ES2276623B1 - NEW ADENOVIRUS RECOMBINANTS OF CONDITIONED REPLICATION (CRAD). - Google Patents

Abstract

New recombinant adenoviruses of conditioned replication (CRAD). The present invention relates to a recombinant conditioned replication adenovirus, characterized in that it comprises a promoter linked to the E1A gene that comprises hypoxia response elements, a promoter linked to the E4 gene that comprises at least one E2F factor response element, a deletion in the CR2 domain of the E1A gene, and an exogenous gene of interest. Additionally, the invention relates to a process for obtaining said adenovirus, and a composition comprising it.

Description

New recombinant replication adenoviruses conditioned (CRAd).

Technical Field of the Invention

The present invention relates to new recombinant adenoviruses for the treatment of solid tumors, and in particular to new selectively replicative adenoviruses in tumor cells that have altered the protein pathway of the retinoblastoma (pRB) and that develop under conditions of hypoxia

State of the art prior to the invention

Despite the latest advances in techniques surgical and imaging, as well as the improvements made in the combined radiotherapy and chemotherapy procedures, the Survival of patients with metastases and certain types of tumors (brain, pancreatic, liver, etc.) has not improved significantly.

In your effort to seek alternative therapies, researchers have seen in virotherapy, and more particularly in adenoviruses, a therapeutic tool Attractive and promising.

At first the use of adenoviruses as suitable vectors for transfer and gene therapy. However, although the preclinical data obtained with various adenoviral gene therapy strategies are encouraging (good transduction capacity and efficiency anti-tumor), clinical trials performed not They have still provided great progress. Probably due to an inefficient transduction of the entire mass of tumors solid.

An alternative strategy seeks to take advantage of the natural ability that adenoviruses possess to penetrate cells and, using cellular machinery, replicate and package their own viral genome, ultimately causing cell lysis and the propagation of their progeny. Thus, adenoviruses are genetically modified so that this replicative and cytopathic activity is attenuated or nullified in normal cells, but not diminished in the target tumor cells. These adenoviruses are commonly known as conditionally replicative adenoviruses (CRAds), oncolytic adenoviruses or also as selective replication adenoviruses. A recent review of the different viral constructs developed can be found in Chu RL et al: Use of replicating oncolytic adenoviruses in combination therapy for cancer; Clinical Cancer Research 2004; 10: 5299-5312.

The first CRAds incorporate genomic mutations that cause a functional loss only compensated by some specific alterations of the target tumor cells. Thus, the incorporation of deletions in the E1A or E1B genes (early transcription genes necessary for " immediate early genes " replication), results in the production of the mutated proteins, unable to bind with cellular proteins and block control elements that possess normal cells, but that are already intrinsically blocked in tumor cells.

So for example, Onyx-015 - one of the best studied CRAds - carries 2 mutations in the gene that encodes for the protein E1B-55 Kda. This way, the E1B-55 Kda protein, which in conditions normal binds and inactive to p53 inducing S phase entry (synthesis phase of the cell cycle), is prevented for binding to p53 and consequently will not activate the S phase and replication, except in tumor cells with an altered p53 pathway.

Another modality also widely studied is Delta24 adenovirus, which incorporates a 24-pair deletion of bases in the constant region 2 (CR2) of the E1A viral gene. This way, the mutated E1A protein is unable to bind to the protein of retinoblastoma pRB, a union that in normal cells is necessary for induction of the S phase and viral replication. These CRAds they would only replicate in cells in which the E1A / pRB interaction, for example in tumor cells with a pathway RB-p16 altered.

A second type of CRAds are those in which one or more specific promoters of tumors replacing the endogenous promoters of some of its viral genes (eg E1A, E1B, E4). In this way the viral replication would be restricted to those tumors in the that the specific tumor promoter is re-activated or over-activated. Since many of these promoters are not activated in all tumors, developments more recent seek to design promoters whose activation is Universal in all types of tumors. So for example they have developed CRAds where transcription of the E1A gene is controlled by the promoter of the E2F-1 gene, by a promoter derived from the reverse transcriptase gene of the telomerase (TERT), or also by a promoter inducible by hypoxia

US6900049, US2005 / 0074430 and WO2004 / 031357 present oncolytic adenoviruses whose replication is dependent on the hypoxia -inducible factor ( hypoxic-inducible factor , HIF). The replicative and cytolytic activity of these viruses would be limited to cells whose HIF activity is increased, and in particular to cells that grow under hypoxic conditions. To this end, the viruses carry one or more genes (E1A, E1B, E4) whose transcription is controlled by a promoter, usually artificial, that incorporates one or more inducible hypoxia response elements
by HIF.

In a recent work, Cuevas Y. et al. (Specific oncolytic effect of a new hypoxia-inducible factor-dependent replicative adenovirus on von Hippel-Lindau-defective renal cell carcinomas; Cancer Research 2003; 63: 6877-6884) have a hypoxia-inducible oncolytic adenovirus (Ad9xHRE1A) in which the expression of the E1A gene is controlled by an artificial promoter with 9 tandem copies of the element of hypoxia response from the VEGF gene promoter (factor of vascular endothelial growth). Ad9xHRE1A, also carries a gene E4 controlled by an E2F-1 promoter, so that E4 expression would be restricted to proliferating cells with an important E2F activity, for example tumor.

It has been noted however, the existence of a compromise between the replicative selectivity of attenuated viruses and their efficiency replicative-oncolytic. Still necessary and Desirable the design and selection of new generations of adenovirus oncolytics to maximize their replicative and oncolytic efficiency, maintaining its selectivity for tumor cells, and ultimately term, presenting the maximum activity anti-tumor and safety. This can be possible by developing new CRAds that "exploit" new regulatory mechanisms, and by selecting CRAds that, combining different control mechanisms, present better benefits.

In view of the essays pre-clinical and clinical performed to date, some specialists have ventured that oncolytic virotherapy by itself it will hardly be effective in complete eradication of tumors However, the clinical data obtained from them inclined to think that the use of oncolytic adenovirus in combination with radiotherapy, chemotherapy or gene therapy They will allow greater anti-tumor efficacy.

It is therefore interesting and desirable, and constitutes the object of this invention, the design of new conditioned replication adenovirus for the treatment of solid tumors and metastases in general that, together with a control optimized replication (selectivity / oncolysis), whether carriers of exogenous genes that contribute to improve efficacy anti-tumor

Detailed description of the invention

A first object of the invention relates to a  recombinant conditioned replication adenovirus, which by simplify we will refer to as recombinant adenovirus of the invention, characterized in that it comprises:

to)

a promoter operably linked to the adenoviral gene E1A comprising at least one HRE hypoxia response element;

b)

a promoter operatively linked to the adenoviral gene E4 comprising the less an element of response to the E2F factor.

C)

a adenoviral gene E1A deleted in the constant region CR2; Y

d)

a Exogenous gene of interest.

For the construction of recombinant adenovirus of the invention any variety or serotype can be used human adenoviral (which has been isolated in humans), for example serotypes 2 (Ad2), 5 (Ad5), 11 (Ad11) or 3 (Ad3). To facilitate understanding, the recombinant adenovirus of the invention is describe and illustrate with examples made using the serotype Ad5, whose complete sequence is available in GeneBank (Human adenovirus type 5, complete genome; Accession number: AC_000008; 35938 bp DNA linear VRL 26-JAN-2005).

In the recombinant virus of the invention the viral promoter that regulates and controls the transcription of the gene that encoding the E1A protein has been replaced by a promoter that comprises at least one hypoxia response element (HRE) inducible by the HIF-1 factor, preferably more of 3. In a more preferred embodiment, said promoter operably linked to the adenoviral gene E1A comprises 9 copies in Tandem of a hypoxia response element (HRE). This elements HIF-1-inducible hypoxia response may be obtained from promoters of other genes that include such elements. Said HREs can be obtained for example from the promoter of the VEGF vascular endothelium growth factor gene, gene of erythropoietin, or some glycolytic enzyme genes, for example enolasa-1.

As used in the present invention, "a promoter operably linked to a gene" means a DNA fragment functionally associated with the coding sequence of said gene, so that said fragment is sufficient to regulate and control the transcription of said coding sequence of the gene Thus "a minimum promoter" is the minimum region of the promoter that includes the (minimum) regulatory sequences that allow efficient control of gene transcription.

In a particular embodiment of adenovirus recombinant of the invention, the promoter that regulates and controls the E1A gene transcription is an artificial promoter that includes several tandem copies of the HRE derived from the VEGF gene promoter human. In a more particular embodiment, said promoter comprises the sequence SEQ. ID. NO: 1, which includes 9 tandem copies of the hypoxia response element of the VEGF-A gene, linked in 3 'position to a TATA sequence from the promoter of the rat prolactin gene. This minimal artificial promoter (9xHRE promoter) has already been described by Cuevas et al. (Cancer Research 2003; above).

On the other hand, in the recombinant adenovirus of the invention, the natural promoter of the gene that encodes the protein E4 has been replaced by a promoter comprising at least one E2F factor response element, preferably more than one. In a particular embodiment said promoter is a fragment of the human E2F-1 factor promoter comprising the regulatory sequences of the E2F-1 gene, for example a minimum promoter In a more particular embodiment, said promoter comprises the sequence SEQ. ID. NO: 2. This promoter minimum artificial has already been described by Hernández-Alcoceba et al ("New oncolytic adenoviruses with hypoxia- and estrogen receptor-regulated replication "; Human Gene Therapy, 2002; 13: 1737-1750). Moreover, the use of the E2F-1 promoter to direct the Viral gene expression E1A, E1B and E4 has been described in WO01 / 36650.

As an additional mechanism for the control of replication, the gene that encodes the virus E1A protein recombinant of the invention has a deletion in the region constant CR2. More specifically, said deletion affects, totally or partially, to the region of CR2 necessary for binding to the pRB retinoblastoma protein, so that the E1A protein mutated is unable to join pRB.

In a particular embodiment the deletion comprises 8 amino acids "LTCHEAGF" (amino acids 122-129 of the E1A protein, corresponding to nucleotides 923-946 of the sequence AC_000008 already cited). This deletion corresponds to the Delta24 deletion (It was J. et al. Oncogene; 2000; 19: 2-12).

In a preferred embodiment, the adenovirus recombinant of the invention comprises a deleted E1A viral gene with the Delta24 deletion and, operably linked to said gene, a 9xHRE promoter with SEQ sequence. ID. NO: 1; and an E4 viral gene operably linked to the human E2F-1 promoter of sequence SEQ ID NO: 2.

Additionally, the recombinant virus of the The invention comprises an exogenous gene or transgene. In one embodiment preferred said exogenous gene is introduced in the place occupied by the viral genes that code for gp19k and 6.7k proteins, which are deleted (nucleotides 28,555 to 29,355 of the sequence of the adenovirus, Gene Bank AC_000008). The introduction of this substitution has already been described by Hawkins et al. ("Gene delivery from the E3 region of replication human adenovirus: evaluation of the 6.7 K / gp19K region "; Gene Therapy, 2001; 8: 1123-1131).

The exogenous gene introduced into adenovirus recombinant of the invention can be a reporter gene (by example luciferase) or a therapeutic gene, such as a suppressor gene tumor, an apoptosis inducing gene, a gene anti-angiogenic, a suicide gene that encodes a pro-drug activating enzyme, or a gene immunostimulator

In a particular embodiment of the invention the Exogenous gene is the luciferase reporter gene. In other particular embodiment said exogenous gene is the suicide gene of the Thymidine Kinase (TK). In another particular embodiment of the invention the exogenous gene is the interleukin 12 gene (IL-12). WO2004 / 031357 describes an oncolytic virus regulated by hypoxia with the IL-12 gene as transgene

The design of the new CRAd has advantages for its use as an oncolytic virus compared to previous versions, since various elements that determine its effectiveness have been optimized and specificity:

1.- The use of a promoter that responds to hypoxia to control the E1A gene allows the replication and cytopathic effect of the virus to be stimulated under conditions of low oxygen tension. These conditions are present in solid tumors, and it has been described that they can decrease the activity of different oncolytic adenoviruses regulated by other mechanisms (Pipiya T. et al ., Gene Therapy, 2005 12: 911-917; Shen BH and Hermiston TW, Gene Therapy (2005), 12: 902-910).

2.- The combined use of the Delta24 deletion in the E1A gene with the transcriptional control of the E1A gene and the region E4 achieves greater attenuation of the virus in normal cells, without negatively affect your ability to kill cells Tumor

3.- The possibility of introducing genes Therapeutics in the structure of the virus increases its effectiveness because the oncolytic ability is linked to the effect of the exogenous gene own adenovirus. In the case of reporter genes, it is done possible visualization of infected cells along the weather.

Advantages of therapeutic genes

one.

Interleukin 12 (IL-12) . This cytokine has several mechanisms of action that contribute to its antitumor effect. On the one hand, it stimulates the reaction of the immune system against tumors through the production of other cytokines and the activation of effector cells. On the other hand, it has an antiangiogenic effect, which hinders the vascularization of tumors and prevents their growth.

These actions make the expression of IL-12 in the context of CRAd described above, present important advantages.

First, there may be a synergy in the stimulation of the immune system against the tumor, since the tumor cells will be infected by a replicative infectious agent. This fact is in itself a immunostimulatory event, which is reinforced by the local expression of IL-12

In second instead, the antiangiogenic effect of IL-12 hinders tumor oxygenation and causes hypoxia, which stimulates replication of CRAd.

2.

Thymidine kinase from Herpes virus type I (HSV-TK) . This enzyme has the function of converting a relatively harmless pro-drug (ganciclovir) into a potent cytotoxic agent. The cells that express HSV-TK, in the presence of exogenously administered ganciclovir, die and cause the death of the cells that are in their vicinity. Since the administration of ganciclovir can be done days after administering the CRAd, this can achieve an increase in the destruction of tumor cells once the virus has been amplified, and thus increase its oncolytic capacity. At the same time, this stops viral replication, due to the death of infected cells, and can be considered a safety mechanism in the case of replication in healthy tissues.

Further, HSV-TK can be used as a reporter gene in humans using the Positron Emission Tomography technique (PET) In this way, it allows to visualize infected cells and Determine the spread of the virus.

Location of exogenous genes

The genome of the CRAd has been modified so that exogenous genes may be included in the E3 region. These genes they take the place of the viral genes that code for gp19k and 6.7k proteins. (Hawkins et al., Gene Therapy (2001) 8, 1123-1131). The deletion of these genes (nucleotides 28,555 to 29,355 in the adenovirus sequence) does not affect the virus replication in tumor cells, since proteins gp19k and 6.7k have the function of inhibiting the immune response against to infected cells. Since tumor cells have own mechanisms to inhibit its recognition by the system immune, these deletions can favor the elimination of the virus in normal cells, but not in tumor cells, and therefore They contribute to the specificity of viral replication.

The inclusion of exogenous genes in this Location has additional advantages. On the one hand, the endogenous promoter and polyphenylation sequences of the virus, which does not need to include these sequences exogenously. This saves space in the viral genome and can include larger genes On the other hand, it has been shown that the promoter endogenous regulating gp19k / 6.7k is activated in the late phase of viral cycle, thereby replicating CRAd and expression of the exogenous gene are regulated in the same way. Finally, it has demonstrated that expression levels exceed those obtained with the usual promoters that are used in gene therapy.

DNA constructs for preparation of the recombinant adenovirus of the invention can be obtained by conventional methods of molecular biology, many of they are collected in general laboratory manuals (for example, "Molecular Cloning: a Laboratory manual". Joseph Sambrook, David W. Russel Eds. 2001, 3rd ed. Cold Spring Harbor, New York). They can also be found in other manuals or references specifically oriented to the preparation of adenovirus, by example:

"Adenovirus Methods and Protocols. Methods in Molecular Medicine. "Wold, William S. M. Ed. 1998, Human Press;

Mizuguchi H. and Kay MA "Efficient construction of a recombinant adenovirus vector by an improved in vitro ligation method"; Hum Gene Ther., 1998; 9: 2577-2583; Y

I have T.C et al. "A simplified system for generating recombinant adenoviruses "; Proc. Batl. Acad. Sci. USA, 1998; 95: 2509-2514.

Any cell line that is permissive for replication and formation of selectively replicative recombinant virions of the recombinant adenovirus of the invention (packaging cell line) can be used for the propagation of the recombinant adenovirus of the invention. Almost any conventional human tumor cell line could be used. The lines HEK293 (derived from embryonic cells), PER.C6 (derived from embryonic retinoblasts), A549 (derived from human lung cancer), HeLa (eg HeLaS3; ATCC Cat.No. CCL-2.2 can be used among others). ; Yuk et al . "Perfusion cultures of human tumor cells: a scalable production platform for oncolytic adenoviral vectors." Biotechnology and Bioengineering, 2004; 86: 637-642).

For efficient propagation of adenovirus recombinant of the invention it is also necessary that the cells packaging machines transfected with the adenovirus genome have increased HIF expression and activity, except HEK293 cells or PER.C6, which constitutively contribute El viral genes. effect, the cells can be subjected to an inductive treatment of HIF expression, such as hypoxic culture (e.g. in a hypoxic chamber adjusted to a gaseous composition 93% N 2/6% CO 2/1% O 2), culture in the presence of chloride cobalt (eg 100 µM), or any other treatment mimetic hypoxic conditions that are inducer of HIF.

Thus, in a particular aspect, the present invention relates to a host cell comprising a recombinant adenovirus previously described and object of the present invention. On the other hand, the invention also relates to a process for the in vitro propagation of said adenovirus object of the present invention which comprises culturing a host cell containing a recombinant adenovirus of the invention, under conditions that allow the expression of said adenovirus. The conditions for optimizing the culture of the host cell will depend on the type of host cell used. If desired, the method of producing the recombinant adenovirus of the invention will include isolation and purification thereof.

A further object of the invention relates to a pharmaceutical composition comprising an adenovirus recombinant of the invention and a pharmaceutically excipient acceptable. The pharmaceutical composition of the invention can formulated with a variety of conventional excipients that improve adenovirus stability during the processes of manufacture, handling, storage and distribution of the product, or that are appropriate for therapeutic administration.

For example, cryo- or io-protective sugars, polyols, surfactants, amino acids, polymers, buffers and salts can be used to adjust the pH of the composition, antioxidants and other chelating agents, as well as bacteriostatic and bactericidal (Parkins et al . "The formulation of biopharmaceutical products "; Pharmaceutical Science and Technology Today, 2000; 3: 129-137). A sterile aqueous or non-aqueous suspension could also be used, which may contain suspending agents or thickening agents. Concrete excipients and formulations useful for the preparation of the pharmaceutical composition of the invention can be found for example in the Journal of Pharmaceutical Sciences (Evans RK et al . "Development of stable liquid formulations for adenovirus-based vaccines"; 2004, 93: 2458-2475 ), Gene Therapy (Croyle MA et al . "Development of formulations that enhance physical stability of viral vectors for gene therapy"; 2001, 8: 1281-1290), J. Virol. Methods (Hosokawa M. et al . "Preparation of purified, sterilized, and stable adenovirus vectors using albumin";2002; 103: 191-199), W098 / 02522, W000 / 34444, W000 / 61726, W003 / 049763, US6544769, US20020031527, among others.

In a particular embodiment the composition Pharmaceutical will contain 10 3 to 10 15 or more particles adenovirals in aqueous solution.

Brief description of the figures

Figure 1. Schematic representation of generic plasmid for the production of CRAds. The sequence of Adenovirus type 5 is in the form of a plasmid with resistance to kanamycin, and can be released by digestion with the enzyme of PacI restriction. E1Ap, E1A promoter, found flanked by recognition sequences for BstBI. E4p, E4 region promoter, flanked by sequences for SwaI and I-CeuI. E1A D24, deletion of the CR2 domain of E1A (optional). E3Dgp19k / 6.7k, partial deletion of the E3 region for insertion of exogenous genes. LP, late promoter of the virus.

Figure 2. Schematic representation of the AdHLuc, AdDHLuc and AdWTLuc virus. ITR, Inverted Terminal Repeat; HRE, Hypoxia Response Element; E2F-1p, promoter of E2F-1 transcription factor. D24, deletion of CR2 domain of E1A.

Figure 3. Cytopathic effect of AdHLuc, AdDHLuc and AdWT in Huh-7 human hepatocarcinoma cells (figure A) and in normal fibroblasts IMR-90 (figure B). Relative survival is represented with respect to uninfected cells grown in the same conditions, comparing survival when cells remained in hypoxia conditions compared to that observed in conditions of normoxia Huh-7 cells were infected with 5 virus / cell, and IMR-90 fibroblasts with 135 virus / cell to compensate for its lower adenovirus infectivity. The cytopathic effect was evaluated 5 days after infection. for Huh-7 cells and at 10 days for IMR-90 fibroblasts.

Figure 4. Cytopathic effect of AdHLuc viruses,  AdDHLuc and AdWT on WI-38 cells (infected with 250 virus / cell) and WI38-VA13 (125 virus / cell), when cells were grown under normoxia conditions or hypoxia The crops were photographed (200x) at 5 days since infection. Cells that undergo cytopathic effect by viral replication is distinguished by loss of adhesion, with increased refringence and rounded morphology.

Figure 5. Cytopathic effect of AdHLuc viruses,  AdDHLuc and AdWT on BJ cells (infected with 500 viruses / cell) and IMR-90 (125 virus / cell), for cells kept in normoxia or hypoxia conditions. Photographed (200x) also at 5 days. The cells that suffer effect Cytopathic viral replication distinguished by loss of adhesion, with increased refringence and morphology rounded.

Figure 6. Cell viability test in infected Huh-7 and IMR-90 cells with AdDHLuc virus (solid line) or AdWT (dashed line), to different viral doses (MOI, "multiplicity of infection", number of viruses per cell). The cultures were kept in hypoxia conditions (squares) or normoxia (circles). The survival was quantified by staining with violet crystal at 5 days (Huh-7) or 10 days (IMR-90) since infection with the virus to be tested.

Figure 7. Control of hypoxia replication.  Graphical comparison of the amount of viral particles infectives (i.u./ml) produced in Huh-7 cells infected with AdDHLuc, AdWT or Ad-CMV-Luc, when they remained in conditions of hypoxia or normoxia. units infective

Figure 8. Graphical comparison of in vitro expression of luciferase (represented as RLU / total total protein; RLU, relative luciferase units) in Huh-7 and HApT-1 cells infected by the AdDHLuc and AdWTLuc viruses, when they were maintained in hypoxia or normoxia conditions. Infection: MOI of 10 viruses / cell.

Figure 9. In vivo expression of luciferase in athymic mice with xenografts of human tumors, after infection (by intratumoral injection) with the AdDHLuc, AdWT and Ad-CMV-Luc viruses. A: Tumors induced by subcutaneous injection of Huh-7 cells; Infection with 2x10 8 iu of the virus to be tested. B: Tumors induced by intrahepatic injection of Huh-7 cells; Infection with 10 9 iu of the AdDHLuc virus. The light emission (expressed in photons / second) was quantified over time by means of a luminometric chamber.

Embodiment of the invention

The following examples are intended to illustrate, in in any way limiting, the embodiment of the invention object of This patent application.

Example 1 Construction and propagation of recombinant adenoviruses

According to the specifications of the invention, 3 recombinant adenoviruses were constructed, each with a different transgene:

- AdDHLuc, which incorporates the gene of the luciferase (reporter);

- AdDHTK, which incorporates the Herpes simplex virus thymidine kinase gene (HSV-TK, suicide gene); Y

- AdDHIL-12, which has been incorporated the interleukin-12 gene (IL-12, therapeutic gene).

In the 3 adenoviruses: i) the E1A gene promoter by a synthetic promoter (SEQ. ID. NO: 1) which  responds to hypoxia; ii) the E4 gene promoter has been replaced by the transcription factor promoter E2F-1 (SEQ. ID. NO: 2); iii) a deletion has been made (deletion Delta24) in the CR2 domain of the E1A gene; and iv) have been introduced the genes of interest replacing the gp19k / 6.7k genes of the E3 region.

In addition, others were prepared and used recombinant adenoviruses that have been used as controls in the experiments:

- AdWT, wild type adenovirus type 5 (ATCC VR-5);

- AdWTLuc, which differs from AdWT in inclusion of the luciferase gene replacing the gp19k / 6.7k genes of the E3 region;

- Ad-CMV-Luc, a defective adenovirus expressing the luciferase gene under the CMV promoter control (Vector Biolabs, Philadelphia, Ref. 1000); Y

- AdHLuc, which differs from AdDHLuc because it has not been deleted (Delta24 deletion) in the CR2 domain of the gene E1A.

Plasmid Construction

For the construction of the recombinant adenoviruses used in the examples, the plasmid, pSEHE2F, was used as the initial reagent. This plasmid is based on the adenovirus type 5 genome, modified to facilitate the replacement of E1A and E4 promoters with tumor-specific promoters (Hernández Alcoceba R. et al . Human Gene Therapy 2002; 13: 1737-1750). On the adenoviral genome, recognition sequences have been introduced for restriction enzymes in specific regions and exogenous promoters that can be substituted with
ease:

- flanked E1A (ElAp) promoter region by recognition sequences for the BstBI enzyme (pSEHE2F contains in this region the artificial promoter 5XEH3, which will be replaced by the 9XHRE promoter in the viruses object of the invention);

- E4 promoter region (E4p) flanked by  recognition sequences for enzymes I-CeuI and SwaI (pSEHE2F contains in this region the promoter for factor E2F-1, which will remain in the viruses object of the invention). This last promoter was obtained by Polymerase Chain Reaction (PCR) from DNA Human genomic using the following oligonucleotides:

SEQ ID NO 3: 5' TACTGTAACTATAACGGTCCTAAGGTAGCGTGGTACCATCCGGACAAAGCC-3 ' Y, SEQ ID NO 4: 5' TAAGTATTTAAATGGCGAGGGCTCGATCCCGC-3 '.

An insulating sequence (named here "Ins") is present in pSEHE2F between the sequence of packaging of adenovirus and the E1A promoter region. This sequence (transcription stop sequence of the gene of the bovine growth hormone) was obtained from the plasmid pCDNA3 (Invitrogen) by digestion with the enzymes PvuII and NotI.

Plasmid pSHE2F was modified in successive stages to obtain the plasmids necessary to produce the virus of the invention and its controls:

- Introduction of the 9XHRE promoter in the E1A region

Plasmid PSEHE2F was digested with BstBI, and was  replaced the 5XEH3 promoter with the 9XHRE promoter. To introduce BstBI restriction sites on both sides of the promoter, are used an adapter consisting of the following pair of oligonucleotides:

SEQ ID NO 5: 5Bstbam: 5 'CGAAGATCTGACTCCAAG 3' Y SEQ ID NO 6: 3Bstbam: 5 'GATCCTTGGAGTCAGATCTT 3'.

The correct orientation of the promoter was verified  by digestion with the restriction enzyme BamHI and sequencing using the following oligonucleotides:

SEQ ID NO 7: 5Ad5St: 5'TAGTGTGGCGGAAGTGTGATGTTG 3 ' Y SEQ ID NO 8: 3Ad5St: 5'TCTTCGGTAATAACACCTCCGTGG 3'.

This new plasmid was called pSHIFE2F.

- Partial deletion of the E3 region

Plasmid pSHIFE2F was modified to delete the genes that code for gp19k / 6.7k (Dgp19k / 6.7K) and flank this area with recognition sequences for the enzyme PI-SceI, which will allow the incorporation of genes exogenous To obtain the deletion successive were carried out subcloning stages. First a fragment of 4.7 was obtained kb by digestion of plasmid pSHIFE2F with the enzyme AgeI, and was subcloned into the AgeI site of the commercial plasmid pMIB / V5-HisC (Invitrogen). This new plasmid (called pMIB-AgeC) was digested simultaneously with the SpeI and XbaI enzymes and a position was introduced in this position fragment obtained by PCR in which a restriction site for the enzyme XmnI at position 28555 relative to the genome of adenovirus type 5. This PCR fragment is obtained with the following pair of oligonucleotides:

SEQ ID NO 9: 5SpeI: 5 'AAGGACTAGTTTCGCGCCCTTTCTCAAATTTAAGC 3', Y SEQ ID NO 10: 3XmnI: 5' CCGATTCTAGAGAAACCTGAATTAGAATAGCCCGTAGAGTTGCTTGAA ATTGTTCTAAACCCCAC 3',

using plasmid pSEHE2F as a template.

The new plasmid was called pMIB-E3Xmn.

Then a digestion of pMIB-E3Xmn with the enzyme MunI (which cuts in the position 29355 relative to adenovirus type 5), and a digestion partial with XmnI so that it is only cut at position 28555. A  once the plasmid is opened by these two sites and removed the fragment between them, a reaction of ligation to insert a sequence recognizable by the enzyme PI-SceI (PI-SceI adapter). This adapter was obtained by mixing the following pair of oligonucleotides that hybridize with each other:

SEQ ID NO eleven: 5PI-Sce: 5' ACGTAATCTATGTCGGGTGCGGAGAAAGAGGTAATGAAATGGCA 3 ' Y, SEQ ID NO 12: 3PI-Sce: 5' TGCCATTTCATTACCTCTTTCTCCGCACCCGACATAGATTACGT 3 '

The resulting plasmid is called pMIB-PISceI, and presents the site PI-SceI in the place where the adenoviral genes encoding gp19K / 6.7k.

To incorporate this deletion into the genome of adenoviral vectors, plasmid pMIB-PISceI was digested with the enzymes AgeI and ScaI simultaneously, and the 4.7 kb fragment obtained was introduced into plasmid pSHIFE2F digested with the same enzymes. In this way a plasmid containing the desired deletion, but which is incomplete for having lost the initial regions of the adenoviral genome. Without However, the 7.7 kb fragment was obtained from this plasmid comprised between the enzymes SwaI and SpeI, which was introduced in plasmid pSHIFE2F replacing the homonymous fragment. This  way, the genes that code for viral proteins gp19K / 6.7k were deleted and the site was introduced instead PI-SceI restriction that can be used for incorporation of exogenous genes in this area, since it is not present in any other region of the virus. The first exogenous gene that was introduced in the E3 region was the reporter gene of the luciferase, obtained from the plasmid pGL3-Basic (Promega). The 1.6 kb fragment comprised between the HindII and XbaI sites that it codes for Luciferase was treated with the enzyme T4 polymerase to get blunt ends, and was introduced on the site PI-SceI which had been treated the same way in the plasmid adenoviral modified above. The resulting plasmid is called pSHE2F-Luc.

To facilitate the subcloning of other genes in E3 region, it is more convenient to use recognition sites for the ClaI enzyme instead of PI-SceI, because the latter is very large and its symmetrical repetition can cause plasmid recombinations. For this you can digest with PI-SceI, blunt the ends with T4 DNA Polymerase, and introduce a ClaI adapter consisting of the pair of oligonucleotides:

SEQ ID NO 13: 5Cla: 5 'CCTATATCGATAGCCT 3' Y SEQ ID NO 14: 3Cla: 5 'AGGCTATCGATATAGG 3'.

The sequence to be introduced can flank by ClaI sites by ligation of these adapters or by PCR reaction using oligonucleotides that include the recognition sequence for ClaI. If the exogenous gene of interest it has internal ClaI sites, as with interleukin 12, NarI sites, which are compatible with ClaI, can be used.

- Deletion of the CR2 domain of the E1A gene

The deletion of bases 922 to 947 of the genome adenoviral was performed by PCR, using the genome as a template of adenovirus type 5. Initially two fragments were generated. One of them, called AB was amplified using the pair of oligonucleotides:

SEQ ID NO fifteen: AE1A: 5 'TCAGTATTCGAATCGCGACTCTTGAGTGCCAGCGAG 3' Y SEQ ID NO 16: BE1A: 5'ATCGATCACCTCCGGTACAAGGTTTGG 3'.

The second, called BC was amplified with the oligonucleotides:

SEQ ID NO 17: CE1A: 5' AACCTTGTACCGGAGGTGATCGATCCACCCAGTGACGACGAGGATGA AGAGG 3 'and, SEQ ID NO 18: DE1A: 5' AAGGCGTTAACCACACACGCAATCACAGGTTTACACCTTATGGCC 3 '

Fragments AB and BC have a region of homology, so that if they are mixed they can partially hybridize. This region has been designed to exclude the bases included between position 922 and 947. If the hybridization of these two fragments is used as a template for a PCR reaction with the oligonucleotides AE1A and DEJA, a fragment (AD) is obtained flanked by BstBI and HpaI sites in which the CR2 domain of the gene E1A has been deleted. Next this fragment should be introduced into plasmid pSHE2F-Luc. To do it possible, pSHE2F-Luc was digested with the enzyme EcoRV and re-linked. In this way a plasmid is obtained much smaller, which contains only one Hpal site. Then you digested this new plasmid with BstBI and HpaI and incorporated the PCR fragment This intermediate plasmid was called pSdlE1A, which has incorporated the modified E1A gene but has lost the promoter 9XHRE and the sequence between bases 9197 and 33756. The 9XHRE promoter was reintroduced using the BstBI site. To restore the rest of the adenoviral genome, initially it subcloned the 14.8 kb fragment between the SdaI sites. A triple ligation was then carried out to merge 3 fragments between RsrII sites that restore the genome modified viral. The 14 kb fragment comes from the plasmid that contains the deletion in the CR2 domain of E1A and the 9XHRE promoter, while the 17 kb fragment (from the plasmid pSHE2F-Luc) contains the luciferase gene in the E3 region. Finally, the genome is completed with the fragment of 7.7 kb also from pSHE2F-Luc. He plasmid resulting from this fusion was called pSDHE2F-Luc.

- Construction of pAdLuc

For this, the 12.5 kb fragment was obtained between the NdeI sites of the plasmid pSHE2F-Luc, and was introduced in homonymous sites of plasmid pTG3602. In this way a plasmid is obtained with the Luciferase gene replacing the gp19k / 6.7k genes in the context of the genome of Adenovirus type 5, without other modifications.

Figure 1 shows the structure general of the modified plasmids, and Figure 2 shows a scheme of the genome of recombinant viruses.

Obtaining viral particles

The plasmids described above will digested with the enzyme PacI, which releases the viral genome of other bacterial sequences, and were transfected into 293 cells (ATCC CRL-1573) by the precipitation method with calcium phosphate. Once observed the cytopathic effect (typically 7-10 days after transfection), the cells were lysed by 3 consecutive cycles of freezing and thawing. Serial dilutions of the lysate and with them A549 cells were infected (ATCC CCL-185; from human lung cancer) in hypoxia conditions (1% oxygen). In this way they were obtained several clones of the viruses, which were verified by PCR. The new viruses obtained from plasmids pSHE2F-Luc, pSd1HE2F-Luc and pAdLuc They were named AdHLuc, AdDHLuc and AdWTLuc, respectively.

Virus amplification and purification

Viruses were amplified in A549 cells maintained in hypoxic conditions in the case of AdHLuc and AdDHLuc, and in 293 cells in the case of AdWTLuc.

The purification was carried out by standard techniques using a cesium gradient and subsequent step by an exclusion column. The virus obtained was preserved in a medium buffered with 10% glycerol at -80ºC until the moment of its utilization. The titration was carried out by observing the cytopathic effect after limit dilution in 293 cells, verified by immunohistochemistry assays with an antibody anti-adenovirus (Adeno-X Rapad Titer Kit, BD Biosciences Clontech Cat. No. K1653-1).

Example 2 Characterization of the AdDHLuc virus in vitro

AdDHLuc virus activity was analyzed against to control viruses in different cell types, both under conditions normal as in hypoxia.

The following parameters were analyzed:

- the cytopathic effect, by staining with the crystal violet dye;

- replication and production of new viral particles by limit dilution in 293 cells or immunohistochemistry with anti-adenovirus antibodies (Adeno-X Rapad Titer Kit, BD Biosciences Clontech Cat. No. K1653-1); Y

- the expression of exogenous genes (luciferase).

Cytopathic effect

The main characteristic sought in the CRAds is its ability to selectively induce the death of tumor cells

Trials to evaluate this cytopathic effect They were performed as follows:

1. Sowing the cells in different wells in two plaques (for growth in normoxia and hypoxia respectively): 5x103 cells / well in 96 plates wells in appropriate medium for the cell line.

2. At 24 hours, infection with the virus a test (one type of virus per well, eg AdWT, AdHLuc or AdDHLuc); the viral concentration was adjusted to each cell line in function of infectivity for said line.

3. Incubation at 37 ° C under hypoxic conditions (chamber adjusted to a gaseous composition of 93% N2 / 6% CO 2/1% O 2) or normoxia (gaseous composition environmental).

4. When AdWT caused obvious cytopathic effect in cultures, staining with violet crystal and quantification of the surviving cells.

5. Calculation of relative survival (%) with respect to cells in control wells, cultured therein conditions but that have not been infected by the virus.

For cell culture Huh-7, HaP-T1, medium was used DMEM (Gibco) and for IMR-90 cells, WI-38, WI38-VA13 and BJ was used MEM medium (Gibco). The maintenance medium was supplemented with 10% fetal serum, the proportion of which was reduced during 2% infection. In all cases it was added to the media grow a mixture of antibiotics (penicillin 50 IU / L - streptomycin 50 mg / mL; Biowhittaker) and antifungals (Amphotericin-B 2.5 mg / mL; Gibco).

       \ newpage
    

Initially, tumor cells were infected Huh-7 (Nakabayashi et al. 1982. Cancer Res., 42: 3858-3863; from human hepatocarcinoma) and HaP-T1 (ECACC No. 93121054; from cancer of hamster pancreas), and normal IMR-90 cells (ATCC CCL-186; from fibroblasts human lung primary) with the various viruses.

As can be seen in Figure 3, both AdDHLuc and AdHLuc were able to eliminate tumor cells when they grow under conditions of low oxygen tension (hypoxia). The cytotoxic effect on hypoxia was similar to that observed with the AdWT wild adenovirus (Figure 3A). These conditions reproduce the situation found in solid tumors. Instead, viruses are attenuated in the presence of oxygen (normoxia). To check the degree of virus selectivity, normal cells (IMR-90) were infected, Figure 3B. The most similar conditions to healthy tissues are normal cells in normoxia, and in these conditions both AdDHLuc and AdHLuc are attenuated (less than 30% cell death). However, when normal cells are exposed to low oxygen tension, AdHLuc is more cytopathic than AdDHLuc. This is consistent with the design of these viruses, since in the case of AdHLuc hypoxia is' capable of triggering viral replication by activation of the E1A promoter, both in tumor and normal cells. In contrast, the additional security mechanism of AdDHLuc, consisting of the deletion of the CR2 domain of the E1A gene, attenuates the virus in normal cells even in the presence of hypoxia. In short, the data in Figure 3 suggest that AdDHLuc has a cytotoxic potency equal to AdHLuc and close to AdWT on tumor cells, but advantageously it is strongly attenuated in cells
normal.

To confirm this point we studied the virus behavior in normal human fibroblasts WI-38 (ATCC CCL-75) and fibroblasts WI38-VA13 (ATCC CCL-75.1), which have been maligned by the expression of SV40 T antigen, which block the pRB path. WI38-VA13 cells have  altered cell cycle control, and therefore it is expected that AdDHLuc virus is not attenuated with respect to AdHLuc. It also performed tests with normal BJ cells (ATCC CRL-2522; from primary fibroblasts human skin).

Figure 4 shows photomicrographs of WI-38 normal and malignant fibroblasts WI38-VA13 infected with the various viruses in hypoxia or normoxia conditions. The cells that are suffering the cytopathic effect of the virus is distinguished because they lose adhesion to the culture plate and acquire a morphology rounded. As you can see, AdDHLuc is the virus that is most attenuated in normal cells, while retaining its ability to Kill malignant cells.

These observations were repeated over others. normal cell types, such as IMR-90 cells and BJ, as shown in Figure 5.

Cytotoxicity at different viral concentrations

In order to study in more detail the cytopathic effect of the AdDHLuc virus, the viability of tumor cells (Huh-7) and normal (IMR-90) infected with different concentrations viral, both in normoxia and hypoxia conditions (as described above).

As can be seen in figure 6, hypoxia  sensibly activated the cytotoxicity of AdDHLuc in cells tumor, achieving an effect similar to that observed with AdWT. In change, the activation in normal cells was lower, and AdDHLuc was showed significantly attenuated with respect to AdWT.

It is important to note that in this type of experiments the decrease in cell viability at low doses is dependent on viral amplification, so in a way indirectly this assay also reflects replication control of the virus

Viral replication

In order to directly analyze the AdDHLuc replication control, cells were infected Huh-7 with the virus under normoxia conditions or hypoxia, and the production of new particles was quantified infective after days.

The cells were seeded, infected and they grew in the same way as in the trials to evaluate the cytopathic effect In this case, 3 days after infection, the cells were lysed by 3 freezing cycles- defrosting and infective particles were quantified by limit dilution in 293 cells or by immunohistochemistry with anti-adenovirus antibodies (Adeno-X Rapad Titer Kit, BD Biosciences Clontech Cat. No. K1653-1) following the instructions of the maker. The result was expressed as infective units per mL (i.u./ml).

As can be seen in figure 7, hypoxia  activated the amplification of the AdDHLuc virus, while it does not occur the same with AdWT, whose replication did not change. As control replication negative an adenovirus was included in the experiment defective luciferase gene carrier (Ad-CMV-Luc, Vector Biolabs Cat. No. 1000).

Exogenous gene expression (luciferase)

The location of the luciferase reporter gene in the E3 region of the AdDHLuc virus allows monitoring of the Exogenous gene expression introduced into the virus. The same time, luciferase expression increases in response to viral replication, due to the activation of late promoters and the increase in the number of copies of the viral genome in the cell. Therefore, measuring luciferase activity is an indicator of viral replication

To this end, cells were seeded Huh-7 and HaP-T1 were infected with AdDHLuc and AdWTLuc (MOI of 10 viruses / cell), and were cultured from the same way as in the trials for effect evaluation cytopathic At 2 days after infection, the cells were lysed to measure Luciferase activity using a commercial kit (Luciferase Assay System, Promega Cat. No. E4030), following the manufacturer's instructions The activity was expressed as RLU / mug total protein (RLU: Relative Luciferase Units).

Figure 8 shows how this activity increases with hypoxia in cells infected with AdDHLuc, while  The same is not true with AdWT.

In short, the experiments described in this example 2 demonstrate that all activity parameters studied for AdDHLuc increase under conditions of hypoxia

Example 3 In vivo activity tests

To evaluate the in vivo activity of the recombinant adenoviruses, human tumor xenotransplants were performed in athymic mice (immunosuppressed) by subcutaneous injection (1x10 7 cells in 150 µl saline) or intrahepatic (1.5x10 6) cells in 50 µl of serum) of Huh-7 cells. At 20 days, the virus to be tested (AdDHLuc, Ad-CMV-Luc and AdWTLuc) was injected by intratumoral injection. At 24 hours after the injection of the virus, the measurement of luciferase activity began, performed daily for 10 days. For this, the luciferin substrate was administered intraperitoneally (150 µg / ml PBS). Thanks to the luciferase reporter gene, the expression kinetics and biodistribution of viruses can be monitored in live animals by measuring the emission of light using a high-sensitivity luminometric camera (In vivo imaging system, Xenogen). Under these conditions, the emission of light (photons / second) responds to a balance between viral replication and the death of infected cells.

Tumor growth was also assessed by measurement of the major (D) and minor (d) diameters. Tumor volume  It was calculated by applying the formula: V = D x (d) 2/2 and expressed in mm3.

As can be seen in Figure 9A, a defective adenovirus (unable to replicate) as Ad-CMV-Luc maintains the levels of initial expression during the first week and then start a Slow decline Instead, AdDHLuc showed an increase important in luciferase activity during the first 4 days. This is compatible with the achievement of several cycles of replication in the tumor. In the case of AdWTLuc, a very intense initial expression and an increase on the second day, followed by a very pronounced decrease. This may be due to the  induction of a faster cytopathic effect on cells infected.

To check the behavior of AdDHLuc in liver tumors, Huh-7 cells were injected in the liver of the mice and subsequently the virus (10 9 i.u).

In figure 9B it can be seen how they achieve very high levels of expression and the increase in the first days and then stabilize and Start a slow descent.

In summary, these data indicate that AdDHLuc is a CRAd capable of serving as an exogenous gene expression vector more effectively than non-replicative adenoviruses.

<110> CIMA BIOMEDICINE PROJECT S.L.

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<120> NEW ADENOVIRUS RECOMBINANTS OF CONDITIONED REPLICATION (CRAd)

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<130> FIMA 05019

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<160> 18

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<170> PatentIn version 3.1

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> SEQ. ID. NO: 1

         \ vskip0.400000 \ baselineskip
      

<211> 601

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Chimeric

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 1

         \ vskip1.000000 \ baselineskip
      

one

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> SEQ. ID. NO: 2

         \ vskip0.400000 \ baselineskip
      

<211> 362

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Chimeric

         \ newpage
      

         \ vskip0.400000 \ baselineskip
      

<400> 2

         \ vskip1.000000 \ baselineskip
      

2

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> SEQ ID NO: 3

         \ vskip0.400000 \ baselineskip
      

<211> 51

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 3

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

tactgtaact ataacggtcc taaggtagcg tggtaccatc cggacaaagc c

\hfill

51

 \ hskip-.1em \ dddseqskip 

tactgtaact ataacggtcc taaggtagcg tggtaccatc cggacaaagc c

 \ hfill 

51

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> SEQ ID NO: 4

         \ vskip0.400000 \ baselineskip
      

<211> 32

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 4

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

taagtattta aatggcgagg gctcgatccc gc

\hfill

32

 \ hskip-.1em \ dddseqskip 

taagtattta aatggcgagg gctcgatccc gc

 \ hfill 

32

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> SEQ ID NO: 5

         \ vskip0.400000 \ baselineskip
      

<211> 18

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 5

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

cgaagatctg actccaag

\hfill

18

 \ hskip-.1em \ dddseqskip 

cgaagatctg actccaag

 \ hfill 

18

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> SEQ ID NO: 6

         \ vskip0.400000 \ baselineskip
      

<211> 20

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 6

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

gatccttgga gtcagatctt

\hfill

20

 \ hskip-.1em \ dddseqskip 

gatccttgga gtcagatctt

 \ hfill 

twenty

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> SEQ ID NO: 7

         \ vskip0.400000 \ baselineskip
      

<211> 24

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 7

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

tagtgtggcg gaagtgtgat gttg

\hfill

24

 \ hskip-.1em \ dddseqskip 

tagtgtggcg gaagtgtgat gttg

 \ hfill 

24

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> SEQ ID NO: 8

         \ vskip0.400000 \ baselineskip
      

<211> 24

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 8

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

tcttcggtaa taacacctcc gtgg

\hfill

24

 \ hskip-.1em \ dddseqskip 

tcttcggtaa taacacctcc gtgg

 \ hfill 

24

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> SEQ ID NO: 9

         \ vskip0.400000 \ baselineskip
      

<211> 35

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 9

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

aaggactagt ttcgcgccct ttctcaaatt taagc

\hfill

35

 \ hskip-.1em \ dddseqskip 

aaggactagt ttcgcgccct ttctcaaatt taagc

 \ hfill 

35

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> SEQ ID NO: 10

         \ vskip0.400000 \ baselineskip
      

<211> 65

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 10

         \ vskip1.000000 \ baselineskip
      

3

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> SEQ ID NO: 11

         \ vskip0.400000 \ baselineskip
      

<211> 44

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 11

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

acgtaatcta tgtcgggtgc ggagaaagag gtaatgaaat ggca

\hfill

44

 \ hskip-.1em \ dddseqskip 

acgtaatcta tgtcgggtgc ggagaaagag gtaatgaaat ggca

 \ hfill 

44

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> SEQ ID NO: 12

         \ vskip0.400000 \ baselineskip
      

<211> 44

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 12

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

tgccatttca ttacctcttt ctccgcaccc gacatagatt acgt

\hfill

44

 \ hskip-.1em \ dddseqskip 

tgccatttca ttacctcttt ctccgcaccc gacatagatt acgt

 \ hfill 

44

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> SEQ ID NO: 13

         \ vskip0.400000 \ baselineskip
      

<211> 16

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 13

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

cctatatcga tagcct

\hfill

16

 \ hskip-.1em \ dddseqskip 

cctatatcga tagcct

 \ hfill 

16

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> SEQ ID NO: 14

         \ vskip0.400000 \ baselineskip
      

<211> 16

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 14

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

aggctatcga tatagg

\hfill

16

 \ hskip-.1em \ dddseqskip 

aggctatcga tatagg

 \ hfill 

16

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> SEQ ID NO: 15

         \ vskip0.400000 \ baselineskip
      

<211> 36

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 15

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

tcagtattcg aatcgcgact cttgagtgcc agcgag

\hfill

36

 \ hskip-.1em \ dddseqskip 

tcagtattcg aatcgcgact cttgagtgcc agcgag

 \ hfill 

36

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> SEQ ID NO: 16

         \ vskip0.400000 \ baselineskip
      

<211> 27

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 16

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

atcgatcacc tccggtacaa ggtttgg

\hfill

27

 \ hskip-.1em \ dddseqskip 

atcgatcacc tccggtacaa ggtttgg

 \ hfill 

27

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> SEQ ID NO: 17

         \ vskip0.400000 \ baselineskip
      

<211> 52

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 17

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

aaccttgtac cggaggtgat cgatccaccc agtgacgacg aggatgaaga gg

\hfill

52

 \ hskip-.1em \ dddseqskip 

aaccttgtac cggaggtgat cgatccaccc agtgacgacg aggatgaaga gg

 \ hfill 

52

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> SEQ ID NO: 18

         \ vskip0.400000 \ baselineskip
      

<211> 45

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 18

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

aaggcgttaa ccacacacgc aatcacaggt ttacacctta tggcc

\hfill

45

 \ hskip-.1em \ dddseqskip 

aaggcgttaa ccacacacgc aatcacaggt ttacacctta tggcc

 \ hfill 

Four. Five

Claims (16)

1. A recombinant conditioned replication adenovirus, characterized in that it comprises:

to)

a promoter operably linked to the adenoviral gene E1A comprising at least one HRE hypoxia response element;

b)

a promoter operatively linked to the adenoviral gene E4 comprising the less an element of response to the E2F factor;

C)

a adenoviral E1A gene deleted in the CR2 domain; Y

d)

a Exogenous gene of interest.

2. A recombinant adenovirus according to claim 1, characterized in that said promoter operably linked to the adenoviral gene E1A comprises 9 tandem copies of a hypoxia response element. 3. A recombinant adenovirus according to any one of claims 1 or 2, characterized in that said hypoxia response elements are derived from the human vascular endothelial growth factor (VEGF) promoter. 4. A recombinant adenovirus according to one of claims 1 to 3, characterized in that said promoter operatively linked to the adenoviral gene E1A comprises SEQ. ID. NO: 1. 5. A recombinant adenovirus according to one of claims 1 to 4, characterized in that said E2F-1 response promoter comprises SEQ. ID. NO: 2. 6. A recombinant adenovirus according to any one of claims 1 to 5, characterized in that said deletion in the CR2 domain is a Delta24 deletion. 7. A recombinant adenovirus according to one of claims 1 to 6, characterized in that it comprises:

to)

a promoter operably linked to the adenoviral gene E1A of sequence SEQ ID NO: 1;

b)

a E2F-1 response promoter operably linked to adenoviral gene E4 of sequence SEQ. ID. NO: 2;

C)

a adenoviral gene E1A deleted in the CR2 domain with the deletion Delta24; Y

d)

a Exogenous gene of interest.

8. A recombinant adenovirus according to any one of claims 1 to 7, characterized in that said exogenous gene is a reporter gene. 9. A recombinant adenovirus according to claim 8, characterized in that said reporter gene encodes luciferase. 10. A recombinant adenovirus according to any one of claims 1 to 7, characterized in that said exogenous gene is a suicide gene. 11. A recombinant adenovirus according to claim 10, characterized in that said exogenous gene is the thymidine kinase gene. 12. A recombinant adenovirus according to any one of claims 1 to 7, characterized in that said exogenous gene is a therapeutic gene. 13. A recombinant adenovirus according to claim 12, characterized in that said exogenous gene is the interleukin 12 gene. 14. A host cell comprising a recombinant adenovirus described in any one of the claims 1 to 13. 15. A method for in vitro propagation of a recombinant adenovirus according to one of claims 1 to 13, characterized in that it comprises:

to)

cultivate a host cell that contain said recombinant adenovirus under conditions that allow adenovirus expression; Y

b)

isolate and purify the adenovirus

16. A composition characterized in that it comprises a recombinant adenovirus described in one of claims 1 to 13 and a pharmaceutically acceptable excipient.