ggaacaagaa gaaccaactc aggaaatggc 18960

tgaagaactt gaagatgagg aggaggcaga ggaggaggag gcagaggagg aggcagaagc 19020

accacaagct gatcagaagg ttaagaagac tcatgtatat gctcaggctc ctttggcagg 19080

ggaaaaaatt accgccaatg gcttacaaat agtttctgat acccaaactg aaggcaatcc 19140

agtttttgcc gatcccactt atcaacctga acctcaggtt ggagaatctc agtggaatga 19200

agctgaagca actgcatctg gaggcagagt actaaaaaag actactccca tgaaaccatg 19260

ctacggatcg tatgccagac ctacaaataa aaatgggggt caaggtatac tagtagcaaa 19320

caaccaaggt gctctagagt ctaaagttga aatgcagttt tttgccccct ctggcactgc 19380

catgaatgaa agaaatgctg ttcagccaag tattgttttg tacagtgagg atgttaatat 19440

ggaaactcct gatactcaca tttcatacaa accaagcaaa actgatgaaa actctaaggc 19500

tatgttgggt caacaagcaa tgccaaacag acccaattac atcgctttta gggacaattt 19560

tattggcctt atgtattaca acagcactgg taacatgggt gtccttgctg gacaagcatc 19620

acagctaaat gccgtggtag acttgcagga cagaaacaca gagctgtcat atcaactttt 19680

gcttgattct attggcgata gaaccagata cttttccatg tggaatcagg ctgtagacag 19740

ctatgatcca gatgtcagaa tcattgaaaa tcatggaact gaggatgagt tgccaaatta 19800

ctgcttccca cttggcggta taggggtaac tgacacctac caaggtataa aatcaaacgg 19860

aaacggtaat cctcaaaact ggaccaaaaa tgacgatttt gcggcacgta atgaaatagg 19920

tgtgggaaac aactttgccc tggagattaa ccttaatgcc aacctatgga gaaatttcct 19980

ctactccaac attgcactgt acctgcctga caagctaaaa tacactccta caaatgtgga 20040

aatatctccc aaccctaatt catacgatta tatgaacaaa cgagtggtgg ctcccgggtt 20100

ggtggattgc tacattaacc ttggagcgcg ttggtcattg gactacatgg acaacgtcaa 20160

cccctttaac catcaccgca atgcgggcct acgctaccgc tccatgttgc tgggcaacgg 20220

tcgctacgtg ccctttcaca tccaggttcc tcagaagttt tttgccatta agaacctcct 20280

actcttgccg ggctcataca cctacgagtg gaacttcagg aaagatgtta acatggtcct 20340

acaaagctcc ctaggaaacg acctaagagt tgacggagcc agcattaagt ttgacagcat 20400

ttgcctctac gccacctttt ttccgatggc ccacaacacc gcctcaacgc ttgaagccat 20460

gcttagaaac gacaccaacg accaatcctt taacgactac ctatccgccg ccaacatgct 20520

ttaccccata cccgccaacg ccaccaacgt gcccatctct atcccctcgc gcaactgggc 20580

ggctttccga ggctgggcct ttacgcgcct taagactaag gaaaccccat ccctgggttc 20640

cggctacgac ccttactata cctactctgg ctccataccc tacctagacg gaacctttta 20700

ccttaatcac accttcaaaa aggtggccat cacctttgac tcttctgtta gctggcctgg 20760

caatgaccgt ctgcttaccc ccaacgagtt tgagatcaag cgttcagttg acggagaggg 20820

ctacaacgtt gcccaatgca acatgaccaa agactggttc ttggtacaga tgctagccaa 20880

ctacaacata ggctaccagg gcttttatat cccagaaagc tataaggacc gcatgtactc 20940

cttctttaga aacttccagc ccatgagccg tcaggtggtg gacgatacca aatacaagga 21000

ctaccaacag gtgggcatcc tccaccagca caataactct ggctttgttg gttacctcgc 21060

tcccaccatg cgagagggac aggcctaccc cgccaacttc ccctacccgc ttataggcaa 21120

gaccgcggtt gacagtatta cccagaaaaa gtttctttgc gaccgcaccc tttggcgcat 21180

tccattctcc agtaacttta tgtccatggg tgcactcaca gacctgggcc aaaaccttct 21240

ctatgcaaac tccgcccacg cgctagatat gacttttgag gtggatccca tggacgagcc 21300

cacccttctt tatgttttgt ttgaagtctt tgacgtggtc cgtgtgcacc agccgcaccg 21360

cggcgtcatc gagaccgtgt acctgcgcac gcccttctcg gctggcaacg ccacaacata 21420

aagaagcaag caacatcaac aacagctgcc gccatgggct ccagtgagca ggaactaaaa 21480

gccattgtca aagatcttgg ttgtgggcca tattttttgg gcacctatga caagcgcttc 21540

ccaggctttg tttccccaca caagctcgcc tgcgccatag ttaacacggc cggtcgcgag 21600

actgggggcg tacactggat ggcctttgcc tggaacccgc gctcaaaaac atgctacctc 21660

tttgagccct ttggcttttc tgaccaacgt ctcaagcagg tttaccagtt tgagtacgag 21720

tcactcctgc gccgtagcgc cattgcctct tcccccgacc gctgtataac gctggaaaag 21780

tccacccaaa gcgtgcaggg gcccaactcg gccgcctgtg gcctattctg ctgcatgttt 21840

ctccacgcct ttgccaactg gccccaaact cccatggatc acaaccccac catgaacctt 21900

attaccgggg tacccaactc catgcttaac agtccccagg tacagcccac cctgcgtcgc 21960

aaccaggaac agctctacag cttcctggag cgccactcgc cctacttccg cagccacagt 22020

gcgcagatta ggagcgccac ttctttttgt cacttgaaaa acatgtaaaa ataatgtact 22080

aggagacact ttcaataaag gcaaatgttt ttatttgtac actctcgggt gattatttac 22140

ccccaccctt gccgtctgcg ccgtttaaaa atcaaagggg ttctgccgcg catcgctatg 22200

cgccactggc agggacacgt tgcgatactg gtgtttagtg ctccacttaa actcaggcac 22260

aaccatccgc ggcagctcgg tgaagttttc actccacagg ctgcgcacca tcaccaacgc 22320

gtttagcagg tcgggtgccg atatcttgaa gtcgcagttg gggcctccgc cctgcgcgcg 22380

cgagttgcga tacacagggt tgcagcactg gaacactatt agcgccgggt ggtgcacgct 22440

ggccagcacg ctcttgtcgg agatcagatc cgcgtccagg tcctccgcgt tgctcagggc 22500

gaacggagtc aactttggta gctgccttcc caaaaagggt gcatgcccag gctttgagtt 22560

gcactcgcac cgtagtggca tcagaaggtg accgtgcccg gtctgggcgt taggatacag 22620

cgcctgcatg aaagccttga tctgcttaaa agccacctga gcctttgcgc cttcagagaa 22680

gaacatgccg caagacttgc cggaaaactg attggccgga caggccgcgt catgcacgca 22740

gcaccttgcg tcggtgttgg agatctgcac cacatttcgg ccccaccggt tcttcacgat 22800

cttggccttg ctagactgct ccttcagcgc gcgctgcccg ttttcgctcg tcacatccat 22860

ttcaatcacg tgctccttat ttatcataat gctcccgtgt agacacttaa gctcgccttc 22920

gatctcagcg cagcggtgca gccacaacgc gcagcccgtg ggctcgtggt gcttgtaggt 22980

tacctctgca aacgactgca ggtacgcctg caggaatcgc cccatcatcg tcacaaaggt 23040

cttgttgctg gtgaaggtca gctgcaaccc gcggtgctcc tcgtttagcc aggtcttgca 23100

tacggccgcc agagcttcca cttggtcagg cagtagcttg aagtttgcct ttagatcgtt 23160

atccacgtgg tacttgtcca tcaacgcgcg cgcagcctcc atgcccttct cccacgcaga 23220

cacgatcggc aggctcagcg ggtttatcac cgtgctttca ctttccgctt cactggactc 23280

ttccttttcc tcttgcgtcc gcataccccg cgccactggg tcgtcttcat tcagccgccg 23340

caccgtgcgc ttacctccct tgccgtgctt gattagcacc ggtgggttgc tgaaacccac 23400

catttgtagc gccacatctt ctctttcttc ctcgctgtcc acgatcacct ctggggatgg 23460

cgggcgctcg ggcttgggag aggggcgctt ctttttcttt ttggacgcaa tggccaaatc 23520

cgccgtcgag gtcgatggcc gcgggctggg tgtgcgcggc accagcgcat cttgtgacga 23580

gtcttcttcg tcctcggact cgagacgccg cctcagccgc ttttttgggg gcgcgcgggg 23640

aggcggcggc gacggcgacg gggacgacac gtcctccatg gttggtggac gtcgcgccgc 23700

accgcgtccg cgctcggggg tggtttcgcg ctgctcctct tcccgactgg ccatttcctt 23760

ctcctatagg cagaaaaaga tcatggagtc agtcgagaag gaggacagcc taaccgcccc 23820

ctttgagttc gccaccaccg cctccaccga tgccgccaac gcgcctacca ccttccccgt 23880

cgaggcaccc ccgcttgagg aggaggaagt gattatcgag caggacccag gttttgtaag 23940

cgaagacgac gaggatcgct cagtaccaac agaggataaa aagcaagacc aggacgacgc 24000

agaggcaaac gaggaacaag tcgggcgggg ggaccaaagg catggcgact acctagatgt 24060

gggagacgac gtgctgttga agcatctgca gcgccagtgc gccattatct gcgacgcgtt 24120

gcaagagcgc agcgatgtgc ccctcgccat agcggatgtc agccttgcct acgaacgcca 24180

cctgttctca ccgcgcgtac cccccaaacg ccaagaaaac ggcacatgcg agcccaaccc 24240

gcgcctcaac ttctaccccg tatttgccgt gccagaggtg cttgccacct atcacatctt 24300

tttccaaaac tgcaagatac ccctatcctg ccgtgccaac cgcagccgag cggacaagca 24360

gctggccttg cggcagggcg ctgtcatacc tgatatcgcc tcgctcgacg aagtgccaaa 24420

aatctttgag ggtcttggac gcgacgagaa acgcgcggca aacgctctgc aacaagaaaa 24480

cagcgaaaat gaaagtcact gtggagtgct ggtggaactt gagggtgaca acgcgcgcct 24540

agccgtgctg aaacgcagca tcgaggtcac ccactttgcc tacccggcac ttaacctacc 24600

ccccaaggtt atgagcacag tcatgagcga gctgatcgtg cgccgtgcac gacccctgga 24660

gagggatgca aacttgcaag aacaaaccga ggagggccta cccgcagttg gcgatgagca 24720

gctggcgcgc tggcttgaga cgcgcgagcc tgccgacttg gaggagcgac gcaagctaat 24780

gatggccgca gtgcttgtta ccgtggagct tgagtgcatg cagcggttct ttgctgaccc 24840

ggagatgcag cgcaagctag aggaaacgtt gcactacacc tttcgccagg gctacgtgcg 24900

ccaggcctgc aaaatttcca acgtggagct ctgcaacctg gtctcctacc ttggaatttt 24960

gcacgaaaac cgcctcgggc aaaacgtgct tcattccacg ctcaagggcg aggcgcgccg 25020

cgactacgtc cgcgactgcg tttacttatt tctgtgctac acctggcaaa cggccatggg 25080

cgtgtggcag cagtgcctgg aggagcgcaa cctgaaggag ctgcagaagc tgctaaagca 25140

aaacttgaag gacctatgga cggccttcaa cgagcgctcc gtggccgcgc acctggcgga 25200

cattatcttc cccgaacgcc tgcttaaaac cctgcaacag ggtctgccag acttcaccag 25260

tcaaagcatg ttgcaaaact ttaggaactt tatcctagag cgttcaggaa ttctgcccgc 25320

cacctgctgt gcgcttccta gcgactttgt gcccattaag taccgtgaat gccctccgcc 25380

gctttggggt cactgctacc ttctgcagct agccaactac cttgcctacc actccgacat 25440

catggaagac gtgagcggtg acggcctact ggagtgtcac tgtcgctgca acctatgcac 25500

cccgcaccgc tccctggtct gcaattcgca actgcttagc gaaagtcaaa ttatcggtac 25560

ctttgagctg cagggtccct cgcctgacga aaagtccgcg gctccggggt tgaaactcac 25620

tccggggctg tggacgtcgg cttaccttcg caaatttgta cctgaggact accacgccca 25680

cgagattagg ttttacgaag accaatcccg cccgccaaat gcggagctta ccgcctgcgt 25740

cattacccag ggccacatcc ttggccaatt gcaagccatc aacaaagccc gccaagagtt 25800

tctgctacga aagggacggg gggtttacct ggacccccag tccggcgagg agctcaaccc 25860

aatccccccg ccgccgcagc cctatcagca gccgcgggcc cttgcttccc aggatggcac 25920

ccaaaaagaa gctgcagctg ccgccgccgc cacccacgga cgaggaggaa tactgggaca 25980

gtcaggcaga ggaggttttg gacgaggagg aggagatgat ggaagactgg gacagcctag 26040

acgaagcttc cgaggccgaa gaggtgtcag acgaaacacc gtcaccctcg gtcgcattcc 26100

cctcgccggc gccccagaaa ttggcaaccg ttcccagcat cgctacaacc tccgctcctc 26160

aggcgccgcc ggcactgccc gttcgccgac ccaaccgtag atgggacacc actggaacca 26220

gggccggtaa gtctaagcag ccgccgccgt taacccaaga gcaacaacag cgccaaggct 26280

accgctcgtg gcgcgggcac aagaacgcca tagttgcttg cttgcaagac tgtgggggca 26340

acatctcctt cgcccgccgc tttcttctct accatcacgg cgtggccttc ccccgtaaca 26400

tcctgcatta ctaccgtcat ctctacagcc cctactgcac cggcggcagc ggcagcggca 26460

gcaacagcag cggtcacaca gaagcaaagg cgaccggata gcaagactct gacaaagccc 26520

aagaaatcca cagcggcggc agcagcagga ggaggagcgc tgcgtctggc gtccaacgaa 26580

cccgtatcga cccgcgagct tagaaacagg atttttccca ctctgtatgc tatatttcaa 26640

caaagcaggg gccaagaaca agagctaaaa ataaaaaaca ggtctctgcg ctccctcacc 26700

cgcagctgcc tgtatcacaa aagcgaagat cagcttcggc gcacgctgga agacgcggag 26760

gctctcttca gcaaatactg cgcgctgact cttaaggact agtttcgcgc cctttctcaa 26820

atttaagcgc gaaaactacg tcatctccag cggccacacc cggcgccagc acctgtcgtc 26880

agcgccatta tgagcaagga aattcccacg ccctacatgt ggagttacca gccacaaatg 26940

ggacttgcgg ctggagctgc ccaagactac tcaacccgaa taaactacat gagcgcggga 27000

ccccacatga tatcccgggt caacggaatc cgcgcccacc gaaaccgaat tctcctcgaa 27060

caggcggcta ttaccaccac acctcgtaat aaccttaatc cccgtagttg gcccgctgcc 27120

ctggtgtacc aggaaagtcc cgctcccacc actgtggtac ttcccagaga cgcccaggcc 27180

gaagttcaga tgactaactc aggggcgcag cttgcgggcg gctttcgtca cagggtgcgg 27240

tcgccaggac agggtataac tcacctgaaa atcagagggc gaggtattca gctcaacgac 27300

gagtcggtga gctcctctct tggtctccgt ccggacggga catttcagat cggcggcgct 27360

ggccgctctt catttacgcc ccgtcaggcg atcctaactc tgcagacctc gtcctcggag 27420

ccgcgctccg gaggcattgg aactctacaa tttattgagg agttcgtgcc ttcagtttac 27480

ttcaacccct tttctggacc tcccggccac tacccggacc agtttattcc caactttgac 27540

gcggtgaaag actcggcgga cggctacgac tgaatgacca gtggagaggc agagcaactg 27600

cgcctgacac acctcgacca ctgccgccgc cacaagtgct ttgcccgcgg ctccggtgag 27660

ttttgttact ttgaattgcc cgaagagcat atcgagggcc cggcgcacgg cgtccggctc 27720

accacccagg tagagcttac acgtagcctg attcgggagt ttaccaagcg ccccctgcta 27780

gtggagcggg agcggggtcc ctgtgttctg accgtggttt gcaactgtcc taaccctgga 27840

ttacatcaag atctttgttg tcatctctgt gctgagtata ataaatacag aaattagaat 27900

ctactggggc tcctgtcgcc atcctgtgaa cgccaccgtt tttacccacc caaagcagac 27960

caaagcaaac ctcacctccg gtttgcacaa gcgggccaat aagtacctta cctggtactt 28020

taacggctct tcatttgtaa tttacaacag tttccagcga gacgaagtaa gtttgccaca 28080

caaccttctc ggcttcaact acaccgtcaa gaaaaacacc accaccaccc tcctcacctg 28140

ccgggaacgt acgagtgcgt caccggttgc tgcgcccaca cctacagcct gagcgtaacc 28200

agacattact cccatttttc caaaacagga ggtgagctca actcccggaa ctcaggtcaa 28260

aaaagcattt tgcggggtgc tgggattttt taattaagta tatgagcaat tcaagtaact 28320

ctacaagctt gtctaatttt tctggaattg gggtcggggt tatccttact cttgtaattc 28380

tgtttattct tatactagca cttctgtgcc ttagggttgc cgcctgctgc acgcacgttt 28440

gtacctattg tcagcttttt aaacgctggg ggcgacatcc aagatgagat taaatgagac 28500

atgattcctc gagttcttat attattgacc cttgttgcgc ttttctgtgc gtgctctaca 28560

ttggccgcgg tcgctcacat cgaagtagat tgcatcccac ctttcacagt ttacctgctt 28620

tacggatttg tcacccttat cctcatctgc agcctcgtca ctgtagtcat cgccttcatt 28680

cagttcattg actgggtttg tgtgcgcatt gcgtacctca ggcaccatcc gcaatacaga 28740

gacaggacta tagctgatct tctcagaatt ctttaattat gaaacggagt gtcatttttg 28800

ttttgctgat tttttgcgcc ctacctgtgc tttgctccca aacctcagcg cctcccaaaa 28860

gacatatttc ctgcagattc actcaaatat ggaacattcc cagctgctac aacaaacaga 28920

gcgatttgtc agaagcctgg ttatacgcca tcatctctgt catggttttt tgcagtacca 28980

tttttgccct agccatatat ccataccttg acattggctg gaatgccata gatgccatga 29040

accaccctac tttcccagtg cccgctgtca taccactgca acaggttatt gccccaatca 29100

atcagcctcg ccccccttct cccaccccca ctgagattag ctactttaat ttgacaggtg 29160

gagatgactg aatctctaga tctagaattg gatggaatta acaccgaaca gcgcctacta 29220

gaaaggcgca aggcggcgtc cgagcgagaa cgcctaaaac aagaagttga agacatggtt 29280

aacctacacc agtgtaaaag aggtatcttt tgtgtggtca agcaggccaa acttacctac 29340

gaaaaaacca ctaccggcaa ccgcctcagc tacaagctac ccacccagcg ccaaaaactg 29400

gtgcttatgg tgggagaaaa acctatcacc gtcacccagc actcggcaga aacagagggc 29460

tgcctgcact tcccctatca gggtccagag gacctctgca ctcttattaa aaccatgtgt 29520

ggtattagag atcttattcc attcaactaa cataaacaca caataaatta cttacttaaa 29580

atcagtcagc aaatctttgt ccagcttatt cagcatcacc tcctttcctt cctcccaact 29640

ctggtatctc agccgccttt tagctgcaaa ctttctccaa agtttaaatg ggatgtcaaa 29700

ttcctcatgt tcttgtccct ccgcacccac tatcttcata ttgttgcaga tgaaacgcgc 29760

cagaccgtct gaagacacct tcaaccccgt gtatccatat gacacagaaa ccgggcctcc 29820

aactgtgccc tttcttaccc ctccatttgt ttcacccaat ggtttccaag aaagtccccc 29880

tggagttctc tctctacgcg tctccgaacc tttggacacc tcccacggca tgcttgcgct 29940

taaaatgggc agcggtctta ccctagacaa ggccggaaac ctcacctccc aaaatgtaac 30000

cactgttact cagccactta aaaaaacaaa gtcaaacata agtttggaca cctccgcacc 30060

acttacaatt acctcaggcg ccctaacagt ggcaaccacc gctcctctga tagttactag 30120

cggcgctctt agcgtacagt cacaagcccc actgaccgtg caagactcca aactaagcat 30180

tgctactaaa gggcccatta cagtgtcaga tggaaagcta gccctgcaaa catcagcccc 30240

cctctctggc agtgacagcg acacccttac tgtaactgca acacccccgc taactactgc 30300

cacgggtagc ttgggcatta acatggaaga tcctatttat gtaaataatg gaaaaatagg 30360

aattaaaata agcggtcctt tgcaagtagc acaaaactcc gatacactaa cagtagttac 30420

tggaccaggt gtcaccgttg aacaaaactc ccttagaacc aaagttgcag gagctattgg 30480

ttatgattca tcaaacaaca tggaaattaa aacgggcggt ggcatgcgta taaataacaa 30540

cttgttaatt ctagatgtgg attacccatt tgatgctcaa acaaaactac gtcttaaact 30600

ggggcaggga cccctgtata ttaatgcatc tcataacttg gacataaact ataacagagg 30660

cctatacctt tttaatgcat caaacaatac taaaaaactg gaagttagca taaaaaaatc 30720

cagtggacta aactttgata atactgccat agctataaat gcaggaaagg gtctggagtt 30780

tgatacaaac acatctgagt ctccagatat caacccaata aaaactaaaa ttggctctgg 30840

cattgattac aatgaaaacg gtgccatgat tactaaactt ggagcgggtt taagctttga 30900

caactcaggg gccattacaa taggaaacaa aaatgatgac aaacttaccc tgtggacaac 30960

cccagaccca tctcctaact gcagaattca ttcagataat gactgcaaat ttactttggt 31020

tcttacaaaa tgtgggagtc aagtactagc tactgtagct gctttggctg tatctggaga 31080

tctttcatcc atgacaggca ccgttgcaag tgttagtata ttccttagat ttgaccaaaa 31140

cggtgttcta atggagaact cctcacttaa aaaacattac tggaacttta gaaatgggaa 31200

ctcaactaat gcaaatccat acacaaatgc agttggattt atgcctaacc ttctagccta 31260

tccaaaaacc caaagtcaaa ctgctaaaaa taacattgtc agtcaagttt acttgcatgg 31320

tgataaaact aaacctatga tacttaccat tacacttaat ggcactagtg aatccacaga 31380

aactagcgag gtaagcactt actctatgtc ttttacatgg tcctgggaaa gtggaaaata 31440

caccactgaa acttttgcta ccaactctta caccttctcc tacattgccc aggaataaag 31500

aatcgtaaac ctgttgcatg ttatgtttca acgtgtttat ttttcaattg cagaaaattt 31560

caagtcattt ttcattcagt agtatagccc caccaccaca tagcttatac agatcaccgt 31620

accttatcaa actcacagaa ccctagtatt caacctgcca cctccctccc aacacacaga 31680

gtacacagtc ctttctcccc ggctggcctt aaaaagcatc atatcatggg taacagacat 31740

attcttaggt gttatattcc acacggtttc ctgtcgagcc aaacgctcat cagtgatatt 31800

aataaactcc ccgggcagct cacttaagtt catgtcgctg tccagctgct gagccacagg 31860

ctgctgtcca acttgcggtt gcttaacggg cggcgaagga gaagtccacg cctacatggg 31920

ggtagagtca taatcgtgca tcaggatagg gcggtggtgc tgcagcagcg cgcgaataaa 31980

ctgctgccgc cgccgctccg tcctgcagga atacaacatg gcagtggtct cctcagcgat 32040

gattcgcacc gcccgcagca taaggcgcct tgtcctccgg gcgcagcagc gcaccctgat 32100

ctcacttaaa tcagcacagt aactgcagca cagcaccaca atattgttca aaatcccaca 32160

gtgcaaggcg ctgtatccaa agctcatggc ggggaccaca gaacccacgt ggccatcata 32220

ccacaagcgc aggtagatta agtggcgacc cctcataaac acgctggaca taaacattac 32280

ctcttttggc atgttgtaat tcaccacctc ccggtaccat ataaacctct gattaaacat 32340

ggcgccatcc accaccatcc taaaccagct ggccaaaacc tgcccgccgg ctatacactg 32400

cagggaaccg ggactggaac aatgacagtg gagagcccag gactcgtaac catggatcat 32460

catgctcgtc atgatatcaa tgttggcaca acacaggcac acgtacatac acttcctcag 32520

gattacaagc tcctcccgcg tcagaaccat atcccaggga acaacccatt cctgaatcag 32580

cgtaaatccc acactgcagg gaagacctcg cacgtaactc acgttgtgca ttgtcaaagt 32640

gttacattcg ggcagcagcg gatgatcctc cagtatggta gcgcgggttt ctgtctcaaa 32700

aggaggtaga cgatccctac tgtacggagt gcgccgagac aaccgagatc gtgttggtcg 32760

tagtgtc 32767

Claims (8)

1. A replicative human adenovirus having the nucleotide sequence as set forth in SEQ ID No.: shown at 21.

2. The replicative human adenovirus of claim 1, wherein: the E1 and E3 regions of the virus were deleted.

3. The replicative human adenovirus of claim 1, wherein: the virus may be replicated in animal cells, human cells or in humans.

4. A composition characterized by: comprising the replicative human adenovirus of claim 1.

5. The composition according to claim 4, wherein the composition comprises: a) an immune modulating agent; b) an immune regulatory cell; c) a radioactive treatment; d) a phototherapeutic compound; or e) a chemotherapeutic compound.

6. The composition of claim 4, further comprising a pharmaceutically acceptable adjuvant, diluent or excipient.

7. The application of the composition in preparing a preparation for preventing or treating tumors or detecting tumors is characterized in that: the composition as claimed in any one of claims 4 to 6.

8. Use according to claim 7, characterized in that: the tumor is selected from breast cancer, brain cancer, lung cancer, nasopharyngeal cancer, head and neck cancer, renal cancer, bladder cancer, liver cancer, esophageal cancer, gastric cancer, colorectal cancer, pancreatic cancer, ovarian cancer, skin cancer, prostatic cancer, fallopian tube cancer, urethra cancer, genitourinary system cancer, endometriosis, cervical cancer, bone cancer or metastatic lesion of cancer.

Images