KR100707832B1 - Molecular marker for the seed coat color of soybean - Google Patents

Abstract

The present invention relates to a molecular label for analyzing genotypes related to the seed color of soybean. Specifically, primers of PCR-based labels cosegregated with I or T loci involved in determining seed color in soybean. The pairs of primers may be used as longitudinal molecular markers in molecular breeding programs.

Soybean, seed color, molecular label, co-separation, I locus, T locus

Description

Molecular marker for the seed coat color of soybean}

1 is a schematic diagram of a branch of the phenylpropanoid pathway leading to biosynthesis of proanthocynidins and anthocyanins,

Figure 2 is a map showing the position of the SSR label on the BAC clone sequence containing the I locus,

Figure 3 is a schematic diagram showing the location of the deletion / insertion polymorphism of the intron II site of the F3'H gene in the arrangement of genomic sequences of the F3'H gene of the seven strains,

Figure 4 shows the position of the SNP in the sequence of genomic sequences of the F3'H gene of the seven strains and the nucleotide sequence of the allele-specific forward primer corresponding to the SNP,

Figure 5 is a photograph confirming the microsatellite polymorphism using SSR markers I-TA01, I-TA02 and I-AT06 in 16 strains,

6 is a genetic map of the molecular association group A2 including the I locus mapped in the RILs population by hybridization of Hwangkeumkong ( Glycine max ) and IT182932 ( G. soja ),

Figure 7a is a photograph confirming the polymorphism of the indel mutation using STS marker F3'H-STS in 16 strains, 7b is a photograph confirming the polymorphism of the indel mutation using the SNP marker F3'HC gap. ego,

8 is a genetic map of the molecular association group C2 including the T locus mapped in the RILs population by hybridization of Hwangkeumkong ( Glycine max ) and IT182932 ( G. soja ).

1.Buzzell, R.I., B.R. Buttery and D.C. Mactavish (1987) Biochemical genetics of black pigmentation of soybean seed. J. Hered. 78: 53-54.

Clough, SJ, JH Tuteja, M. Li, LF Marek, RC Shoemaker and LO Vodkin (2004) Features of a 103-kb gene-rich region in soybean include an inverted perfect repeat cluster of CHS genes comprising the I locus. Genome 47: 819-831

3. Dixon, R.A. and L.W. Summer (2003) Legume natural products: Understanding and manipulating complex pathways for human and animal health. Plant Physiol. 131: 878-885.

4. Nicholas, C. D., J. T. Lindstrom and L.O. Vodkin (1993) Variation of proline rich cell wall proteins in soybean lines with anthocyanin mutations. Plant Mol. Biol. 21: 145-156.

5.Senda, M., A. Jumonji, S. Yumoto, R. Ishikawa, T. Harada, M. Niizeki, and S. Akada (2002) Analysis of the duplicated CHS1 gene related to the suppression of the seed coat pigmentation in yellow soybeans. Theor. Appl. Genet. 104: 1086-1091.

Senda, M., C. Masuta, S. Ohnishi, K. Goto, A. Kasai, T. Sano, JS Hong and S. Mac Farlane (2004) Patterning of virus-infected Glycine max seed coat is associated with suppression of endogenous silencing of chalcone synthase genes. Plant Cell 16: 807-818.

7.Toda, K., D. Yang, N. Yamanaka, S. Watanabe, K. Harada and R. Takahashi (2002) A single-base deletion in soybean flavonoid 3'-hydroxylase gene is associated with gray pubescence color. Plant Mol. Biol. 50: 187-196.

Todd, JJ and LO Vodkin (1993) Pigmented soybean ( Glycine max ) seed coats accumulate proanthocyanidins during development. Plant Physiol. 102: 663-670.

9. Todd, JJ. and E.O. Vodkin, (1996) Duplications that suppress and deletions that restore expression from a chalcone synthase multigene family. Plant Cell 8: 687-699.

10.Tuteja, JH, SJ Clough, WC Chan and LO Vodkin (2004) Tissue-specific gene silencing mediated by a naturally occurring chalcone synthase gene cluster in Glycine max . Plant Cell 16: 819-835.

11. Woodworth, C.M. (1921) Inheritance of cotyledon, seed-coat, hilum, and pubescence colors in soy-beans. Genetics 6: 487-553.

12. Zabala, G. and L. Vodkin (2003) Cloning of the pleiotropic T locus in soybean and two recessive alleles that differentially affect structure and expression of the encoded flavonoid 3 'hydroxylase. Genetics 163: 295-309.

The present invention relates to molecular labels for analyzing genotypes related to longitudinal coloration.

Specifically, to provide a primer pair that cosegregates with the I or T locus involved in determining the seed color in soybean, the primer pair can be used as a seed marker molecular marker in molecular breeding programs.

The type and distribution of anthocyanin and proanthocyanin pigments determine the specific seed color of soybeans. The synthesis of this substance occurs in a branch of the phenylpropanoid pathway, one of the secondary metabolic processes (see Figure 1). Anthocyanin and proanthocyanin pigments are known to have protection against pathogens and UV exposure in plants. In recent years, however, they have attracted attention because of their antioxidant properties and their medical and nutritional value (reviewed in Dixon and Sumner, (2003) Plant Physiol. 131: 878-885).

Three independent loci ( I , R , and T ) control the biosynthesis of pigments that determine the species color of soybean ( Glycine max ) (reviewed in Nicholas et al., (1993) Plant Mol. Biol. 21: 145 -156). The I locus controls the distribution of anthocyanin and proanthocyanin pigments, indicating homologous gene silencing from the dominant to the yellow epidermis. The R and T loci determine anthocyanin and proanthocyanidins, and specific species such as black, incomplete black, brown, or pale yellow.

The I locus is located at the site containing the chalcone synthase ( CHS ) gene family of soybean associated group A2 and controls the distribution of anthocyanin and proanthocyanin pigments (Todd and Vodkin, (1993) Plant Physiol. 102 : 663-670). The dominant I allele fully expresses the colorless epidermal phenotype by dominant inhibition. Homozygous recessive I alleles ( i , i ⁱ , i ^k ) cause coloration of the entire epithelium or restriction of pigment distribution to specific sites in the epithelium. The sequencing and genetic analysis of soybean strains with different I alleles showed that dominant inhibition was CHS. This is due to homology-dependent gene silencing caused by base-pairing between genes and ΔCHS3 located just backward 5 'of ICHS1 (Todd and Vodkin, 1996; Senda et al., (2002) Theor. Appl. Genet. 104: 1086-1091). Recently, the presence of short interfering RNAs (Senda et al . 2004) and vigorous transcription of genes in the I locus family (Tuteja et al . 2004) have reported that the post-transcriptional mode of gene silencing works in this system. The complete sequencing and gene annotation of soybean BAC clone 104J7 (BAC104J7) across the I locus has recently been made (Clough et al ., (2004) Genome 47 : 819-831). This BAC clone sequence showed the repeatability and reverseness of the CHS genes. The total size was 103,334-bp and was found to include the gene-rich region of the soybean genome.

The R and T loci are determined by determining the type of anthocyanin and proanthocyanin ( i, R, T ), incomplete assay ( i, R, t ), brown ( i, r, T ), pale yellow ( i, r, t To control certain species. The R locus is located in the soybean linkage group K. The R genotype includes proanthocyanidins and ansocyanins and the r genotype includes only proanthocyanidins. Thus, R was proposed to encode an enzyme that works after the formation of proanthocyanidins or before the formation of ansocyanines (Todd and Vodkin, (1993) Plant Physiol. 102: 663-670). However, the molecular nature of the R locus has not been determined to date.

The T locus is located in the soybean linkage group C2. The T locus was originally described in relation to the hair color of stems, leaves, and pods (Woodworth (1921) Genetics 6: 487-553), and is also effective in cracking and pigmentation of the epidermis.

Chromatographic analysis indicated what kinds of proanthocyanidins and ansocyanins contained in the soybean genotypes with T and R alleles (Buzzell et al. (1987) J. Hered. 78: 53-54 .; Todd and Vodkin, (1993) Plant Physiol. 102 : 663-670). The major anthocyanin pigments of the black soybeans ( i , R , T ) are cyanidin-3-monoglucoside and delphinidin-3-monoglucoside. Mature incomplete assays ( i , R , t ) contain delphinidin as the primary anthocyanin. Immature assay seedlings ( i , R , T ) contain significant amounts of procyanidin. In contrast, immature, incomplete assays ( i, R, t ) contain properlagonidin and procyanidin. These findings suggest that the T locus encodes a flavonoid 3 'hydroxylase ( F3'H ) that is involved in hydroxylation at the 3' position of the flavonoid's B-ring, located in the microsome, to produce cyanidin pigments. It was. Cloning and mapping of genomic DNA and cDNA sequences of the soybean F3'H gene showed that the F3'H gene cosegregates with the T locus (Toda et al., (2002) Plant Mol. Biol. 50 : 187-196; Zabala and Vodkin, (2003) Genetics 163: 295-309). However, pleiotropic phenomena on cell wall integrity (stem-crack) of the T locus have not been elucidated.

In breeding programs, the analysis of genetic color-related genotypes has traditionally favored soybeans with yellow soybeans. It is necessary for the purpose of increasing. Seed color is also associated with soybean yield and environmental stress resistance (Benitez et al., (2004) Crop Sci. 44: 2023-2042). Recently, anthocyanin and proanthocyanin have been shown to be beneficial to health. (Reviewed in Dixon and Sumner, (2003) Plant Physiol. 131: 878-885). However, until now, molecular markers suitable for analyzing the above genotypes have not been developed, and thus, the seed color is known after maturation in the growing process. Therefore, the necessity of the molecular label development has been raised to shorten the breeding period.

It is an object of the present invention to develop high throughput molecular markers cosegretaing with I and T loci for marker-assisted selection of sarcoma traits in a breeding program.

In order to achieve the above object, the present invention provides a primer pair of a PCR base label that is co-separated from soybean I locus or T locus.

In this case, a primer pair is provided which is co-separated from the I locus including the nucleic acid sequences of SEQ ID NOs: 1 and 2, SEQ ID NOs: 3 and 4, or SEQ ID NOs: 5 and 6. Also provided are primer pairs that are co-separated from the T locus comprising the nucleic acid sequences of SEQ ID NOs: 7 and 8, or SEQ ID NOs: 9 and 11, and 10 and 11.

In addition, the present invention (1) extracting the DNA of the unknown soybean sample; (2) using a primer pair co-separated from a soybean I locus or a T locus and performing PCR using the DNA as a template; And (3) analyzing the size of PCR products and comparing them with known varieties.

The terminology used herein is for more clearly describing the subject matter and is not intended to limit the scope of use of the term. Also, undefined terms follow the usual meaning, and technical terms are interpreted in the plural or singular according to the implied meaning of the paragraph according to the general standard grammar and common knowledge.

The term "label or molecular label" frequently used herein refers to a nucleotide sequence that is used as a reference point when identifying genetically unspecific associated loci. The term also applies to nucleic acid sequences that are complementary to a label sequence, such as a nucleic acid used as a primer pair capable of amplifying the label sequence. The location of the molecular marker on the genetic map is called the locus.

Also, simple sequence length polymorphism (abbreviated as 'SSLP') is an insertion or deletion observed in the sequence of sequences obtained from an allele locus (the same locus that appears in more than one individual). It means the polymorphism represented by. SSLP is not only a simple insertion / deletion, but also a difference in the number of repetitions of microsatellite or simple sequence repeats (hereinafter abbreviated as 'SSR') where one, two or three short sequences are repeated. Caused by. Molecular labels developed using SSLP are referred to as SSLP label, accessory label, SSR label, sequence-characterized amplified region (SCAR), and sequence tagged site (STS) label.

In the present specification, single nucleotide polymorphism (hereinafter, abbreviated as 'SNP') refers to a polymorphism caused by mutual substitution of adenosine, guarcin, thymidine, and cytosine bases observed in an nucleotide sequence obtained from an allele. it means. In a broad sense, SNPs also include insertion / deletion of a single base and the SNPs referred to herein fall within this category. Molecular labels developed using SNPs are commonly referred to as SNP labels.

It will be described in detail below.

The present invention provides molecular labels for analyzing genotypes related to the somatic color of soybeans.

Specifically, it provides a PCR based molecular label that is co-separated from soybean I locus or T locus.

In the present invention, to provide the I locus and the ball separation primer pairs of beans (hereinafter abbreviated as 'BAC') bacterial artificial chromosome including the I locus clone nucleotide sequence (GenBank Accession No. AY262686; Clough et al,. 2004) SSR molecular labeling is made using polymorphism of the number of repeats of a number of microsatellite repeats.

In this case, the SSR molecular label may be a primer pair including nucleic acid sequences of SEQ ID NOs: 1 and 2, a primer pair including nucleic acid sequences of SEQ ID NOs: 3 and 4, or a primer pair including nucleic acid sequences of SEQ ID NOs: 5 and 6. A primer pair comprising the nucleic acid sequences of SEQ ID NOs: 1 and 2 and a primer pair comprising the nucleic acid sequences of SEQ ID NOs: 3 and 4 include TA repeats of the BAC clone (BAC104J7) nucleotide sequences, and nucleic acid sequences of SEQ ID NOs: 5 and 6 Primer pairs that include include AT repeat.

In the present invention, in order to confirm that the primer pair according to the present invention is co-separated from the I locus, DNA of the F ₁₁ Recombinant inbred lines (RILs) population grown in the crossing of Glycine max and IT182932 ( G. soja ). PCR was carried out with the template to perform association analysis on the PCR product.

As a result, a genetic map as shown in FIG. 6 was obtained, which confirmed that the primer pair according to the present invention existed on the I locus.

In addition, by performing PCR using the primer pair according to the present invention, the microsatellite repeat of the BAC clone sequence can be amplified. In other words, by analyzing PCR-related variations in microsatellite repeats in each cultivar, the desired genotypes of I genes can be selected according to microsatellite repeat characteristics without observing the phenotype.

Specifically, in order to investigate the polymorphism of the molecular label according to the present invention, the characteristics of the I locus were analyzed by extracting their DNA using 16 soybean varieties and performing PCR using the primer pairs (see FIG. 5). ).

As a result, PCR products were at least six in size , with a wider variation than the four known I locus genotypes (genotype, i, i ⁱ , i ^k , I ). By using the variation according to the variety of soybean varieties in relation to the size of the PCR product, it is possible to analyze even a sample without information on the I locus, thus maintaining or improving the variety.

The present invention also provides a primer pair that is co-separated from the soybean T locus.

The T locus encodes a Flavonoid 3 'hydroxylase (hereinafter abbreviated as'F3'H') gene (Toda et al., (2002) Plant Mol. Biol. 50 : 187-196; Zabala and Vodkin, (2003) Genetics 163: 295-309).

The base sequence of cDNA and genomic DNA of the F3'H gene (GenBank Accession No. AF501293 to AF501305; Zabala and Bodkin, 2003) shows two insertion / deletion (indel) mutations.

The first indel mutation is seven soybean lines with different T genotypes: Richland (I, R, t), T157 (i, R, t), Harosoy (I, r, t), XB22A (i ⁱ , r, T ), 37609 (i ⁱ , r, t ^* ), 37649 (i ⁱ , r, t ^* ), and the second intron (intron II) of the F3'H gene of Williams (i ⁱ , R, T) The genomic DNA sequence sequence of the site was found in Richland (t), T157 (t), and Harosoy (t) intron II to XB22A (T), 37609 (t ^* ), 37649 (t ^* ), and Williams (T). It contains 262 bp longer sequences than intron II (Zabala and Vodkin, 2003).

The second indel mutation resulted in the deletion of the C base at the 279 bp protein coding region on the 3 'side of the intron II of Richland (t), T157 (t), and Harosoy (t), resulting in premature termination of the open reading frame. By inducing the expression of nonfunctional peptides in these lines, causing the brown mimicking mutant phenotype.

In the present invention, an STS molecular label is provided using the first 262 bp indel mutation in the F3'H gene encoding the T locus (see FIG. 3). In this case, it is preferable that the STS molecule label is a primer pair including nucleic acid sequences of SEQ ID NOs: 7 and 8.

The present invention also provides an allele-specific PCR label (Jeong and Saghai Maroof, (2004) Plant Breeding 123: 305-310) using a second single base indel mutation in the F3'H gene encoding the T locus (FIG. 4). In this case, it is preferable that the SNP molecular label is a primer pair including the nucleic acid sequences of SEQ ID NOs: 9 and 11 or SEQ ID NOs: 10 and 11.

In the present invention, in order to confirm that the primer pair according to the present invention is co-separated from the T locus, DNA of the F ₁₁ Recombinant inbred lines (RILs) population grown in the crossing of golden soybean ( Glycine max ) and IT182932 ( G. soja ) PCR was carried out with the template to perform association analysis on the PCR product.

As a result, also to yield a genetic map (genetic map) as shown in Fig. 8, and which pairs of the primer according to the invention exists in the upper left hand T gene would check the T locus and balls separated.

PCR can be performed using primer pairs, which are STS molecular markers according to the present invention, to amplify the F3'H gene intron II site. Therefore, 262 bp indel mutations appearing in each cultivar can be analyzed by PCR products, and the database can be used to determine the cultivars according to the indel mutation characteristics of the T locus from unknown sample soybeans (see FIG. 7A). . In other words, the indel mutations in each cultivar can be analyzed by PCR product to select the desired genotype of the T gene according to the desired microsatellite repeat characteristics without observing the phenotype.

In addition, PCR can be performed using the primer pair, the SNP molecular label according to the present invention, to amplify the F3'H gene intron II site. Therefore, the premature termination mutations in each cultivar can be analyzed by PCR products, and the database can be used to identify T genotypes according to SNP mutation characteristics from unknown sample soybeans.

Hereinafter, the present invention will be described in more detail with reference to Examples, but the scope of the present invention is not limited to these Examples, and various modifications and variations are possible within the protection scope of the present invention described in the claims. It will be apparent to those skilled in the art to which the invention pertains.

< Example  1> I At the locus  Preparation of Corresponding SSR Labels

Primer pairs were prepared to PCR amplify the microsatellite repeat on the BAC clone sequence (AY262686) containing the I locus (see FIG. 2 and Table 1).

The prepared I-TA01, I-TA02, and I-AT06 primer pairs were designed to amplify PCR products of 136, 115, and 146 bp, respectively, in Williams 82 bean varieties from which BAC clones originated.

I-TA01 and I-TA02 contain TA repeat and I-AT06 contain AT repeat.

PCR primer pairs designed for amplification of TA or AT microsatellite labels in BAC clone sequence AY262686 containing the I locus Cover name Direction and sequence number Sequence Location on AY262686 I-TA01 Forward, Sequence Listing 1 TGTCCTGTAATCTGTCACCA 93-112 Reverse, sequence listing 2 TTTGCTGAGAGATGTTTGTG 209-228 I-TA02 Forward, Sequence Listing 3 TTTTAATGTTGTGTTTTTAAGTG 4099-4121 Reverse, Sequence Listing 4 CCAAACATATTTTAAAGAAGTCA 4191-4213 I-AT06 Forward, Sequence Listing 5 ATTGGAACCCTCCAAAAA 100667-100684 Reverse Sequence Listing 6 TTGGATGTAACAACTTATTTGTATT 100788-100812

< Example  2> T At the locus  Equivalent STS  And preparation of SNP labels

T locus encrypts the F3'H gene, and the nucleotide sequence of the cDNA and genomic DNA array of the F3'H gene (GenBank Accession No. AF501293 ~ AF501305) was characterized by the two indel mutation.

First, seven soybean lines with different T genotypes Richland (I, R, t), T157 (i, R, t), Harosoy (I, r, t), XB22A (i ⁱ , r, T), 37609 ( genomic DNA of the site expected to be the second intron (intron II) of the F3'H gene of i ⁱ , r, t ^* ), 37649 (i ⁱ , r, t ^* ), and Williams (i ⁱ , R, T) The sequence sequence shows that intron II of Richland (t), T157 (t), and Harosoy (t) is less than XB22A (T), 37609 (t ^* ), 37649 (t ^* ), and Williams (T) intron II. 262 bp contained longer sequences (Zabala and Vodkin, 2003). As shown in Fig. 3, in the present invention, PCR based molecular label F3'H-STS was prepared using this 262 bp indel.

Second, the deletion of C base in the protein coding region of the 279 bp region of intron II of Richland (t), T157 (t), and Harosoy (t) resulted in premature termination of the open reading frame, resulting in nonfunctional peptide. Expression has been shown to result in a brown mimicking mutant phenotype in these lines. In this invention, the allele-specific PCR label F3'H-Cgap was produced using this single base indel (FIG. 4).

PCR primer pairs of sequence tagged sites and allele specific (AS) PCR labels prepared based on the F3'H gene sequence. Cover name Direction and sequence number Sequence F3'H-STS Forward, Sequence Listing 7 TTATAACGTAACTGCACAGA Reverse Sequence Listing 8 TAACTTTTGGTTTCTAGTCG F3'H-Cgap AS Forward, Sequence Listing 9 GAGATATTTGGCTACCACATCCCGAA AS Forward, Sequence Listing 10 GAGATATTTGGCTACCACATCCGA Reverse Sequence Listing 11 ATCCATGTTCAACTTTTCT

< Example  3> Of primer  Validation

PCR was performed to verify whether the primer pair prepared in Example 1 or 2 can analyze the genotype of the I or T locus.

(3-1) Plant Material

F ₁₁ Recombinant inbred lines (RILs) populations grown in the crosses of Glycine max and IT182932 ( G. soja ) were used for mapping of the markers. In 2004, the genotypes of the I and T loci of the recombinant individuals were determined by observing the seed color and longitudinal cracks of the seeds harvested from the recombinant plants grown in glass greenhouses and fields.

16 soybean lines (Golden, IT182932, York, Williams, V94-5152, SS2-2, L29, Wish, PI96983, Peking, Evans, Hutchson, Taekwang, Sinpaldal, Marshall, Lee68) were used to investigate the polymorphism of the marker. It became.

(3-2) DNA extraction

Samples for DNA extraction were taken by cutting the leaves of young exuded leaves of 15-day-old beans growing in a greenhouse. Nearly similar amounts of tissue (0.5 g) were taken from each plant. After tissue collection, the samples were stored in a -70 ° C. rapid freezer and subjected to CTAB method (Saghai Maroof et al. (1984) Proc. Natl. Acad. Sci. USA 91: 5466-5470). Tissues were taken from a -70 ° C freezer, placed in a mortar and immediately added to 20 mL of liquid nitrogen to powder. Tissues were placed in 5-10 mL of extraction buffer [0.1 M Tris (pH 8.0), 1.4 M NaCl, 0.02 M EDTA (pH 8.0), 2% cetyltrimethylammonium bromide (CTAB), 1% 2-mercaptoethanol] and then ground. This tissue was placed in a 50 mL Falcon centrifuge tube and shaken in a 60 ° C. water bath for at least 2 hours, and then 10 mL of chloroform: isoamyl alcohol (24: 1) solution was placed in each sample. The tubes were inverted by hand, mixed and centrifuged for 15 minutes on a horizontal shaker. Then, it was turned for 15 minutes at 3200 rpm, 4 ℃. The supernatant was transferred to another tube and 10 μl (10 mg / mL) RNase A was added thereto. After 30 minutes, 2/3 of isopropanol was added and turned over. The precipitated pellet was taken out and placed in 20 mL of 76% ethanol and 10 mM NH ₄ OAc. After overnight, the DNA pellet was dried and 1 mL of 10 mM NH ₄ OAc and 0.25 M EDTA were added thereto. F2 DNA samples were each quantified by fluorometer (Bioneer, charging) using pico green.

(3-3) SSLP  For analysis PCR

PCR conditions for SSLP analysis, ie, SSR and STS analysis, consisted of 10 ng / μl of genomic DNA 2 μl, primer pairs SEQ ID NO: 1 and 2, 3 and 4, 5 and 6 or 7 and 8, respectively 0.1 μl of pmol, 0.8 μl of 10 nM dNTP (dATP, dTTP, dCTP, and dGTP aqueous solutions), 1 μl of 10 × reaction buffer, 0.05 μl of 0.25 units of Taq polymerase (Bioneer, Daejeon), and 5.95 μl The final volume of the sterilized water was 10 μl. The PCR was performed for the first 3 minutes at 94 ° C, followed by 34 cycles of 30 seconds at 94 ° C, 30 seconds at 47 ° C, 30 seconds at 72 ° C, and finally 5 minutes at 72 ° C. 10 μl of the PCR product was added 9.6 μl of formamide, 0.2 μl of 0.5 M (pH 8.0) EDTA, and 0.2 μl of 0.4% bromophenol blue, 0.4% xylene cyano, and picol 29%, followed by 3 minutes at 90 ° C. 6.25% (W / V) polyacrylamide gel (1.5 M Tris (pH 8.8) 9 mL, 40% acrylamide 6.3 mL, distilled water 4.86 mL, urea 18.36 g, TEMED 36 mL, 1.5% APS 1.8 mL ) Was performed for at least 15 hours in a kit containing 1X TBE buffer at 18-25 mA.

PCR product separation was performed using a protein kit equipped with a 16 x 18 cm polyacrylamide gel, which is widely used for protein separation (Bio-red, PROTEAN ^™ II kit). In order to identify the gel, a silver staining kit (Bioneer, Daejeon) was used according to the protocol from Bioneer. This kit was designed to dye four gels per unit.

Briefly, the gel is separated from the acrylamide plate, placed in a 1.5 liter stop solution (10% acetic acid) and placed on a shaker for at least 30 minutes, and a 1.5 liter enhancement solution (1.5 g enhancement solution, and 1.4985 g of distilled water). 30 minutes, then washed twice with distilled water for 3 minutes each before replacing with 1.5 liters of dyeing solution (1.5 g AgNO ₃ , 2.25 g formaldehyde, and 1496.25 g distilled water), and then shaker for at least 30 minutes. Put on Wash with distilled water for 40 seconds before adding to developer solution, and finally add developer solution (45 g Na ₂ CO ₃ , 300 μl sodium tyrosulfate, 2.25 g formaldehyde, and 1452.55 g) until bands appear (about 3 minutes) After watching, the band was separated by placing in a 1.5 liter fixed solution (10% acetic acid).

(3-4) for SNP analysis PCR

Analysis of SNPs using allele-specific PCR followed the method of Jeong and Saghai Maroof, 2004. Other plant materials and DNA analysis are the same as in (3-1, 2, 3).

Having nucleic acid sequences of SEQ ID NOs: 9 and 11 or 10 and 11 for SNP analysis PCR products of SNP primer pairs consisted of 2 μl of 10 ng of DNA and 0.2 μl of 10 mmol of primer, 1.6 μl of 10 nM of dNTP, 2 μl of 10 × reaction buffer, 0.5 unit of Taq polymerase (Bioneer, Daejeon), And 11.6 μl of sterilized water had a final volume of 20 μl. The PCR reaction was denatured for the first 3 minutes at 94 ° C, followed by 34 cycles of 30 seconds at 94 ° C, 30 seconds at 50 ° C, and 30 seconds at 72 ° C, and finally the extension reaction was carried out at 72 ° C for 5 minutes. The final PCR product of 20 μl was loaded with 2 μl of 10 × loading dye buffer and 6 μl was loaded onto 1.2% agarose gel.

(3-5) I At the locus  Polymorphic Analysis of Corresponding SSR Labels

When I-TA01, I-AT02, and I-AT06 were isolated from polyacrylamide gel, the PCR band size showed at least six or more mutations, more than the four I locus genotypes known to vary among soybean strains. 5). That is, IT182932, Williams, and Pecking clearly have recessive i alleles but differ in the size of PCR bands.

(3-6) T At the locus  Equivalent STS  And polymorphism analysis of SNP labels

The genotypes in the 16 soybean lines of F3'H-STS and F3'H-Cgap matched, which may be suggested to have a close association with the T and t genotypes (see FIGS. 7A and 7B).

< Example  4> Longitudinal color  Genotype and Molecular Label Association Analysis

Genotype data of markers developed for genetic association analysis are genotype data of published molecular labels (Satt315, Sat_336, etc.) described in FIGS. 6 and 8 that are known to be closely associated with the I and T loci. ncgr.org/cgi-bin/ace/generic/search/soybase) and plant material for the endothelial and hair color phenotypes associated with the I locus and T-locus (Zabala and Vodkin, 2003). Collected from the recombinant population described in the analysis.

Association analysis was performed using a MapMaker 3.0 computer program (Lander et al., (1987) Genomics 1: 174-181). The confidence limit of the genetic map was LOD 3.0 and the limit Haldane distance was analyzed by 50 centimorgan (cM).

As a result, the association group analysis on the I locus confirmed that the developed markers I-TA01, I-AT02, and I-AT06 were located at the same position as the I locus of the molecular association group A2 (FIG. 6).

Also regarding the T locus Association group analysis confirmed that the developed labels F3'H-STS and F3'H-Cgap are located at the same position as the T locus of the molecular association group C2 (see FIG. 8).

As described above, the label molecule of the present invention can amplify a nucleic acid sequence present in the I locus and T gene upper left which is involved in determining the seed coat color of the beans, a genetic variation that occurs at the I locus and T locus Identifying genetic variations in lineages, therefore, must promote marker-assist selection of longitudinal color in future molecular sarcoma programs.

Attach sequence list electronic file

Claims (10)

A primer pair consisting of the nucleic acid sequences of SEQ ID NOs: 1 and 2 that amplify the nucleic acid sequences on the soybean I locus. A primer pair consisting of the nucleic acid sequences of SEQ ID NOs: 3 and 4 that amplify the nucleic acid sequences on the soybean I locus. A primer pair consisting of the nucleic acid sequences of SEQ ID NOs: 5 and 6 which amplify the nucleic acid sequences on the soybean I locus. A primer pair consisting of the nucleic acid sequences of SEQ ID NOs: 7 and 8 that amplify the nucleic acid sequences on the soybean T locus. A primer pair consisting of the nucleic acid sequences of SEQ ID NOs: 9 and 11 or 10 and 11 to amplify the nucleic acid sequences on the soybean T locus. delete delete delete delete delete

Images