ES2367240T3 - ADENOVÍRIC VECTORS FOR THE TREATMENT OF DISEASES. - Google Patents

Abstract

A recombinant adenoviral vector comprising restriction sites in the E3 region of said vector selected from the group consisting of Pac1, Clal, Pme1, Swa1, BamH1, BstB1, Ssp1, Nhe1, Stu1 and EcoRV, wherein said restriction sites have positions relative as shown in Figures 4 to 7; wherein the restriction sites are introduced by mutations preferably without modifying the coding sequence, but when changes are made in the amino acids they are conservative in nature; and wherein the restriction sites are located so as not to interrupt critical signals of alternative processing and polyadenylation; wherein the restriction sites facilitate the partial or total elimination of an adenoviral gene or genes contained in said E3 region, and the replacement of said partial or total deletion of said adenoviral gene or genes with a heterologous gene, wherein said gene heterologous presents an expression pattern, both in terms of synchronization and degree of expression, similar to the endogenous adenoviral gene it replaces; wherein said vector includes restriction sites in the genes of the early region of the E3 region encoding the 6.7K and gp19K proteins and / or wherein said vector includes restriction sites in the genes of the early region of the region E3 encoding the 10.4K, 14.5K and 14.7K proteins.

Description

Field of the Invention

[0001] The invention described herein is generally related to the field of gene therapy, and more specifically to adenoviral vectors that have prophylactic or therapeutic applications.

Background of the invention

[0002] The adenovirus is a vector selected to carry out gene therapy. See, Jolly, D., Cancer Gene Therapy, vol. 1, no. 1. 1994: p. 51-64. The perfectly characterized molecular genetics of adenovirus make it an advantageous vector in this regard. Adenoviruses are double-stranded icosahedral DNA viruses with a linear genome of approximately 36 kilobase pairs. Each end of the viral genome has a short sequence known as inverted terminal repeat (or ITR), which is necessary for viral replication. Parts of the viral genome can easily be replaced with DNA of exogenous origin, and in addition, recombinant adenoviruses are structurally stable.

[0003] The adenovirus replication cycle has two phases: an early phase, during which 4 transcription units E1, E2, E3, and E4 are expressed, and a late phase that occurs after the start of DNA synthesis viral when late transcripts are expressed from the main late promoter (MLP). The latest messengers encode most of the structural proteins of the virus. The gene products of E1, E2, and E4 are responsible for transcriptional activation, cell transformation, viral DNA replication, as well as other viral functions, and are necessary for virus multiplication.

[0004] To date, most adenoviral vectors are based on viruses mutated in E1, E3 or a site upstream of E4 that provide sites for exogenous DNA insertion. Perhaps most vectors are based on mutant strains of adenovirus that lack the E1 region of the genome. By eliminating this region, the virus becomes replicatively incompetent, and in addition, a region available for the insertion of exogenous genes is achieved.

[0005] There are numerous reports on the use of adenovirus for gene therapy, for example, Smith, et al., Nature Genetics, Vol. 5, p. 397-402 (1993) describes the administration to mice of an adenoviral vector that includes a human Factor IX gene. Such administration results in liver transduction and efficient plasma levels of human Factor IX that would be therapeutic for patients with hemophilia B. However, levels of human Factor IX slowly decline to baseline levels at nine weeks after injection, and not they are restored with a second injection of the vector. Smith, et al., Have also found that neutralizing antibodies to adenovirus block successful repeated administration of adenovirus.

[0006] Kozarsky, et al., J. Biol. Chem., Vol. 269, No. 18. p. 13695-13702 (May 6, 1994) describes the infusion of an adenoviral vector that includes DNA encoding the LDL receptor to rabbits. Stable expression of the LDL receptor gene was obtained for 7 to 10 days, and decreased to undetectable levels at 3 weeks. The development of neutralizing antibodies against adenovirus resulted in a completely ineffective second dose.

[0007] Kass-Eisler, et al., Gene Therapy, Vol. 1, p. 395-402 (1994) suggests that the T-cell response contributes to, but is not solely responsible for, the limited duration of adenoviral vector expression in adults. The authors also show that cyclosporin A is not effective for blocking the humoral response to the vector.

[0008] Fang, et al., J. Cell. Biochem., Supplement 21A, C6-109, p. 363 (1995) describes the attempt to reinject an adenoviral vector in dogs that had been treated with cyclosporin A, an immunosuppressive agent. This attempt at reinjection was unsuccessful.

[0009] Yang, et al., Proc. Nat. Acad. Sci., Vol. 91. p. 4407-4411 (May 1994) describes recombinant adenoviruses in which the E1a and E1b regions have been removed. Such viruses also include a transgene. When these adenoviruses are administered to an animal host, the cells that house the recombinant virus genome express the transgene in the desired manner: however: a low level of viral gene expression can also occur.

[0010] As noted above, adenoviruses can be efficient in gene transfer in cells in vivo, and thus can be used as delivery vehicles for the introduction of desired genes into eukaryotic cells, by which adenovirus introduces said genes into eukaryotic cells by binding to cell receptors. There are, however, several limitations to the transfer of genes with adenovirus that are due, in part, to the host responses directed against the adenovirus vector particle, the products of the vector particle breakage, or the transduced cells. These host cells include non-specific responses and specific immune responses. Non-specific responses include inflammatory and non-inflammatory changes. An example of the latter is a change in the gene expression of the host cell. Specific immune responses include various cellular responses and humoral antibody responses. Cellular responses include those mediated by helper T lymphocytes, suppressor T lymphocytes, cytotoxic T lymphocytes (CTL), and natural killer cells.

[0011] Despite the high efficiency of gene transfer mediated by the adenoviral vector, the transient nature of the gene transfer mediated by the adenoviral vector has suggested that repeated administrations of adenoviral vectors may be necessary. However, recent studies in cotton rats have shown that host immune responses directed towards adenoviral vectors are related to reduced efficiency of gene transfer and expression after repeated administrations. Yei et al., Gene Therapy, 1: 192-200 (1994). The E3 region encodes several immunoregulatory proteins, which are not necessary for viral replication; gp 19K, 10.4K, 14.5K and an 11.6K protein, which is necessary for the lysis of infected cells, and the release of the infectious progeny.

[0012] Although the E3 region is not essential for virus replication, it plays a fundamental role in modulating the host's immune response to the virus. For example, it is known that gp19K binds to MHC class 1 molecules in the endoplasmic reticulum, thus inhibiting their glycosylation and the transport to the surface of virus-infected cells. Consequently, infected cells are not recognized as exogenous by cytotoxic lymphocytes, Sec. Burgert. B. et al., Proc Natl Acad Sci USA 1987, vol 8 1356-60.

[0013] Due to the numerous functions of the E3 region, it would be desirable to have an adenoviral vector for applications in gene therapy that would eliminate particular regions of E3, and replace them with exogenous DNA, depending on the intended application for the vector. For example, there are deletions described in the E3 region that result in the removal of 1.88 kb, between the Xba I, Sec. Berknerk and Sharp sites. P. (1983) Nucleic Acids Res Vol 11, pages 6003-6020, and Haj-Ahmad. And and Graham. F (1936) J Virol Vol 57. pages 267-271. In addition, compositions and procedures for the construction of adenoviruses having insertions or deletions in both regions E1 and E3 are described. See also, Ginsberg. H S et al., Proc Natl Acad Sci USA 1989, vol 86, p. 3823-7.

[0014] Thus, although there are vectors that have mutations in the E3 region, or large parts of the region removed, to date there is no vector that allows the removal of selected parts of the region and replace them with exogenous DNA.

Summary of the invention

[0015] A first object of the invention is to describe recombinant viral vectors that present restriction sites that can be engineered in the E3 region that facilitate partial or total elimination of this region, or selected genes contained therein, and if If desired, replace them with a heterologous gene, whose gene will exhibit an expression pattern, both in terms of time and degree of expression, similar to the endogenous adenoviral gene it replaces.

[0016] Accordingly, a recombinant adenoviral vector is provided comprising restriction sites in the E3 region of said vector selected from the group consisting of Pac1, Cla1, Pme1, Swa1, BamH1, BstB1, Ssp1, Nhe1, Stu1 and EcoR1, in which said restriction sites have relative positions as shown in Figures 4 to 7;

in which restriction sites are introduced by mutations preferably without changing the coding sequence, but in which the changes that occur in amino acids are conservative in nature; and wherein the restriction sites are located so as not to interrupt critical signals of alternative processing and polyadenylation;

wherein the restriction sites facilitate the partial or total elimination of an adenoviral gene or genes contained in said E3 region, and the replacement of said partial or total deletion of said adenoviral gene or genes with a heterologous gene,

wherein said heterologous gene has an expression pattern, both in terms of synchronization and degree of expression, similar to the endogenous adenoviral gene it replaces;

wherein said vector includes restriction sites in the genes of the early region of the E3 region encoding the 6.7K and 19K gp proteins and / or

wherein said vector includes restriction sites in the genes of the early region of the E3 region encoding the 10.4K, 14.5K and 14.7K proteins.

[0017] A second object of the present invention is to describe a process for the preparation of recombinant adenoviral vectors that have restriction sites in the E3 region and that facilitate partial or total removal of the E3 region or selected genes contained therein. Accordingly, there is provided a method of producing a recombinant adenoviral vector for use in the expression of a heterologous gene, said method comprising the genetic engineering manipulation of a restriction site in the E3 region of said vector selected from the group constituted by Pac1, Cla1, Pme1, Swa1, BamH1, BstB1, Ssp1, Nhe1, Stu1 and EcoRV;

wherein said restriction sites have the relative positions shown in Figures 4 to 7;

whose restriction site allows the partial or total elimination of an adenoviral gene or genes contained in said E3 region, and the replacement of said partial or total elimination of said adenoviral gene or genes with a heterologous gene; said restriction site that is positioned such that said heterologous gene exhibits an expression pattern, both in terms of synchronization and degree of expression, similar to the endogenous adenoviral gene that it replaces without interrupting critical signals of alternative processing and polyadenylation;

in which any change in amino acids is conservative in nature;

wherein said restriction site is engineered into the genes in the early region of the E3 region that encode 6.7K and 19K gp proteins; I

wherein said restriction site is engineered in the genes of the early region of the E3 region that encode the 10.4K, 14.5K and 14.7K proteins.

[0018] Recombinant adenoviral mutants that exhibit restriction sites in the E3 region that facilitate partial or total elimination of the E3 region or of selected genes contained therein are also described.

[0019] In addition, recombinant adenoviral mutants are described that have restriction sites in the E3 region that facilitate partial or total elimination of the E3 region, or selected genes contained therein, including virions: E3SV, E3SV + V, E3SV + B, and E3SV + V + B.

[0020] A ninth object of the invention is a description of recombinant adenoviral vectors of the invention that have restriction sites in the E3 region that facilitate partial or total removal of the E3 region, wherein said vectors also have mutations in any another part of the adenoviral genome, preferably in the E1A, E1B, and / or E4 regions.

[0021] A tenth object of the invention is a description of the use of recombinant adenoviral vectors that have restriction sites in the E3 region that facilitate partial or total removal of the E3 region, or selected genes contained therein, in which the Adenoviral mutants have substituted genes in the E3 region that encode medically beneficial proteins for the preparation of a medicament for the treatment of cancer in a mammal. Preferred substituted genes include heterologous genes that include negative selection genes, preferably cytosine deaminase, and thymidine kinase.

[0022] These and other objects of the present invention will be apparent to someone with ordinary knowledge in the field upon reading the description of the various aspects of the invention in the following specification. The following and other aspects of the present invention are explained in more detail in the drawings, detailed description, and examples set forth below.

Brief description of the drawings [0023]

Figure 1 shows a map of the transcriptional unit of the E3 region of adenovirus type 5. The arrows of separation indicate the structures processed alternately from mRNAs (open rectangles or solid lines represent exons; dotted lines, introns): the thickness of the date indicates abundance relative. The shaded bars above the arrows indicate the E3 proteins, which are called in based on their molecular masses. Figure 2 shows the production of recombinant viruses using Ad5 pNB and TP-DNA (m.u. refers to map units). Figure 3 shows the production of recombinant viruses using Ad5 pSN and TP-DNA. Figure 4 shows the restriction map of the E3 region of the E3SV adenovirus. Figure 5 shows the restriction map of the E3 region of the E3SV + V adenovirus. Figure 6 shows the restriction map of the E3 region of the E3SV + B adenovirus. Figure 7 shows the restriction map of the E3 region of the E3SV + V + B adenovirus. Figure 8 shows infected A549 cells simulated or infected with Ad5. Figure 9 shows A549 cells infected with viruses 301, 302, 303, and 304. Figure 10 shows the Western blot analysis of gp19K from cell lysates prepared to from cells infected with viruses 301, 302, 303, and 304 at different times after infection. Figure 11 shows a CD assay on cell lysates prepared from cells infected with viruses 301, 302, 303, 304, and 305 at different times after infection. Figure 12 shows a CD assay on cell lysates from cells infected with viruses. 301, 302, 303, 304, and 305 different times after infection using 0.6 µg of protein / reaction. Figure 13 shows the cytopathic effect of viruses 305 and 320 at different times after infection. Figure 14 shows the cytopathic effect of virus 320 on cells that have or do not have changes in the environment at certain times after infection.

Detailed description of the invention

Definitions

[0024] Unless otherwise defined, all technical and scientific terms used in this document have the same meaning usually understood by someone with ordinary knowledge in the field to which this invention belongs. In general, the nomenclature used in this document and the laboratory procedures detailed below are well known and commonly used in the field.

[0025] Standard techniques are used for procedures with recombinant nucleic acids, polynucleotide synthesis, and microbial culture and transformation (eg, electroporation, lipofection). In general, enzymatic reactions and purification steps are carried out according to the manufacturer's specifications. The techniques and procedures in general are carried out according to conventional procedures in the field and various general references (see, in general, Sambrook et al., Molecular Cloning: A Laboratory Manual. 2nd, edition (1989) Cold Spring Harbor Laboratory Press Cold Spring Harbor, NY) provided throughout this document. The nomenclature used herein and the laboratory procedures in analytical chemistry, organic synthesis chemistry, and pharmaceutical formulation described below are well known and commonly used in the art. Standard techniques for chemical synthesis, chemical analysis, pharmaceutical formulation and administration, and treatment of patients are used.

[0026] Those skilled in the art will also recognize publications that facilitate genetic engineering techniques with the adenoviruses of the invention to produce mutants in the E3 region. Such publications include those of McGrory, W. J. et al. (1988) Virology, vol. 177, p. 437-444, who describes the insertion of DNA in the E1 region. Danke, T. et al., (1990) Virology. vol. 177, p. 437-444 and Bett. A. J. et al. (1993) J. Virol. vol. 67. pp. 5911-5921 who describes the insertion of exogenous DNA in the E3 region; and Bett, A. J. et al., (1994) Proc. Natl Acad. Sci. Vol. 91. pages 8802-8806, who describes the insertion of DNA into regions E1 and E3.

[0027] In the formulas representing selected specific embodiments of the present invention, the amino and carboxy-terminal groups, although often not specifically shown, are understood to be in the form that they would adopt at physiological pH values, a unless otherwise specified. Thus, H2N-terminal and O-C-terminal at physiological pH are understood to be present even though they are not necessarily specified and shown, either in specific examples or in generic formulas. In the polypeptide notation used herein, the left end of the molecule is the aminoterminal end and the right end is the carboxy terminal end, in accordance with standard uses and conventions. Naturally, acidic and basic addition salts, including those that are formed at non-physiological pH values, are also included in the compounds of the invention. The amino acid residues described herein are preferably in the "L" isomeric form. The stereoisomers (for example, D-amino acids) of the 20 conventional amino acids, unnatural amino acids such as α-distributed amino acids, N-alkylamino acids, lactic acid, and other unconventional amino acids may also be suitable components for the polypeptides of the present invention, as long as the polypeptide maintains the desired functional property. For the polypeptides shown, each encoded moiety where appropriate is represented by a three-letter designation, corresponding to the trivial name of the conventional amino acid, in accordance with the standard nomenclature of the polypeptides (described in J. Biol. Chem., 243: 3552 -59 (1969) and adopted in 37 CFR §1.822 (b) (2)). Free functional groups, including the carboxy- or amino-term, called non-interfering substituents, can also be modified by amidation, acylation or other substitution that may, for example, change the solubility of the compounds without affecting their activity.

[0028] As used throughout this description, it is understood that the following terms, unless otherwise indicated, have the following meanings:

[0029] The term "isolated protein" referred to herein means a cDNA protein, recombinant RNA, or of synthetic origin or some of its combinations, which by virtue of its origin the "isolated protein"

(1) is not associated with proteins found in nature, (2) is free of other proteins from the same source, for example, free of human proteins, (3) is expressed by a cell of a different species,

or (4) does not occur in nature.

[0030] The expression "of natural origin" as used herein applied to an object refers to the fact that the object can be found in nature. For example, a sequence of polypeptides or polynucleotides that is present in an organism (including viruses) that can be isolated from a source of nature and that has not been intentionally modified by man in the laboratory is of natural origin.

[0031] The term "adenovirus" as mentioned herein indicates more than 40 adenoviral subtypes isolated from humans, and many others from other mammals and birds. See, Strauss, "Adenovirus infections in humans," in The Adenoviruses, Ginsberg, ed., Plenum Press, New York, NY, p. 451596 (1984). The term preferably applies to two human serotypes, Ad2 and Ad5.

[0032] The term "polynucleotide" as mentioned herein means a polymeric form of nucleotides with a length of at least 10 bases, either ribonucleotides or deoxynucleotides or a modified form of any type of nucleotide. The term includes single stranded and double stranded DNA forms.

[0033] The term "oligonucleotide" as mentioned herein includes naturally occurring nucleotides and modified nucleotides linked by oligonucleotide junctions of natural and non-natural origin. Oligonucleotides are a subset of polynucleotides with a length of 200 bases or less. Preferably the oligonucleotides have a length of 10 to 60 bases. Normally oligonucleotides are single stranded, for example, for probes: although oligonucleotides can be double stranded, for example, for use in the construction of a mutant gene. The oligonucleotides of the invention can be oligonucleotides in the 5 'or 3' direction. The term "naturally occurring nucleotides" mentioned herein includes deoxyribonucleotides and ribonucleotides. The term "modified nucleotides" mentioned herein includes nucleotides with modified or substituted saccharide groups and the like, known in the art.

[0034] As used herein, the terms "labeling" or "labeling" refer to the incorporation of a detectable label, for example, with the incorporation of a radiolabeled amino acid or the coupling to a biotinyl moiety polypeptide which they can be detected with labeled avidin (for example, streptavidin containing a fluorescent label or enzymatic activity that can be detected by optical or colorimetric procedures). Various methods of labeling polypeptides and glycoproteins can be used in the art. Examples of markers for polypeptides include, but are not limited to, the following: radioisotopes (e.g., 3H, 14C, 35S, 125I, 131I), fluorescent markers (e.g., FITC, rhodamine, lanthanide phosphors), enzymatic markers ( for example, horseradish peroxidase, betagalactosidase, luciferase, alkaline phosphatase), chemiluminescent, biotinyl groups, epitopes of predetermined polypeptides recognized by a secondary reporter (e.g., sequences of leucine zipper pairs, secondary antibody binding sites, domains of metal binding, epitope markers). In some embodiments, the markers are joined by spacer arms of varying lengths to reduce potential steric hindrances.

[0035] The term "sequence homology" mentioned herein describes the proportion of base pairings between two nucleic acid sequences or the proportion of amino acid pairings between two amino acid sequences. When the sequence homology is expressed as a percentage, for example, 50%, the percentage denotes the proportion of pairings along the length of the sequence that is compared to some other sequence. Separations (in either sequence) are allowed to maximize the pairings; separations with a length of 15 bases or less are usually used, 6 bases or less are preferred, with 2 bases or less separations being more preferred.

[0036] The term "selectively hybridize" mentioned herein specifically refers to a detectable binding. The polynucleotides, oligonucleotides and fragments of the invention selectively hybridize to nucleic acid chains under hybridization and washing conditions that minimize appreciable amounts of detectable binding to non-specific nucleic acids. As is known in the art and described herein, very stringent conditions can be used to achieve selective hybridization conditions. In general, the nucleic acid sequence homology between the polynucleotides, oligonucleotides, and fragments of the invention and the nucleic acid sequence of interest will be at least 80%, and more usually preferably with increasing homologies of at least 85%, 90%, 95%, 99%, and 100%.

[0037] Two amino acid sequences are homologous if there is a partial or complete identity between their sequences. For example, an 85% homology means that 85% of the amino acids are identical when the two sequences are aligned for maximum matching. Separations (in any of the two sequences to be matched) are allowed in maximizing the pairings; separation lengths of 5 or less are preferred, separations of 2 or less being more preferred. Alternatively and preferably, two protein sequences (or polypeptide sequences derived therefrom at least 30 amino acids in length) are homologous, as the term is used herein, if they have an alignment score greater than 5 (in standard deviation units) using the ALIGN program with the mutation data matrix and a separation penalty of 6 or higher. See, Dayhoff, M.O., in Atlas of Protein Sequence and Structure, 1972, volume 5, National Biomedical Research Foundation, p. 101-110, and Supplement 2 to this volume, p. 1-10. The two sequences or their parts are preferably more homologous if their amino acids are 50% identical or higher when optimally aligned using the ALIGN program.

[0038] The term "corresponds to" is used herein to indicate that a polynucleotide sequence is homologous (ie, identical, but not strictly related at the evolutionary level) to all or a fraction of a reference polynucleotide sequence , or that a polypeptide sequence is identical to a reference polypeptide sequence. In contrast, the term "complementary to" is used herein to indicate that the complementary sequence is homologous to all or part of a reference polynucleotide sequence. For illustrative purposes, the "TATAC" nucleotide sequence corresponds to a "TATAC" reference sequence and is complementary to a "GTATA" reference sequence.

[0039] The following expressions are used to describe the sequence relationships between two or more polynucleotides: "reference sequence", "comparison window", "sequence identity", "percentage sequence identity", and "substantial identity ". A "reference sequence" is a defined sequence used as the basis for a sequence comparison; a reference sequence may be a subgroup of a larger sequence, for example, as a segment of a cDNA sequence or of a full length gene given in a sequence listing may comprise a cDNA sequence or a complete gene. In general, a reference sequence has a length of at least 20 nucleotides, often a length of at least 25 nucleotides, and usually a length of at least 50 nucleotides. Since each of two polynucleotides (1) may comprise a sequence (i.e., a portion of the complete polynucleotide sequence) that is similar between the two polynucleotides, and (2) additionally may comprise a sequence that is divergent between the two polynucleotides, sequence comparisons are normally carried out between two (or more) polynucleotides by comparing sequences of the two polynucleotides along a "comparison window" to identify and compare local regions of sequence similarity. A "comparison window", as can be used herein, refers to a conceptual segment of at least 20 contiguous nucleotide positions and where the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions ( that is, separations) of 20% or less compared to the reference sequence (which does not include additions or deletions) for optimal alignment of the two sequences. Optimal sequence alignment to align a comparison window can be carried out using the local homology algorithm of Smith and Waterman (1981) Adv. Appl. Math 2: 482, by the homology alignment algorithm of Needleman and Wunsch (1970) J. Mol. Biol. 48: 443, by the search for the similarity method of Pearson and Lipman (1988) Proc. Natl Acad. Sci. (USA) 85: 2444, by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Dr., Madison, WI), or by inspection , and the best alignment is selected (that is, the one that results with the highest homology percentage along the comparison window) generated by the various procedures. The term "sequence identity" means that two polynucleotide sequences are identical (ie, nucleotide by nucleotide) along the comparison window. The term "sequence identity percentage" is calculated by comparing two optimally aligned sequences along the comparison window, determining the number of positions in which identical nucleic acid bases are found (eg, A, T, C, G, U, or I) in both sequences to give the number of paired positions, dividing the number of paired positions by the total number of positions in the comparison window (that is, the size of the window), and multiplying the result per 100 to give the percentage of sequence identity. The terms "substantial identity" as used herein denotes a characteristic of a polynucleotide sequence, wherein the polynucleotide comprises a sequence having a sequence identity of at least 85%, preferably a sequence identity of at least 90 to 95%, more usually a sequence identity of at least 99% compared to a reference sequence along the comparison window of at least 20 nucleotide positions, often along a window of at least 25 -50 nucleotides, where the percentage of sequence identity is calculated by comparing the reference sequence with the polynucleotide sequence that may include deletions or additions that make a total of 20% or less of the reference sequence along the window of comparison. The reference sequence may be a subgroup of a larger sequence.

[0040] As used herein, "substantially pure" means that an object species is the predominant species present (ie, on a molar basis it is more abundant than any other individual species of the composition), and preferably a fraction Substantially purified is a composition where the target species comprises at least about 50% (on a molar basis) of all macromolecular species present. In general, a substantially pure composition will comprise more than about 80% of all macromolecular species present in the composition, more preferably above 85%, 90%, 95%, and about 99%. Most preferably, the target species is purified to essential homogeneity (contaminant species cannot be detected in the composition by conventional detection procedures) where the composition consists essentially of a single macromolecular species.

[0041] Applied to polypeptides, the term "substantial identity" means that two peptide sequences, when optimally aligned, such as by GAP or BESTFIT programs using default separation weights, share a sequence identity of at least 80%, preferably a sequence identity of at least 90%, more preferably a sequence identity of at least 95%, and most preferably a sequence identity of at least 99%. Preferably, the positions of the residues that are not identical differ in conservative amino acid substitutions. Conservative amino acid substitutions refer to the interchangeability of residues that have similar side chains. For example, a group of amino acids with aliphatic side chains is that of glycine, alanine, valine, leucine, and isoleucine; A group of amino acids with aliphatic hydroxyl side chains is that of serine and threonine; a group of amino acids with side chains containing amide is that of asparagine and glutamine; A group of amino acids with aromatic side chains is that of phenylalanine, tyrosine, and tryptophan; A group of amino acids with basic side chains is that of lysine, arginine, and lustidine; and a group of amino acids with sulfur-containing side chains is that of cysteine and methionine. Preferred conservative amino acid substitution groups are that of valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, glutamic-aspartic, and asparagine-glutamine.

[0042] The term "polypeptide fragment" or "peptide fragment" as used herein refers to a polypeptide having an amino-terminal and / or carboxy-terminal deletion, but in which the rest of the sequence of Amino acids are identical to the corresponding positions in the naturally derived sequence derived, for example, from a full length cDNA sequence. The fragments normally have a length of 8-10 amino acids, preferably a length of at least 10-20 amino acids, and even more preferably a length of 20-70 amino acids.

[0043] Other chemical terms herein are used according to conventional use in the art, exemplified by The McGraw-Hill Dictionary of Chemical Terms (ed. Parker. S., 1985). McGraw-Hill San Francisco.

[0044] The production of proteins from genetically cloned genes is well known. See, for example, US Pat. No. 4,761,371 to Bett et al., From column 6 - line 3 to column 9 - line

65. Accordingly, the following description is intended to be a summary of this field, and is not intended to reflect the complete state of the art.

[0045] DNA encoding proteins that can be inserted into the adenoviral constructs of the present invention in the E3 region can be obtained, in view of the present description, by chemical synthesis by selecting reverse transcripts of mRNA from cell cultures or lines. appropriate cells, by selecting genomic libraries from appropriate cells, or by combinations of these procedures, as illustrated below. The selection of mRNA or genomic DNA can be carried out with oligonucleotide probes generated from the information of a known gene sequence. The probes can be labeled with a detectable group such as a fluorescent group, a radioactive atom or a chemiluminescent group according to known procedures and used in conventional hybridization assays, as described in greater detail in the Examples below.

[0046] In an alternative, the gene sequence can be recovered with the use of the polymerase chain reaction (PCR) procedure. See US patents. No. 4,683,195 to Mullis et al., And 4,683,202 to Mullis.

[0047] A vector is a replicable DNA construct. Vectors of preferred embodiments described herein to produce adenovirus E3 mutants are based on the pGEM vector series from Promega Corporation. Vectors are used to amplify the DNA encoding a desired protein and / or to express the DNA encoding the protein. An expression vector is a replicable DNA construct in which a DNA sequence encoding a protein of interest is operably linked to suitable control sequences capable of effecting the expression of the protein in a suitable host. The need for such control sequences will vary depending on the host selected and the transformation procedure chosen. Generally the control sequences include a transcriptional promoter and an optional operator sequence to control transcription, a sequence encoding suitable ribosomal binding sites of mRNA, and sequences that control transcription termination and translation. Amplification vectors do not require domains for expression control. All that is needed is the ability to replicate in a host, normally conferred by an origin of replication, and a selection gene to facilitate the recognition of transformants.

[0048] Vectors useful for practicing the present invention include plasmids, viruses (including phages), and integrable DNA fragments (ie, integrable fragments in the host genome by homologous recombination). The vector replicates and functions independently of the host genome or, in some cases, can be integrated into the genome itself. Suitable vectors will contain replicons and control sequences that come from species compatible with the intended expression host. Transformed host cells are cells that have been transformed or transfected with vectors constructed using recombinant DNA techniques.

[0049] DNA regions are operably linked when they are functionally related to each other. For example, a promoter is operably linked to a coding sequence if it controls the transcription of the sequence; a ribosome binding site is operably linked to a coding sequence if it is positioned so as to allow translation. In general, operably linked means contiguous and in the case of leader sequences, contiguous and in the reading frame. A preferred promoter in those cases where certain DNA from the E3 region has been removed and there is substituted DNA in place is a tissue specific promoter that is operably linked to a negative selection gene.

[0050] Suitable host cells include prokaryotes, yeast cells, or higher eukaryotic cells. Prokaryotes include gram-negative or gram-positive organisms, for example, Escherichia coli (E. coli) or higher bacilli. Eukaryotic cells include established mammalian cell lines as described below. Exemplary host cells are DH5a, E. coli W3110 (ATCC 27,325), E. coli B.,

E. coli X1776 (ATCC 31,537) and E. coli 294 (ATCC 31,446).

[0051] A wide variety of suitable microbial vectors are available, and may have applications in the construction of the present adenoviral vectors. In general, a microbial vector will contain an origin of replication recognized by the intended host, a promoter that will function in the host and a phenotypic selection gene such as a gene that encodes proteins that confer antibiotic resistance or that provide an autotrophic requirement. Similar constructions will be manufactured for other hosts. E. coli is normally transformed using pBR322. See Bolivar et al., Gene 2, 95 (1977). The pBR322 vector contains ampicillin and tetracycline resistance genes and thus provides simple means for the identification of transformed cells. Expression vectors must contain a promoter that is recognized by the host organism. Thus in general it means a promoter obtained from the intended host. Promoters most commonly used in recombinant microbial expression vectors include the beta-lactamase (penicillinase) and lactose (Chang et al., Nature 275.615 (1978): and Goeddel et al., Nucleic Acids Res 8, 4057 (1980) and EPO application with publication number 36.776) and the tac promoter (H. De Boer et al., Proc. Natl. Acad. Sci. USA 80, 21 (1983)). Although these are commonly used, other microbial promoters are also suitable. Details regarding nucleotide sequences of many promoters have been published, allowing an expert person to operably link them in plasmid or viral vectors to DNA (Siebenlist et al., Cell 20. 269. 1980)).

[0052] Cell cultures derived from multicellular organisms are a desirable host for the synthesis of recombinant proteins. In principle, any cell culture of higher eukaryotes is valid, either a culture from vertebrates or invertebrates. However, mammalian cells are preferred. The propagation of these cells in cell cultures has become a routine procedure. See, Tissue Culture, Academic Press, Kruse and Paterson, editors (1973). Examples of useful host cell lines are VERO and HeLa cells, Chinese hamster ovary (CHO) cells, and FL5.12, WI138, BHK, COS-7, CV, and MDCK cell lines. Expression vectors for such cells normally include (if necessary) an origin of replication, a promoter located upstream of the gene to be expressed, together with a ribosome binding site, an alternative RNA processing site (if DNA is used genome containing introns), a polyadenylation site, and a sequence for termination of transcription.

[0053] An origin of replication may be provided in the construction of the vector to include an exogenous origin, so that it can come from SV40 or other viral source (eg, polyoma, adenovirus, VSV, or BPV), or it can be provide through the mechanism of chromosomal replication of the host cell. If the vector is integrated into the host cell chromosome, the latter may be sufficient.

[0054] Sequences for transcription control and translation into expression vectors to be used in transforming vertebrate cells are often provided from viral sources, including adenovirus. A variety of viral and mammalian constitutive promoter elements can be used. See, Mittal et al., (1993) Virus Research, vol. 28, p. 67-90. For example, some commonly used promoters come from polyoma, adenovirus 2, and simian virus 40 (SV40). See, for example, US Pat. No. 4,599,308. Early and late promoters are useful because both are easily obtained from the fragment virus that also contains the SV40 viral origin of replication. See, Fiers et al., Nature 273, 113 (1978).

Construction of adenovirus E3 mutants

[0055] In general, methods for the construction of adenoviral mutants are known in the art. See, Mittal, S. K., Virus Res., 1993, vol: 28, p. 67-90. In addition, the adenovirus 5 genome is registered with the Genbank accession number M73260, and the virus is available in the American Type Culture Collection, Rockville, Maryland, USA, with the access number VR-5.

[0056] In general, the construction of an adenoviral vector involves the initial removal or modification of a desired region of the adenoviral genome, preferably the Ad5 genome, in a plasmid cassette using standard techniques. For example, the Adde NdeI fragment, corresponding to bases 19549-31089, can be cleaved from the Ad5 genome and inserted into an appropriate plasmid, preferably pGEM5zf +, available from Promega Corporation. This plasmid is called pNB, and is described in more detail in the Examples section, below.

[0057] The adenoviral DNA, or one of its fragments present in pNB and corresponding to the E3 region of the virus, is then cloned into another plasmid which can also be pGEM5zf +. For example, the SpeI-NdeI fragment, corresponding to bases 27082-31089, of the Ad5 genome can be cleaved from pNB and cloned between the SpeI and NdeI sites at the multiple cloning site (MCS) of pGEM5zf +. This vector is called pSN, and the adenovirus DNA present therein, bases 27082-31089, can be used to genetically engineer the desired restriction sites in the E3 region to give the appropriate vectors, plasmids and E3 viruses, described. below.

[0058] Some of the materials and procedures used to construct adenovirus mutants have been described by Hanke. T., et al., (1990) Virology. vol. 177. pp. 437-444, and Bett, A. J., et al., (993) J. Virol. vol 67, p. 5911-5921, and in document PCT / CA96 / 00375. Microbix Biosystems. Inc., located at 341 Bering Avenue, Toronto, Ontario, Canada, sells many of the materials used to build adenovirus mutants, and provides product information sheets on how to prepare them.

[0059] It should be noted that although the present invention is described in terms of type 5 adenovirus, it can be practiced with other similar adenovirus serotypes. The general organization of the adenoviral genome is conserved among the different serotypes, and the specific functions are similarly located.

[0060] Mutations in the E3 region described herein can be incorporated into adenoviral mutants that exhibit mutations outside the E3 region. Preferably, said mutations will be in the E1B and / or E1A and / or E4orf6 regions of the adenoviral genome. In the case of E1B mutations, the mutations can confer to the adenovirus the ability to preferentially replicate on neoplastic cells compared to normal cells, where the neoplastic cells are functionally defective in the tumor suppressor, p53. Such mutations normally occur in the E1B region encoding the 55K protein. Defective p53 can appear in numerous ways, including a defect in proteins that interact with p53; that is, a defect in the p53 pathway that makes p53 functionally inactive. See, US Pat. No. 5,677,178. Thus, the E3 mutations described herein could be combined with the elimination of E1B in adenovirus dl1520. This virus has been described by Barker and Berk (1987) Virology 156: 107.

[0061] In the case of E1A mutations, the mutations may confer on the adenovirus the ability to preferentially replicate in neoplastic cells compared to normal cells, where the neoplastic cells are functionally defective in the retinoblastoma tumor suppressor gene product, or p105 Rb . Such inactivating mutations normally occur in the CR1 domain (amino acids 30-85 in Ad5: nucleotide positions 697-790) and / or the CR2 domain (amino acids 120-139 in Ad5: nucleotide positions 920-967) of E1a, which are involved in the binding of the p105 Rb protein. The CR3 domain of the adenoviral genome (amino acids ranging from 150-186) can remain and can be expressed in the form of truncated p289R polypeptide and be functional in the transactivation of early adenovirus genes. Defective Rb can appear in numerous forms, including a defect in the proteins that interact with Rb; that is, a defect in the Rb pathway that makes Rb functionally inactive. See, US Pat. No. 5,677,178. Thus, the E3 mutations described herein could be combined with the removal of E1A in the Ad5 NT dl 1010 adenovirus.

[0062] Another aspect of the present invention is the incorporation of heterologous genes into the E1B, E1A, or E4orf6 regions of an E3 mutant virus described herein. Thus, said viruses would contain heterologous genes in E3, and optionally in E1B, E1A or E4orf6. Examples of such heterologous genes, or their fragments encoding biologically active peptides, include those encoding immunomodulatory proteins, and prodrug activators (i.e., cytosine deaminase, thymidine kinase, U.S. Patent No. 5,358,866, and 5,677. 178). Examples of the latter will include interleukin 2, US Pat. No.

4,738,927 or 5,641,665; interleukin 7, U.S. Pat. No. 4,965,195 or 5,328,988; and interleukin 12, U.S. Pat. No. 5,457,038; tumor necrosis factor alpha, US Pat. No. 4,677,063 or 5,773,582; gamma interferon, U.S. Pat. No. 4,727,138 or 4,762,791; or GM-CSF, U.S. Pat. No. 5,393,870 or 5,391,485. Other additional immunomodulatory proteins include inflammatory macrophage proteins, including MIP-3, (see, Well, TN and Peitsch, MC. J. Leukoc. Biol vol 61 (5): pages 545-50, 1997), and proteins that induce Cellular suicide or apoptosis, including BAD and BAX. See, Yang, E., et al., Cell, vol 80, pages 285-291 (1995): and Sandeep, R., et al., Cell, vol. 91, pages 231-241 (1997).

[0063] As mentioned above, the initial stage in the construction of recombinant adenoviral vectors that have new restriction sites in the E3 region that facilitate partial or total removal of the E3 region, or selected genes contained therein, is for introducing mutations in the adenovirus genome into a plasmid cassette using very established molecular biology techniques, to which this document refers. The following restriction sites were engineered in the E3 region of adenovirus 5: PacI, ClaI, PmeI, SwaI, BamHI, BstBI, Sspl, Nhel, and StuI and EcoRV. Their relative positions in the E3 region are shown in Figures 4-7. Restriction sites were placed so as not to interrupt critical signals of alternative processing and polyadenylation. Another consideration was the protein coding sequence in the E3 region; In most cases, the mutations that were introduced to add the new restriction sites did not produce a change in the coding sequence: however, when changes in the amino acids were introduced, they were conservative in nature. Thus it is important to point out a key advantage of said adenoviruses that have a heterologous gene or genes inserted in the E3 region, which is that said gene (s) will have an expression pattern, both in terms of synchronization and degree of expression, similar to endogenous adenoviral gene (s) it replaces.

[0064] The adenoviral vectors of the present invention can also incorporate a tissue specific promoter into a part of the E3 region that has been removed that will lead to the expression of another gene, preferably a negative selection gene. An example of a tissue specific promoter includes the prostate specific antigen promoter. See document PCT / US95 / 14461. Examples of certain negative selection genes include cytosine deaminase, and thymidine kinase. Regarding cytosine deaminase, see US Pat. No. 5,358,866 and 5,677,178.

[0065] For example, a cassette of the HSV tk gene may be operably linked immediately downstream of an E3 promoter. Typically, it is desirable to remove a non-essential portion (i.e., for viral replication and viral genome encapsulation) to accommodate the negative selection cassette: thus, a substantial portion of the E3 gene region can be removed and replaced with a Negative selection cassette such as the HSV tk gene operably linked to a tissue specific promoter (and enhancer) or other suitable promoter / enhancer. Alternatively, a negative selection gene may be operably linked to a promoter from the late adenovirus region to provide efficient expression of the negative selection gene product in cells expressing a replication phenotype characterized by transcription from promoters of the late gene

[0066] The expression of the HSV tk gene in a cell is not directly toxic to the cell, unless the cell is exposed to a negative selection agent such as ganciclovir or FIAU. Infected cells expressing a replication phenotype where a negative selection gene is substantially expressed can produce essentially no cytotoxicity until the negative selection agent (eg, ganciclovir) is administered in an effective selective dosage, at which time Infected cells expressing the tk gene will be selectively separated; thus the negative selection can be used to increase cytopathic death and / or to cushion a greater viral replication by killing cells that have a replicative phenotype.

[0067] An example is a cassette of the HSV tk gene (Zjilstra et al. (1989) Nature 342: 435: Mansour et al. (1988) Nature 336: 348; Johnson et al. (1989) Science 245 : 1234. Adair et al., (198) Proc. Natl. Acad. Sci (USA)

86: 4574. Capecchi. M. (1989) Science 244: 1288) operably linked to an appropriate promoter and / or enhancer with a polyadenylation site to form a tk expression cassette. The tk expression cassette (or other negative selection expression cassette) is inserted into the adenovirus genome, for example, as a substitute for substantial removal of the E3 region.

[0068] The adenoviral vectors of the present invention encoding a desired protein can be used for the transformation of a suitable mammalian host cell. The transformation can be by any known method for introducing polynucleotides into a host cell, including, for example, encapsulation of the polynucleotide into a virus and transduction into a host cell with the virus or by transfection procedures known in the art, such and as exemplified in U.S. Pat. No. 4,399,216, 4,912,040, 4,740,461, and 4,939,455. The transformation procedure used depends on the host to be transformed. Methods for introducing heterologous polynucleotides into mammalian cells are known in the art and these include dextran-mediated transfection, calcium phosphate precipitation, polybrene-mediated transfection, electroporation, encapsulation of the polynucleotide (s) in liposomes and Direct microinjection of the DNA in the nuclei.

Therapeutic procedures

[0069] The therapeutic treatment of the disease, preferably a neoplastic disease, can be achieved by administering to a patient a composition comprising the adenoviruses of the invention and additionally comprising a negative selection gene. Examples of the latter would include cytosine deaminase, and thymidine kinase.

[0070] Various human neoplasms can be treated with the adenoviral constructs of the invention, particularly in those cases in which the E3 region of the virus encodes a protein useful for gene therapy of the disease. An example would be a cytokine, preferably an interleukin. For example, but not by way of limitation, a human patient or a non-human mammal with bronchogenic carcinoma, nasopharyngeal carcinoma, laryngeal carcinoma, small cell and non-small cell lung carcinoma, pulmonary adenocarcinoma, hepatocarcinoma, pancreatic carcinoma, bladder carcinoma Colon carcinoma, breast carcinoma, cervical carcinoma, ovarian carcinoma, and lymphocytic leukemias can be treated by administering an effective antineoplastic dosage of an appropriate adenovirus. Suspensions of infectious adenoviral particles can be applied to neoplastic tissues by various routes, including intravenous, intraperitoneal, intramuscular, subdermal, and topical. An adenovirus suspension containing between 103 and 1012 virion particles per milliliter approximately or more can be inhaled in the form of a mist (for example, for pulmonary administration to treat bronchogenic carcinoma, small cell lung carcinoma, lung cell carcinoma non-small, pulmonary adenocarcinoma, or laryngeal cancer) or can be applied directly to the tumor site to treat a tumor (for example, bronchogenic carcinoma, nasopharyngeal carcinoma, laryngeal carcinoma, cervical carcinoma) or can be administered by infusion (for example , in the peritoneal cavity to treat ovarian cancer, in the portal vein to treat hepatocarcinoma or liver metastases from other non-hepatic primary tumors) or other suitable routes, including direct injection into a tumor mass (e.g., a tumor of breast), an enema (for example, colon cancer), or a catheter (for example, cancer d and bladder).

[0071] Adenovirus mutants of the invention can also be evaluated for their ability to reduce tumorigenesis or neoplastic cell load in nu / nu mice that harbor a neoplastic cell transplant, compared to untreated mice that house an equivalent transplant. of neoplastic cells.

[0072] Adenoviral therapy using the E3 viruses of the present invention can be combined with other anti-neoplastic protocols, such as conventional chemotherapy. In addition, in the event that the present E3 adenoviral vectors, or viruses, trigger an immune response that dampens its effect on a host animal, they can be administered with an appropriate immunosuppressive drug.

Propagation of the mutant adenovirus

[0073] The adenoviral mutants of the invention normally propagate in the form of virus stock solutions in a cell line (eg, cell line 293 ATCC # CRL 1573, American Type Culture Collection, Rockville, MD; Graham et al., (1977) J. Gen. Virol. 36: 59, or A549 cells) that can provide certain desired viral functions, if necessary, in trans to aid in the replication and formation of infectious mutant virions.

Formulations

[0074] E3 mutants of adenovirus can be formulated for therapeutic and diagnostic administration to a patient. For therapeutic or prophylactic uses, a sterile composition containing a pharmacologically effective dosage of one or more adenovirus species is administered to a human patient or a non-human veterinary patient for the treatment, for example, of a neoplastic condition. In general, the composition will comprise between 103 and 1015 adenoviral particles approximately or greater in an aqueous suspension. In such sterile compositions a pharmaceutically acceptable carrier or excipient is often employed. A variety of aqueous solutions can be used, for example, water, buffered water, 0.4% saline, 0.3% glycine and the like. These solutions are sterile and, in general, free of particulate matter other than the desired adenoviral virions. The compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions, such as pH adjustment agents and buffering agents, toxicity adjustment agents and the like, for example sodium acetate, sodium chloride, potassium chloride. , calcium chloride, sodium lactate, etc. Excipients that improve infection of cells by adenovirus may be included.

[0075] The adenoviruses of the invention, or the DNA contained therein, can be introduced into the neoplastic cells by administration with liposomes or immunoliposomes; such administration can be selectively directed to neoplastic cells based on a property of the cell surface present in the population of neoplastic cells (for example, the presence of a protein on the cell surface that binds to an immunoglobulin in an immunoliposome) . Normally, an aqueous suspension containing the virions is encapsulated in liposomes or immunoliposomes. For example, a suspension of adenovirus virions can be encapsulated in micelles to form immunoliposomes by conventional procedures (U.S. Patent 5,043,164, U.S. Patent 4,957,735, U.S. Patent 4,925,661 ; Connor and Huang (1985) J. Cell Biol. 101: 582; Lasic DD (1992) Nature 355: 279: Novel Drug Delivery (eds. Prescott LF and Nimmo WS: Wiley, New York, 1989); Reddy et al. , (1992) J. Immunol. 148: p. 1585). To direct the virions, or virion DNA to said cells, immunoliposomes comprising an antibody that specifically binds to a cancer cell antigen (eg, CALLA, CEA) present in the individual's cancer cells can be used.

[0076] Compositions containing the present adenoviruses or a cocktail thereof can be administered for prophylactic and / or therapeutic treatments of neoplastic diseases. In a therapeutic application, the compositions are administered to a patient already affected by the particular neoplastic disease, in an amount sufficient to cure or at least partially stop the ailment and its complications. An adequate amount to achieve this is defined as a "therapeutically effective dose" or "effective dose". The effective amounts for this use will depend on the severity of the condition, the general condition of the patient, and the route of administration.

[0077] In prophylactic applications, compositions containing the adenoviruses of the invention, or a cocktail thereof, are administered to a patient who is not currently suffering from a neoplastic disease to improve the patient's resistance to recurrence of a neoplasm or to prolong the remission time. This amount is defined as a "prophylactically effective dose". In this use, the precise amounts again depend on the patient's state of health and his level of general immunity.

[0078] Single or multiple administrations of the compositions can be carried out with dosage levels and profiles that are selected by the attending physician. In any case, pharmaceutical formulations must provide an amount of anti-neoplastic adenovirus of this invention sufficient to effectively treat the patient.

[0079] The anti-neoplastic adenoviral therapy of the present invention can be combined with other anti-neoplastic protocols, such as conventional chemotherapy.

Uses of the invention

[0080] Based on the above description, it will be apparent that the adenoviral viruses / vectors described herein have multiple uses, including applications in gene therapy. For example, in one embodiment of the invention, a gene encoding a medically useful protein in the E3 region of the virions of the present invention can be cloned, and the virions can be used directly in gene therapy protocols to treat disease. In another embodiment of the invention, described above, said mutant virions in E3 also have deletions in the E1B region and therefore have a gene substituted with desirable properties. In any of the E3 or E1B regions such genes could encode cytokines, including interleukins, cell cycle regulatory proteins, including p16, or ras, or proteins that induce cell suicide, or apoptosis, prodrug activators, including cytosine deaminase or thymidine kinase. In addition, tumor necrosis factor alpha, interferon gamma, and mip-3 can be used.

[0081] The present adenoviral vectors can also be used to express proteins that are useful immunogens, or as a vaccine, and to transform cells that normally do not express a particular protein to subsequently express this protein. The cells expressing these molecules are useful as intermediates for the preparation of cell membrane preparations useful for binding assays, which in turn are useful for drug selection.

[0082] The following Examples are illustrative of specific embodiments of the invention, and their various uses. They are set forth for explanatory purposes only, and should not be taken as a limitation of the invention.

Example 1

General procedures and work vectors

[0083] Methods for the construction and propagation of human adenoviral vectors are known in the art and it is understood that they will be applied in the Example presented below by the person skilled in the art. This will include the work of Hitt, M., et al., Construction and propagation of human adenovirus vectors. In: Cell Biology: a Laboratory Handbook; J. Cells (Ed), Academic Press, N. Y. (1996); Graham, F. L. and Prevec, L. Adenovirus based expression vectors and recombinant vaccines. In: Vaccines: New Approaches to Immunological Problems. R. W. Ellis (ed) Butterworth. Pp. 363-390; and Graham, F. L. and Prevec, L. Manipulation of adenovirus vectors. In: Methods in Molecular Biology, Vol. 7: Gene Transfer and Expression Techniques. E. J. Murray and J. M. Walker

5 (eds) Humana Press Inc., Clifton, N. J. p. 109-128, 1991. The materials and procedures described in these articles were used below.

Adenoviral vectors:

[0084] Vectors based on pGEM (Promega Corp.) were modified and used to clone, subclone, and generate mutations in the appropriate E3 region of Ad5. For this purpose, the existing restriction sites in the E3 region were used, which are shown in Table 1. Table 1

Restriction sites present in Ad5

NdeI

19549 and 31089

SpeI

 27082

EcoRI

27295 and 30049

SunI

 28390

EcoRV

 27295

KpnI

 28787

Muni

29355

NotI

29510

XhoI

 29791

HpaI

 30569

[0085] The vector named pNB was prepared by inserting the NdeI fragment of Ad5, bases 19549 to 31089, into the NdeI site of pGEM5Zf + (Promega Corp.). This was subsequently subcloned by inserting the SpeI fragment (27082) to NdeI (31089) of Ad5 at the SpeI and NdeI sites of the multiple cloning site (MCS) in pGEM5Zf; This plasmid was called pSN. The pNB vector was created for the convenience of virus construction; the NdeI fragment of Ad5 can be isolated and ligated to the TP-DNA of Ad5 cut with NdeI. This can then be used to

Transfect cells as shown in Figure 2. This construct is also comfortable for virus construction using homologous recombination, since the overlapping area is extensive, as depicted in Figure 3. Plasmid pSN was created because It contains the E3 region to be manipulated and since it is smaller than pNB and thus limits the variety of restriction sites.

[0086] In the case of pSN, the pGEM5 vector was further modified because it has 3 SspI sites (2199, 2384, 2408); SspI is one of the sites engineered by genetic engineering in the shuttle vector of E3. With the removal of the SspI sites from the vector, the insertion of genes into the SspI site of E3 is facilitated since it does not imply partial restriction digestions. To eliminate vector sites, plasmid pGEM5 was cut with SspI and EcoRV (present in the MCS at base 51) and ligated again. Unfortunately, the SspI site in 2199 is not

30 removed satisfactorily and was found in the resulting altered vectors. Thus, the resulting vector contains the removal of SspI in 2384 to EcoRV in 51. The presence of this extra SspI site still requires partial restriction digestion when using SspI in the E3 region, although isolation of the correct fragment was simplified with the Elimination of two of these sites. Note also that there is an SspI site in the E3 region in 30172; it resides in the same region that would be split when the SspI site modified by genetic engineering is to be used. This

35 form, does not affect the pattern of digestion, and has no consequences. This altered pGEM vector was used as a vector to insert the SpeI to NdeI region of Ad5, and for subsequent manipulations in the E3 regions and is indicated by pG.

Example 2

40

E3 shuttle vector construction

[0087] Using the above vectors, the following restriction sites in the E3 region of adenovirus 5 were genetically engineered: PacI, ClaI, PmeI, SwaI, BamHI, BstBI, SspI, NheI, and StuI and EcoRV. Its 45 relative positions in the E3 region are shown in Figure 7. The restriction sites were carefully positioned so as not to consciously interrupt critical signals of alternative processing and polyadenylation (see, Figure 1). The protein coding sequence was also considered: in most cases, the amino acid

It was not modified, and when changes had to be made, they were conservative. After the construction of the virus with these alterations, the alternative processing and levels and functions of the proteins were compared against the wild-type Ad5 to confirm the functionality of the E3 genes in the shuttle vector.

[0088] Due to the position of sites engineered by genetic engineering, some mutations had to be performed sequentially. All oligonucleotide sequences used for mutagenesis and exact location (position number in Ad5) are listed in the tables. All mutations were confirmed by restriction digestions and all constructs were sequenced. Table 2 summarizes the sites of

10 restrictions that were added to the E3 region of adenovirus 5.

Table 2

Restriction sites added to E3 of Ad5. The numbers refer to the genome of Ad5

PacI

28497

NheI

 28532

PmeI

29310

BstBI

29484

StuI

29718

EcoRV *

 29781

Clai

 29862

SspI

30377

BamHI **

 30467

SwaI

 30830

* The initiation codon for 10.4K was altered with this mutation ** The initiation codon for 14.7K was altered with this mutation

[0089] The PacI and ClaI sites were generated simultaneously using the mutant oligonucleotide PacC + PacNC and ClaC + ClaNC, respectively, using the Transformer Site-Directed Mutagenesis kit (Clonetech # K1600-1) according to the manufacturer's guidelines. The PmeI and SwaI sites were built separately using PmeC + PmeNC and SwaC

+ SwaNC, respectively, using the QuickChange Sitc-Directed Mutagenesis kit (Stratagene # 200518) exactly following the manufacturer's instructions. The Pmel site was cloned into the plasmid containing PacI / ClaI by inserting

20 the KpnI-XhoI fragment containing Pmel (natural Ad5 sites) in this plasmid. To this construct, the SwaI site was inserted using the HpaI fragment to NdeI. This resulting construct was called pG-PPCS and was used for the next round of mutagenesis.

BamHI

[0090] All of the following mutations were created by PCR-based mutagenesis (see, Nucleic Acids Research 17: 5404; 1989, and U.S. Patent Nos. 4,683,195 to Mullis et al., And 4,683,202 to Mullis ) using Pfu polymerase, a high fidelity enzyme (Stratagene) and all fragments generated by PCR were subsequently sequenced and determined to be error free. This procedure uses two

30 sequential PCR reactions and then excision of the final product for insertion into the desired plasmid.

[0091] The BamHI site was generated with the BamC and SwaNC oligonucleotides in the first PCR and this product with PmeC in the second PCR, using the plasmid pG-PPCS described above as a template. This fragment

35 (the product of the second PCR) was digested with PmeI and SwaI to insert it into pG-PPCS and this was called pG-PPCS + B. It should be noted that this mutation also changes the 14.7K initiation codon to prevent premature initiation of any gene inserted into this site and that only two of the final four versions of the E3 shuttle vectors present the BamHI site.

40 BstBI, NheI, and StuI

[0092] The BstBI site was created using BstBC and SwaNC in the first PCR and PmeC plus the first product in the second PCR. The mold used was pG-PPCS. The product of the second PCR was digested with MunI and SwaI and inserted into pG-PPCS, resulting in pG-PPBCS. To prepare a version of this vector that contained the site

BamHI, the ClaI fragment was inserted into HpaI with this site to prepare pG-PPBCS + B.

[0093] The NheI site was made with NheC and PmeNC in the first PCR and SunC and the first product in the second PCR, using pG-PPBCS +/- B as templates in separate reactions. This fragment was digested with PacI and PmeI and 5 was inserted into the two versions of the constructs described above, pG-PPBCS +/- B. This construction was called pG-PNPBCS +/- B. The StuI site was added using StuC and SwaNC in the first reaction and PmeC and the first product in the second reaction, with pG-PPBCS +/- B as templates. The fragment was digested with MunI and SwaI and inserted into the two versions of the plasmid described in the previous paragraph (- or + BamHI) and these were called pG-PPBSCS or pG-PPBSCS + B, respectively. The new StuI and NheI sites were added together digesting with the

10 two plasmids with PacI and PmeI and inserting the fragment containing the NheI site (from pG-PNPBCS) into the plasmid containing Stul (pG-PPBSCS). This was carried out in plasmids that had or did not have the BamHI site and the resulting plasmids were designated pG-PNPBSCS + B and pG-PNPBSCS, respectively.

SspI and EcoRV

[0094] The last two mutations were made using the two plasmids described above, pG-PNPBSCS and pG-PNPBSCS + B as a template. The SspI site was created with primers SspC and HpaNC in the first PCR and NheC and the product of the first PCR in the second PCR. This fragment was digested with XhoI and HpaI to insert it into the parental plasmid, with or without the BamHI site. The EcoRV site was prepared using primers

20 EcoRVC and HpaNC in the first PCR and NheC and the first product in the second PCR. This fragment was cut with XhoI and HpaI to insert it into the plasmids described in the previous paragraph. The SspI and EcoRV sites were added together by cutting the two plasmids that contained BamHI or that did not contain BamHI with PmeI and CIaI and inserting the EcoRV-containing fragment into the parental plasmids. Note that the EcoRV site also modifies the initiation codon for 10.4K to prevent premature initiation of genes inserted into the ClaI site at its 5 'end. He

The ClaI site will be used, instead of the EcoRV site, for gene insertion since the region with the EcoRV site is also involved in alternative processing. The elimination of this region could interrupt this event.

[0095] These final versions of the E3 shuttle vectors are represented in Figs. 4 to 7. These

30 are called pE3SV, pE3SV + V, pE3SV + B, and pE3SV + V + B, the differences being the presence or absence of the EcoRV and BamHI sites. These shuttle vectors are used for the construction of all subsequent plasmids, either for the insertion of exogenous genes or the removal of the E3 genes from Ad5.

[0096] The oligonucleotides that were used to generate mutations in the desired E3 region are shown in Table 3.

Table 3

Sequence of oligonucleotides used to generate mutations in the E3 region of Adenovirus 5:

Sunc

 CCTCTCCGAGCTCAGCTACTCCATCAG

Pacc

GGAGGTGAGCTTAATTAACCCTTAGGG

PacNC

 CCCTAAGGGTTAATTAAGCTCACCTCC

CD2-NdeC

GCTGCAAGTGCTGCACATGGGGCTGCATG

Eco RVC

GATTAAATGAGATATCATTCCTCGAG

HpaNC

GGCGGTGTCCGGTGGTATTACTGTCG

NheC

G GGTATTAGGCCAAAGGCGCAGCTAGCGTGGGG

StuC

CC CAAACAATGAAGGCCTCCATAGATTGG

Sspc

CAGCTACTTTAATATTACAGGAGGAG

Bstbc

GCGACCCACCCTTTCGAACAGAGATGACCAAC

BamC

GGAGACGACTGACACCCTGGATCCAGAAATGG

ClaC

 C ACATCGATGTAGACTGC

ClaNC

 G CAGTCTACATCGATGTG

PmeC

T AGAATAGGGTTTAAACCCCCCGG

PmeNC

CCGGGGGGTTTAAACCCTATTCTA

Swac

CTCAAAGATCTTATTCCATTTAAATAATAAA

SwaNC

W TATTATTTAAATGGAATAAGATCTTTGAG

CD-PacC

GTGAGCTTAATTAAGGCTAGCAATGTCGAATAACGC

CD-SwaNC

GTGAGCATTTAAATCAGTCGTTCAACGTTTGTAATC

All sequences are written in the 5 'to 3' direction. All modified bases are underlined. The inserted bases are in bold.

Examples

Virus and control construction

[0097] The final stage was to insert these altered E3 regions into the pNB plasmids for virus construction. To achieve this, plasmids pG-PPCS and pNB were cut with SpeI. Plasmid pNB has two SpeI sites: one in the Ad5 insert and one in the MCS of pGEM5. The fragment from pNB containing a fraction of the MCS and NdeI 19549 to SpeI 27082 was inserted into the plasmid pG-PPCS cut with SpeI. The orientation was confirmed to be correct, and the resulting plasmid was called pNB-PPCS. All final versions of the E3 shuttle vectors were cloned into this plasmid by inserting the PacI to SwaI region of the smaller plasmids into the larger pNB-PPCS. The resulting plasmids are called pNB-E3SV, pNB-E3SV + V, pNB-E3SV + B, and pNB-E3SV + V + B. As shown in Figure 2, these plasmids were then used to produce the corresponding adenoviruses called E3SV, E3SV + V, E3SV + B, and E3SV + V + B.

[0098] It should be noted that there are three different site groups that can be used to insert genes in the 6.7-gp 19K region. These are PacI and PmeI, SunI and MunI, and NheI and PmeI. The PacI site overlaps with the leader sequence and, an important sequence for the translation of late gene products. The interruption of this sequence can cancel its effect for certain applications. Therefore, another Nhel site was inserted that does not overlap with the leader sequence and. If no adverse effects are observed, then the SunI to MunI sites, naturally present in Ad5, may be useful since they allow greater cloning capacity

Construction of empty controls

[0099] For controls, each of the E3 genes was removed using genetically engineered sites. To do this, the shuttle plasmids were cut with the following enzyme pairs, filled in using T4 DNA polymerase, and ligated again: PacI and PmeI, SunI and MunI, Nhel and PmeI, BstBI and StuI (all in pG-E3SV), ClaI and SwaI (in pG-E3SV + V), ClaI and SspI (in pG-E3SV + V), and BamHI and SwaI (in pG-E3SV + B). All these were put in the pNB vector for virus construction.

Example 4 Construction of CD Plasmids

[0100] To test the shuttle vector system for therapeutic use, the E. coli cytosine deaminase (CD) gene was used due to its prodrug capabilities. The CD was obtained in the ATCC (# 40999, plasmid pCD2) and the CD gene was amplified from this plasmid in the following manner. It should also be noted that the CD gene contains an Ndel restriction site; and because we tried to use this particular enzyme to cut the NdeI sites (the NdeI sites of Ad5 19549 and 31089) that would be present in the final plasmids, it was necessary to remove the NdeI site in the CD gene by PCR mutagenesis. This technique is the same as that used to genetically manipulate the new restriction sites in the E3 region, using high fidelity Pfu polymerase. Tables 3 and 4 show the oligonucleotides used to amplify the CD gene.

[0101] In summary, a conservative mutation was introduced at the NdeI site, changing the T base to a C. The primers for the first PCR reaction were CD-NdeC and SwaCDNC. Plasmid pCD2 was used as a template. This product, together with the same template and the CD-PacC primer, were used for the second PCR reaction. This met two objectives: it altered the Ndel site and added the PacI and SwaI restriction sites to the 5 'and 3' ends, respectively. This final PCR product was cut with PacI and SwaI: the shuttle vector, E3SV was also digested with PacI and SwaI. The fragments were gel purified using the Qiagen gel extraction kit and then ligated together using the NEB T4 DNA ligase. E. coli strain XL- was transformed with the ligation mixture, grown on plates containing ampicillin for selection, and colonies were selected and cultured. The DNA was isolated and then selected by restriction digestion to verify that the insertion and removal had been correct. The clones that appeared correct were then sequenced along the entire CD gene and the surrounding vector to verify that no unwanted mutations had taken place. This correct and verified clone was called pG-CDPacSwa and was used in subsequent PCR amplifications where the CD gene was amplified for insertion into other regions. Note that the CD gene contains a bacterial initiation codon, GTG. In the 5 primers, the initiation codon was included and changed to the eukaryotic codon, ATG.

[0102] The other vectors containing the CD were created by designing the appropriate primers that possess the desired restriction site at the 5 'or 3' end of the gene; the 5 'primer always contains the ATG initiation codon. The CD gene was inserted into the E3 regions using the following restriction sites: BstBI to StuI, NheI to MunI, NheI to Pmel, PacI to PmeI, SunI to MunI, ClaI to SwaI, and BamHI to SwaI. Plasmids were named: pG-CDBstStu, pG-CDNheMun, pG-CDNhePme, pG-CDPacPme, pG-CDSunMun, pG-CDClaSwa, pG-CDBamSwa, respectively. All the plasmids used are listed in Table 3 and the template was always the plasmid pG-CDPacSwa confirmed. The CD gene in the ClaI to SwaI region was inserted into plasmid E3SV + V; the CD gene in the BamHI to SwaI region was inserted into plasmid E3SV + B. All insertions were completely sequenced to ensure that unwanted mutations had not taken place and that the CD gene had been inserted correctly.

[0103] To allow virus construction, the pG-CDClaSwa, pG-CDPacSwa, and pG-CDBamSwa constructs were digested with PacI and SwaI and the fragment containing the CD gene was gel purified. At the same time, the pNB-E3SV vector was also cut with PacI and SwaI and gel purified. They were ligated, the bacteria were transformed, and the colonies were selected for future virus construction.

[0104] Several virus points are predicted as a result of previous E3 insertions. First, the construction that eliminates portions of the leader sequence and, as in pG-CDSunMun, can cause an adverse effect during the course of infection, as described above. This may also be true for genes inserted into the PacI site, although less has been removed from the leader and sequence. Another prediction is that inserts in the 11.6K region, as in pG-CDBstStu, can result in a greatly attenuated infection. As published, the removal of 11.6K protein (ADP or adenovirus death protein) does not allow infected cells to lysate at the right time, compared to infection by the wild type. In this case the cell continues with the metabolism, the viral production per cell is high, and the cell basically becomes a factory for the exogenous gene. In addition, since ADP is synthesized in large quantities using the main late promoter during the late phase of infection, the exogenous gene inserted into the region is expected to have the same expression characteristics. The results obtained with these viruses will be described below.

Example 5

TNF Plasmid Construction

[0105] The plasmid containing the murine tumor necrosis factor (mTNF) was obtained in the ATCC (# 63169). This sequence contains the complete mTNF gene that includes the coding region of the prosequence. The mTNF gene was amplified from this plasmid by PCR and gel purified. The pGE3SV vector was cut with BstBI and StuI and gel purified. At the same time, another vector, pG-E3SV + V was cut with ClaI and SwaI and gel purified. The purified PCR product was inserted into each of these vectors, made possible by the compatible ends. These constructs were called pG-mTNFBstStu and pG-mTNFClaSwa, respectively.

[0106] Using the ATCC plasmid as a template once again, the mTNF gene was amplified by PCR. Plasmid pG-E3SV + B and the PCR product were cut with BamHI and SwaI, gel purified, and ligated together. This construction is called pG-mTNFBamSwa. All constructs were sequenced extensively in search of unwanted mutations.

Example 6

CD and TNF virus construction

[0107] To introduce the above constructs in the Ad5 genome, BstLink TP-DNA was used since it offers the advantages described previously. The construction of the plasmid is described in Example 8. Virus construction was prepared exactly as described for these recombinant viruses, using the wild-type Ad5 TP-DNA. Note that all transfections were carried out in 6 cm plates and in duplicate; The quantities described herein are for each 6 cm plate.

[0108] Procedures: E3-CD-PacPme (Onyx 301), E3-CD-NhePmc (Onyx 302), E3-CDSunMun (Onyx 303), E3-CD-NheMun (Onyx 304), E3-CD-BstStu (Onyx 305), and E3-mTNF-BstStu (Onyx 320) were prepared as follows: first, 0.5 µg of BstLink TP-DNA and 10 µg of plasmid were cut with EcoRI (20 units) at 37 ° C for 5 hours (excess plasmid DNA was used to allow approximately 5 µg of the actual DNA insert by transfection). At this point, the TP-DNA was allowed to digest at room temperature overnight while the cut plasmids were run on a 1% agarose gel overnight. The inserts were gel purified using the Qiagen gel extraction kit. Ligation reactions consisted of the cut TPDNA and the fragments purified with 10 units of high concentration T4 DNA ligase (Boehringer Mannheim) overnight at 16 ° C. This reaction mixture was used directly for transfection.

[0109] For the construction of the CDPacSwa, mTNFClaSwa, CDBamSwa, mTNFBamSwa viruses, a different method, homologous recombination, was used because these mutations in the E3 region are outside the EcoRI restriction sites. The amounts of DNA and TP-DNA are the same as before. The BstLink TPDNA was cut with BstBI for transfection. Plasmids containing CD were cut with SpeI and Ndel and plasmids containing mTNF were cut with PacI and NdeI. The fragments were gel purified and eluted in water. For transfections, TP-DNA and isolated fragments were used without any additional manipulation.

[0110] Transfection procedures: For transfections, A549 cells were seeded on 6 cm plates the previous day so that they had reached a confluence of approximately 70 to 80% on the day of transfection. To transfect these cells, two solutions were prepared and then mixed. Solution A contained the ligation mixture and 300 µl of OptiMEM (Life Technologies) for each 6 cm plate. Solution B contained 300 µl of OptiMEM and 13 µl of Lipofectamine (Life Technologies). These two solutions were added together, mixed gently, and allowed to incubate at room temperature for 30 to 45 minutes. Near the end of this incubation period, the cells were washed with hot OptiMEM and 2.4 ml of OptiMEM was added to each of the mixtures. This final 3 ml mixture was added directly to the washed cell monolayer and incubated at 37 ° C for 5 hours. Next, 3 ml of DME containing 20% FBS was added to each of the plates without removing the transfection mixture, bringing the final serum concentration to 10%. This was allowed to incubate at 37 ° C overnight. The cells were covered with an 8 ml layer of DME / 2% FBS / 1.0% Noble agar (Difco). Five days after covering with this layer, another layer (5 ml) was added that also contained 0.3% neutral red (Life Technologies) to help visualize the plates.

[0111] Propagation and confirmation of viral mutants: as the plates appeared (10 to 20 days after transfection), they were isolated as agar plugs using a sterile Pasteur pipette. To propagate the viruses present in the agar plugs, 3.5 cm plates were seeded with A549 cells in 10% DME / FBS the day before. On the day of infection, the medium was replaced with 2% DME / FBS and the isolated plates were added to the cells. Infections were checked daily for CPE (cytopathic effect, where cells become rounded and detach from plaque as a result of viral infection), which normally occurred 3 to 5 days after infection. All medium and cells were collected and stored at -20 ° C. To verify the mutation of the virus, 200 µl of the mixture of cells and medium was used to isolate the viral DNA (together with cellular DNA) using the Qiagen Blood kit. This purified DNA was verified by PCR using primers that corresponded with the CD gene itself or the flanking E3 region. Once the PCR of the recombinant virus DNA had been shown to produce a fragment with the correct size, the additional characterization included the cutting of the PCR fragments with restriction enzymes for unique patterns of CD or mTNF and also sequencing of the PCR product. In addition, to confirm that the correct virus was obtained, a Hirt analysis was carried out.

[0112] The correct viruses were expanded by infecting a T150 of A549 cells with 500 µl of the CPE obtained from the 3.5 cm plate. This was allowed to continue until a complete CPE (when more than 75% of the cells are no longer attached to the surface of the bottle), which occurred in approximately 3 days. 7.5 ml of this mixture of cells and medium were then used to infect a 3 liter rotating flask of KB cells and the bands were developed with CeCl. Tests were carried out with the plates to determine the infectious particles per unit volume.

[0113] At this point the viruses were named in such a way that it was obvious to identify which insert had been added and where the insert had been placed. Numbers were also assigned to each virus to facilitate references and appear in parentheses. Their names are E3-CD-PacPme (Onyx 301), E3-CDNhePme (Onyx 302), E3-CD-SunMun (Onyx 303), E3-CD-NheMun (Onyx 304), E3-CDBstStu (Onyx 305), and E3-mTNF-BstStu (Onyx 320).

[0114] CD test: To test the activity of cytosine deaminase (CD), the reaction was carried out in a manner similar to that described in Rogulski et al., 1997. Summarizing, cells were seeded

A549 in 10 cm plates so that they would have reached a confluence of 70 to 80% on the day of infection (approximately 2 to 4 million cells per plate). The cells were infected at an MOI (multiplicity of infection) of 10 pfu (plaque forming units) per cell for each of the E3-CD viruses. Ad5 and infected simulated as controls were included. For infection, the appropriate virus volume was suspended in 2 ml of 5 DME per 10 cm plate and then added to the cell monolayer. After one hour, 8 ml of 2% DME / FBS medium was added to each plate. At various times after infection (4, 8, 12, 24, 36, 48, 60, 72, 84, 96, 120 hours), the cells were rinsed, 1 ml of cold PBS was added, the cells were scratched ( using disposable cell scrapers) and settled in 1.5 ml Eppendorf tubes. All PBS was removed and the cell pellets quickly frozen in dry ice / ethanol and stored at -80 ° C. 200 10 µl of assay buffer (100 mM Tris / HCl (pH 8.0), 1 mM EDTA, 1 mM beta-mercaptoethanol) was added to each sediment and the cells were lysed with 4 freeze / thaw cycles. The lysates were clarified by centrifugation at maximum speed for 5 minutes at 4 ° C. The amount of protein was determined with a Bradford assay using Bio-Rad reagents. For the enzymatic assay, 5 µg or 0.6 µg of protein from each sample was used, along with 2.5 mM [2-14C] -cytosine (1 microCurie; 5 µl; Moravek Biochemicals, # MC131) and buffer test 15 to bring the reaction volume to 10 µl. The reaction was allowed to continue for one hour at 37 ° C. To quench the reaction, 10 µl of cold cytosine / uracil (0.4 mg / ml each) was added. 10 µl of each sample was applied on a thin layer chromatography plate (Baker # 7009-04) and then placed in a tank balanced with 1-butanol-water (86% / 14%). After allowing the solvent front to approach the top of the plate (approximately 2 hours), the plate was allowed to dry and then exposed to a film. This autoradiogram was passed through a scanner for the Figures. Assay of murine TNF-a: A549 cells were cultured in 6 cm plates so that they had reached a confluence of approximately 80% by the time of infection. The infection was carried out as described above at an MOI of 10. At various times the medium was removed and replaced with 3 ml of 2% DME / FBS. This was incubated at 37 ° C for 1 hour. After that period, an aliquot of the 1 ml medium was removed and stored frozen at -80 ° C until all samples were collected. The medium of each of the plates was replaced so that the final volume was 4 ml to the next time point. The mTNF that had been secreted to the medium was tested with an ELISA (Biosource # KMC3012). Each sample was determined in duplicate and each time point was collected from two different plates of infected cells. Western blot analysis: For Western blot analysis, A549 cells were infected in a 6 cm plate at an MOI of 10. At various 30 times after infection, the cells were scratched and collected as described. previously. The cell pellet was stored at -80 ° C. 300 µl of lysis buffer was added to each sample, frozen / thawed 3 times, and passed through a 22 gauge needle. A Bradford test was carried out to determine the amount of protein. 10 µg of total protein was loaded onto a 14% SDS gel and subjected to electrophoresis. The proteins were transferred to a PVDF transfer membrane blocked with

3% dry milk in PBS, and treated with the appropriate antibody. The antibodies for E3 proteins and for pVIII (a protein made during the last moments of infection) were rabbit polyclonal antibodies. They were used at a ratio of 1: 400. The antibody for murine TNF was obtained from R and D Systems and was used at 0.1 µg per ml. Appropriate secondary antibodies were used and then visualized using the ECL system (Amersham).

[0115] In addition to the Western blot analysis of cell lysates, the medium collected at one hour intervals was analyzed by Western blot using the same antibody against mTNF and 25 µl of lane-loaded media. Table 4: Oligonucleotides used to amplify the CD gene.

Paccd

GTGAGCTTAATTAAGGCTAGCAATGTCGAATAACGC

PmeCD

GTGAGCGTTTAAACAGTCGTTCAACGTTTGTAATCG

NheCD

 GGCCGCTAGCGGCTAACAATGTCGAATAACGC

SunCD

GTGAGCCGTACGAGGCTAGCAATGTCGAATAACGC

MunCD

 GTGAGCCAATTGCAGTCGTTCAACGTTTGTAATCG

BstBICD

GCGCTTCGAAGTGGAGGCTAACAATGTCGAATA

StuICD

GGCCAGGCCTCTAAGCTCGCTGTAACCCAGTCG

[0116] All sequences are written in the 5 'to 3' direction. All modified bases are underlined. The inserted bases are in bold.

[0117] Example 7

Viral expression of CD or mTNF

[0118] Viruses containing CD: E3-CD-PacPme (Onyx 301), E3-CD-NhePme (Onyx 302), E3-CDSunMun (Onyx 303), E3-CD-NheMun (Onyx 304), also called 301 , 302, 303, and 304, respectively. The A549 cell line was infected with each virus 301, 302, 303, and 304 at a high MOI (multiplicity of infection). At designated post-infection times (p.i.), samples were collected as described in the procedures section for testing CD activity. In addition, at each time point, a photograph of the cells was taken to show phenotypic differences.

[0119] Figure 8 shows control infected cells simulated and infected with Ad5, and Figure 9 shows cells infected with viruses that have CD inserted in the gp19K region, that is, 301, 302, 303 viruses, and

304. Infection with the wild type occurs normally and shows an almost total CPE at 48 hours after infection. Virus 304 shows CPE levels close to the wild type at 48 h p.i., while virus 303 shows a slightly attenuated infection. The other two viruses, 301 and 302, show an intermediate phenotype. Interestingly, 303 is the replacement of the CD using the SunI site and as predicted, the infection is slower than in the wild type probably due to the removal of part of the leader sequence and, canceling its addition to late messages and probably reducing its translation efficiency. Viruses 301 and 302 are only slightly behind Ad5 since most, in the case of 301, or the entire leader sequence and, in the case of 302, are intact.

[0120] Experiments demonstrate that the expression time of heterologous genes inserted into the viral E3 constructs of the present invention is similar to the endogenous viral genes they replace. Viruses 301, 302, 303, and 304 are substitutions of gp19K. As shown in Fig. 10, the synthesis of gp19K begins between 4 and 8 hours after infection, using Western blot analysis. This is similar to published values. It is evident at 48 hours p.i. by Western blot analysis. In addition, Figure 10 shows that CD viruses do not manufacture gp19K, as predicted since the gene has been deleted.

[0121] To see if the synchronization of the expression of the CD synthesis is similar to the synthesis of gp19K, the CD protein was analyzed with a functional assay. The CD assay was prepared as described in the previous section. Although the protein is extremely stable, the assay is not as sensitive as a Western blot. For that reason, two different assays were used to observe CD activity using two different amounts of protein in each reaction. To check when the CD is first expressed, 5 µg of total protein was used per reaction. The results are shown in Fig. 11. As in the case of gp19K, CD activity is observed for the first time 8 h p.i. in viruses 301 to 304. This validates that the endogenous expression time is similar to that of the inserted CD gene.

[0122] To get an idea of the amount of CD protein that is synthesized in each position, 0.6 µg was used for each reaction and the results are shown in Fig. 12. A smaller amount of protein was used with the In order to observe the incomplete conversion of the substrate, to compare between viruses. Fig. 12 shows that viruses 301, 302, and 304 synthesize similar amounts of CD. On the other hand, virus 303 shows a total conversion of the substrate at approximately 24 hours, indicating that proportionally more CD is present. Therefore, we conclude that this virus probably makes more CD than the others.

[0123] ADP substitutions: CD and mTNF: The adenovirus E3 death protein (ADP) gene was replaced by CD or mTNF, as described above. It is known that viruses with the ADP removed do not lyse the cells at the expected time compared to the wild type. Thus, the gene is thought to be important for the release of the virus. As in the case of viruses with the elimination of ADP, viruses of the invention that replace other genes in this region have a similar phenotype. This is shown in Fig. 13 and Fig. 14. At 72 h p.i. when the wild type infection shows a total CPE, virus 305 (insertion of the CD) and virus 320 (insertion of mTNF) have a significant CPE. The infection does not reach a total CPE until 96 h p.i. (Fig. 14). If the medium is changed every 24 hours, the cells remain attached and have an almost normal phenotype even at 120 h p.i. It is not until after 164 h p.i. (7 days) that the cells appear to show a classic CPE and detach from the plaque. This is a key observation and will be useful in a therapeutic sense since even if the infected cells do not lyse immediately, they will still express the heterologous gene of interest.

[0124] ADP is a late protein synthesized from the main late promoter and expressed at elevated levels during the late phase, that is, after DNA replication. To determine whether inserted exogenous genes have similar kinetics, an assay with the CD on virus 305 was carried out, and an analysis for the mTNF on virus 320 was carried out. As shown in Fig. 11, the virus 305 does not have a substantial CD activity up to 12 pi hours, after which time the virus has entered the late phase. In Fig. 11 the comparison with CD in the gp 19K region, an early region, is also contrasted. There is clearly a difference in synchronization with which the protein is synthesized.

[0125] To compare the amount of CD activity, a CD assay was performed using 0.6 µg of total protein. After visual inspection and comparison with Fig. 12 (the experiments were carried out at the same time), it seems that virus 305 does not synthesize as much as 301-304. But it should be noted that cells infected with 305 have a progression of attenuated infection.

[0126] As verification for the late phase of infection, Western blot analysis was performed on cell lysates and conjugated with an antibody to a late structural protein, pVIII and for ADP (11.6K). The expression of both 11.6K and pVIII is observed in infections with Ad5 and 320 at 24 h p.i., which indicates that the virus has entered the late phase between 12 and 24 h. It is also observed that virus 305 does not manufacture ADP, as one would expect since it does not contain the gene.

[0127] The inserted CD instead of ADP has an expression time similar to ADP. A similar observation was made with Onyx 320, which has the mTNF inserted instead of the ADP. In short, the cells were infected and lysates were produced at different times p.i. Western blot analysis was performed on these lysates, using both simulated infected cells and Ad5 infected cells as controls. It was shown that intracellular mTNF expression is not observed until 24 hours p.i. This is consistent with our previous findings that exogenous genes that replace endogenous adenoviral genes have similar expression patterns.

Example 8

Construction of the BstLink / TP-DNA virus

[0128] The insertion of a selected gene is a long process since it involves first cloning in the smaller plasmids and then adding them to the larger pNB-based vectors. This is almost always due to the large number of restriction endonuclease sites present in the larger pNB plasmid in relation to the smaller pSN based plasmids. The virus of the present invention makes cloning easier because it prevents the isolation of partially cut fragments, which are often difficult to separate from unwanted fragments, and working with smaller plasmids usually results in superior DNA yield. . However, its use for co-transfections for virus construction is difficult because it only allows a limited number of overlapping sequences necessary for homologous recombination. For example, there is only an overlap of 240 base pairs at the 5 'end when TP-DNA is cut with EcoRI, the usual procedure. Thus, to increase the overlap region, a virus called BstLink was created as follows. The empty control known as pG-Bst → Stu was used due to the selection advantages it offers. This eliminates the 11.6K death gene that results in much smaller plaques. Therefore when recombinant viral plaques that should contain the 11.6K gene (or other death gene) are selected, the phenotypic difference between the wild type (small plates) and the recombinant (larger plates) will make the selection of recombinants clearer. This plasmid was digested with MunI, filled with the T4 DNA polymerase, and a BstBI linker was added by ligation. This restriction site was chosen because it is not present in any other part of the Ad5 genome. The work objective is to prepare this construct (an E3 region without 11.6K and containing the additional BstBI site) in a virus (from any source), prepare the TP-DNA from the virus, and then use this for the construction of the virus. This was done by cutting the TP-DNA with BstBI and co-transfecting it with plasmid E3 with the desired alterations. This increases the homology at the 5 'end to 2273 base pairs. Time will be saved since it is no longer necessary to construct plasmids from small plasmids into larger plasmids. It is also easier to select recombinant viruses based on phenotypic differences. Plaques must still be selected for mutations, but the proportion of correct viral clones is predicted to be higher.

[0129] Having fully described the invention, it will be apparent to someone with ordinary knowledge in the art that numerous changes and modifications can be made therein within the scope of the appended claims.

Claims (16)

one.

A recombinant adenoviral vector comprising restriction sites in the E3 region of said vector

selected from the group consisting of Pac1, Clal, Pme1, Swa1, BamH1, BstB1, Ssp1, Nhe1, Stu1 and EcoRV, in which said restriction sites have relative positions such as those shown in Figures 4 to 7; wherein the restriction sites are introduced by mutations preferably without modifying the coding sequence, but when changes are made in the amino acids they are conservative in nature; and wherein the restriction sites are located so as not to interrupt critical signals of alternative processing and polyadenylation; wherein the restriction sites facilitate the partial or total elimination of an adenoviral gene or genes contained in said E3 region, and the replacement of said partial or total deletion of said adenoviral gene or genes with a heterologous gene, wherein said gene heterologous presents an expression pattern, both in terms of synchronization and degree of expression, similar to the endogenous adenoviral gene it replaces; wherein said vector includes restriction sites in the genes of the early region of the E3 region encoding the 6.7K and gp19K proteins and / or wherein said vector includes restriction sites in the genes of the early region of the region E3 encoding the 10.4K, 14.5K and 14.7K proteins.

2.

A recombinant adenoviral vector according to claim 1 further comprising removing an E1A or E1B region from said adenoviral vector, and wherein said E1B region encodes a 55K protein.

3.

A recombinant adenoviral vector according to any one of the preceding claims comprising a heterologous gene substituted by said partial or total elimination of said adenoviral gene or genes from the E3 region, wherein said heterologous gene exhibits an expression pattern, both in terms of synchronization. as of degree of expression, similar to the endogenous adenoviral gene it replaces.

Four.

A recombinant adenoviral vector according to claim 2 or claim 3 wherein the deletions of said E1B region or said E1A region are replaced with a gene encoding a heterologous protein.

5.

A recombinant adenoviral vector according to any one of the preceding claims wherein said heterologous protein is selected from the group consisting of tumor necrosis factor alpha, interferon gamma, an interleukin, a protein for cellular suicide and mip-3.

6.

A recombinant adenoviral vector according to any one of claims 1 to 4 wherein the heterologous protein is a negative selection gene.

7.

A recombinant adenoviral vector according to claim 6 wherein the negative selection gene is selected from the group consisting of cytosine deaminase and thymidine kinase.

8.

Use of a recombinant adenoviral vector according to any one of claims 1 to 7 in the preparation of a medicament for the treatment of cancer in a mammal.

9.

Use according to claim 8 wherein said medicament is for administration in association with a chemotherapeutic agent or immunosuppressant.

10.

A method of producing a recombinant adenoviral vector for use in the expression of a heterologous gene, said method comprising the genetic engineering manipulation of a restriction site in the E3 region of said vector selected from the group consisting of Pac1, Cla1, Pme1, Swa1, BamH1, BstB1, Ssp1, Nhe1, Stu1 and EcoRV;

wherein said restriction sites have relative positions such as those shown in Figures 4 to 7; whose restriction sites allow the partial or total elimination of an adenoviral gene or genes contained in said E3 region, and the replacement of said partial or total elimination of said adenoviral gene or genes with a heterologous gene; said restriction site that is positioned such that said heterologous gene has an expression pattern, both in terms of synchronization and degree of expression, similar to the endogenous adenoviral gene that it replaces without interrupting critical signals from alternative processing and polyadenylation; in which any change in amino acids are conservative in nature; said restriction site comprising is engineered in the genes of the early region of the E3 region encoding the 6.7K and gp19K proteins; and / or comprising said restriction site is engineered in the genes of the early region of the E3 region encoding the 10.4K, 14.5K and 14.7K proteins.

eleven.

A method according to claim 10 further comprising the step of introducing an elimination in an E1A or E1B region of said adenoviral vector, and wherein said E1B region encodes a 55K protein.

12.

A method according to claim 10 or claim 11 further comprising the step of replacing a heterologous gene with said partial or total elimination of said adenoviral gene or genes, wherein said heterologous gene exhibits an expression pattern, both in terms of synchronization as of degree of expression, similar to the endogenous adenoviral gene it replaces.

13.

A method according to claim 11 further comprising replacing said deletions of the E1B region or E1A region with a gene encoding a heterologous protein.

14.

A method according to any of claims 10 to 13 wherein said heterologous protein is selected from the group consisting of tumor necrosis factor alpha, gamma interferon, an interleukin, a protein for cellular suicide and mip-3.

fifteen.

A method according to any of claims 10 to 13 wherein the heterologous protein is a negative selection gene.

16.

A method according to claim 15 wherein the negative selection gene is selected from the group consisting of cytosine deaminase and thymidine kinase.