WO2007068772A1

WO2007068772A1 - Novel conditionally-replicating recombinant adenoviruses (crad)

Info

Publication number: WO2007068772A1
Application number: PCT/ES2006/000676
Authority: WO
Inventors: Rubén HERNÁNDEZ ALCOCEBA; Sergia Bortolanza
Original assignee: Proyecto De Biomedicina Cima, S.L.
Priority date: 2005-12-12
Filing date: 2006-12-07
Publication date: 2007-06-21
Also published as: ES2276623A1; ES2276623B1

Abstract

The invention relates to a conditionally-replicating recombinant adenovirus which is characterised in that it comprises a promoter which is linked to gene E1A comprising hypoxia response elements, a promoter which is linked to region E4 comprising at least one factor E2F response element, a deletion in domain CR2 of gene E1A, and an exogenous gene of interest. The invention also relates to a method for obtaining said adenovirus and to a composition containing same.

Description

NEW ADENOVIRUS RECOMBINANTS OF CONDITIONED REPLICATION (CRAD)

TECHNICAL FIELD OF THE INVENTION The present invention relates to new recombinant adenoviruses for the treatment of solid tumors, and in particular to new selectively replicative adenoviruses in tumor cells that have altered the pathway of retinoblastoma protein (pRB) and that develop in hypoxia conditions

STATE OF THE PRIOR ART OF THE INVENTION

Despite the latest advances in surgical and imaging techniques, as well as improvements in the combined radiotherapy and chemotherapy procedures, the survival of patients with metastases and certain types of tumors

(cerebral, pancreatic, hepatic, etc.) has not improved significantly. In its effort to seek alternative therapies, researchers have seen in Virotherapy, and more particularly e ^'n adenoviruses, attractive and promising therapeutic tool.

Initially, the use of adenoviruses as suitable vectors for gene transfer and therapy was discussed. However, although the preclinical data obtained with various adenoviral gene therapy strategies are encouraging (good transduction capacity and anti-tumor efficacy), the clinical trials performed have not yet provided large

SUBSTITUTE SHEET (RULE 26) advances Probably due to an inefficient transduction of the entire mass of solid tumors.

An alternative strategy seeks to take advantage of the natural ability that adenoviruses possess to penetrate cells and, using cellular machinery, replicate and package their own viral genome, ultimately causing cell lysis and the propagation of their progeny. Thus, adenoviruses are genetically modified so that this replicative and cytopathic activity is attenuated or nullified in normal cells, but not diminished in the target tumor cells. These adenoviruses are commonly known as conditioned replication adenoviruses.

("conditionally replicative adenoviruses" or CRAds), oncolytic adenoviruses or also as selective replication adenoviruses. A recent review of the different viral constructs developed can be found in Chu R. L. and cois: Use of replicating oncolytic adenoviruses in combination therapy for cancer; Clinical Cancer Research 2004; 10: 5299-5312. •

The first CRAds incorporate genomic mutations that cause a functional loss only compensated by some specific alterations of the target tumor cells. Thus, the incorporation of deletions in the ElA or ElB genes (early transcription genes necessary for "immediate early genes" replication), results in the production of the mutated proteins, unable to bind with cellular proteins and block control elements that possess normal cells, but that are already intrinsically blocked in tumor cells.

SUBSTITUTE SHEET (RULE 26) Thus, for example, Onyx-015 - one of the best studied CRAds - carries 2 mutations in the gene that codes for the E1B-55 Kda protein. In this way, the E1B-55 Kda protein, which normally binds and inactivates p53 by inducing entry into S phase (synthesis phase of the cell cycle), is prevented from binding to p53 and consequently will not activate the phase. S and replication, except in tumor cells with an altered p53 pathway.

Another modality also widely studied is the Delta24 adenovirus, which incorporates a 24 base pair deletion in the constant region 2 (CR2) of the ElA viral gene. In this way, the mutated ElA protein is unable to bind to the pRB retinoblastoma protein, a binding that in normal cells is necessary for induction of the S phase and viral replication. These

CRAds would only replicate in cells in which the ElA / pRB interaction is not necessary, for example in tumor cells with an altered RB-plβ pathway.

A second type of CRAds is those in which one or more tumor-specific promoters are introduced instead of the endogenous promoters of some of their viral genes (eg ElA, ElB, E4). In this way viral replication would be restricted to those tumors in which the specific tumor promoter is re-activated or over-activated. Since many of these promoters are not activated in all tumors, the most recent developments seek to design promoters whose activation is universal in all types of tumors. Thus, for example, CRAds have been developed where the transcription of the ElA gene is controlled by the promoter of the E2F-1 gene, by a promoter derived from the gene

SUBSTITUTE SHEET (RULE 26) of telomerase reverse transcriptase (TERT), or also by a hypoxia inducible promoter.

US6900049, US2005 / 0074430 and WO2004 / 031357 have oncolytic adenoviruses whose replication is dependent on the hypoxia-inducible factor (hypoxia-inducible factor, HIF). The replicative and cytolytic activity of these viruses would be limited to cells whose HIF activity is increased, and in particular to cells that grow under hypoxic conditions. For this purpose, viruses carry one or more genes (ElA, ElB, E4) whose transcription is controlled by a promoter, usually artificial, that incorporates one or more hypoxia-responsive hypoxia-responsive elements.

In a recent work, Cuevas Y. and cois. (Specific oncolytic effect of a new hypoxia-inducible factor-dependent replicative adenovirus on von Hippel-Lindau- defective renal cell carcinomas; Cancer Research 2003;

63: 6877-6884) have a hypoxia-inducible oncolytic adenovirus (Ad9xHRElA) in which the expression of the ElA gene is controlled by an artificial promoter with 9 tandem copies of the hypoxia response element from the VEGF gene promoter ( vascular endothelial growth). Ad9xHRElA, also carries an E4 gene controlled by an E2F-1 promoter, so that E4 expression will be restricted to proliferating cells with significant activity

E2F, for example tumor.

It has been possible to verify, however, the existence of a compromise between the replicative selectivity of the attenuated viruses and their replicative-oncolytic efficiency.

Design and selection is still necessary and desirable

SUBSTITUTE SHEET (RULE 26) of new generations of oncolytic adenoviruses to maximize their replicative and oncolytic efficiency, maintaining their selectivity for tumor cells, and ultimately, presenting maximum anti-tumor activity and safety. This may be possible by developing new CRAds that "exploit" new regulatory mechanisms, and by selecting CRAds that, by combining different control mechanisms, have better performance. In view of the pre-clinical and clinical trials conducted to date, some specialists have ventured that oncolytic virotherapy alone will hardly be effective in the complete eradication of tumors. However, the clinical data obtained incline them to think that the use of oncolytic adenovirus in combination with radiotherapy, chemotherapy or gene therapy will allow greater anti-tumor efficacy.

It is therefore interesting and desirable, and is the object of this invention, the design of new adenovirus conditioned replication for the treatment of solid tumors and metastases in general that, together with an optimized control of replication (selectivity / oncolysis), are carriers of exogenous genes that contribute to improve antitumor efficacy.

DETAILED DESCRIPTION OF THE INVENTION

A first object of the invention relates to a recombinant conditioned replication adenovirus, which for simplicity we will refer to as adenovirus

SUBSTITUTE SHEET (RULE 26) recombinant of the invention, characterized in that it comprises: a) a promoter operatively linked to the ElA adenoviral gene comprising at least one HRE hypoxia response element; b) a promoter operatively linked to the adenoviral region E4 comprising at least one element of response to the E2F factor. c) an adenoviral ElA gene deleted in the constant region CR2; and d) an exogenous gene of interest.

For the construction of the recombinant adenovirus of the invention any human adenoviral variety or serotype (which has been isolated in humans) can be used, for example serotypes 2 (Ad2), 5 (Ad5), 11 (AdIl) or 3 (Ad3). For ease of understanding, the recombinant adenovirus of the invention is described and illustrated with examples made using the Ad5 serotype, whose complete sequence is available in GeneBank (Human adenovirus type 5, complete genome; Accession number: AC_000008; 35938 bp linear DNA VRL 26 -JAN-2005).

In the recombinant virus of the invention the viral promoter that regulates and controls the transcription of the gene encoding the ElA protein has been replaced by a promoter comprising at least one hypoxia response element (HRE) inducible by the HIF-I factor, preferably more than 3. In a more preferred embodiment, said promoter operatively linked to the ElA adenoviral gene comprises 9 tandem copies of a hypoxia response element (HRE). These elements of

SUBSTITUTE SHEET (RULE 26) HIF-I-inducible hypoxia responses can be obtained from promoters of other genes that include such elements. Such HREs can be obtained, for example, from the promoter of the VEGF vascular endothelium growth factor gene, the erythropoietin gene, or some glycolytic enzyme genes, for example enolasa-1.

As used in the present invention, "a promoter operably linked to a gene" means a DNA fragment functionally associated with the coding sequence of said gene, such that said fragment is sufficient to regulate and control the transcription of said sequence. gene coding Thus "a minimum promoter" is the minimum promoter region that includes regulatory (minimum) sequences that allow efficient control of gene transcription.

In a particular embodiment of the recombinant adenovirus of the invention, the promoter that regulates and controls transcription of the ElA gene is an artificial promoter that includes several tandem copies of the HRE derived from the human VEGF gene promoter. In a more particular embodiment, said promoter comprises the sequence SEQ. ID. NO: 1, which includes 9 tandem copies of the hypoxia response element of the VEGF-A gene, linked in a 3 'position to a TATA sequence from the rat prolactin gene promoter. This minimal artificial promoter (9xHRE promoter) has already been described by Cuevas y cois. (Cancer Research 2003; cited above).

On the other hand, in the recombinant adenovirus of the invention, the natural promoter of the genes encoding the E4 proteins has been replaced by a promoter that

SUBSTITUTE SHEET (RULE 26) it comprises at least one element of response to the E2F factor, preferably more than one. In a particular embodiment said promoter is a fragment of the human E2F-1 factor promoter comprising the regulatory sequences of the E2F-1 gene, for example a minimal promoter. In a more particular embodiment, said promoter comprises the sequence SEQ. ID. NO: 2. This minimal artificial promoter has already been described by Hernández-Alcoceba and cois ("New oncolytic adenoviruses with hypoxia- and estrogen receptor-regulated replication"; Human Gene Therapy, 2002; 13: 1737-1750). On the other hand, the use of the E2F-1 promoter to direct the expression of the ElA, ElB and E4 viral genes has been described in WO01 / 36650. As an additional mechanism for replication control, the gene encoding the ElA protein of the recombinant virus of the invention has a deletion in the constant region CR2. More specifically, said deletion affects, totally or partially, the region of CR2 necessary for protein binding of pRB retinoblastoma, so that the mutated ElA protein is unable to bind to pRB.

In a particular embodiment, the deletion comprises 8 "LTCHEAGF" amino acids (amino acids 122-129 of the ElA protein, corresponding to nucleotides 923-946 of the aforementioned sequence AC_000008). This deletion corresponds to the Delta24 deletion (Fueyo J. et al. Oncogene; 2000/19: 2-12).

In a preferred embodiment, the recombinant adenovirus of the invention comprises an ElA viral gene deleted with the Delta24 deletion and, operatively

SUBSTITUTE SHEET (RULE 26) linked to said gene, a 9xHRE promoter with SEQ sequence. ID. NO: 1; and an E4 viral gene operably linked to the human E2F-1 promoter of sequence SEQ ID NO: 2.

Additionally, the recombinant virus of the invention comprises an exogenous gene or transgene. In a preferred embodiment said exogenous gene is introduced in the place occupied by the viral genes encoding the gpl9k and 6.1k proteins, which are deleted

(nucleotides 28,555 to 29,355 of the adenovirus sequence, Gene Bank AC_000008). The introduction of this substitution has already been described by Hawkins and cois.

("Gene delivery from the E3 region of replication human adenovirus: evaluation of the 6.7 K / gpl9K region"; Gene

Therapy, 2001; 8: 1123-1131). The exogenous gene introduced into the recombinant adenovirus of the invention may be a reporter gene.

(eg luciferase) or a therapeutic gene, such as a tumor suppressor gene, an apoptosis inducing gene, an anti-angiogenic gene, a suicide gene that encodes a pro-drug activating enzyme, or an immunostimulatory gene.

In a particular embodiment of the invention the exogenous gene is the luciferase reporter gene. In another particular embodiment said exogenous gene is the thymidine kinase (TK) suicide gene. In another particular embodiment of the invention the exogenous gene is the interleukin 12 gene (IL-12). WO2004 / 031357 describes a hypoxic-regulated oncolytic virus with the IL-12 gene as a transgene.

SUBSTITUTE SHEET (RULE 26) The design of the new CRAd has advantages for its use as an oncolytic virus compared to previous versions, since several elements that determine its efficacy and specificity have been optimized: 1.- The use of a promoter that responds to hypoxia to control the ElA gene allows that the replication and cytopathic effect of the virus be stimulated under conditions of low oxygen tension. These conditions are present in solid tumors, and it has been described that they can decrease the activity of different oncolytic adenoviruses regulated by other mechanisms.

(Pipiya T. et al., Gene Therapy (2005) 12: 911-917; Shen

BH and Hermiston T.W., Gene Therapy (2005) 12: 902-910).

2.- The combined use of the Delta24 deletion in the ElA gene with the transcriptional control of the ElA gene and the E4 region achieves greater attenuation of the virus in normal cells, without negatively affecting its ability to kill tumor cells. This concept has been demonstrated for the ONYX-411 virus, in which the deletion of the El2 CR2 domain was combined with the transcriptional control of the ElA and E4 regions by the promoter

E2F-1 (Johnson et al., CeIl Cancer (2002), 1: 325-337).

It is important to note that an advantage of the recombinant adenovirus of the invention over ONYX-411 is the control of _. the ElA and E4 regions by different promoters, and specifically the use of the E2F-1 promoter in the E4 region. This allows a double replication control mechanism, while ONYX-411 depends exclusively on the pRB path in the cells. On the other hand, avoiding the repetition of sequences reduces the

SUBSTITUTE SHEET (RULE 26) possibility of recombination, increasing the stability of the viral genome.

3.- The possibility of introducing therapeutic genes into the structure of the virus increases its effectiveness because the oncolytic ability of adenovirus is linked to the exogenous gene effect. In the case of reporter genes, the visualization of infected cells over time is made possible.

Advantages of therapeutic genes.

1. Interleukin 12 (IL-12). This cytokine has several mechanisms of action that contribute to its antitumor effect. On the one hand, it stimulates the reaction of the immune system against tumors through the production of other cytokines and the activation of effector cells. On the other hand, it has an antiangiogenic effect, which hinders the vascularization of tumors and prevents their growth. These actions make the expression of IL-12 in the context of the CRAd described above present important advantages.

First, there may be a synergy in the stimulation of the immune system against the tumor, since the tumor cells will be infected by a replicative infectious agent. This fact is in itself an immunostimulatory event, which is reinforced by the local expression of IL-12.

Second, the anti-angiogenic effect of IL-12 hinders tumor oxygenation and

SUBSTITUTE SHEET (RULE 26) causes hypoxia, which stimulates the replication of CRAd. 2. Thymidine kinase from Herpes virus type I (HSV-TK).

This enzyme has the function of converting a relatively harmless drug (ganciclovir) into a potent cytotoxic agent. The cells that express HSV-TK, in the presence of exogenously administered ganciclovir, die and cause the death of the cells that are in their vicinity. Since the administration of ganciclovir can be done days after administering the CRAd, this can achieve an increase in the destruction of tumor cells once the virus has been amplified, and thus increase its oncolytic capacity. At the same time, this stops viral replication, due to the death of infected cells, and can be considered a safety mechanism in the case of replication in healthy tissues.

In addition, HSV-TK can be used as a reporter gene in humans using the technique of

Positron Emission Tomography (PET). In this way, it allows visualizing infected cells and determining the spread of the virus.

Location of exogenous genes.

The CRAd genome has been modified so that exogenous genes can be included in the E3 region. These genes take the place of the viral genes that code for the gpl9k and β.7k proteins. (Hawkins et al., Gene Therapy (2001) 8, 1123-1131). The deletion of these genes

(nucleotides 28,555 to 29,355 in the sequence of

SUBSTITUTE SHEET (RULE 26) adenovirus) does not affect the replication of the virus in tumor cells, since the gpl9k and β.7k proteins have the function of inhibiting the immune response against infected cells. Since tumor cells have their own mechanisms to inhibit their recognition by the immune system, these deletions can favor the elimination of the virus in normal cells, but not in tumor cells, and therefore contribute to the specificity of viral replication. The inclusion of exogenous genes in this location has additional advantages. On the one hand, the endogenous promoter and polyphenylation sequences of the virus are used, so it is not necessary to include these sequences exogenously. This saves space in the viral genome and larger genes can be included. On the other hand, it has been shown that the endogenous promoter that regulates gpl9k / 6.7k is activated in the late phase of the viral cycle, whereby replication of the CRAd and expression of the exogenous gene are regulated in the same way. Finally, it has been shown that expression levels exceed those obtained with the usual promoters used in gene therapy.

DNA constructs for the preparation of the recombinant adenovirus of the invention can be obtained by conventional methods of molecular biology, many of them collected in general laboratory manuals (for example, "Molecular Cloning: a

Laboratory manual ". Joseph Sambrook, David W. Russel Eds. 2001, 3rd ed. Cold Spring Harbor, New York). Also users can check in other manuals or references

SUBSTITUTE SHEET (RULE 26) specifically oriented to the preparation of adenovirus, for example:

"Adenovirus Methods and Protocols. Methods in Molecular Medicine". WoId, William S. M. Ed. 1998, Humana Press;

Mizuguchi H. and Kay M. A. "Efficient construction of a recombinant adenovirus vector by an improved in vitro ligation method"; Hum Gene Ther., 1998; 9: 2577-2583; Y

I have T. C and cois. "A simplified system for generating recombinant adenoviruses"; Proc. Nati Acad. Sci. USA, 1998; 95: 2509-2514.

Any cell line that is permissive for the replication and formation of selectively replicative recombinant virions of the recombinant adenovirus of the invention (packaging cell line) can be used for the propagation of the recombinant adenovirus of the invention. Almost any conventional human tumor cell line could be used. Among others, lines HEK293 (derived from embryonic cells), PER.Cβ (derived from embryonic retinoblasts), A549 (derived from human lung cancer), HeLa (eg HeLaS3; ATCC Cat.No. CCL-2.2) ; Yuk et al. "Perfusion cultures of human tumor cells: a scalable production platform for oncolytic adenoviral vectors". Biotechnology and Bioengineering, 2004; 86: 637-642).

For efficient propagation of the recombinant adenovirus of the invention it is also necessary that the packaging cells transfected with the adenovirus genome have increased HIF expression and activity, except for HEK293 or PER.C6 cells, which constitutively contribute the El viral genes. effect the

SUBSTITUTE SHEET (RULE 26) cells can be subjected to an inducing treatment of HIF expression, such as culture under hypoxia conditions (eg in a hypoxic chamber adjusted to a gaseous composition 93% N ₂ / β% CÜ ₂ /1% O ₂ ) , culture in the presence of cobalt chloride (eg 10OOM), or any other mimetic treatment of hypoxia conditions that is an inducer of HIF.

Thus, in a particular aspect, the present invention relates to a host cell comprising a recombinant adenovirus previously described and object of the present invention. On the other hand, the invention also relates to a process for the in vitro propagation of said adenovirus object of the present invention which comprises culturing a host cell containing a recombinant adenovirus of the invention, under conditions that allow the expression of said adenovirus. The conditions for optimizing the culture of the host cell will depend on the type of host cell used. If desired, the method of producing the recombinant adenovirus of the invention will include isolation and purification thereof.

A further object of the invention relates to a pharmaceutical composition comprising a recombinant adenovirus of the invention and a pharmaceutically acceptable excipient. The pharmaceutical composition of the invention can be formulated with a variety of conventional excipients that improve adenovirus stability during the manufacturing, handling, storage and distribution processes of the product, or that are appropriate for therapeutic administration.

SUBSTITUTE SHEET (RULE 26) For example, cryoprotectant sugars, polyols, surfactants, amino acids, polymers, buffers and salts can be used to adjust the pH of the composition, antioxidants and other chelating agents, as well as bacteriostatics and bactericides (Parkins et al. "The formulation of biopharmaceutical products "; Pharmaceutical Science and Technology Today, 2000; 3: 129-137). A sterile aqueous or non-aqueous suspension could also be used, which may contain suspending agents or thickening agents. Concrete excipients and formulations useful for the preparation of the pharmaceutical composition of the invention can be found for example in the Journal of Pharmaceutical Sciences (Evans RK et al. "Development of stable liquid formulations for adenovirus-based vaccines"; 2004, 93: 2458-2475 ), Gene Therapy (Croyle MA et al. "Development of formulations that enhance physical stability of viral vectors for gene therapy"; 2001, 8: 1281-1290), J. Virol. Methods (Hosokawa M. et al. "Preparation of purified, sterilized, and stable adenovirus vectors using albumin";2002; 103: 191-199), WO98 / 02522, WO00 / 34444, WO00 / 61726, WO03 / 049763, US6544769, US20020031527, among others.

In a particular embodiment the pharmaceutical composition will contain from 10 ³ to 10 ¹⁵ or more adenoviral particles in aqueous solution.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1. Schematic representation of the generic plasmid for the production of CRAds. The sequence of

Type 5 adenovirus is in the form of a plasmid with

SUBSTITUTE SHEET (RULE 26) Kanamycin resistance, and can be released by digestion with the restriction enzyme Pací. ElAp, ElA promoter, which is flanked by recognition sequences for BstBI. E4p, promoter of the E4 region, flanked by sequences for SwaI and

I-Ceul. ElA D24, deletion of the CR2 domain of ElA

(optional). E3Dgpl9k / β .7k, partial deletion of the region

E3 for the insertion of exogenous genes. LP, late promoter of the virus. Figure 2. Schematic representation of the AdHLuc, AdDHLuc, AdDHTK, AdDHIL-12 and AdWTLuc viruses. ITR, Inverted Terminal Repeat; HRE, ^' Hypoxia Response Element; E2F-lp, promoter of the transcription factor E2F-1. D24, deletion of the CR2 domain of ElA. Figure 3. Cytopathic effect of AdHLuc, AdDHLuc and AdWT in Huh-7 human hepatocarcinoma cells (Figure A) and in normal IMR-90 fibroblasts (Figure B). Relative survival is represented with respect to uninfected cells cultured under the same conditions, comparing survival when the cells were maintained in hypoxia conditions compared to that observed in normoxia conditions. Huh-7 cells were infected with 5 viruses / cell, and IMR-90 fibroblasts with 135 viruses / cell to compensate for their lower adenovirus infectivity. The cytopathic effect was evaluated at 5 days after infection for Huh-7 cells and at 10 days for IMR-90 fibroblasts. The asterisk indicates significant differences (p <0.05)

Figure 4. Cytopathic effect of AdHLuc, AdDHLuc and AdWT viruses on WI-38 cells (infected with

250 virus / cell) and WI38-VA13 (125 virus / cell), when

SUBSTITUTE SHEET (RULE 26) The cells were grown under normoxia or hypoxia. The cultures were photographed (20Ox) 5 days after infection. Cells that undergo cytopathic effect by viric replication are distinguished by loss of adhesion, with increased refringence and rounded morphology.

Figure 5. Cytopathic effect of the AdHLuc, AdDHLuc and AdWT viruses on BJ cells (infected with 500 viruses / cell) and IMR-90 (125 viruses / cell), for cells maintained under normoxia or hypoxia conditions. Photographed (20Ox) also at 5 days. Cells that undergo cytopathic effect by viric replication are distinguished by loss of adhesion, with increased refringence and rounded morphology. Figure 6. Cell viability assay in Huh-7 and IMR-90 cells infected with AdDHLuc virus

(triangles) or AdHLuc (squares), at different viral doses (MOI, "multiplicity of infection", number of viruses per cell). The cultures were maintained in hypoxic conditions (dashed line) or normoxia.

(continuous line) . Survival was quantified by staining with violet crystal at 6 days (Huh-7) or 8 days (IMR-90) from infection with the virus to be tested.

The asterisk indicates significant differences (p <0.05) Figure 7. Control of replication by hypoxia.

Graphical comparison of the amount of infective viral particles (i.u./ml) produced in A549 cells infected with an MOI of 1 virus / virus cell

AdDHLuc or AdWT, when they remained in hypoxia or normoxia conditions for 4 days. units

SUBSTITUTE SHEET (RULE 26) infective The asterisk indicates significant differences (p <0.05).

Figure 8. Graphical comparison of in vitro expression of luciferase (represented as RLU / μg of total protein; RLU, relative luciferase units) in Huh-7 cells infected by the AdDHLuc, AdHLuc viruses,

AdWTLuc or AdCMVLuc when they were kept in hypoxia or normoxia conditions. Infection: MOI of 10 viruses / cell.

The asterisk indicates significant differences (p <0.05). Figure 9. Cytotoxicity of the AdDHTK virus in response to hypoxia and GCV treatment. Graphic comparison of the viability of A549 cells infected with an MOI of 0.12 virus / cell under normoxia and hypoxia conditions, after 5 days of incubation with a normal culture medium or supplemented with 100 μM GCV. The asterisk indicates significant differences (p <0.05).

Figure 10. Control of the expression of IL12 in the AdDHIL12 virus. Graphical comparison of the increase in IL12 production measured in the supernatant of HeLa cells infected with the AdDHIL12 virus under conditions of normoxia or hypoxia. The asterisk indicates significant differences (p <0.05).

Figure 11. In vivo expression of luciferase in athymic mice with human tumor xenografts (Huh-7 cells), after infection (by intratumoral injection) with the AdDHLuc, AdDHWT and Ad-CMV-Luc viruses.

A: Luciferase activity in subcutaneous tumors at different times after infection with 2xlO ⁸ iu of the virus to be tested. B: Increase in luciferase activity compared to day 1 in the same mice. C: Tumors induced by intrahepatic injection of Huh-7 cells;

SUBSTITUTE SHEET (RULE 26) Infection with 10 ⁹ iu of the AdDHLuc virus. The light emission (expressed in photons / second) was quantified over time by means of a luminometric chamber. The asterisk indicates significant differences (p <0.05).

EMBODIMENT OF THE INVENTION

The following examples are intended to illustrate, in no way limitative, the embodiment of the invention object of the present patent application.

Example 1. Construction and propagation of recombinant adenoviruses

In accordance with the specifications of the invention, 3 recombinant adenoviruses were constructed, each with a different transgene:

- AdDHLuc, which incorporates the luciferase gene (reporter);

- AdDHTK, which incorporates the Herpes simplex virus thymidine kinase gene (HSV-TK, suicide gene); and - AdDHIL-12, to which the interleukin-12 gene (IL-12, therapeutic gene) has been incorporated.

In the 3 adenoviruses: i) the ElA gene promoter has been replaced by a synthetic promoter (SEQ. ID. NO: 1) that responds to hypoxia; ii) the E4 region promoter has been replaced by the E2F-1 transcription factor promoter (SEQ. ID. NO: 2); iii) a deletion (Delta24 deletion) has been made in the CR2 domain of the ElA gene; and iv) the genes of interest have been introduced to replace the gpl9k / β.7k genes of the E3 region.

SUBSTITUTE SHEET (RULE 26) In addition, other recombinant adenoviruses that have been used as controls in the experiments were prepared and used:

- AdWT, wild type 5 adenovirus (ATCC VR-5); - AdWTLuc, which differs from AdWT in the inclusion of the luciferase gene in place of the gpl9k / β.7k genes of the E3 region;

- Ad-CMV-Luc, a defective adenovirus that expresses the luciferase gene under the control of the CMV promoter (Vector Biolabs, Philadelphia, Ref. 1000); Y

- AdHLuc, which differs from AdDHLuc because it has not been deleted (Delta24 deletion) in the CR2 domain of the ElA gene.

Plasmid Construction

For the construction of the recombinant adenoviruses used in the examples, the plasmid, pSEHE2F, was used as the initial reagent. This plasmid is based on the adenovirus type 5 genome, modified to facilitate the replacement of the ElA and E4 promoters with tumor-specific promoters (Hernández Alcoceba R. et al. Human Gene Therapy (2002) 13: 1737-1750). On the adenoviral genome, recognition sequences have been introduced for restriction enzymes in specific regions and exogenous promoters that can be easily substituted:

- ElA promoter region (ElAp) flanked by recognition sequences for the BstBI enzyme (pSEHE2F contains in this region the artificial promoter 5XEH3, which will be replaced by the 9XHRE promoter in the viruses object of the invention);

SUBSTITUTE SHEET (RULE 26) - E4 promoter region (E4p) flanked by recognition sequences for the I-Ceul and SwaI enzymes (pSEHE2F contains in this region the promoter for factor E2F-1, which will be maintained in the viruses object of the invention). This last promoter was obtained by Polymerase Chain Reaction (PCR) from human genomic DNA using the following oligonucleotides: SEQ ID NO 3: 5 'TACTGTAACTATAACGGTCCTAAGGTAGCGTGGTACCATCCGGACAAAGCC-S' and, SEQ ID NO 4: 5 'TAAGTATTTAGG .

An insulating sequence (referred to herein as "Ins") is present in pSEHE2F between the adenovirus packaging sequence and the ElA promoter region. This sequence (transcription stop sequence of the bovine growth hormone gene) was obtained from plasmid pCDNA3 (Invitrogen) by digestion with the enzymes PvuII and Notl. Plasmid pSHE2F was modified in successive stages to obtain the plasmids necessary to produce the viruses of the invention and their controls: .- Introduction of the 9XHRE promoter in the ElA region.

Plasmid PSEHE2F was digested with BstBI, and the 5XEH3 promoter was replaced by the 9XHRE promoter. To introduce the BstBI restriction sites on both sides of the promoter, an adapter consisting of the following pair of oligonucleotides was used:

SEQ ID NO 5: 5Bstbam: 5 'CGAAGATCTGACTCCAAG 3' and SEQ ID NO 6: 3Bstbam: 5 'GATCCTTGGAGTCAGATCTT 3'.

SUBSTITUTE SHEET (RULE 26) The correct orientation of the promoter was verified by digestion with the restriction enzyme BamHI and sequencing using the following oligonucleotides: SEQ ID NO 7: 5Ad5St: 5 'TAGTGTGGCGGAAGTGTGATGTTG 3' and SEQ ID NO 8: 3Ad5St: 5 'TCTTCGGTAATAACACCTCCG.

This new plasmid was called pSHIFE2F. .- Partial deletion of the E3 region.

Plasmid pSHIFE2F was modified to delete the genes encoding gpl9k / 6.7k (Dgpl9k / β .7K) and flanking this area with recognition sequences for the Pl-Scel enzyme, which will allow the incorporation of exogenous genes. To obtain the deletion, successive stages of subcloning were carried out. First, a 4.7 kb fragment was obtained by digestion of plasmid pSHIFE2F with the AgeI enzyme, and subcloned into the Agel site of commercial plasmid pMIB / V5-HisC

(Invitrogen). This new plasmid (called pMIB-AgeC) was digested simultaneously with the Spel and Xbal enzymes and a fragment obtained by PCR was introduced in this position into which a restriction site for the Xmnl enzyme has been introduced at position 28555 relative to the genome of adenovirus type 5. This PCR fragment was obtained with the following pair of oligonucleotides:

SEQ ID NO 9: 5Spel: 5 'AAGGACTAGTTTCGCGCCCTTTCTCAAATTTAAGC 3', and SEQ ID NO 10:

3XmnI: 5 'CCGATTCTAGAGAAACCTGAATTAGAATAGCCCGTAGAGTTGCTTGA AATTGTTCTAAACCCCAC 3', using plasmid pSEHE2F as a template. The new plasmid was called pMIB-E3Xmn.

SUBSTITUTE SHEET (RULE 26) Subsequently, a digestion of pMIB-E3Xmn was carried out with the enzyme Muñí (which cuts at position 29355 relative to adenovirus type 5), and a partial digestion with Xmnl so that it is only cut at position 28555. Once the plasmid is opened through these two sites and removing the fragment between them, a ligation reaction was carried out to insert a sequence recognizable by the enzyme Pl-Scel (adapter Pl-Scel). This adapter was obtained by mixing the following pair of oligonucleotides that hybridize with each other: SEQ ID NO 11:

5PI-Sce: 5 'ACGTAATCTATGTCGGGTGCGGAGAAAGAGGTAATGAAATGGCA 3' and, SEQ ID NO 12:

3PI-Sce: 5 'TGCCATTTCATTACCTCTTTCTCCGCACCCGACATAGATTACGT 3'.

The resulting plasmid is called pMIB-PIScel, and it has the Pl-Scel site where the adenoviral genes that code for

To incorporate this deletion into the genome of adenoviral vectors, plasmid pMIB-PIScel was digested with Agel and Seal enzymes simultaneously, and the 4.1 kb fragment obtained was introduced into plasmid pSHIFE2F digested with the same enzymes. In this way, a plasmid is generated that contains the desired deletion, but is incomplete because it has lost the initial regions of the adenoviral genome. However, from this plasmid the 7.7 kb fragment comprised between the SwaI and Spel enzymes was obtained, which was introduced into the plasmid pSHIFE2F instead of the homonymous fragment. In this way, the genes that

SUBSTITUTE SHEET (RULE 26) coding for gpl9K / 6.7k viral proteins were deleted and instead the Pl-Scel restriction site was introduced that can be used for the incorporation of exogenous genes in this area, since it is not present in any other region of the virus. The first exogenous gene that was introduced in the E3 region was the luciferase reporter gene, obtained from plasmid pGL3-Basic (Promega). The 1.6 kb fragment between the HindIII and Xbal sites encoding luciferase was treated with the enzyme T4 polymerase to achieve blunt ends, and was introduced into the Pl-Scel site that had been treated in the same way in the modified adenoviral plasmid previously. The resulting plasmid is called pSHE2F-Luc. To facilitate the subcloning of other genes in the E3 region, it is more convenient to use recognition sites for the CIaI enzyme instead of Pl-Scel, because the latter is very large and its symmetrical repetition can cause plasmid recombinations. To do this, it is possible to digest with Pl-Scel, blunt the ends with T4 DNA Polymerase, and introduce a CIaI adapter consisting of the pair of oligonucleotides: SEQ ID NO 13: 5CIa: 5 'CCTATATCGATAGCCT 3' and SEQ ID NO 14: 3CIa: 5 'AGGCTATCGATATAGG 3'. The sequence that is intended to be introduced can be flanked by CIaI sites by ligation of these adapters or by PCR reaction using oligonucleotides that include the recognition sequence for CIaI. If the exogenous gene of interest has internal CIaI sites, as with the

SUBSTITUTE SHEET (RULE 26) interleukin 12, NarI sites, which are compatible with CIaI, can be used.

.- Deletion of the CR2 domain of the ElA gene.

Deletion of bases 922 to 947 of the adenoviral genome was performed by PCR, using the adenovirus genome type 5 as a template. Initially two fragments were generated. One of them, called AB, was amplified using the oligonucleotide pair: SEQ ID NO 15: AElA: 5 'TCAGTATTCGAATCGCGACTCTTGAGTGCCAGCGAG 3' and

SEQ ID NO 16: BElA: 5 'ATCGATCACCTCCGGTACAAGGTTTGG 3'.

The second, called BC, was amplified with the oligonucleotides: SEQ ID NO 17: CElA: 5 'AACCTTGTACCGGAGGTGATCGATCCACCCAGTGACGACGAGGATGAA GAGG 3' and, SEQ ID NO 18:

DElA: 5 'AAGGCGTTAACCACACACGCAATCACAGGTTTACACCTTATGGCC 3'

The AB and BC fragments have a homology region, so that if they are mixed they can partially hybridize. This region has been designed to exclude the bases between position 922 and 947. If the hybridization of these two fragments is used as a template for a PCR reaction with oligonucleotides AElA and

DElA, a fragment (AD) flanked by BstBI and Hpal sites is obtained in which the CR2 domain of the ElA gene has been deleted. This fragment must then be introduced into plasmid pSHE2F-Luc. To make this possible, pSHE2F-Luc was digested with the EcoRV enzyme and re-ligated. In this way a much smaller plasmid is obtained, which contains only one Hpal site. This new plasmid was then digested with BstBI and Hpal and

SUBSTITUTE SHEET (RULE 26) incorporated the PCR fragment. This intermediate plasmid was named pSdlElA, which has incorporated the modified ElA gene but has lost the 9XHRE promoter and the sequence between bases 9197 and 33756. The 9XHRE promoter was reintroduced using the BstBI site. To restore the rest of the adenoviral genome, the 14.8 kb fragment comprised between the Sdal sites was initially subcloned. A triple ligation was then carried out to fuse 3 fragments between RsrII sites that restore the modified viral genome. The 14 kb fragment comes from the plasmid that contains the deletion in the CR2 domain of ElA and the 9XHRE promoter, while the 17 kb fragment (from plasmid pSHE2F-Luc) contains the luciferase gene in the E3 region. Finally, the genome is completed with the 7.7 kb fragment also from pSHE2F-Luc. The plasmid resulting from this fusion was called pSDHE2F-Luc. .- Construction of pAdLuc. For this, the 12.5 kb fragment between the Ndel sites of plasmid pSHE2F-Luc was obtained and introduced into the homonymous sites of plasmid pTG3602. In this way a plasmid with the luciferase gene is obtained by replacing the gpl9k / 6.7k genes in the context of the adenovirus type 5 genome, without other modifications. .- Construction of pSDHE2F-TK.

For this purpose, a fragment consisting of the coding sequence for the optimized TK-protein (SEQ ID NO 19, flanked by sites) was obtained by PCR.

SUBSTITUTE SHEET (RULE 26) CIaI recognition. The oligonucleotides used were: SEQ ID NO 20:

5CIaTK: 5 'GTACTATCGATGCTAGCCACCATGGCTTCGTACC 3' and SEQ ID NO 21:

3CIaTK: 5 'GTACTATCGATAAGCTTAAGTCAGTTAGCCTCC 3' This fragment was digested with CIaI and subcloned into a plasmid based on pSDHE2F-Luc, in which the E3 deletion is flanked by CIaI sites, as described in the previous section. In this way the luciferase gene is replaced by the TK gene. .- Construction of pSDHE2F-IL12.

For this purpose, a fragment consisting of the coding sequence for an optimized version of murine interleukin 12 (fusion protein of subunits p35 and p40, SEQ ID NO 22, Lieschke et al., Nat Biotechnol (1997) 15 was obtained by PCR. : 35-40), flanked by NarI recognition sites. The oligonucleotides used were: SEQ ID NO 23:

5NARIL12: 5 'GTACTGGCGCCACCATGGGTCCTCAGAAGCTAACC 3' and

SEQ ID NO 24:

3NarIL12: 5 'GTACTGGCGCCTAATCCGGATCAATTCTCAGG 3' This fragment was digested with NarI and subcloned into the CIaI site of the pro-viral plasmid described above. In this way the luciferase gene is replaced by the interleukin 12 gene.

SUBSTITUTE SHEET (RULE 26) The general structure of the modified plasmids is depicted in Figure 1, and a genome skeleton of the recombinant viruses is shown in Figure 2.

Obtaining viral particles

The plasmids described above were digested with the enzyme Pací, which releases the viral genome from the rest of the bacterial sequences, and transfected into 293 cells (ATCC CRL-1573) by the calcium phosphate precipitation method. Once the cytopathic effect was observed (typically 7-10 days after transfection), the cells were used by 3 consecutive cycles of freezing and thawing. Serial dilutions of the lysate were made and with them A549 cells (ATCC CCL-185; from human lung cancer) were infected under hypoxic conditions (1% oxygen). In this way several clones of the viruses were obtained, which were verified by PCR. The new viruses obtained from plasmids pSHE2F-Luc, pSDHHE2F-Luc, pSDHE2F-TK, pSDHE2F-IL12 and pAdLuc were named AdHLuc, AdDHLuc, AdDHTK, AdDHIL12 and AdWTLuc, respectively.

Amplification and purification of viruses Viruses were amplified in A549 cells maintained under hypoxia in the case of AdHLuc, AdDHLuc,

AdDHTK, AdDHIL12, and in 293 cells in the case of AdWTLuc. Purification was carried out by standard techniques using a Cesium gradient and subsequent passage through an exclusion column. The virus obtained was stored in a medium buffered with 10% glycerol at -80 ° C

SUBSTITUTE SHEET (RULE 26) until the moment of its use. Titration was carried out by observing the cytopathic effect after limited dilution in 293 cells, verified by immunohistochemical assays with an anti-adenovirus antibody (Adeno-X Rapad Titer Kit, BD Biosciences Clontech Cat. No. K1653-1).

Example 2. Characterization of the AdDHLuc virus in vitro

The activity of the AdDHLuc virus against control viruses in different cell types was analyzed, both in normal conditions and in hypoxia.

The following parameters were analyzed: - the cytopathic effect, by staining with the violet crystal dye; - replication and production of new viral particles by limiting dilution in 293 cells or immunohistochemistry with anti-adenovirus antibodies (Adeno-X Rapad Titer Kit, BD Biosciences Clontech Cat. No. K1653-1); and - the expression of exogenous genes (luciferase).

Cytopathic effect

The main feature sought in CRAds is their ability to selectively induce the death of tumor cells.

The tests to evaluate this cytopathic effect were performed as follows:

1. Sowing the cells in different wells in each plate (for growth in normoxia and hypoxia respectively): 5xlO ³ cells / well in 96-well plates in appropriate medium for the cell line.

SUBSTITUTE SHEET (RULE 26) 2. At 24 hours, infection with the virus to be tested (one type of virus per well, eg AdWT, AdHLuc or AdDHLuc); The viral concentration was adjusted to each cell line based on the infectivity for that line. 3. Incubation at 37 ° C under hypoxic conditions (chamber adjusted to a gaseous composition of 93% N2 / 6% CO2 / 1% O ₂ ) or normoxia (environmental gaseous composition).

4. When AdWT caused obvious cytopathic effect on the cultures, staining with violet crystal and quantification of the surviving cells.

5. Calculation of relative survival (%) with respect to cells in control wells, grown under the same conditions but not infected by the virus. For the culture of the Huh-7 cells, A549 DMEM medium (Gibco) was used and for the IMR-90, WI-38, WI38-VA13 and BJ cells MEM medium (Gibco) was used. The maintenance medium was supplemented with 10% fetal bovine serum, the proportion of which was reduced during 2% infection. In all cases a mixture of antibiotics (penicillin 50 IU / L - streptomycin 50 mg / mL; Biowhittaker) and antifungal agents (amphotericin-B 2.5 mg / mL; Gibco) was added to the culture media.

Initially Huh-7 tumor cells (Nakabayashi et al. 1982 were infected. Cancer Res., 42: 3858-3863; from human hepatocarcinoma) and A549 (ATTC CCL-185; from human lung cancer), and normal IMR cells -90 (ATCC CCL-186; from primary human lung fibroblasts) with the various viruses.

SUBSTITUTE SHEET (RULE 26) As can be seen in Figure 3, both AdDHLuc and AdHLuc were able to eliminate tumor cells when they grow under conditions of low oxygen tension (hypoxia). The cytotoxic effect on hypoxia was similar to that observed with the AdWT wild adenovirus (Figure 3A). These conditions reproduce the situation found in solid tumors. Instead, viruses are attenuated in the presence of oxygen

(normoxia). To check the degree of virus selectivity, normal cells (IMR-90) were infected, Figure 3B. The most similar conditions to healthy tissues are normal cells in normoxia, and in these conditions both AdDHLuc and AdHLuc are attenuated

(less than 30% cell death). However, when normal cells are exposed to low oxygen tension, AdHLuc is more cytopathic than AdDHLuc. This is consistent with the design of these viruses, since in the case of AdHLuc hypoxia is capable of triggering viral replication by activation of the ElA promoter, both in tumor and normal cells. In contrast, the additional security mechanism of AdDHLuc, consisting of the deletion of the CR2 domain of the ElA gene, attenuates the virus in normal cells even in the presence of hypoxia. Ultimately, the data in Figure 3 suggest that AdDHLuc has a cytotoxic potency equal to

AdHLuc and close to AdWT on tumor cells, but advantageously it is strongly attenuated in normal cells.

To confirm this point, the behavior of the viruses in normal human fibroblasts WI-38 (ATCC CCL-75) and fibroblasts WI38-VA13 was studied

SUBSTITUTE SHEET (RULE 26) (ATCC CCL-75.1), which have been maligned by the expression of SV40 T antigen, which blocks the pRB path. WI38-VA13 cells have impaired cell cycle control, and therefore it is expected that the AdDHLuc virus is not attenuated with respect to AdHLuc. Likewise, tests were carried out with normal BJ cells (ATCC CRL-2522; from primary human skin fibroblasts).

Figure 4 shows photomicrographs of normal WI-38 and malignant WI38-VA13 fibroblasts infected with the different viruses under hypoxia or normoxia conditions. The cells that are suffering from the cytopathic effect of the virus are distinguished because they lose adhesion to the culture plate and acquire a rounded morphology. As can be seen, AdDHLuc is the virus that is most attenuated in normal cells, while retaining its ability to kill malignant cells.

These observations were repeated on other types of normal cells, such as IMR-90 and BJ cells, as shown in Figure 5.

Cytotoxicity at different viral concentrations

In order to study in more detail the cytopathic effect of the AdDHLuc and AdHLuc viruses, the viability of tumor (Huh-7) and normal (IMR-90) infected cells with different viral concentrations was determined, both under normoxia and hypoxia (as described above). As can be seen in Figure 6, hypoxia significantly activated the cytotoxicity of both AdDHLuc

SUBSTITUTE SHEET (RULE 26) as of AdHLuc in tumor cells, eliminating around 90% of the cells with an MOI of 5 viruses / cell. The effect was similar to that observed with AdWT

(not shown in the graph). On the other hand, the activation exerted by hypoxia in normal cells was significantly lower in the case of AdDHLuc compared to

AdHLuc, which confirms greater attenuation and the operation of the double control system for its replication. It is important to note that in this type of experiments the decrease in cell viability at low doses is dependent on viral amplification, so this test also indirectly reflects the control of virus replication.

Viral replication

In order to directly analyze the control of AdDHLuc replication, A549 cells were infected with the virus under normoxia or hypoxia conditions, and the production of new infective particles was quantified after days.

The cells were seeded, infected and grown in the same manner as in the tests to evaluate the cytopathic effect. In this case, 4 days after infection, the cells were used by 3 freeze-thaw cycles and the infective particles were quantified by limit dilution in 293 cells or by immunohistochemistry with anti-adenovirus antibodies (Adeno-X Rapad Titer Kit , BD Biosciences Clontech Cat. No. K1653-1) following the instructions

SUBSTITUTE SHEET (RULE 26) manufacturer. The result was expressed as infective units per mL (iu / ml).

As can be seen in Figure 7, hypoxia activated the amplification of the AdDHLuc virus, while the same does not happen with AdWT, whose replication did not undergo changes in these experimental conditions.

Exogenous gene expression (luciferase)

The location of the luciferase reporter gene in the E3 region of the AdDHLuc virus allows monitoring of the expression of exogenous genes introduced into the virus. At the same time, luciferase expression is increased in response to viral replication, due to the activation of late promoters and the increase in the number of copies of the viral genome in the cell. Therefore, measuring luciferase activity is an indicator of viral replication.

To this end, Huh-7 cells were seeded and infected with the AdDHLuc, AdHLuc, AdWTLuc replicative viruses, and with the Ad-CMV-Luc defective virus (Vector Biolabs Cat. No. 1000). The dose of virus used (MOI) was 10 viruses / cell, and the cells were cultured in the same manner as in the tests for cytopathic effect evaluation. Two days after infection, the cells were used to measure Luciferase activity using a commercial kit (Luciferase Assay System, Promega Cat. No. E4030), following the manufacturer's instructions. The activity was expressed as RLü / μg of total protein (RLU: Relative Luciferase Units).

SUBSTITUTE SHEET (RULE 26) Figure 8 shows how this activity increases with hypoxia in cells infected with AdDHLuc, and AdHLuc, while the same does not occur with AdWT and Ad-CMV-Luc, the two viruses not regulated by hypoxia. It can also be seen that the ability to express genes is much greater in the case of replicative viruses against the defective AdCMVLuc virus.

Ultimately, the experiments described in this example 2 demonstrate that all activity parameters studied for AdDHLuc are increased in hypoxic conditions, preferably in tumor cells.

Example 3. Characterization of the AdDHTK virus In v ± tro To check the function of the AdDHTK virus, the cytopathic effect obtained after infection of the A549 cells, in the presence or absence of the Ganciclovir pro-drug (GCV), was analyzed. The test was performed as described in example 2, with the following modifications. The cells were infected with different AdDHTK MOIs under conditions of normoxia or hypoxia, and 24 hours later the infectious medium was removed and two types of wells were differentiated. In one of them standard culture medium with 2% fetal bovine serum was added, and in the other GCV (100 μM) was included. Cell survival was quantified 5 days later. Figure 9 shows the data obtained when A549 cells were infected with an MOI of 0.12 virus / cell. As can be seen, this small amount of virus did not significantly decrease the survival of tumor cells under conditions

SUBSTITUTE SHEET (RULE 26) of normoxia, but activation of the cytopathic effect was observed when the cells remained in hypoxia. As expected if the virus expresses a functional TK enzyme, the viability of GCV treated cells was significantly lower. This indicates that the regulation of viral replication in these cells is maintained, and that the therapeutic TK gene can increase the antitumor effect of the virus. This is especially important in the case that tumor cells are exposed to a low amount of virus, as is usually the case in tumors in vivo. Example 4. Characterization of the AdDHILl2 virus in vitro

To check the function of the AdDHIL12 virus, HeLa cells (ATTC CCL-2) were seeded in 24-well plates (2xlO ⁴ cells / well), and infected with the AdDHIL12 virus under normoxia or hypoxia conditions. Since IL12 is a secretable protein, its production in the culture medium was quantified at different times after infection. The detection of murine IL12 was carried out by a commercial ELISA kit (BD

Bioscience) Graph 10 shows the increase in IL12 production in response to hypoxia over time. As can be seen, the amount of

IL12 practically does not increase under normoxia conditions, but there is a significant increase at 3 days if the cells are maintained in hypoxia conditions. These data confirm that the AdDHIL12 virus is amplified over time in response to hypoxia, and as a result there is an increase in IL12 in a microenvironment that mimics the expected conditions in solid tumors.

SUBSTITUTE SHEET (RULE 26) Example 5. Activity tests ± n live

To evaluate the in vivo activity of the recombinant adenoviruses, human tumor xenotransplants were performed in atomic mice (immunosuppressed) by subcutaneous injection (IxIO ⁷ cells in 150 μl saline serum) or intrahepatic (1.5 x ⁶ cells in 50 μl serum) of Huh-7 cells. At 20 days, the virus to be tested (AdDHLuc, Ad-CMV-Luc and AdWTLuc) was injected by intratumoral injection. 24 hours after the injection of the virus, the measurement of luciferase activity was started, performed daily for 10 days. For this, the luciferin substrate was administered intraperitoneally.

(150 μg / ml dissolved in PBS). Thanks to the luciferase reporter gene, the expression kinetics and biodistribution of viruses can be monitored in live animals by measuring the emission of light using a high-sensitivity luminometric camera (In vivo imaging system, Xenogen). Under these conditions, the light emission

(photons / second) responds to a balance between viral replication and the death of infected cells.

As can be seen in Figure HA, a defective adenovirus (unable to replicate) such as Ad-CMV-Luc maintains the initial expression levels during the first week and then initiates a slow decrease. In contrast, AdDHLuc showed a significant increase in luciferase activity during the first 4 days. Figure HB illustrates the luciferase activity relative to the first day post-infection and shows how only in the case of AdDHLuc there is a significant increase in successive days. This is compatible with the achievement of several replication cycles in the

SUBSTITUTE SHEET (RULE 26) tumor. In the case of AdWTLuc, a very intense initial expression and an increase on the second day were observed, followed by a very pronounced decrease. This may be due to the induction of a faster cytopathic effect on infected cells.

To check the behavior of AdDHLuc in liver tumors, Huh-7 cells were injected into the liver of the mice and subsequently the virus was administered (10 ⁹ i.). In figure HC it can be observed how very high levels of expression are achieved and the increase in the first days is confirmed and then stabilized and a slow descent begins.

In summary, these data indicate that AdDHLuc is a CRAd capable of serving as an expression vector for exogenous genes with efficacy superior to non-replicative adenoviruses.

SUBSTITUTE SHEET (RULE 26)

Claims

1. - A recombinant conditioned replication adenovirus, characterized in that it comprises: a) a promoter operatively linked to the adenoviral ElA gene comprising at least one HRE hypoxia response element; b) a promoter operatively linked to the adenoviral gene E4 comprising at least one element of response to the E2F factor; c) an adenoviral ElA gene deleted in the CR2 domain; and d) an exogenous gene of interest.

2. A recombinant adenovirus according to claim 1, characterized in that said promoter operatively linked to the adenoviral ElA gene comprises 9 tandem copies of a hypoxia response element.

3. A recombinant adenovirus according to any one of claims 1 or 2, characterized in that said hypoxia response elements are derived from the human vascular endothelial growth factor (VEGF) promoter.

4. A recombinant adenovirus according to one of claims 1 to 3, characterized in that said promoter operatively linked to the adenoviral ElA gene comprises SEQ. ID. NO: 1.

SUBSTITUTE SHEET (RULE 26)

5. A recombinant adenovirus according to one of claims 1 to 4, characterized in that said E2F-1 response promoter comprises SEQ. ID. NO: 2.

6. - A recombinant adenovirus according to any one of claims 1 to 5, characterized in that said deletion in the CR2 domain is a Delta24 deletion.

7. A recombinant adenovirus according to one of claims 1 to 6, characterized in that it comprises: a) a promoter operably linked to the adenoviral ElA gene of sequence SEQ ID NO: 1; b) an E2F-1 response promoter operably linked to the adenoviral gene E4 of sequence SEQ. ID. NO: 2; c) an adenoviral ElA gene deleted in the CR2 domain with the Delta24 deletion; and d) an exogenous gene of interest.

8. A recombinant adenovirus according to any one of claims 1 to 1, characterized in that said exogenous gene is a reporter gene.

9. A recombinant adenovirus according to claim 8, characterized in that said reporter gene encodes luciferase.

10. A recombinant adenovirus according to any one of claims 1 to 7, characterized in that said exogenous gene is a suicide gene.

SUBSTITUTE SHEET (RULE 26)

11. A recombinant adenovirus according to claim 10, characterized in that said exogenous gene is the thymidine kinase gene.

12. A recombinant adenovirus according to any one of claims 1 to 7, characterized in that said exogenous gene is a therapeutic gene.

13. A recombinant adenovirus according to claim 12, characterized in that said exogenous gene is the interleukin 12 gene.

14. A host cell comprising a recombinant adenovirus described in any one of claims 1 to 13.

15. A method for in vitro propagation of a recombinant adenovirus according to one of claims 1 to 13, characterized in that it comprises: a) culturing a host cell containing said recombinant adenovirus under conditions that allow adenovirus expression; and b) isolate and purify the adenovirus.

16. A composition characterized in that it comprises a recombinant adenovirus described in one of claims 1 to 13 and a pharmaceutically acceptable excipient.

SUBSTITUTE SHEET (RULE 26)