KR100460747B1 - PROBE FOR DETECTING Human herpesvirus, GENOTYPING KIT AND GENOTYPING METHOD FOR Human herpes virus USING THE SAME - Google Patents

Abstract

The present invention is a probe that binds to the nucleic acid of the herpes virus complementary, a kit for detecting or genotyping herpes virus using a DNA chip comprising the same, and whether the herpes virus is infected using the probe or analysis kit To detect and analyze genotypes. The genotyping method according to the present invention has a merit that it is faster and more accurate than the conventional smear or electron microscopic examination to derive the experimental results. In addition, genotypes can be identified in a single experiment.

Description

PROBE FOR DETECTING Human herpesvirus, GENOTYPING KIT AND GENOTYPING METHOD FOR Human herpes virus USING THE SAME}

[Technical Field]

The present invention relates to kits or methods for detecting or genotyping human herpesvirus (HHV), and probes and DNA chips used therein. More specifically, the present invention is a herpes simplex virus type 1 (HSV-1) and herpes simplex virus-2 (HSV-2) and herpes virus-8 virus belonging to the HHV using a DNA chip The present invention relates to a method of determining whether a herpes virus is infected by analyzing a genotype of a patient using a genotyping kit and an electrical analysis kit for analyzing the genotype of a patient infected with (HHV-8).

[Private Technology]

Human herpesviruses (HHVs) related to Sexual Transmitted Diseases (STD) include Herpes Simplex Virus type 1 (HSV-1), HSV-2, and HHV-8. HSV is a virus that causes genital herpes and is infected by sexual intercourse, forming blisters on the genital area.

Early infections with HSV form blisters in the genital area, followed by ulcers or asymptomatic infections. Afterwards, the virus lurks in the ganglion, causing latent infection for life, and the virus lurking in the ganglion is activated by external factors, such as stress, to regenerate blisters and ulcers in the genital area, or to secrete the virus asymptomatically. do.

The greatest risk factor for genital herpes is that about 80% of infected people are asymptomatic and are responsible for significant vertical and horizontal infections in the outbreak of the virus. An estimated 45 million people worldwide are infected, with an increase of about 32% in the 1990s from the late 1970s. Herpes genitals are becoming more and more important, while other STDs are decreasing. There has been an increased risk of miscarriage or stillbirth during birth canal or intrauterine HSV infection in pregnant women (Nahmias AJ. Et al., Am. J. Obstet Gynecol 1971; 110: 825). The possibility of a pathogen has been suggested (Adam E. et al., Cancer 1974; 33: 147-52).

HHV-8 was first discovered in Kaposi's sarcoma in HIV patients in 1994 (Chang Y. et al., Science 1994; 266: 1865-69), and in approximately 90% of Kaposi's sarcoma tissue in AIDS patients, It is detected in about 50% of Kaposi's sarcoma tissue, and HHV-8 is recognized as a causative virus of Kaposi's sarcoma. See also: Meal OM. Et al., Arch Dermatol 1997; 133: 1247-51, Castleman's disease (Soulier J. et al., Blood 1995; 86: 1276-80), primary effusion lymphoma ( Cesarman E. et al., N Engl J Med 1995; 332: 1186-91), sarcoidosis (Di Alberti L. et al., Lancet 1997; 350: 1655-61), myeloma (Rettig MB. Et al., Science 1997; 276: 1851-54), angiosarcoma (Gyulai R. et al., N Engl J Med 1996; 22: 540-41), Kikuchi disease (Huh JR. Et al, Hum Pathol 1998; 29: 1091-96 , Angiolymphoid hyperplasia with eosinophilia (ALHE) (Gyulai R. et al., Lancet 1996; 347: 1837). So far, it has been known to spread through the sexual acts of homosexual men, but HHV8 DNA has also been detected around the anus of heterosexual men (Jang Kyung Ae et al., Korean Dermatological Association 2000; 38 (9): 1162-1167), secretions of children and nose It can be considered that other factors may affect the propagation in the presence of HHV-8 (Blackbourn DJ. Et al., J Invest Dis 1998; 177: 213-16). Patients infected with HSV-2 and HHV-8 are highly susceptible to AIDS (Maria C. et al., J Clin Microbiol 1998; 36: 848-49, Thomas F. Et al., Virus Res 2002; 82: 115- 26) These viruses are at higher risk for infection in homosexuals, working women, and those who have been exposed to other sexually transmitted diseases.

The diagnosis of genital herpes by HSV has been mostly clinical, but the number of patients with reduced immune function is increasing due to various causes, and these patients often have atypical clinical features. Therefore, Tzanck smear, pathologic examination, electron microscopy, serological examination, tissue culture, immunofluorescence and PCR are performed for accurate diagnosis of HSV.

Tzanck smears are economical, help clinical diagnosis, but may vary with the reader, results are relatively high false negative (Nahass GT. Et al., JAMA 1992; 268: 2541-44), and pathological tissue Medical tests also have the disadvantage of being difficult to distinguish from other viral diseases.

Electron microscopy reveals significant differences in sensitivity and specificity, depending on the experience of the reader, and cannot distinguish between types of infected HSV (Solomon AR. Et al., J Am Acad Dermatol 1988; 18: 218-21). Virus cultivation is only possible after 7 days of culture to see the cytopathic effect, so the late reading does not provide much benefit for the patient's care.

As a test for distinguishing genotypes of HSV, immunofluorescence or polymerase chain reaction (PCR) using antibodies can be used. Immunofluorescence has a relatively high sensitivity and specificity, and has the advantage of distinguishing virus types, but the disadvantage of requiring a fluorescence microscope and freezing or fixing the tissue (Solomon AR. Et al., J Am Acad Dermatol 1988; 18: 218-21). On the other hand, PCR has made up for the shortcomings of the prior art and has a very high specificity and sensitivity, thereby enabling fast and accurate results. Since HSV-1 and HSV-2 have different prognosis such as clinical signs, path of infection, and recurrence rate, it is necessary to distinguish between infected HSV types for accurate diagnosis and treatment. To date, no accurate differentiation has been carried out for clinical reasons because of the time and expense required, but the recent development of new antiviral agents against the infection of herpes virus has led to the need for the selection of sensitive agents effective for treatment (De Clercq E. et. al., J Infect Dis 1980; 141: 563-74). Accordingly, research into techniques for identifying genotypes as well as the presence of HSV has been continuously conducted.

Therefore, it is not only necessary to develop a simple and accurate diagnosis of herpes virus infection and its genotype, but also to develop a diagnostic method and kit for human herpes virus having high specificity and sensitivity, probes and DNA chips used therein. Constantly emerging. In addition, the diagnostic kit, probes and DNA chips used therein should be able to diagnose HHV infection and genotype more accurately by analyzing three types of HHV causing STD with high specificity and sensitivity.

In order to solve the problems of the prior art as described above, an object of the present invention is to provide a novel probe that can complementarily complement the nucleic acid of HHV to diagnose HHV infection and genotype more accurately with high specificity and sensitivity. It is done.

Still another object of the present invention is to provide a DNA chip for detecting or genotyping human herpes virus including the probe.

Still another object of the present invention is to provide a kit for detecting or genotyping human herpes virus including the probe.

Still another object of the present invention is to provide a method for detecting or genotyping human herpes virus using the probe.

1 is a schematic diagram showing the type and position of a probe located in a DNA chip according to an example of the present invention.

2 is a photograph of amplification of HHV using a primer according to an example of the present invention.

Figure 3 is a photograph of amplification of HHV using the conventional primer shown in SEQ ID NO: 23 and 24.

Figure 4 is a photograph of amplifying the HHV DNA using a primer according to an embodiment of the present invention.

5 is a photograph of amplifying HHV DNA using a primer according to an example of the present invention.

Figure 6a is a result of analyzing the HSV-1 DNA with a DNA chip according to an example of the present invention, Figure 6b is a result of analyzing the HSV-2 DNA, Figure 6c is a result of analyzing the HHV-8 DNA, Figure 6d Is a photograph showing the result of analyzing the β-globin, shows the result that HHV was not detected.

7 is a schematic diagram showing the type and position of a probe located in a DNA chip according to an example of the present invention.

Figure 8a is a photograph showing the results of the analysis of HSV-1, Figure 8b is a photograph showing the results of the analysis of HHV-8, Figure 8c is a photograph showing the results of analyzing the β-globin shows a result that HHV was not detected.

9A, 9B, and 9C show results of analyzing a clinical sample with a DNA chip according to an example of the present invention. FIG. 9A is analyzed as a sample infected with HSV-1, and FIG. 9B is analyzed as a sample infected with HSV-2. 9c is analyzed with the sample infected with HHV-8, and FIG. 9d shows the result that no HHV was detected.

The present invention is selected from the group consisting of oligonucleotides having a nucleotide sequence of SEQ ID NO: 1 to the base sequence of SEQ ID NO: 9, and oligonucleotides having a nucleotide sequence complementary to these oligonucleotides, complementary to the nucleic acid of the herpes virus It relates to a probe to bind.

The present invention also provides a human body comprising at least one probe selected from the group consisting of an oligonucleotide having a nucleotide sequence of SEQ ID NO: 1 to a base sequence of SEQ ID NO: 1, and an oligonucleotide having a nucleotide sequence complementary to these oligonucleotides. A DNA chip for the detection or genotyping of herpes virus.

The present invention also provides (a) a DNA chip for detecting the herpes virus, (b) a primer for amplifying the sample DNA of the herpes virus by PCR, and (c) relates to a kit for the detection or genotyping of a herpes virus comprising a labeling means for detecting amplified DNA hybridized with the DNA chip.

The present invention also comprises the steps of (a) amplifying the sample DNA using a primer for DNA amplification of herpes virus;

(b) hybridizing the amplified DNA to a DNA chip comprising a single probe or a set of two or more probes selected from the group consisting of the base sequence of SEQ ID NO: 1 to the base sequence of SEQ ID NO: 9; And

(c) a method for detecting or genotyping a herpes virus, comprising detecting the probe and the hybridized reactant.

The present invention also comprises the steps of: (a) amplifying the sample DNA of herpes virus using a primer for DNA amplification of herpes virus;

(b) hybridizing the amplified DNA with a single probe or a set of two or more probes selected from the group consisting of nucleotide sequences of SEQ ID NO: 1 to nucleotide sequences of SEQ ID NO: 9; And

(c) a method for detecting or genotyping a herpes virus, comprising detecting the probe and the hybridized reactant.

The present invention also relates to a primer for amplifying human herpes virus DNA having a nucleotide sequence of SEQ ID NO: 11 to a nucleotide sequence of SEQ ID NO: 20.

The present inventors have tried to establish a method to diagnose human herpes virus (HHV) infection by analyzing the genotype of a patient by a simple method and to accurately determine the type of infected HHV, thereby amplifying the DNA of HHV. Probes capable of complementarily binding to primers and DNA chips containing the same have been developed. In addition, a DNA chip comprising a probe capable of complementarily binding to the DNA of HHV, a primer for amplifying the DNA taken from the sample by a PCR method and a label for detecting the amplified DNA hybridized with the DNA chip A genotyping kit of HHV comprising the means was prepared, and by analyzing the genotyping of DNA collected from a patient's sample using an electrical analysis kit, it was possible to quickly and accurately diagnose the infection of HHV, After confirming that the type can be determined, the present invention has been completed.

Hereinafter, the present invention will be described in detail.

The present invention relates to a probe that binds complementarily with nucleic acids, such as DNA or RNA, of human herpes virus, preferably oligonucleotides having the nucleotide sequence of SEQ ID NO: 1 to the nucleotide sequence of SEQ ID NO: 9, and these oligonucleotides It is selected from the group consisting of oligonucleotides having a complementary base sequence. The probe may be hybridized with DNA or RNA of herpes virus.

The present invention provides a DNA sequence of human herpes virus, preferably a base sequence that complementarily binds to the glycoprotein H DNA of HHV. Probes of the invention comprise the nucleotide sequences set forth in SEQ ID NOS: 1-9. In Table 1 below, the underlined portions of the sequences in SEQ ID NOs: 3, 6 are sequences added to provide a suitable form for probe function.

HHV probe SEQ ID NO. HHV type order One One 5'-ACCTACCTGGGGATCTCAACAGGCC-3 ' 2 One 5'-GTACCTACCTGGGGATCTCAACAG-3 ' 3 One 5'- T GTACCTACCTGGGGATCTCAACAG-3 ' 4 One 5'-CCAAGACTGACACATTAAAAAACACAGAAT -3 ' 5 One 5'-ATCCCAAGACTGACACATTAAAAAACACAGAAT -3 ' 6 One 5'- AA CCAAGACTGACACATTAAAAAACACAG GTT -3 ' 7 2 5'-GTACCGACCCGGAGTCCGTAGCAG-3 ’ 8 8 5'-CAGAATTGCTCCACGCGCTGCACCT-3 9 8 5'-GAATTGCTCCACGCGCTGCACCTCG-3 ' 10 β-globin 5'-TGCACCTGACTCCTGAGGAGAAGTCTGCCG -3 '

In another aspect, the present invention is to provide a primer for DNA amplification of herpes virus. The present invention provides a primer for amplification of HHVDNA comprising at least one oligonucleotide selected from the group consisting of oligonucleotides having the nucleotide sequences shown in SEQ ID NOs: 11 and 20. In the following Table 2 shows the present invention a primer.

PCR primers SEQ ID NO. HHV type order 11 1,2 (forward) 5'-GTCGTCCAGATGCCCAC-3 ' 12 1,2 (reverse) 5'-ATCACGCATCTGCACAAC-3 ' 13 1,2 (forward) 5'-GTCGTCCAGACGCCCACGG-3 ' 14 1,2 (reverse) 5'-ATCACGCACCTGCACAACGC-3 ' 15 1 (forward direction) 5'-AGCTGATAGCCCAGCGCG-3 ’ 16 1 (reverse) 5'-GCTTTTTGGCCCACTCGC-3 ’ 17 8 (forward direction) 5'-AGTCGTCCGCTCTGACG-3 ' 18 8 (reverse) 5'-TAATCTTTGAACAGTTAATCGC-3 ’ 19 8 (forward direction) 5'-GTCGTCCGCTCTGACGCGG-3 ’ 20 8 (reverse) 5'-ATCTTTGAACAGTTAATCGCCGG-3 ' 21 β-globin (BG) (forward direction) 5'-ATACAAGTCAGGGCAGAG-3 ' 22 β-globin (BG) (reverse direction) 5'-CTTAAACCTGTCTTGTAACC-3 ' 23 1,2,8 (forward direction) 5'-GTGGTGGACTTTGCCAGCCTGTACCC-3 ' 24 1,2,8 (reverse direction) 5'-TAAACATGGAGTCCGTGTCGCCGTAGATGA-3 '

The present invention provides a primer pair having a nucleotide sequence shown in SEQ ID NO: 11 and 12, or a primer pair having a nucleotide sequence shown in SEQ ID NO: 13 and 14 as a primer for amplifying HSV-1 and HSV-2 DNA. The present invention also provides a primer pair having a nucleotide sequence shown in SEQ ID NO: 17 and 18, or a primer pair having a nucleotide sequence shown in SEQ ID NO: 19 and 20 as a primer for amplifying the HHV-8 DNA.

In Table 2, the primer pair consisting of SEQ ID NO: 15 and 16 is a primer for amplification of HSV-1 DNA, the primer pair consisting of SEQ ID NO: 11 and 12, primer pair consisting of SEQ ID NO: 13 and 14 is HSV-1 and HSV- 2 are both amplifiable primers, and the primer pair consisting of SEQ ID NOs: 17 and 18 and the primer pair consisting of SEQ ID NOs: 19 and 20 are primers for amplifying HHV-8 DNA. One or two primer pairs depending on the type of HHV in the sample. In case of uncertainty about which type of HHV is included, the primers may be combined and used to amplify all three types of HHV. For example, a primer pair consisting of SEQ ID NOs: 11 and 12 capable of amplifying HSV-1 and 2 DNA or a primer pair consisting of SEQ ID NOs: 13 and 14 is selected, and the HHV-8 DNA is amplified by SEQ ID NOs: 17 and 18. A primer pair consisting of or a primer pair consisting of SEQ ID NOs: 19 and 20 can be selected and used. Preferably, amplification of three types of HHV DNA using a primer pair consisting of SEQ ID NOs: 13 and 14 and a primer pair consisting of SEQ ID NOs: 17 and 18, or a primer pair consisting of SEQ ID NOs: 11 and 12 and SEQ ID NOs: 17 and 18 Amplification can be accomplished using the pair of primers.

The primer pair consisting of SEQ ID NOs: 23 and 24 is a primer pair capable of amplifying all known DNAs of HSV-1, 2, and HHV-8 ( Journal of Clinical Microbiology (2000) 38 (9): 3274-3279). PCR results thereof are shown in FIG. 3, and the primers of the present invention amplify a large amount of DNA in the same amount as compared to the primer pair consisting of SEQ ID NOs: 23 and 24. This can be seen by comparing the intensities of the amplified PCR bands of FIGS. 2 and 3, or 4 and 3.

Selection and combination of primers and probes according to HHV type are summarized in Table 3 below.

HHV type Primer SEQ ID NO Probe SEQ ID NO HSV-1 11 and 12, or 13 and 14 1,2,3 15 and 16 4,5,6 HSV-2 11 and 12, or 13 and 14 7 HHV-8 17 and 18, or 19 and 20 8, 9

For genotyping of HSV-1, a sample DNA amplified with a primer pair consisting of SEQ ID NOs: 15 and 16 may use a probe having the nucleotide sequences shown in SEQ ID NOs: 4, 5, and 6 shown in Table 1 above, Sample DNA amplified with a primer pair consisting of Nos. 11 and 12 or a primer pair consisting of SEQ ID NOs: 13 and 14 may use one or more probes having the nucleotide sequences shown in SEQ ID NOs: 1 to 3 shown in Table 1 above. For genotyping of HSV-2, the sample DNA amplified with a primer pair consisting of SEQ ID NOs: 11 and 12 or a primer pair consisting of SEQ ID NOs: 13 and 14 has one or more nucleotide sequences shown in SEQ ID NO: 7 shown in Table 1 above. Probes can be used. In addition, in the case of genotyping of HHV-8, the sample DNA amplified with the primer pair consisting of SEQ ID NOs: 17 and 18 or the primer pair consisting of SEQ ID NOs: 19 and 20 is SEQ ID NO: 8 and / or SEQ ID NO shown in Table 1 above. A probe having the nucleotide sequence shown in 9 can be used.

In another aspect, the present invention is a micro array, preferably a DNA chip containing the oligonucleotide probe of the herpes virus. In one embodiment of the invention, the DNA chip also includes a DNA chip comprising all probe sequence sets that can be readily combined by one of ordinary skill in the art. DNA chip according to the present invention comprises one or more probes selected from the group consisting of oligonucleotides having a nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 9, and oligonucleotides having a nucleotide sequence complementary to these oligonucleotides do.

In addition, the DNA chip of the present invention, in addition to the probe for the herpes virus, Chlamydia trachomas, gonococcus, syphilis ( Treponema pallidum ), Trichomonas vaginalis , Mycobacterium tuberculosis , Human papillomavirus ( Human Papillomavirus ) One DNA chip can be prepared by simultaneously fixing a DNA probe capable of detecting the back and the like on one slide. When immobilized DNA probes of various bacteria or viruses on a slide, it is easy to detect which bacteria or viruses are present in a sample in a single experiment. In addition, when the DNA probes of various bacteria and viruses, in addition to the above-mentioned bacteria or viruses, are placed on a single slide, there is an advantage in that the sample can be accurately analyzed in a single experiment.

In addition, the DNA chip may further include a reference marker as a control for the global position marker and the hybridization reaction. Examples of reference markers may further include β-globin, actin, or glyceraldehyde-3-phosphate dehydrogenase genes. When the reference marker is β-globin, preferably has the nucleotide sequence shown in SEQ ID NO: 10, the primer for amplification thereof β-globin DNA amplification having the nucleotide sequence of SEQ ID NO: 21 and the nucleotide sequence of SEQ ID NO: 22 It may be a primer for.

On the other hand, the method of manufacturing a DNA chip included in the genotyping kit of the herpes virus includes the steps of preparing a DNA probe having an amine bound to the 5 'end of the nucleotide sequence that can complementarily bind to the nucleic acid of the herpes virus; Binding the prepared DNA probe to the surface of the solid to which the aldehyde is bound; And reducing aldehydes not bound to the amine present on the solid surface to which the electric DNA probe is bound.

The binding of the probe DNA to the aldehyde on the surface of the solid may be carried out by a method known in the art, that is, through a Schiffs base reaction of amine and aldehyde under a temperature of 37 ° C. and a humidity of 70%. Reduction of the aldehyde may be carried out using a reducing agent such as NaBH ₄ . The concentration of probe DNA reacting with aldehyde present on the surface of the solid is preferably 100-300 pmol / L. When used in other ranges, the probe DNA may not bind to the aldehyde on a solid surface.

The solid may be selected from glass, silicon dioxide, plastic or ceramic.

Hereinafter, the DNA chip of the present invention and its manufacturing method will be described in more detail by dividing the process.

First Step: Probe Preparation

A DNA probe having an amine bound to the 5'-terminus of a nucleotide sequence capable of complementarily binding to DNA of a herpes virus is prepared. In this case, the probe is designed and synthesized to have a base sequence of the herpes virus DNA, preferably, a base sequence that complementarily binds to the DNA of the glycoprotein H of the herpes virus virus, and the synthesized base sequence is to be bound to the surface of the solid. A probe is prepared by binding an amine group to the 5 'end of the nucleotide sequence.

Step 2: Immobilize the Probe

The prepared DNA probe is bound to the surface of the aldehyde-bound solid: the solid is not particularly limited, but is preferably glass, and the aldehyde of the solid surface is a method known in the art, that is, the 5 'end of the probe. The probe is coupled to the solid surface by carrying out a Schiffs base reaction at 30-40 ° C. and 70-100% humidity with the amine bound to the amine. At this time, the concentration of the probe is preferably 100 to 300 pmole / l, most preferably 200 pmole / l. Also attached to the surface of the solid is a β-globin probe that serves as a control for the global position marker and hybridization reaction.

Third Step: Manufacture of DNA Chip

A DNA chip is prepared by reducing aldehydes not bound to the amine present on the solid surface to which the probe is bound. At this time, the reducing conditions of the aldehyde is not particularly limited, it is preferable to use a reducing agent such as NaBH ₄ .

The present invention relates to a kit for the detection or genotyping of human herpes virus, preferably at least one probe selected from the group consisting of oligonucleotide probes having the nucleotide sequence of SEQ ID NO: 1 to 9 or a nucleotide sequence complementary thereto. It will include a DNA chip containing. In a specific example of the invention,

(a) a DNA chip for detecting the herpes virus, (b) a primer for amplifying the sample DNA of the herpes virus, and (c) a labeling means for detecting the amplified DNA hybridized with the DNA chip It provides a kit for the detection of herpes virus.

The label means may be used in the present invention a variety of labels known to those skilled in the art, for example Cy5, Cy3, biotin-binding material, EDANS (5- (2'-aminoethyl) amino- 1-naphthalene sulfuric acid), tetramethyltamine (TMR), tetramethyltamine isocyanate (TMRITC), x-rhodamine or Texas red can be used. The labeling means may add a label gene for human herpes virus to label the gene in the amplification and label amplification process using a PCR reaction. In addition, it can be labeled using a biotin-binding material which is a general labeling means. The biotin-binding material includes, for example, streptavidin-R-phycoerythrin. In case of labeling using Cy5, the fluorescent signal can be analyzed directly using an analyzer such as a confocal laser scanner when detecting the labeled reactant, which is more efficient and compared to labeling using biotin-binding material. More sensitive results can be obtained.

The present invention also relates to a method for detecting or genotyping the herpes virus using the herpes virus probe and amplification primers.

In an example of the present invention, the method comprises the steps of: (a) amplifying a sample DNA of herpes virus using a primer for amplifying DNA of herpes virus;

(b) hybridizing the amplified DNA with a single probe or a set of two or more probes selected from the group consisting of nucleotide sequences of SEQ ID NO: 1 to nucleotide sequences of SEQ ID NO: 9; And

(c) provides a method for detecting or genotyping human herpes virus, comprising the step of detecting a hybridized reaction with the probe.

In another example of the invention,

(a) amplifying human herpes virus sample DNA using a primer for DNA amplification of herpes virus;

(b) hybridizing the amplified DNA to a DNA chip comprising a single probe or a set of two or more probes selected from the group consisting of the base sequence of SEQ ID NO: 1 to the base sequence of SEQ ID NO: 9; And

(c) provides a method for detecting or genotyping human herpes virus, comprising the step of detecting a hybridized reaction with the probe.

The primer is preferably selected from the group consisting of primers for amplifying human herpes virus having a nucleotide sequence of SEQ ID NO: 11 to SEQ ID NO: 20, the examples are shown in Table 2.

In addition, the present invention may use a micro array, preferably a DNA chip containing the oligonucleotide probe of the human herpes virus, wherein the DNA chip is β-globin, actin, or glyceraldehyde-3-phosphate dehydrogenase (glyceraldehyde-3-phosphate dehydrogenase) gene may be further included as a position marker, and the position marker may be used in the DNA chip. The detection can be performed using a labeling means, and the labeling means listed above can be used.

In one example of the invention, amplification of the sample DNA can be carried out by a conventional PCR reaction. In other words, the sample DNA can be amplified by a PCR reaction consisting of total denaturation, denaturation, primer binding, and chain extension.

In a preferred embodiment of the present invention, the herpes-virus virus primer and β-globin primer, dATP, dCTP, dGTP, dTTP, labeling material, and Taq polymerase, and optionally, BSA and DMSO using the PCR as an additive Place in a thermocycler, denature for 5 minutes at 94 ° C, denature for 1 minute at 94 ° C, 45 seconds at 45-60 ° C Primer annealing for 1 minute, extension process for 20 to 45 seconds at 72 ° C. for 30 to 35 times, followed by extension for 2 minutes at 72 ° C. to obtain an amplified DNA sample with labeled molecules. do.

Hereinafter, the human herpes virus detection method using the analysis kit of the herpes virus of the present invention will be described in more detail by dividing step by step.

Step 1: Obtain and Amplify the Sample

Amplify the sample to be tested to obtain an amplified sample containing Cy5 (Cyanine 5): At this time, an amplified sample is obtained by PCR using Cy5-dUTP so that the amplified sample contains Cy5.

Second Step: Hybridization Reaction

An electrical amplification sample is applied to the DNA chip to perform hybridization reaction with the probe.

Third Process: Detection

The probe and the hybridized DNA are labeled with a labeling means and detected to determine whether the herpes virus is infected. The detection method is carried out according to the detection method of each display means, for example, can be read by scanning with a confocal laser scanner as the detection means.

HHV genotyping kit and analysis method using the DNA chip of the present invention, when diagnosing the infection of HHV, it is possible to detect HHV infection and genotype quickly, simply and accurately, so that the exact HHV causing STD Diagnosis, thereby preventing and treating genital herpes or Kaposi's sarcoma.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention in more detail, it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention. . Since the type and number of probes are not particularly limited, various analysis kits using DNA chips and electric DNA chips using probes having base sequences derived from HHV are also within the scope of the present invention.

Example 1 Preparation of Probes

Probes specific to each HHV genotype and β-globin specific probes used for genotyping of HSV-1, HSV-2 and HHV-8 were constructed to include an amine group at the 5 'end. The base sequence of each probe is shown in Table 1 and SEQ ID NOs: 1 to Shown in 10.

Example 2: Preparation of DNA Chips

Each probe prepared in Example 1 was dissolved in 3X SSC (0.05 M sodium citrate, 0.45 M NaCl, pH 7.0) to 200 pmol / l, and an aldehyde group bonded slide (silylated slide, CSS-100, CEL, Houston, TX, USA) Using the arrayer (GMS 417 Arrayer, TaKaRa, Japan) on the surface, spotting at 150 m size and 300 m spacing for 4 hours at 37 ℃ and 70% humidity A biphasic Schiff base reaction was performed followed by washing the slides with 0.2% (w / v) sodium dodecyl sulfate (SDS) solution, washing with tertiary distilled water, and then NaBH ₄ After dipping in a solution (2 g NaBH ₄ , 150 ml phosphate buffered saline (PBS), 50 ml ethanol) for 40 minutes to reduce the amine unbound aldehyde, washed with tertiary distilled water, and dried to prepare a DNA chip It was.

Also attached to the surface of the solid was β-globin, which serves as a control for global position markers and hybridization reactions.

1 and 7 show a layout view of a DNA chip according to an example of the present invention. Figure 1 is a schematic diagram showing the type and location of the probes located on the DNA chip, the number denotes each probe, (○) represents the site to which the probe can bind to the sample, (●) is the reaction A background marker for checking whether or not it has occurred and at the same time a reference marker for indicating the position of the probe.

Example 3: Obtaining a Sample

To check whether human tissue or herpes bleeding (lesion) or the like has been infected with HHV, DNA was first extracted from the tissue and purified. Using the purified DNA as a template, PCR was performed using β-globin primers having SEQ ID NOs: 21 and 22, and DNAs amplified by β-globin gene were selected and used as search samples. . Clinical samples were obtained from the Korean National Institute of Health (KNIH), Nokban-dong, Eunpyeong-gu, Seoul, Korea.

In addition, the HSV-1 and HSV-2 positive controls of the samples were cultured in Vero cells grown on RPMI 1640 medium with the standard virus (HSV-1 (F strain); HSV-2 (G strain) purchased from the National Institutes of Health. After extraction and purification was used. In addition, HHV-8 DNA extracted and purified from Bcbl-1 cell line (body cavity based lymphoma) donated by Korea Advanced Institute of Science and Technology (KAIST) in Guseong-dong, Yuseong-gu, Daejeon, Korea was used as a positive control. It was.

3-1: Obtaining β-globin Sample

The configuration and conditions for establishing the optimal PCR of β-globin are as follows. 2X PCR buffer (50 mM KCl, 10 mM Tris-HCl, pH 8.3), 0.1 μg DNA, 2 mM MgCl ₂ , 25 pmol β-globin primers of SEQ ID NO: 11 and SEQ ID NO: 12, 50 μM of each dNTP using a mixture (TaKaRa), 0.05 nM of Cy5-dUTP (NEN, USA) and 2 units Taq polymerase BSA and DMSO, etc. as additives in some cases includes a (second unit Taq polymerase, TaKaRa, Japan) in 50 ㎕ The reaction mixture is placed in a PCR thermocycler (thermocycler, Perkin-Elmer Cetus, Calif., USA), denatured at 94 ° C. for 5 minutes, denatured at 94 ° C. for 1 minute, and conjugated at 50 ° C. for 2 minutes. (primer annealing), repeat the extension process for 30 seconds at 72 ℃ 5 times, denatured for 1 minute at 94 ℃, primer binding for 2 minutes at 50 ℃, and repeat 35 times for 15 seconds at 72 ℃. Thereafter, the reaction was further extended at 72 ° C. for 2 minutes to obtain an amplified DNA sample having Cy5 bound thereto.

3-2: Obtaining HHV Samples (using SEQ ID NOs: 13, 14, 17 and 18 or primers 11, 12, 17 and 18)

For optimal PCR amplification of HHV, PCR was performed using SEQ ID NOs. 13, 14, and SEQ ID NOs: 17 and 18 as primers: 1 × PCR buffer (50 mM KCl, 10 mM Tris-HCl, pH 8.3), 0.1 μg DNA, 2 mM MgCl ₂ , 25 pmol primer each, 100 μM each dATP, dCTP, dGTP, dTTP (TaKaRa), 5% Dimethyl suloxide (DMSO), 0.05 nM Cy5-dUTP 50 μl of reaction mixture containing (NEN, USA) and 2.5 unit Taq polymerase (TaKaRa, Japan) was placed in a PCR thermocycler (thermocycler, Perkin-Elmer Cetus, Calif., USA) and denatured at 94 ° C. for 5 minutes. (denaturation), denaturation at 94 ° C. for 1 minute, primer annealing at 58 ° C. for 45 seconds, extension at 72 ° C. for 30 seconds, and then extension reaction at 72 ° C. for 2 minutes To obtain an amplified DNA sample bound to Cy5. The results are shown in FIG. 2.

PCR was performed using the purified HSV-1, -2, HHV-8 DNA as a template, and using SEQ ID NOs: 11, 12, and SEQ ID NOs: 17 and 18 as primers: 1 x PCR buffer ( 50 mM KCl, 10 mM Tris-HCl, pH 8.3), 0.1 μg DNA, 2 mM MgCl ₂ , 25 pmol primer each, 100 μM each dATP, dCTP, dGTP, dTTP (TaKaRa), 5% Dimethyl suloxide 50 μl of reaction mixture containing (DMSO), 0.05 nM of Cy5-dUTP (NEN, USA) and 2.5 units of Taq polymerase (TaKaRa, Japan) was added to a PCR thermocycler (thermocycler, Perkin-Elmer Cetus, CA, USA). ), Denature for 5 minutes at 94 ° C, denature for 1 minute at 94 ° C, primer annealing for 45 seconds at 58 ° C, and extension for 30 seconds at 72 ° C. After repeated extension reaction at 72 ° C. for 2 minutes, an amplified DNA sample conjugated with Cy5 was obtained. PCR results are shown in FIG. 4.

3-3: Obtaining HHV Samples (using SEQ ID NOs: 15 and 16, 17 and 18 primers)

For PCR amplification of HSV-1 and HHV-8, PCR was performed using SEQ ID NO: 13, 14, and SEQ ID NO: 17 and 18 as primers as follows. 1 x PCR buffer (50 mM KCl, 10 mM Tris-HCl, pH 8.3), 0.1 μg DNA, 1.5 mM MgCl ₂ , primers of 10 pmol each, 100 μM of each dATP, dCTP, dGTP, dTTP (TaKaRa) , 50 μl of reaction mixture containing 0.05 nM of Cy5-dUTP (NEN, USA) and 2 units of Taq polymerase (TaKaRa, Japan) were placed in a PCR thermocycler (Perkin-Elmer Cetus, Calif., USA). After denaturation at 94 ° C. for 5 minutes, denaturation at 94 ° C. for 1 minute, primer annealing at 55 ° C. for 45 seconds, extension at 72 ° C. for 30 seconds, and then repeated 35 times. The reaction was further extended at 72 ° C. for 2 minutes to obtain an amplified DNA sample having Cy5 bound thereto. PCR results are shown in FIG. 5.

3-4: Obtaining Clinical Samples

DNA obtained from the previously obtained blister or tissue was used as a template, and a nucleotide sequence having SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 17, and SEQ ID NO: 18 was used as a primer, and Cy5 was prepared in the same manner as in Example 3-2. Combined amplified DNA samples were obtained.

Example 4: Confirmation of Infection Using DNA Chips

By applying the amplified sample obtained in Example 3 to the DNA chip prepared in Example 2, the hybridization reaction was carried out as follows. In this case, a 100 μl cover slip (GRACE Bio-Labs, USA, PC4L-1.0) was used as a hybridization reaction chamber.

For standard viral DNA or for clinical sample DNA, a mixture of 15 μl of HHV amplification product and 5 μl of β-globin amplification product was used as the reaction sample . 10% (v / v) of 3N sodium hydroxide (NaOH) aqueous solution was added to the sample to denature at room temperature for 5 minutes, and neutralized by adding 5% (v / v) of 1M Tris-HCl (pH 7.4). . Thereafter, 10% (v / v) of 3N hydrochloric acid was added to the resultant, and then left for 5 minutes on ice. Then, silylated at 45 ° C using hybridization solution (6X Saline-Sodium Phosphate-EDTA buffer (SSPE, Sigma Chemical Co., St. Louis, MO, USA) and 0.05% sodium dodecyl sulfate (SDS) After 2 hours of reaction with the probe immobilized on the silylated slide, the DNA chip was washed for 2 minutes with 3X SSPE and 2 minutes with 1X SSPE and air dried at room temperature or dried using a spin dryer. Fluorescence signals were analyzed using a confocal laser scanner (GSI Lumonics, Germany) (excitation 650 nm, emission 668 nm).

6A, 6B, 6C, and 6D show the results of analysis using the HHV samples obtained using the primers of SEQ ID NO: 13, 14, 17, and 18 in Example 3-2. 6A is a photograph showing the result of analyzing HSV-1, FIG. 6B is a photograph showing the result of analyzing HSV-2, and FIG. 6C is a photograph showing the result of analyzing HHV-8. Figure 6d is a result of analyzing the β-globin photograph shows the result that HHV was not detected. As shown in Figures 6a to 6d, it was confirmed that the hybridization signal resulting from the amplification product of each DNA appears to be clear only in the probe in place without other serious cross-hybridization.

The results of the analysis using the HHV samples obtained using the primers of SEQ ID NO: 15, 16, 17 and 18 in Example 3-3 are shown in FIGS. 8A, 8B and 8C. 8A is a photograph showing the result of analyzing HSV-1, and FIG. 8B is a photograph showing the result of analyzing HHV-8. Figure 8c shows the result of the HHV was not detected in the photograph of the β-globin analysis.

Example 5 Confirmation of Diagnostic Results of Clinical Samples Using DNA Chips

The clinical sample obtained in Example 3-4 was subjected to genotyping assay of HHV in substantially the same manner as in Example 4. The analysis results are shown in FIGS. 9A and 9B 9C. As a result, FIG. 9A was analyzed as a sample infected with HSV-1, FIG. 9B was analyzed as a sample infected with HSV-2, FIG. 9C was analyzed as a sample infected with HHV-8, and FIG. 9D was not detected when HHV was detected. Indicates.

As a result of the assay, the genotyping kit of the present invention not only could easily detect HHV, but also could determine the genotype of infected HHV. Therefore, using the DNA chip according to the present invention will be able to contribute to the diagnosis of HHV infection and the prevention of herpes recurrence or AIDS due to the correct treatment.

As described above in detail specific parts of the present invention, it is apparent to those skilled in the art that such specific descriptions are merely preferred embodiments, and thus the scope of the present invention is not limited thereto. something to do. Thus, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

HHV genotyping kit and analysis method using the DNA chip of the present invention, when diagnosing the infection of HHV, it is possible to detect HHV infection and genotype quickly, simply and accurately, so that the exact HHV causing STD Diagnosis, thereby preventing and treating genital herpes or Kaposi's sarcoma.

<110> BIOMEDLAB <120> PROBE FOR DETECTING Human herpesvirus, GENOTYPING KIT AND GENOTYPING METHOD FOR Human herpes virus USING THE SAME <130> DPP2002-1913 <160> 24 <170> KopatentIn 1.71 <210> 1 <211> 25 <212 > DNA <213> Artificial Sequence <220> <223> HSV-1 Probe <400> 1 acctacctgg ggatctcaac aggcc 25 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HSV- 1 Probe <400> 2 gtacctacct ggggatctca aca 23 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HSV-1 Probe <400> 3 tgtacctacc tggggatctc aacag 25 <210> 4 < 211> 30 <212> DNA <213> Artificial Sequence <220> <223> HSV-1 Probe <400> 4 ccaagactga cacattaaaa aacacagaat 30 <210> 5 <211> 33 <212> DNA <213> Artificial Sequence <220 > <223> HSV-1 Probe <400> 5 atcccaagac tgacacatta aaaaacacag aat 33 <210> 6 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> HSV-1 Probe <400> 6 aaccaagact gacacattaa aaaacacagg tt 32 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> HSV-2 Probe <400> 7 gtaccgaccc ggagtccgta gcag 24 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HHV-8 Probe <400> 8 cagaattgct ccacgcgctg cacct 25 <210> 9 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HHV-8 Probe <400> 9 gaattgctcc acgcgctgca cctcg 25 <210> 10 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Beta-globin Probe <400> 10 tgcacctgac tcctgaggag aagtctgccg 30 <210> 11 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Forward Primer for HSV-1 and HSV-2 <400> 11 gtcgtccaga tgcccac 17 <210> 12 <211> 18 < 212> DNA <213> Artificial Sequence <220> <223> Backward Primer for HSV-1 and HSV-2 <400> 12 atcacgcatc tgcacaac 18 <210> 13 <211> 19 <212> DNA <213> Artificial Sequence <220 > <223> Forward Primer for HSV-1 and HSV-2 <400> 13 gtcgtccaga cgcccacgg 19 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Backward Primer for HSV-1 and HSV-2 <400> 14 atcacgcacc tgcacaacgc 20 <210> 15 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Forward Primer for HSV-1 <400> 15 agctgatagc ccagcgcg 18 <210> 16 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Backward Primer for HSV-1 <400> 16 gctttttggc ccactcgc 18 <210> 17 <211> 17 <212> DNA < 213> Artificial Sequence <220> <223> Forward Primer for HHV-8 <400> 17 agtcgtccgc tctgacg 17 <210> 18 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Backward Primer for HHV -8 <400> 18 taatctttga acagttaatc gc 22 <210> 19 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Forward Primer for HHV-8 <400> 19 gtcgtccgct ctgacgcgg 19 <210> 20 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Backward Primer for HHV-8 <400> 20 atctttgaac agttaatcgc cgg 23 <210> 21 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Forward Primer for beta-globin <400> 21 atacaagtca gggcagag 18 <210> 22 <211> 20 <212> DNA < 213> Artificial Sequence <220> <223> Backward Primer for beta-globin <400> 22 cttaaacctg tcttgtaacc 20 <210> 23 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Known Forward Primer for HSV-1, HSV-2, and HHV-8 <400> 23 gtggtggact ttgccagcct gtaccc 26 <210> 24 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Known Backward Primer for HSV-1 , HSV-2 and HHV-8 <400> 24 taaacatgga gtccgtgtcg ccgtagatga 30

Claims (18)

Oligonucleotides having the nucleotide sequences shown in SEQ ID NOS: 1 to 9, and oligonucleotides having the nucleotide sequence complementary to the oligonucleotides, are selected from the group consisting of, and complementary to the nucleic acid of the human Herpes Virus (HHV) Binding probes. Primer for amplification of human herpes virus (HHV) DNA comprising at least one oligonucleotide selected from the group consisting of oligonucleotides having the nucleotide sequence shown in SEQ ID NO: 11 to SEQ ID NO: 20. A primer for amplifying HSV-1 and HSV-2 DNA, which is a primer pair having a nucleotide sequence shown in SEQ ID NO: 11 and SEQ ID NO: 12, or a pair of primers having a nucleotide sequence shown in SEQ ID NO: 13 and SEQ ID NO: 14. A primer pair for amplifying HHV-8 DNA having a nucleotide sequence shown in SEQ ID NO: 17 and SEQ ID NO: 18, or a nucleotide sequence shown in SEQ ID NO: 19 and SEQ ID NO: 20. Human Herpes Virus (Human Herpes Virus) comprising at least one HHV probe selected from the group consisting of oligonucleotides having the nucleotide sequences shown in SEQ ID NO: 1 to SEQ ID NO: 9, and oligonucleotides having a nucleotide sequence complementary to these oligonucleotides , HHV) DNA chip for detection or genotyping. The method according to claim 5, wherein at least one probe of HSV-1 selected from the group consisting of oligonucleotides having a nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 3 of HSV-2 having an oligonucleotide having a nucleotide sequence of SEQ ID NO: 7 DNA chip for detection or genotyping of a herpes virus comprising a probe and a probe of HHV-8 selected from the group consisting of oligonucleotides having the nucleotide sequences of SEQ ID NOs: 8 and 9. 6. The DNA chip of claim 5, wherein the DNA chip further comprises a reference marker probe selected from the group consisting of β-globin, actin, and glyceraldehyde-3-phosphate dehydrogenase genes. DNA chip. 8. The DNA chip of claim 7, wherein the β-globin probe has a nucleotide sequence shown in SEQ ID NO: 10. The DNA chip according to claim 5, wherein the 5 'terminal amine group of the probe DNA is immobilized by a cip group reaction with an aldehyde group on the surface of the chip solid. (a) a DNA chip for detecting or genotyping human herpes virus (HHV) according to any one of claims 5 to 9, (b) a primer set for amplifying a sample HHV DNA by a PCR method, and ( c) kit for the detection or genotyping of a herpes virus comprising a labeling means for detecting amplified DNA hybridized with the DNA chip. The method of claim 10, wherein the labeling means is Cy5, Cy3, biotin-binding material, EDANS (5- (2'-aminoethyl) amino-1-naphthalene sulfate), tetramethyltamine (TMR), tetramethyltamine Kit for detection or genotyping of the herpes virus, which is selected from the group consisting of isocyanate (TMRITC), x-rhodamine and Texas red. The method of claim 10, wherein the primer set is a primer pair having a nucleotide sequence shown in SEQ ID NO: 11 and 12, a primer pair having a nucleotide sequence shown in SEQ ID NO: 13 and 14, a primer having a nucleotide sequence shown in SEQ ID NO: 15 and 16 And a pair of primer pairs selected from the group consisting of a pair of primers having a nucleotide sequence shown in SEQ ID NOs: 17 and 18, and a pair of primers having a nucleotide sequence shown in SEQ ID NOs: 19 and 20. The method of claim 12, wherein the primer set is selected from the group consisting of a primer pair having a nucleotide sequence shown in SEQ ID NO: 11 and 12, and a primer pair having a nucleotide sequence shown in SEQ ID NO: 13 and 14 HSV-1 and HSV-2 Primer pairs for amplifying DNA, A kit comprising a primer pair for amplifying HHV-8 DNA selected from the group consisting of a primer pair having a nucleotide sequence shown in SEQ ID NO: 17 and 18, and a primer pair having a nucleotide sequence shown in SEQ ID NO: 19 and 20. The kit according to claim 10, wherein the primer set comprises a primer pair for amplifying β-globin DNA having a nucleotide sequence of SEQ ID NO: 21 to a nucleotide sequence of SEQ ID NO: 22. (A) amplifying the DNA of the sample using a primer for DNA amplification of the herpes virus; (b) the DNA amplified in the DNA chip comprising oligonucleotides having the nucleotide sequences shown in SEQ ID NOS: 1-9, and at least one HHV probe selected from the group consisting of oligonucleotides having a nucleotide sequence complementary to these oligonucleotides Hybridizing; And (c) detecting or genotyping the herpes virus, comprising detecting the probe and the hybridized reactant. The method of claim 15, wherein the primer is selected from the group consisting of HHV DNA amplification primers having a nucleotide sequence of SEQ ID NO: 11 to SEQ ID NO: 20. 16. The method of claim 15, wherein the detection of the herpes virus is characterized in that the fluorescent signal is analyzed using a confocal laser scanner when the gene is labeled with Cy5. (A) amplifying the sample DNA using a primer for DNA amplification of the herpes virus; (b) hybridizing the amplified DNA with at least one HHV probe selected from the group consisting of oligonucleotides having the nucleotide sequences shown in SEQ ID NOS: 1-9, and oligonucleotides having the nucleotide sequences complementary to these oligonucleotides; And (c) detecting or genotyping the herpes virus, comprising detecting the probe and the hybridized reactant.