KR20040022800A - PROBE FOR DETECTING Human herpesvirus, GENOTYPING KIT AND GENOTYPING METHOD FOR Human herpes virus USING THE SAME - Google Patents

PROBE FOR DETECTING Human herpesvirus, GENOTYPING KIT AND GENOTYPING METHOD FOR Human herpes virus USING THE SAME Download PDF

Info

Publication number
KR20040022800A
KR20040022800A KR1020020054330A KR20020054330A KR20040022800A KR 20040022800 A KR20040022800 A KR 20040022800A KR 1020020054330 A KR1020020054330 A KR 1020020054330A KR 20020054330 A KR20020054330 A KR 20020054330A KR 20040022800 A KR20040022800 A KR 20040022800A
Authority
KR
South Korea
Prior art keywords
seq
dna
hhv
nucleotide sequence
probe
Prior art date
Application number
KR1020020054330A
Other languages
Korean (ko)
Other versions
KR100460747B1 (en
Inventor
김정미
이지영
윤성욱
Original Assignee
주식회사 바이오메드랩
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 바이오메드랩 filed Critical 주식회사 바이오메드랩
Priority to KR10-2002-0054330A priority Critical patent/KR100460747B1/en
Publication of KR20040022800A publication Critical patent/KR20040022800A/en
Application granted granted Critical
Publication of KR100460747B1 publication Critical patent/KR100460747B1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2531/00—Reactions of nucleic acids characterised by
    • C12Q2531/10—Reactions of nucleic acids characterised by the purpose being amplify/increase the copy number of target nucleic acid
    • C12Q2531/113—PCR
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2563/00—Nucleic acid detection characterized by the use of physical, structural and functional properties
    • C12Q2563/107—Nucleic acid detection characterized by the use of physical, structural and functional properties fluorescence

Abstract

PURPOSE: A probe for detecting human herpesvirus(HHV), a genotyping kit and a genotyping method for human herpesvirus using the same are provided, thereby rapidly, simply and accurately detecting HHV which consists of Herpes Simplex virus type 1(HSV-1), HSV-2 and human herpesvirus-8(HHV-8) and causes STD(sexual transmitted disease). CONSTITUTION: A probe for detecting human herpesvirus(HHV) is selected from oligonucleotides having the nucleotide sequences of SEQ ID NO: 1 to SEQ ID NO: 9 and complementary oligonucleotides thereof and complementarily binds to the nucleic acid of human herpesvirus. A DNA chip for detecting human herpesvirus(HHV) or genotyping of HHV contains at least one probes selected from oligonucleotides having the nucleotide sequences of SEQ ID NO: 1 to SEQ ID NO: 9 and complementary oligonucleotides thereof. A genotyping kit for human herpesvirus comprises (a) the DNA chip for detecting human herpesvirus, (b) a PCR primer and (c) a marker means for detecting amplified DNA hybridized with the DNA chip. A genotyping method for human herpesvirus comprises the steps of: (a) amplifying a sample DNA using the PCR primer; (b) hybridizing the amplified DNA on the DNA chip containing one probe or two or more of probe sets; and (c) detecting the product hybridized with the probe.

Description

인체포진 바이러스의 프로브, 이를 이용한 인체포진 바이러스의 유전형 분석용 키트 및 유전형 분석방법{PROBE FOR DETECTING Human herpesvirus, GENOTYPING KIT AND GENOTYPING METHOD FOR Human herpes virus USING THE SAME}PROBE FOR DETECTING Human herpesvirus, GENOTYPING KIT AND GENOTYPING METHOD FOR Human herpes virus USING THE SAME}

[기술분야][Technical Field]

본 발명은 성병-관련 인체포진 바이러스 (Human herpesvirus, HHV)을 탐지 또는 유전형 분석키트 및 분석방법, 및 이에 사용되는 프로브 및 DNA 칩에 관한 것이다. 더욱 구체적으로, 본 발명은 DNA 칩을 사용하여 HHV에 속하는 바이러스인 단순포진 바이러스-1 (Herpes Simplex Virus type 1, HSV-1)과 단순포진 바이러스-2 (HSV-2)그리고 인체포진 바이러스-8 (HHV-8)에 감염된 환자의 유전형을 분석하는 유전형 분석키트 및 전기 분석키트를 사용하여 환자의 유전형을 분석함으로써, 인체포진 바이러스의 감염여부를 판별하는 방법에 관한 것이다.The present invention relates to kits or methods for detecting or genotyping human herpesvirus (HHV), and probes and DNA chips used therein. More specifically, the present invention is a herpes simplex virus type 1 (HSV-1) and herpes simplex virus-2 (HSV-2) and herpes virus-8 virus belonging to the HHV using a DNA chip The present invention relates to a method of determining whether a herpes virus is infected by analyzing a genotype of a patient using a genotyping kit and an electrical analysis kit for analyzing the genotype of a patient infected with (HHV-8).

[종래기술][Private Technology]

성병 (Sexual Transmitted Diseases, STD)에 관련된 인체포진 바이러스(Human herpesvirus, HHV)로는 단순포진 바이러스-1 (Herpes Simplex Virus type 1, HSV-1)과 HSV-2, 및 HHV-8을 들 수 있다. HSV는 음부포진을 일으키는 원인 바이러스로서 성관계에 의해 감염되며 성기부위에 수포를 형성한다.Human herpesviruses (HHVs) related to Sexual Transmitted Diseases (STD) include Herpes Simplex Virus type 1 (HSV-1), HSV-2, and HHV-8. HSV is a virus that causes genital herpes and is infected by sexual intercourse, forming blisters on the genital area.

HSV에 의한 초기 감염은 성기부위에 수포를 형성한 후 궤양을 형성하거나 무증상 감염을 보인다. 이 후 바이러스가 신경절에 잠복함으로써 평생동안 잠복감염을 유발하게 되며, 신경절에 잠복하는 바이러스가 스트레스 등의 외부 요인에 의하여 활성화되어 성기 부위에 수포와 궤양을 다시 형성하거나 무증상으로 바이러스를 분비함으로써 재발하게 된다.Early infections with HSV form blisters in the genital area, followed by ulcers or asymptomatic infections. Afterwards, the virus lurks in the ganglion, causing latent infection for life, and the virus lurking in the ganglion is activated by external factors, such as stress, to regenerate blisters and ulcers in the genital area, or to secrete the virus asymptomatically. do.

음부포진의 가장 큰 위험요인은 감염자의 약 80%가 무증상으로 감염 사실을 인식하지 못한 채 불현성 바이러스 유출에 있어 중요한 수직 및 수평 감염의 원인이 되고 있다는 점이다. 전세계적으로 4천5백만명 정도가 감염되어 있으며 1990년대에는 1970년대 말에 비해 약 32%가 증가한 것으로 알려지고 있다. 다른 STD는 점점 감소하는데 비해 음부포진은 점점 증가하는 추세로 STD에서 점점 중요한 위치를 차지하고 있다. 임산부의 산도 혹은 자궁내 HSV 감염시에 유산 혹은 사산의 가능성이 증가됨이 보고된 바 있으며 (Nahmias AJ. et al., Am. J. Obstet Gynecol 1971; 110: 825) 또한 HSV-2는 자궁경부암의 병원체일 가능성이 시사된 바 있다(Adam E. et al.,Cancer1974; 33:147-52).The greatest risk factor for genital herpes is that about 80% of infected people are asymptomatic and are responsible for significant vertical and horizontal infections in the outbreak of the virus. An estimated 45 million people worldwide are infected, with an increase of about 32% in the 1990s from the late 1970s. Herpes genitals are becoming more and more important, while other STDs are decreasing. There has been an increased risk of miscarriage or stillbirth during birth canal or intrauterine HSV infection in pregnant women (Nahmias AJ. Et al., Am. J. Obstet Gynecol 1971; 110: 825). The possibility of a pathogen has been suggested (Adam E. et al., Cancer 1974; 33: 147-52).

HHV-8은 1994년 에이즈 환자의 카포시 육종에서 처음 발견되었으며(Chang Y. et al.,Science1994; 266:1865-69), 에이즈 환자의 카포시 육종 조직의 90% 정도에서, 에이즈 무관련 환자의 카포시 육종 조직의 50% 정도에서 검출되어 HHV-8은 카포시 육종의 원인 바이러스로 인식되고 있다. 또한 천포창 (Memar OM. et al.,Arch Dermatol1997; 133:1247-51), Castleman병 (Soulier J. et al.,Blood1995; 86:1276-80), 일차 삼출액 림프종 (primary effusion lymphoma) (Cesarman E. et al.,N Engl J Med1995; 332:1186-91), 유육종증 (Di Alberti L. et al.,Lancet1997; 350: 1655-61), 골수종 (Rettig MB. et al.,Science1997; 276:1851-54), 혈관육종 (Gyulai R. et al.,N Engl J Med1996; 22:540-41), Kikuchi병 (Huh JR. et al,Hum Pathol1998; 29:1091-96), Angiolymphoid hyperplasia with eosinophilia (ALHE)(Gyulai R. et al.,Lancet1996; 347:1837) 등의 질환과의 연관성이 보고되고 있다. 지금까지 동성연애 남성들의 성행위를 통해 전파된다고 알려져 있었으나 이성연애자의 항문 주위에서도 HHV8 DNA가 검출되었으며 (장경애 등, 대한피부과학회지 2000; 38(9):1162-1167), 소아나 코의 분비물, 침 등에서도 HHV-8이 검출된 것을 볼 때 전파에 다른 요인이 작용할 것으로 생각할 수 있다 (Blackbourn DJ. et al.,J Invest Dis1998; 177:213-16). HSV-2와 HHV-8에 감염된 환자는 에이즈에 감수성이 높으며 (Maria C. et al.,J Clin Microbiol1998; 36:848-49, Thomas FS. Et al.,Virus Res2002; 82:115-26), 이들 바이러스는 동성연애자, 직업여성, 다른 성병에 노출되었던 경험이 있던 자에게 감염의 위험이 더욱 높다.HHV-8 was first discovered in Kaposi's sarcoma in HIV patients in 1994 (Chang Y. et al., Science 1994; 266: 1865-69), and in approximately 90% of Kaposi's sarcoma tissue in AIDS patients, It is detected in about 50% of Kaposi's sarcoma tissue, and HHV-8 is recognized as a causative virus of Kaposi's sarcoma. See also: Meal OM. Et al., Arch Dermatol 1997; 133: 1247-51, Castleman's disease (Soulier J. et al., Blood 1995; 86: 1276-80), primary effusion lymphoma ( Cesarman E. et al., N Engl J Med 1995; 332: 1186-91), sarcoidosis (Di Alberti L. et al., Lancet 1997; 350: 1655-61), myeloma (Rettig MB. Et al., Science 1997; 276: 1851-54), angiosarcoma (Gyulai R. et al., N Engl J Med 1996; 22: 540-41), Kikuchi disease (Huh JR. Et al, Hum Pathol 1998; 29: 1091-96 , Angiolymphoid hyperplasia with eosinophilia (ALHE) (Gyulai R. et al., Lancet 1996; 347: 1837). So far, it has been known to spread through the sexual acts of homosexual men, but HHV8 DNA has also been detected around the anus of heterosexual men (Jang Kyung Ae et al., Korean Dermatological Association 2000; 38 (9): 1162-1167), secretions of children and nose It can be considered that other factors may affect the propagation in the presence of HHV-8 (Blackbourn DJ. Et al., J Invest Dis 1998; 177: 213-16). Patients infected with HSV-2 and HHV-8 are highly susceptible to AIDS (Maria C. et al., J Clin Microbiol 1998; 36: 848-49, Thomas F. Et al., Virus Res 2002; 82: 115- 26) These viruses are at higher risk for infection in homosexuals, working women, and those who have been exposed to other sexually transmitted diseases.

HSV에 의한 음부포진의 진단은 대부분 임상적 특징으로 진단이 가능하였으나 여러 원인에 의해 면역기능이 저하된 환자가 증가하고 있으며 이런 환자에서 비전형적인 임상양상을 보이는 경우가 흔하게 되었다. 따라서 정확한 HSV의 진단을 위해 Tzanck 도말, 병리조직학적 검사, 전자 현미경 검사, 혈청학적 검사, 조직내 바이러스 배양, 면역형광법 및 PCR 등을 시행한다.The diagnosis of genital herpes by HSV has been mostly clinical, but the number of patients with reduced immune function is increasing due to various causes, and these patients often have atypical clinical features. Therefore, Tzanck smear, pathologic examination, electron microscopy, serological examination, tissue culture, immunofluorescence and PCR are performed for accurate diagnosis of HSV.

Tzanck 도말은 경제적이고, 임상에서 신속한 진단에 도움을 주나 판독하는 사람에 따라 결과가 달라질 수 있고, 위음성도가 비교적 높으며 (Nahass GT. et al.,JAMA1992; 268:2541-44), 병리 조직학적 검사 역시 다른 바이러스 질환과의 구분이 힘들다는 단점이 있다.Tzanck smears are economical, help clinical diagnosis, but may vary with the reader, results are relatively high false negative (Nahass GT. Et al., JAMA 1992; 268: 2541-44), and pathological tissue Medical tests also have the disadvantage of being difficult to distinguish from other viral diseases.

전자 현미경 검사로는 판독자의 경험 정도에 따라 민감도와 특이도에 큰 차이가 있으며 감염된 HSV의 type을 구별할 수 없다 (Solomon AR. et al.,J Am Acad Dermatol1988; 18:218-21). 바이러스 배양은 세포병성 효과 (cytopathic effect)를 보려면 배양 후 7일 이후에나 가능하므로 판독이 늦은 단점으로 인하여 환자의 진료에 큰 도움을 주지 못한다.Electron microscopy reveals significant differences in sensitivity and specificity, depending on the experience of the reader, and cannot distinguish between types of infected HSV (Solomon AR. Et al., J Am Acad Dermatol 1988; 18: 218-21). Virus cultivation is only possible after 7 days of culture to see the cytopathic effect, so the late reading does not provide much benefit for the patient's care.

HSV의 유전형을 구별할 수 있는 검사로는 항체를 이용한 면역형광법 또는 중합효소연쇄반응 (Polymerase Chain Reaction, 이하 PCR)등이 있다. 면역형광법은 민감도와 특이도가 비교적 높고 바이러스 형을 구분할 수 있는 장점이 있으나 형광 현미경이 필요하고 조직을 얼리거나 고정해야 하는 단점이 있다 (Solomon AR. et al.,J Am Acad Dermatol1988; 18:218-21). 이에 반해 PCR은 종래의 단점들을 보완하고 매우 높은 특이성과 감수성으로, 빠르고 정확한 결과 도출을 가능하게 하였다. HSV-1과 HSV-2는 임상적 증세나 감염의 경로, 재발율 등의 예후가 각각 다르기 때문에 정확한 진단과 치료를 위해 감염된 HSV형의 감별이 필요하다. 지금까지는임상에서 많은 시간과 경비 소요를 이유로 정확한 감별을 시행하지 않았으나 최근 헤르페스 바이러스의 감염에 대한 새로운 항바이러스 제제의 계속되는 개발로 인해 치료에 효과적인 예민한 약제의 선택이 필요하게 되었다 (De Clercq E. et al.,J Infect Dis1980; 141:563-74). 이에 따라 HSV의 존재뿐만 아니라 유전형을 확인하는 기법들에 관한 연구가 지속적으로 진행되고 있는 실정이다.As a test for distinguishing genotypes of HSV, immunofluorescence or polymerase chain reaction (PCR) using antibodies can be used. Immunofluorescence has a relatively high sensitivity and specificity, and has the advantage of distinguishing virus types, but the disadvantage of requiring a fluorescence microscope and freezing or fixing the tissue (Solomon AR. Et al., J Am Acad Dermatol 1988; 18: 218-21). On the other hand, PCR has made up for the shortcomings of the prior art and has a very high specificity and sensitivity, thereby enabling fast and accurate results. Since HSV-1 and HSV-2 have different prognosis such as clinical signs, path of infection, and recurrence rate, it is necessary to distinguish between infected HSV types for accurate diagnosis and treatment. To date, no accurate differentiation has been carried out for clinical reasons because of the time and expense required, but the recent development of new antiviral agents against the infection of herpes virus has led to the need for the selection of sensitive agents effective for treatment (De Clercq E. et. al., J Infect Dis 1980; 141: 563-74). Accordingly, research into techniques for identifying genotypes as well as the presence of HSV has been continuously conducted.

따라서, 인체포진 바이러스의 감염여부와 그 유전형을 간단하고, 정확하게 진단할 수 있을 뿐만 아니라 높은 특이도와 민감도를 갖는 인체포진 바이러스의 진단 방법 및 키트, 이에 사용되는 프로브 및 DNA 칩을 개발하여야 할 필요성이 끊임없이 대두되었다. 또한, 상기 진단키트, 이에 사용되는 프로브 및 DNA 칩은 STD를 일으키는 HHV의 세가지 유형을 높은 특이도 및 민감도로 분석하여 HHV 감염여부와 유전형을 더욱 정확하게 진단할 수 있어야 한다.Therefore, it is not only necessary to develop a simple and accurate diagnosis of herpes virus infection and its genotype, but also to develop a diagnostic method and kit for human herpes virus having high specificity and sensitivity, probes and DNA chips used therein. Constantly emerging. In addition, the diagnostic kit, probes and DNA chips used therein should be able to diagnose HHV infection and genotype more accurately by analyzing three types of HHV causing STD with high specificity and sensitivity.

상기와 같은 종래기술의 문제점을 해결하고자, 본 발명은 높은 특이도 및 민감도로 HHV 감염여부와 유전형을 더욱 정확하게 진단하기 위해서, HHV의 핵산과 상보적으로 결합할 수 있는 신규 프로브를 제공하는 것을 목적으로 한다.In order to solve the problems of the prior art as described above, an object of the present invention is to provide a novel probe that can complementarily complement the nucleic acid of HHV to diagnose HHV infection and genotype more accurately with high specificity and sensitivity. It is done.

본 발명의 또다른 목적은 상기 프로브를 포함하는 인체포진 바이러스의 탐지 또는 유전형 분석용 DNA 칩을 제공하는 것이다.Still another object of the present invention is to provide a DNA chip for detecting or genotyping human herpes virus including the probe.

본 발명의 또다른 목적은 상기 프로브를 포함하는 인체포진 바이러스의 탐지 또는 유전형 분석용 키트를 제공하는 것이다.Still another object of the present invention is to provide a kit for detecting or genotyping human herpes virus including the probe.

본 발명의 또다른 목적은 상기 프로브를 이용한 인체포진 바이러스의 탐지또는 유전형 분석방법을 제공하는 것이다.Still another object of the present invention is to provide a method for detecting or genotyping human herpes virus using the probe.

도 1은 본 발명의 일례에 따른 DNA 칩에 위치한 프로브의 종류와 위치를 나타내는 모식도이다.1 is a schematic diagram showing the type and position of a probe located in a DNA chip according to an example of the present invention.

도 2는 본 발명의 일례에 따른 프라이머를 이용하여 HHV를 증폭한 사진이다.2 is a photograph of amplification of HHV using a primer according to an example of the present invention.

도 3은 서열번호 23 및 24에 나타난 종래의 프라이머를 이용하여 HHV를 증폭한 사진이다.Figure 3 is a photograph of amplification of HHV using the conventional primer shown in SEQ ID NO: 23 and 24.

도 4는 본 발명의 일례에 따른 프라이머를 이용하여 HHV DNA를 증폭한 사진이다.Figure 4 is a photograph of amplifying the HHV DNA using a primer according to an embodiment of the present invention.

도 5는 본 발명의 일례에 따른 프라이머를 이용하여 HHV DNA를 증폭한 사진이다.5 is a photograph of amplifying HHV DNA using a primer according to an example of the present invention.

도 6a는 본 발명의 일례에 따른 DNA 칩으로 HSV-1 DNA를 분석한 결과이고, 도 6b는 HSV-2 DNA를 분석한 결과이고, 도 6c는 HHV-8 DNA를 분석한 결과이고, 도 6d는 β-글로빈을 분석한 결과를 나타내는 사진으로 HHV가 검출되지 않은 결과를 나타낸다.Figure 6a is a result of analyzing the HSV-1 DNA with a DNA chip according to an example of the present invention, Figure 6b is a result of analyzing the HSV-2 DNA, Figure 6c is a result of analyzing the HHV-8 DNA, Figure 6d Is a photograph showing the result of analyzing the β-globin, shows the result that HHV was not detected.

도 7은 본 발명의 일례에 따른 DNA 칩에 위치한 프로브의 종류와 위치를 나타내는 모식도이다.7 is a schematic diagram showing the type and position of a probe located in a DNA chip according to an example of the present invention.

도 8a는 HSV-1을 분석한 결과를 나타내는 사진이고 도 8b는 HHV-8을 분석한 결과를 나타내는 사진이고, 도 8c는 β-글로빈을 분석한 결과 사진으로 HHV가 검출되지 않은 결과를 나타낸다.Figure 8a is a photograph showing the results of the analysis of HSV-1, Figure 8b is a photograph showing the results of the analysis of HHV-8, Figure 8c is a photograph showing the results of analyzing the β-globin shows a result that HHV was not detected.

도 9a, 9b, 9c는 본 발명의 일례에 따른 DNA 칩으로 임상시료를 분석한 결과를 나타내는 것으로서, 도 9a는 HSV-1에 감염된 시료로 분석되었고, 도 9b는 HSV-2에 감염된 시료로 분석되었고, 도 9c는 HHV-8에 감염된 시료로 분석되었고, 도 9d는 HHV가 검출되지 않은 결과를 나타낸다.9A, 9B, and 9C show results of analyzing a clinical sample with a DNA chip according to an example of the present invention. FIG. 9A is analyzed as a sample infected with HSV-1, and FIG. 9B is analyzed as a sample infected with HSV-2. 9c is analyzed with the sample infected with HHV-8, and FIG. 9d shows the result that no HHV was detected.

본 발명은 서열번호 1의 염기서열 내지 서열번호 9의 염기서열을 갖는 올리고뉴클레오타이드, 및 이들 올리고뉴클레오타이드에 상보적인 염기서열을 갖는 올리고뉴클레오타이드로 이루어진 군에서 선택되며, 인체포진 바이러스의 핵산과 상보적으로 결합하는 프로브에 관한 것이다.The present invention is selected from the group consisting of oligonucleotides having a nucleotide sequence of SEQ ID NO: 1 to the base sequence of SEQ ID NO: 9, and oligonucleotides having a nucleotide sequence complementary to these oligonucleotides, complementary to the nucleic acid of the herpes virus It relates to a probe to bind.

본 발명은 또한 서열번호 1의 염기서열 내지 서열번호 9의 염기서열을 갖는 올리고뉴클레오타이드, 및 이들 올리고뉴클레오타이드에 상보적인 염기서열을 갖는 올리고뉴클레오타이드로 이루어진 군에서 선택되는 1종 이상의 프로브를 포함하는, 인체포진 바이러스의 탐지 또는 유전형 분석용 DNA 칩에 관한 것이다.The present invention also provides a human body comprising at least one probe selected from the group consisting of an oligonucleotide having a nucleotide sequence of SEQ ID NO: 1 to a base sequence of SEQ ID NO: 1, and an oligonucleotide having a nucleotide sequence complementary to these oligonucleotides. A DNA chip for the detection or genotyping of herpes virus.

본 발명은 또한 (a) 상기 인체포진 바이러스의 탐지용 DNA 칩, (b) 인체포진 바이러스의 시료 DNA를 PCR 방법으로 증폭시키기 위한 프라이머, 및 (c) 상기 DNA 칩과 하이브리드되는 증폭된 DNA를 탐지하기 위한 표지수단을 포함하는 인체포진 바이러스의 탐지 또는 유전형 분석용 키트에 관한 것이다.The present invention also provides (a) a DNA chip for detecting the herpes virus, (b) a primer for amplifying the sample DNA of the herpes virus by PCR, and (c) relates to a kit for the detection or genotyping of a herpes virus comprising a labeling means for detecting amplified DNA hybridized with the DNA chip.

본 발명은 또한 (a) 인체포진 바이러스의 DNA 증폭용 프라이머를 이용하여 시료 DNA를 증폭하는 단계;The present invention also comprises the steps of (a) amplifying the sample DNA using a primer for DNA amplification of herpes virus;

(b) 서열번호 1의 염기서열 내지 서열번호 9의 염기서열로 이루어진 군에서 선택된 단독 프로브 또는 2종 이상의 프로브 세트를 포함하는 DNA 칩에 상기 증폭된 DNA를 하이브리드시키는 단계; 및(b) hybridizing the amplified DNA to a DNA chip comprising a single probe or a set of two or more probes selected from the group consisting of the base sequence of SEQ ID NO: 1 to the base sequence of SEQ ID NO: 9; And

(c) 상기 프로브와 하이브리화된 반응물을 검출하는 단계를 포함하는 인체포진 바이러스의 탐지 또는 유전형 분석방법에 관한 것이다.(c) a method for detecting or genotyping a herpes virus, comprising detecting the probe and the hybridized reactant.

본 발명은 또한 (a) 인체포진 바이러스의 DNA 증폭용 프라이머를 이용하여 인체포진 바이러스의 시료 DNA를 증폭하는 단계;The present invention also comprises the steps of: (a) amplifying the sample DNA of herpes virus using a primer for DNA amplification of herpes virus;

(b) 서열번호 1의 염기서열 내지 서열번호 9의 염기서열로 이루어진 군에서 선택된 단독 프로브 또는 2종 이상의 프로브 세트와 상기 증폭된 DNA를 하이브리드시키는 단계; 및(b) hybridizing the amplified DNA with a single probe or a set of two or more probes selected from the group consisting of nucleotide sequences of SEQ ID NO: 1 to nucleotide sequences of SEQ ID NO: 9; And

(c) 상기 프로브와 하이브리화된 반응물을 검출하는 단계를 포함하는 인체포진 바이러스의 탐지 또는 유전형 분석방법에 관한 것이다.(c) a method for detecting or genotyping a herpes virus, comprising detecting the probe and the hybridized reactant.

본 발명은 또한 서열번호 11의 염기서열 내지 서열번호 20의 염기서열을 갖는 인체포진 바이러스 DNA 증폭용 프라이머에 관한 것이다.The present invention also relates to a primer for amplifying human herpes virus DNA having a nucleotide sequence of SEQ ID NO: 11 to a nucleotide sequence of SEQ ID NO: 20.

본 발명자들은 간단한 방법으로 환자의 유전형을 분석하여 인체포진 바이러스 (HHV)의 감염여부를 진단하고, 감염된 HHV의 종류를 정확하게 판별할 수 있는 방법을 확립하고자 연구 노력한 결과, HHV의 DNA를 증폭시킬 수 있는 프라이머와 상보적으로 결합할 수 있는 프로브 및 이를 포함하는 DNA 칩을 개발하였다. 또한, HHV의 DNA와 상보적으로 결합할 수 있는 프로브를 포함하는 DNA 칩, 시료로부터 채취한 DNA를 PCR방법으로 증폭시키기 위한 프라이머 및 상기 DNA 칩과 하이브리디제이션되는 증폭된 DNA를 탐지하기 위한 표지수단을 포함하는 HHV의 유전형 분석키트를 제작하였고, 전기 분석키트를 사용하여 환자의 시료에서 채취한 DNA의 유전형을 분석함으로써, HHV의 감염여부를 신속하고 정확하게 진단할 수 있을 뿐만 아니라, 감염된 HHV의 타입을 판별할 수 있음을 확인하고, 본 발명을 완성하게 되었다.The present inventors have tried to establish a method to diagnose human herpes virus (HHV) infection by analyzing the genotype of a patient by a simple method and to accurately determine the type of infected HHV, thereby amplifying the DNA of HHV. Probes capable of complementarily binding to primers and DNA chips containing the same have been developed. In addition, a DNA chip comprising a probe capable of complementarily binding to the DNA of HHV, a primer for amplifying the DNA taken from the sample by a PCR method and a label for detecting the amplified DNA hybridized with the DNA chip A genotyping kit of HHV comprising the means was prepared, and by analyzing the genotyping of DNA collected from a patient's sample using an electrical analysis kit, it was possible to quickly and accurately diagnose the infection of HHV, After confirming that the type can be determined, the present invention has been completed.

이하에서 본 발명을 자세히 설명하고자 한다.Hereinafter, the present invention will be described in detail.

본 발명은 인체포진 바이러스의 핵산, 예컨대 DNA 또는 RNA와 상보적으로 결합하는 프로브에 관한 것이며, 바람직하게는 서열번호 1의 염기서열 내지 서열번호 9의 염기서열을 갖는 올리고뉴클레오타이드, 및 이들 올리고뉴클레오타이드에 상보적인 염기서열을 갖는 올리고뉴클레오타이드로 이루어진 군에서 선택되는 것이다. 상기 프로브는 인체포진 바이러스의 DNA 또는 RNA와 하이브리드 가능하다.The present invention relates to a probe that binds complementarily with nucleic acids, such as DNA or RNA, of human herpes virus, preferably oligonucleotides having the nucleotide sequence of SEQ ID NO: 1 to the nucleotide sequence of SEQ ID NO: 9, and these oligonucleotides It is selected from the group consisting of oligonucleotides having a complementary base sequence. The probe may be hybridized with DNA or RNA of herpes virus.

본 발명은 인체포진 바이러스의 DNA 염기서열, 바람직하게는 HHV의 당단백질 H DNA와 상보적으로 결합하는 염기서열을 프로브로 제공한다. 본 발명의 프로브는 서열목록 서열번호 1 내지 9에 기재된 염기서열을 포함한다. 하기 표 1중 서열번호 3, 6에서 서열중 진하게 밑줄 그어 부분은 프로브 기능을 위해 적합한 형태를 제공하기 위해서 부가된 서열이다.The present invention provides a DNA sequence of human herpes virus, preferably a base sequence that complementarily binds to the glycoprotein H DNA of HHV. Probes of the invention comprise the nucleotide sequences set forth in SEQ ID NOS: 1-9. In Table 1 below, the underlined portions of the sequences in SEQ ID NOs: 3, 6 are sequences added to provide a suitable form for probe function.

HHV 프로브HHV probe SEQ ID NO.SEQ ID NO. HHV 유형HHV type 서열order 1One 1One 5'-ACCTACCTGGGGATCTCAACAGGCC-3’5'-ACCTACCTGGGGATCTCAACAGGCC-3 ' 22 1One 5'-GTACCTACCTGGGGATCTCAACAG-3’5'-GTACCTACCTGGGGATCTCAACAG-3 ' 33 1One 5'-TGTACCTACCTGGGGATCTCAACAG-3’5'- T GTACCTACCTGGGGATCTCAACAG-3 ' 44 1One 5'-CCAAGACTGACACATTAAAAAACACAGAAT -3’5'-CCAAGACTGACACATTAAAAAACACAGAAT -3 ' 55 1One 5'-ATCCCAAGACTGACACATTAAAAAACACAGAAT -3’5'-ATCCCAAGACTGACACATTAAAAAACACAGAAT -3 ' 66 1One 5'-AACCAAGACTGACACATTAAAAAACACAGGTT-3’5'- AA CCAAGACTGACACATTAAAAAACACAG GTT -3 ' 77 22 5'-GTACCGACCCGGAGTCCGTAGCAG-3’5'-GTACCGACCCGGAGTCCGTAGCAG-3 ’ 88 88 5'-CAGAATTGCTCCACGCGCTGCACCT-35'-CAGAATTGCTCCACGCGCTGCACCT-3 99 88 5'-GAATTGCTCCACGCGCTGCACCTCG-3’5'-GAATTGCTCCACGCGCTGCACCTCG-3 ' 1010 β-글로빈β-globin 5'-TGCACCTGACTCCTGAGGAGAAGTCTGCCG -3’5'-TGCACCTGACTCCTGAGGAGAAGTCTGCCG -3 '

또한 본 발명은 인체포진 바이러스의 DNA증폭용 프라이머를 제공하고자 한다. 본 발명은 서열번호 11 및 20에 나타난 염기서열을 갖는 올리고뉴클레오타이드로 이루어진 군에서 선택되는 1종 이상의 올리고뉴클레오타이드를 포함하는 HHVDNA의 증폭을 위한 프라이머를 제공한다. 이하 표 2에서 본 발명을 프라이머를 나타내었다.In another aspect, the present invention is to provide a primer for DNA amplification of herpes virus. The present invention provides a primer for amplification of HHVDNA comprising at least one oligonucleotide selected from the group consisting of oligonucleotides having the nucleotide sequences shown in SEQ ID NOs: 11 and 20. In the following Table 2 shows the present invention a primer.

PCR 프라이머PCR primers SEQ ID NO.SEQ ID NO. HHV 유형HHV type 서열order 1111 1,2 (정방향)1,2 (forward) 5'-GTCGTCCAGATGCCCAC-3’5'-GTCGTCCAGATGCCCAC-3 ' 1212 1,2 (역방향)1,2 (reverse) 5'-ATCACGCATCTGCACAAC-3’5'-ATCACGCATCTGCACAAC-3 ' 1313 1,2 (정방향)1,2 (forward) 5'-GTCGTCCAGACGCCCACGG-3’5'-GTCGTCCAGACGCCCACGG-3 ' 1414 1,2 (역방향)1,2 (reverse) 5'-ATCACGCACCTGCACAACGC-3’5'-ATCACGCACCTGCACAACGC-3 ' 1515 1 (정방향)1 (forward direction) 5'-AGCTGATAGCCCAGCGCG-3’5'-AGCTGATAGCCCAGCGCG-3 ’ 1616 1 (역방향)1 (reverse) 5'-GCTTTTTGGCCCACTCGC-3’5'-GCTTTTTGGCCCACTCGC-3 ’ 1717 8 (정방향)8 (forward direction) 5'-AGTCGTCCGCTCTGACG-3’5'-AGTCGTCCGCTCTGACG-3 ' 1818 8 (역방향)8 (reverse) 5'-TAATCTTTGAACAGTTAATCGC-3’5'-TAATCTTTGAACAGTTAATCGC-3 ’ 1919 8 (정방향)8 (forward direction) 5'-GTCGTCCGCTCTGACGCGG-3’5'-GTCGTCCGCTCTGACGCGG-3 ’ 2020 8 (역방향)8 (reverse) 5'-ATCTTTGAACAGTTAATCGCCGG-3’5'-ATCTTTGAACAGTTAATCGCCGG-3 ' 2121 β-글로빈 (BG)(정방향)β-globin (BG) (forward direction) 5'-ATACAAGTCAGGGCAGAG-3'5'-ATACAAGTCAGGGCAGAG-3 ' 2222 β-글로빈 (BG) (역방향)β-globin (BG) (reverse direction) 5'-CTTAAACCTGTCTTGTAACC-3'5'-CTTAAACCTGTCTTGTAACC-3 ' 2323 1,2,8 (정방향)1,2,8 (forward direction) 5'-GTGGTGGACTTTGCCAGCCTGTACCC-3'5'-GTGGTGGACTTTGCCAGCCTGTACCC-3 ' 2424 1,2,8 (역방향)1,2,8 (reverse direction) 5'-TAAACATGGAGTCCGTGTCGCCGTAGATGA-3'5'-TAAACATGGAGTCCGTGTCGCCGTAGATGA-3 '

본 발명은 HSV-1 및 HSV-2 DNA를 증폭하기 위한 프라이머로서 서열번호 11 및 12에 나타난 염기서열을 갖는 프라이머쌍, 또는 서열번호 13 및 14에 나타난 염기서열을 갖는 프라이머쌍을 제공한다. 또한, 본 발명은 HHV-8 DNA를 증폭하기 위한 프라이머로서 서열번호 17 및 18에 나타난 염기서열을 갖는 프라이머쌍, 또는 서열번호 19 및 20에 나타난 염기서열을 갖는 프라이머쌍을 제공한다.The present invention provides a primer pair having a nucleotide sequence shown in SEQ ID NO: 11 and 12, or a primer pair having a nucleotide sequence shown in SEQ ID NO: 13 and 14 as a primer for amplifying HSV-1 and HSV-2 DNA. The present invention also provides a primer pair having a nucleotide sequence shown in SEQ ID NO: 17 and 18, or a primer pair having a nucleotide sequence shown in SEQ ID NO: 19 and 20 as a primer for amplifying the HHV-8 DNA.

상기 표 2에서, 서열번호 15 및 16으로 이루어진 프라이머쌍은 HSV-1 DNA 증폭용 프라이머이고, 서열번호 11 및 12로 이루어진 프라이머쌍, 서열번호 13 및 14로 이루어진 프라이머쌍은 HSV-1 및 HSV-2를 모두 증폭가능한 프라이머이고, 상기 서열번호 17 및 18로 이루어진 프라이머쌍과 서열번호 19 및 20으로 이루어진 프라이머쌍은 HHV-8 DNA 증폭용 프라이머이다. 시료중 HHV의 유형에 따라 상기 프라이머쌍을 하나 또는 둘 이상 선택하여 조합하여 사용할 수 있으며 어느 유형의 HHV가 포함되어 있는지 불명확한 경우에는 세 가지 유형의 HHV를 모두 증폭 가능하도록 프라이머를 조합하여 사용할 수 있다. 예컨대, HSV-1과 2 DNA를 증폭가능한 서열번호 11 및 12로 이루어진 프라이머쌍 또는 서열번호 13 및 14로 이루어진 프라이머쌍을 선택하고, 이와 조합하여 HHV-8 DNA를 증폭가능한 서열번호 17 및 18로 이루어진 프라이머쌍 또는 서열번호 19 및 20으로 이루어진 프라이머쌍을 선택하여 사용할 수 있다. 바람직하게는 서열번호 13 및 14로 이루어진 프라이머쌍과 서열번호 17 및 18로 이루어진 프라이머쌍을 사용하여 세가지 유형의 HHV DNA를 증폭하거나, 서열번호 11 및 12로 이루어진 프라이머쌍과 서열번호 17 및 18로 이루어진 프라이머쌍을 사용하여 증폭할 수 있다.In Table 2, the primer pair consisting of SEQ ID NO: 15 and 16 is a primer for amplification of HSV-1 DNA, the primer pair consisting of SEQ ID NO: 11 and 12, primer pair consisting of SEQ ID NO: 13 and 14 is HSV-1 and HSV- 2 are both amplifiable primers, and the primer pair consisting of SEQ ID NOs: 17 and 18 and the primer pair consisting of SEQ ID NOs: 19 and 20 are primers for amplifying HHV-8 DNA. One or two primer pairs depending on the type of HHV in the sample. In case of uncertainty about which type of HHV is included, the primers may be combined and used to amplify all three types of HHV. For example, a primer pair consisting of SEQ ID NOs: 11 and 12 capable of amplifying HSV-1 and 2 DNA or a primer pair consisting of SEQ ID NOs: 13 and 14 is selected, and the HHV-8 DNA is amplified by SEQ ID NOs: 17 and 18. A primer pair consisting of or a primer pair consisting of SEQ ID NOs: 19 and 20 can be selected and used. Preferably, amplification of three types of HHV DNA using a primer pair consisting of SEQ ID NOs: 13 and 14 and a primer pair consisting of SEQ ID NOs: 17 and 18, or a primer pair consisting of SEQ ID NOs: 11 and 12 and SEQ ID NOs: 17 and 18 Amplification can be accomplished using the pair of primers.

서열번호 23 및 24로 이루어진 프라이머쌍은 기존에 알려진 HSV-1, 2, 및 HHV-8의 DNA를 모두 증폭가능한 프라이머쌍이다 (Journal of Clinical Microbiology(2000) 38(9):3274-3279). 이에 대한 PCR 결과는 도 3에 나타내었으며 본발명의 프라이머는 서열번호 23 및 24로 이루어진 프라이머쌍에 비해 같은 양의 DNA를 양적으로 많이 증폭시킨다. 도 2와 도3, 또는 도 4와 도 3의 증폭된 PCR 밴드(band)의 세기를 비교함으로써 알 수 있다.The primer pair consisting of SEQ ID NOs: 23 and 24 is a primer pair capable of amplifying all known DNAs of HSV-1, 2, and HHV-8 ( Journal of Clinical Microbiology (2000) 38 (9): 3274-3279). PCR results thereof are shown in FIG. 3, and the primers of the present invention amplify a large amount of DNA in the same amount as compared to the primer pair consisting of SEQ ID NOs: 23 and 24. This can be seen by comparing the intensities of the amplified PCR bands of FIGS. 2 and 3, or 4 and 3.

HHV 유형에 따른 프라이머 및 프로브의 선택 및 조합을 하기 표 3에 정리하여 표시하였다.Selection and combination of primers and probes according to HHV type are summarized in Table 3 below.

HHV 유형HHV type 프라이머 SEQ ID NOPrimer SEQ ID NO 프로브 SEQ ID NOProbe SEQ ID NO HSV-1HSV-1 11 및 12, 또는 13 및 1411 and 12, or 13 and 14 1,2,31,2,3 15 및 1615 and 16 4,5,64,5,6 HSV-2HSV-2 11 및 12, 또는 13 및 1411 and 12, or 13 and 14 77 HHV-8HHV-8 17 및 18, 또는 19 및 2017 and 18, or 19 and 20 8, 98, 9

HSV-1의 유전형 분석용인 경우에는, 서열번호 15 및 16으로 이루어진 프라이머쌍으로 증폭한 시료 DNA는 상기 표 1에 나타난 서열번호 4, 5 및 6에 나타난 염기서열을 갖는 프로브를 사용할 수 있고, 서열번호 11 및 12로 이루어진 프라이머쌍 또는 서열번호 13 및 14로 이루어진 프라이머쌍으로 증폭한 시료 DNA는 상기 표 1에 나타난 서열번호 1 내지 3에 나타난 염기서열을 갖는 하나 이상의 프로브를 사용할 수 있다. HSV-2의 유전형 분석용인 경우에는 서열번호 11 및 12로 이루어진 프라이머쌍 또는 서열번호 13 및 14로 이루어진 프라이머쌍으로 증폭한 시료 DNA는 상기 표 1에 나타난 서열번호 7에 나타난 염기서열을 갖는 하나 이상의 프로브를 사용할 수 있다. 또한 HHV-8의 유전형 분석용인 경우에는, 상기 서열번호 17 및 18로 이루어진 프라이머쌍 또는 서열번호 19 및 20으로 이루어진 프라이머쌍으로 증폭한 시료 DNA는 상기 표 1에 나타낸 서열번호 8 및/또는 서열번호 9에 나타난 염기서열을 갖는 프로브를 사용할 수 있다.For genotyping of HSV-1, a sample DNA amplified with a primer pair consisting of SEQ ID NOs: 15 and 16 may use a probe having the nucleotide sequences shown in SEQ ID NOs: 4, 5, and 6 shown in Table 1 above, Sample DNA amplified with a primer pair consisting of Nos. 11 and 12 or a primer pair consisting of SEQ ID NOs: 13 and 14 may use one or more probes having the nucleotide sequences shown in SEQ ID NOs: 1 to 3 shown in Table 1 above. For genotyping of HSV-2, the sample DNA amplified with a primer pair consisting of SEQ ID NOs: 11 and 12 or a primer pair consisting of SEQ ID NOs: 13 and 14 has one or more nucleotide sequences shown in SEQ ID NO: 7 shown in Table 1 above. Probes can be used. In addition, in the case of genotyping of HHV-8, the sample DNA amplified with the primer pair consisting of SEQ ID NOs: 17 and 18 or the primer pair consisting of SEQ ID NOs: 19 and 20 is SEQ ID NO: 8 and / or SEQ ID NO shown in Table 1 above. A probe having the nucleotide sequence shown in 9 can be used.

또한 본 발명은 상기 인체포진 바이러스의 올리고뉴클레오타이드 프로브를 포함하는 마이크로 어레이, 바람직하게는 DNA칩이다. 본 발명의 일례에서, 상기 DNA칩은 본 발명의 기술분야 전문가가 용이하게 조합가능한 모든 프로브 서열 세트를 포함하는 DNA 칩도 포함한다. 본 발명에 따른 DNA 칩은 서열번호 1의 염기서열 내지 서열번호 9의 염기서열을 갖는 올리고뉴클레오타이드, 및 이들 올리고뉴클레오타이드에 상보적인 염기서열을 갖는 올리고뉴클레오타이드로 이루어진 군에서 선택되는 1종 이상의 프로브를 포함한다.In another aspect, the present invention is a micro array, preferably a DNA chip containing the oligonucleotide probe of the herpes virus. In one embodiment of the invention, the DNA chip also includes a DNA chip comprising all probe sequence sets that can be readily combined by one of ordinary skill in the art. DNA chip according to the present invention comprises one or more probes selected from the group consisting of oligonucleotides having a nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 9, and oligonucleotides having a nucleotide sequence complementary to these oligonucleotides do.

또한, 본 발명의 DNA칩은 상기 인체포진 바이러스에 대한 프로브외에도 클라미디아 트라코마스, 임균, 매독균(Treponema pallidum), 트리코모나스 바지날리스(Trichomonas vaginalis), 결핵균(Mycobacterium tuberculosis), 인유두종 바이러스(Human Papillomavirus) 등을 검출할 수 있는 DNA 프로브를 동시에 하나의 슬라이드에 고정시켜 하나의 DNA 칩을 제조할 수 있다. 하나의 슬라이드에 여러 가지 박테리아 또는 바이러스의 DNA 프로브를 고정화시켰을 경우, 한번의 실험으로 어떤 박테리아 또는 바이러스가 시료에 존재하는 지를 쉽게 검출할 수 있게 된다. 또한, 위에서 언급한 박테리아 또는 바이러스 외에 다른 여러 가지 박테리아, 바이러스의 DNA 프로브를 하나의 슬라이드에 올려놓게 될 경우, 마찬가지로 한번의 실험으로 시료를 정확히 분석할 수 있다는 장점이 있다.In addition, the DNA chip of the present invention, in addition to the probe for the herpes virus, Chlamydia trachomas, gonococcus, syphilis ( Treponema pallidum ), Trichomonas vaginalis , Mycobacterium tuberculosis , Human papillomavirus ( Human Papillomavirus ) One DNA chip can be prepared by simultaneously fixing a DNA probe capable of detecting the back and the like on one slide. When immobilized DNA probes of various bacteria or viruses on a slide, it is easy to detect which bacteria or viruses are present in a sample in a single experiment. In addition, when the DNA probes of various bacteria and viruses, in addition to the above-mentioned bacteria or viruses, are placed on a single slide, there is an advantage in that the sample can be accurately analyzed in a single experiment.

또한, 상기 DNA칩은 전체적인 위치 마커 및 하이브리드화 반응에 대한 대조군으로서 기준마커를 추가로 포함할 수 있다. 기준마커의 예로는 β-글로빈, 액틴, 또는 글리세르알데히드-3-포스페이트 데하이드로게나제 (glyceraldehyde-3-phosphate dehydrogenase) 유전자를 추가로 포함할 수 있다. 상기 기준마커가 β-글로빈인 경우에는 바람직하게는 서열번호 10에 나타난 염기서열을 가지며, 이의 증폭을 위한 프라이머로는 서열번호 21의 염기서열 및 서열번호 22의 염기서열을 갖는 β-글로빈 DNA 증폭용 프라이머일 수 있다.In addition, the DNA chip may further include a reference marker as a control for the global position marker and the hybridization reaction. Examples of reference markers may further include β-globin, actin, or glyceraldehyde-3-phosphate dehydrogenase genes. When the reference marker is β-globin, preferably has the nucleotide sequence shown in SEQ ID NO: 10, the primer for amplification thereof β-globin DNA amplification having the nucleotide sequence of SEQ ID NO: 21 and the nucleotide sequence of SEQ ID NO: 22 It may be a primer for.

한편, 상기 인체포진 바이러스의 유전형 분석키트에 포함된 DNA 칩의 제조방법은 인체포진 바이러스의 핵산과 상보적으로 결합할 수 있는 염기서열의 5'말단에 아민이 결합된 DNA 프로브를 제조하는 공정; 제조된 DNA 프로브를 알데히드가 결합된 고체의 표면에 결합시키는 공정; 및, 전기 DNA 프로브가 결합된 고체표면에 존재하는 아민과 결합하지 않은 알데히드를 환원시키는 공정을 포함한다.On the other hand, the method of manufacturing a DNA chip included in the genotyping kit of the herpes virus includes the steps of preparing a DNA probe having an amine bound to the 5 'end of the nucleotide sequence that can complementarily bind to the nucleic acid of the herpes virus; Binding the prepared DNA probe to the surface of the solid to which the aldehyde is bound; And reducing aldehydes not bound to the amine present on the solid surface to which the electric DNA probe is bound.

상기 고체의 표면에서 프로브 DNA와 알데히드의 결합은 이 분야에서 알려진 방법 즉, 37℃의 온도 및 70%의 습도 조건하에서 아민과 알데히드의 시프염기반응 (Schiffs base reaction)을 통해 수행될 수 있다. 상기 알데히드의 환원은 NaBH4와 같은 환원제를 사용하여 수행될 수 있다. 상기 고체의 표면에 존재하는 알데히드와 반응하는 프로브 DNA의 농도는 100-300 pmol/L이 바람직하다. 이 외 범위로 사용하는 경우 상기 프로브 DNA가 고체 표면에 알데히드와의 결합이 이루어지지 않을 수 있다.The binding of the probe DNA to the aldehyde on the surface of the solid may be carried out by a method known in the art, that is, through a Schiffs base reaction of amine and aldehyde under a temperature of 37 ° C. and a humidity of 70%. Reduction of the aldehyde may be carried out using a reducing agent such as NaBH 4 . The concentration of probe DNA reacting with aldehyde present on the surface of the solid is preferably 100-300 pmol / L. When used in other ranges, the probe DNA may not bind to the aldehyde on a solid surface.

상기 고체는 유리, 실리콘 이산화물, 플라스틱 또는 세라믹으로부터 선택될 수 있다.The solid may be selected from glass, silicon dioxide, plastic or ceramic.

이하, 본 발명의 DNA 칩 및 그의 제조방법을 공정별로 나누어 보다 구체적으로 설명하고자 한다.Hereinafter, the DNA chip of the present invention and its manufacturing method will be described in more detail by dividing the process.

제 1공정: 프로브의 제조First Step: Probe Preparation

인체포진 바이러스의 DNA와 상보적으로 결합할 수 있는 염기서열의 5'-말단에 아민이 결합된 DNA 프로브를 제조한다. 이때, 프로브는 인체포진 바이러스 DNA의 염기서열, 바람직하게는 인체포진 바이러스의 당단백질 H의 DNA와 상보적으로결합하는 염기서열을 갖도록 설계 및 합성되고, 합성된 염기서열이 고체의 표면에 결 합될 수 있도록 염기서열의 5'말단에 아민기를 결합시켜서 프로브를 제조한다.A DNA probe having an amine bound to the 5'-terminus of a nucleotide sequence capable of complementarily binding to DNA of a herpes virus is prepared. In this case, the probe is designed and synthesized to have a base sequence of the herpes virus DNA, preferably, a base sequence that complementarily binds to the DNA of the glycoprotein H of the herpes virus virus, and the synthesized base sequence is to be bound to the surface of the solid. A probe is prepared by binding an amine group to the 5 'end of the nucleotide sequence.

제 2공정: 프로브의 고정화Step 2: Immobilize the Probe

상기 제조된 DNA 프로브를 알데히드가 결합된 고체의 표면에 결합시킨다: 이때, 고체는 특별히 제한되는 것은 아니나, 유리인 것이 바람직하고, 고체 표면의 알데히드는 이 분야에서 알려진 방법, 즉 프로브의 5’말단에 결합된 아민과 30 내지 40℃, 70 내지 100%의 습도조건에서 시프염기반응 (Schiffs base reaction)을 수행하여 고체 표면에 프로브를 결합시킨다. 이때, 프로브의 농도는 100 내지 300 pmole/l가 바람직하고, 가장 바람직하게는 200 pmole/l이다. 또한 상기 고체의 표면에 전체적인 위치 마커 및 하이브리디제이션 반응에 대한 대조군 역할을 하는 β-글로빈 프로브을 부착한다.The prepared DNA probe is bound to the surface of the aldehyde-bound solid: the solid is not particularly limited, but is preferably glass, and the aldehyde of the solid surface is a method known in the art, that is, the 5 'end of the probe. The probe is coupled to the solid surface by carrying out a Schiffs base reaction at 30-40 ° C. and 70-100% humidity with the amine bound to the amine. At this time, the concentration of the probe is preferably 100 to 300 pmole / l, most preferably 200 pmole / l. Also attached to the surface of the solid is a β-globin probe that serves as a control for the global position marker and hybridization reaction.

제 3공정: DNA 칩의 제조Third Step: Manufacture of DNA Chip

상기 프로브가 결합된 고체표면에 존재하는 아민과 결합하지 않은 알데히드를 환원시켜서, DNA 칩을 제조한다. 이때, 알데히드의 환원조건이 특별히 제한되는 것은 아니나, NaBH4등의 환원제를 사용함이 바람직하다.A DNA chip is prepared by reducing aldehydes not bound to the amine present on the solid surface to which the probe is bound. At this time, the reducing conditions of the aldehyde is not particularly limited, it is preferable to use a reducing agent such as NaBH 4 .

본 발명은 인체포진 바이러스의 탐지용 또는 유전형 분석키트에 관한 것이며, 바람직하게는 상기 서열번호 1 내지 9의 염기서열 또는 이에 상보적인 염기서열을 갖는 올리고뉴클레오타이드 프로브로 이루어지는 군에서 선택되는 1종 이상의 프로브를 포함하는 DNA 칩을 포함하는 것이다. 본 발명의 구체적인 일례에서,The present invention relates to a kit for the detection or genotyping of human herpes virus, preferably at least one probe selected from the group consisting of oligonucleotide probes having the nucleotide sequence of SEQ ID NO: 1 to 9 or a nucleotide sequence complementary thereto. It will include a DNA chip containing. In a specific example of the invention,

(a) 상기 인체포진 바이러스의 탐지용 DNA 칩, (b) 인체포진 바이러스의 시료 DNA를 PCR 방법으로 증폭시키기 위한 프라이머, 및 (c) 상기 DNA 칩과 하이브리드되는 증폭된 DNA를 탐지하기 위한 표지수단을 포함하는 인체포진 바이러스의 탐지용 키트를 제공한다.(a) a DNA chip for detecting the herpes virus, (b) a primer for amplifying the sample DNA of the herpes virus, and (c) a labeling means for detecting the amplified DNA hybridized with the DNA chip It provides a kit for the detection of herpes virus.

상기 표지수단은 이 기술분야의 숙련된 자에게 알려져 있는 여러 가지 표지물들이 본 발명에 사용될 수 있으며, 그 예로는 Cy5, Cy3, 비오틴-결합물질, EDANS(5-(2'-아미노에틸)아미노-1-나프탈렌 황산), 테트라메틸로다민(TMR), 테트라메틸로다민 이소시아네이트(TMRITC), x-로다민 또는 텍사스 레드를 사용할 수 있다. 상기 표지수단은 인체포진 바이러스에 대한 표지 유전자를 첨가하여 PCR 반응을 이용하여 증폭 및 표지증폭과정에서 유전자를 표지할 수 있다. 또한, 일반적인 표지수단인 비오틴-결합물질을 이용하여 표지할 수 있다. 상기 비오틴-결합물질은 예를 들어, 스트렙타비딘-R-피코에리스린(streptavidine-R-phycoerythrin)을 포함한다. Cy5를 이용하여 표지할 경우, 표지된 반응물을 검출할 때 추가적인 반응 없이 직접 콘포칼 레이저 스캐너와 같은 분석기를 이용하여 형광신호를 분석할 수 있어 효율적이며 비오틴-결합물질을 이용하여 표지하는 경우에 비해 더 민감한 결과를 얻을 수 있다.The label means may be used in the present invention a variety of labels known to those skilled in the art, for example Cy5, Cy3, biotin-binding material, EDANS (5- (2'-aminoethyl) amino- 1-naphthalene sulfuric acid), tetramethyltamine (TMR), tetramethyltamine isocyanate (TMRITC), x-rhodamine or Texas red can be used. The labeling means may add a label gene for human herpes virus to label the gene in the amplification and label amplification process using a PCR reaction. In addition, it can be labeled using a biotin-binding material which is a general labeling means. The biotin-binding material includes, for example, streptavidin-R-phycoerythrin. In case of labeling using Cy5, the fluorescent signal can be analyzed directly using an analyzer such as a confocal laser scanner when detecting the labeled reactant, which is more efficient and compared to labeling using biotin-binding material. More sensitive results can be obtained.

본 발명은 또한 상기 인체포진 바이러스의 프로브 및 증폭용 프라이머를 이용하여 인체포진 바이러스를 탐지 또는 유전형 분석방법에 관한 것이다.The present invention also relates to a method for detecting or genotyping the herpes virus using the herpes virus probe and amplification primers.

본 발명의 일례에서, (a) 인체포진 바이러스의 DNA 증폭용 프라이머를 이용하여 인체포진 바이러스의 시료 DNA를 증폭하는 단계;In an example of the present invention, the method comprises the steps of: (a) amplifying a sample DNA of herpes virus using a primer for amplifying DNA of herpes virus;

(b) 서열번호 1의 염기서열 내지 서열번호 9의 염기서열로 이루어진 군에서 선택된 단독 프로브 또는 2종 이상의 프로브 세트와 상기 증폭된 DNA를 하이브리드시키는 단계; 및(b) hybridizing the amplified DNA with a single probe or a set of two or more probes selected from the group consisting of nucleotide sequences of SEQ ID NO: 1 to nucleotide sequences of SEQ ID NO: 9; And

(c) 상기 프로브와 하이브리화된 반응물을 검출하는 단계를 포함하는 인체포진 바이러스의 탐지 또는 유전형 분석방법을 제공한다.(c) provides a method for detecting or genotyping human herpes virus, comprising the step of detecting a hybridized reaction with the probe.

본 발명의 또다른 일례에서,In another example of the invention,

(a) 인체포진 바이러스의 DNA 증폭용 프라이머를 이용하여 인체포진 바이러스 시료 DNA를 증폭하는 단계;(a) amplifying human herpes virus sample DNA using a primer for DNA amplification of herpes virus;

(b) 서열번호 1의 염기서열 내지 서열번호 9의 염기서열로 이루어진 군에서 선택된 단독 프로브 또는 2종 이상의 프로브 세트를 포함하는 DNA 칩에 상기 증폭된 DNA를 하이브리드시키는 단계; 및(b) hybridizing the amplified DNA to a DNA chip comprising a single probe or a set of two or more probes selected from the group consisting of the base sequence of SEQ ID NO: 1 to the base sequence of SEQ ID NO: 9; And

(c) 상기 프로브와 하이브리화된 반응물을 검출하는 단계를 포함하는 인체포진 바이러스의 탐지 또는 유전형 분석방법을 제공한다.(c) provides a method for detecting or genotyping human herpes virus, comprising the step of detecting a hybridized reaction with the probe.

상기 프라이머는 서열번호 11 내지 서열번호 20의 염기서열을 갖는 인체포진 바이러스 증폭용 프라이머로 이루어진 군에서 선택되는 것이 바람직하며, 그 예는 상기 표 2에 표시하였다.The primer is preferably selected from the group consisting of primers for amplifying human herpes virus having a nucleotide sequence of SEQ ID NO: 11 to SEQ ID NO: 20, the examples are shown in Table 2.

또한 본 발명은 상기 인체포진 바이러스의 올리고뉴클레오타이드 프로브를 포함하는 마이크로 어레이, 바람직하게는 DNA칩을 사용할 수 있으며, 상기 DNA칩은 β-글로빈, 액틴, 또는 글리세르알데히드-3-포스페이트 데하이드로게나제(glyceraldehyde-3-phosphate dehydrogenase) 유전자를 위치 마커로 추가로 포함할 수 있으며, 위치마커는 상기 DNA 칩에서 사용한 것을 사용할 수 있다. 상기 검출은 표지수단을 이용하여 수행할 수 있으며, 상기에 열거한 표지수단을 사용할 수 있다.In addition, the present invention may use a micro array, preferably a DNA chip containing the oligonucleotide probe of the human herpes virus, wherein the DNA chip is β-globin, actin, or glyceraldehyde-3-phosphate dehydrogenase (glyceraldehyde-3-phosphate dehydrogenase) gene may be further included as a position marker, and the position marker may be used in the DNA chip. The detection can be performed using a labeling means, and the labeling means listed above can be used.

본 발명의 일례에서, 시료 DNA의 증폭은 통상의 PCR 반응으로 수행할 수 있다. 즉, 전변성, 변성, 프라이머 결합, 및 사슬연장단계로 이루어진 PCR 반응으로 시료 DNA를 증폭할 수 있다.In one example of the invention, amplification of the sample DNA can be carried out by a conventional PCR reaction. In other words, the sample DNA can be amplified by a PCR reaction consisting of total denaturation, denaturation, primer binding, and chain extension.

본 발명의 바람직한 일예에서, 상기 인체포진 바이러스 프라이머 및 β-글로빈 프라이머, dATP, dCTP, dGTP, dTTP, 표지물질, 그리고 Taq 폴리머라제를 포함하고, 경우에 따라 첨가물로 BSA 및 DMSO등을 사용하여 PCR 서머싸이클러에 넣고, 94℃에서 5분간 변성(denaturation)후, 94℃에서 1분간 변성(denaturation), 45 ~ 60 ℃에서 45초 ~ 1분간 프라이머 결합(primer annealing), 72℃에서 20 ~ 45초간 연장(extension)과정을 30 ~ 35회 반복 후 72℃에서 2분간 더 연장 반응을 하여, 표지분자가 결합된 증폭된 DNA시료를 수득한다.In a preferred embodiment of the present invention, the herpes-virus virus primer and β-globin primer, dATP, dCTP, dGTP, dTTP, labeling material, and Taq polymerase, and optionally, BSA and DMSO using the PCR as an additive Place in a thermocycler, denature for 5 minutes at 94 ° C, denature for 1 minute at 94 ° C, 45 seconds at 45-60 ° C Primer annealing for 1 minute, extension process for 20 to 45 seconds at 72 ° C. for 30 to 35 times, followed by extension for 2 minutes at 72 ° C. to obtain an amplified DNA sample with labeled molecules. do.

이하, 본 발명의 인체포진 바이러스의 분석키트를 이용한 인체포진 바이러스 검출방법을 단계별로 나누어 보다 구체적으로 설명하고자 한다.Hereinafter, the human herpes virus detection method using the analysis kit of the herpes virus of the present invention will be described in more detail by dividing step by step.

제 1공정: 시료의 수득 및 증폭Step 1: Obtain and Amplify the Sample

검사할 시료를 증폭시켜서 Cy5(Cyanine 5)을 포함하는 증폭시료를 수득한다: 이때, 증폭된 시료가 Cy5을 함유하기 위하여 Cy5-dUTP를 사용한 PCR을 통하여 증폭시료를 수득한다.Amplify the sample to be tested to obtain an amplified sample containing Cy5 (Cyanine 5): At this time, an amplified sample is obtained by PCR using Cy5-dUTP so that the amplified sample contains Cy5.

제 2공정: 하이브리디제이션 반응Second Step: Hybridization Reaction

전기 증폭시료를 DNA 칩에 적용하여, 프로브와 하이브리디제이션 반응을 수행한다.An electrical amplification sample is applied to the DNA chip to perform hybridization reaction with the probe.

제 3공정: 검출Third Process: Detection

프로브와 하이브리디제이션된 DNA를 표지수단으로 표지하고, 이를 검출하여, 인체포진 바이러스의 감염여부를 판단한다. 검출방법은 상기 각각의 표시수단의 검출방법에 따라 수행하며, 예컨대 검출수단으로 콘포칼 레이저 스캐너(confocal laser scanner)로 스캐닝하여 읽을 수 있다.The probe and the hybridized DNA are labeled with a labeling means and detected to determine whether the herpes virus is infected. The detection method is carried out according to the detection method of each display means, for example, can be read by scanning with a confocal laser scanner as the detection means.

본 발명의 DNA 칩을 이용한 HHV의 유전형 분석키트 및 분석방법을 사용하여, HHV의 감염여부를 진단할 경우, 신속하고 간단하며 정확하게 HHV 감염여부 및 유전형을 검출할 수 있으므로, STD를 일으키는 HHV의 정확한 진단, 이로 인한 음부포진 또는 카포시 육종등의 예방 및 치료에 기여할 수 있을 것이다.HHV genotyping kit and analysis method using the DNA chip of the present invention, when diagnosing the infection of HHV, it is possible to detect HHV infection and genotype quickly, simply and accurately, so that the exact HHV causing STD Diagnosis, thereby preventing and treating genital herpes or Kaposi's sarcoma.

이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당 업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다. 프로브의 종류 및 개수가 특별히 제한되는 것은 아니므로, HHV로부터 유도된 염기서열을 갖는 프로브를 이용한 DNA 칩 및 전기 DNA 칩을 이용한 각종 분석키트 또한 본 발명의 범주에 속한다.Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention in more detail, it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention. . Since the type and number of probes are not particularly limited, various analysis kits using DNA chips and electric DNA chips using probes having base sequences derived from HHV are also within the scope of the present invention.

실시예 1: 프로브의 제조Example 1 Preparation of Probes

HSV-1, HSV-2 및 HHV-8의 유전형 검출을 위하여 사용된 각 HHV 유전형에 특이적인 프로브와 β-글로빈에 특이적인 프로브는 5'말단에 아민 (amine)기가 포함되도록 작제하였다. 각 프로브의 염기서열은 표 1 및 서열번호 1 내지 10에 나타냈다.Probes specific to each HHV genotype and β-globin specific probes used for genotyping of HSV-1, HSV-2 and HHV-8 were constructed to include an amine group at the 5 'end. The base sequence of each probe is shown in Table 1 and SEQ ID NOs: 1 to Shown in 10.

실시예 2: DNA 칩의 제조Example 2: Preparation of DNA Chips

상기 실시예 1에서 제조된 각각의 프로브를 3X SSC (0.05 M 소디움 시트레이트, 0.45 M NaCl (pH 7.0)에 200 pmol/l가 되도록 용해시키고, 알데히드기가 결합된 슬라이드 (silylated slide, CSS-100, CEL, Houston, TX, USA) 표면에 어레이어 (GMS 417 Arrayer, TaKaRa, Japan)를 이용하여 크기 150 m, 간격 300 m으로 스파팅 (spotting)한 다음 37℃, 습도 70% 이상의 조건에서 4시간 이상 시프염기반응 (Schiff base reaction)을 수행하였다. 이어서, 0.2% (w/v) 소디움 도디실설페이트 (sodium dodecyl sulfate, SDS) 용액으로 슬라이드를 세척하고, 3차 증류수로 세척한 다음, NaBH4용액 (2 g NaBH4, 150 ml phosphate buffered saline (PBS), 50 ml ethanol)에 40분 동안 침지하여 아민이 결합되지 않은 알데히드를 환원시킨 후, 3차 증류수로 세척하고, 건조시켜서 DNA 칩을 제조하였다.Each probe prepared in Example 1 was dissolved in 3X SSC (0.05 M sodium citrate, 0.45 M NaCl, pH 7.0) to 200 pmol / l, and an aldehyde group bonded slide (silylated slide, CSS-100, CEL, Houston, TX, USA) Using the arrayer (GMS 417 Arrayer, TaKaRa, Japan) on the surface, spotting at 150 m size and 300 m spacing for 4 hours at 37 ℃ and 70% humidity A biphasic Schiff base reaction was performed followed by washing the slides with 0.2% (w / v) sodium dodecyl sulfate (SDS) solution, washing with tertiary distilled water, and then NaBH 4 After dipping in a solution (2 g NaBH 4 , 150 ml phosphate buffered saline (PBS), 50 ml ethanol) for 40 minutes to reduce the amine unbound aldehyde, washed with tertiary distilled water, and dried to prepare a DNA chip It was.

또한 상기 고체의 표면에 전체적인 위치 마커 및 하이브리디제이션 반응에 대한 대조군 역할을 하는 β-글로빈을 부착하였다.Also attached to the surface of the solid was β-globin, which serves as a control for global position markers and hybridization reactions.

본 발명의 일례에 따른 DNA 칩의 배치도를 도 1 및 도 7에 나타냈다. 도 1은 DNA 칩에 위치한 프로브의 종류와 위치를 나타내는 모식도로서, 표시된 번호는 각각의 프로브를 나타내고, (○)는 시료와 결합할 수 있는 프로브가 결합된 부위를 나타내며, (●)는 반응이 일어난 것인지를 확인하기 위한 배경마커이며 동시에 프로브의 위치를 나타내기 위한 기준마커를 나타낸다.1 and 7 show a layout view of a DNA chip according to an example of the present invention. Figure 1 is a schematic diagram showing the type and location of the probes located on the DNA chip, the number denotes each probe, (○) represents the site to which the probe can bind to the sample, (●) is the reaction A background marker for checking whether or not it has occurred and at the same time a reference marker for indicating the position of the probe.

실시예 3: 시료의 수득Example 3: Obtaining a Sample

사람의 조직 또는 포진의 수포액 (lesion)등이 HHV에 감염되었는지의 여부를 확인하기 위하여, 먼저 전기 조직에서 DNA를 추출하고, 정제하였다. 전기 정제된 DNA를 주형으로 하고, 서열번호 21 및 22를 갖는 β-글로빈 프라이머 (β-globin primer)를 이용하여 PCR을 수행하며, β-글로빈 유전자가 증폭된 DNA를 선별하여 검색시료로서 사용하였다. 임상시료는 대한민국 서울시 은평구 녹번동 5번지에 소재하는 국립보건원 (Korean National Institute of Health, KNIH)에서 제공받았다.To check whether human tissue or herpes bleeding (lesion) or the like has been infected with HHV, DNA was first extracted from the tissue and purified. Using the purified DNA as a template, PCR was performed using β-globin primers having SEQ ID NOs: 21 and 22, and DNAs amplified by β-globin gene were selected and used as search samples. . Clinical samples were obtained from the Korean National Institute of Health (KNIH), Nokban-dong, Eunpyeong-gu, Seoul, Korea.

또한 검색시료의 HSV-1과 HSV-2 양성 대조군으로, 국립보건원에서 구입한 표준 바이러스 (HSV-1 (F strain); HSV-2 (G strain))를 RPMI 1640 배지에 키운 Vero cell에 배양한 후 추출 및 정제하여 사용하였다. 아울러, 대한민국 대전시 유성구 구성동에 소재하는 한국과학기술원 (Korea Advanced Institute of Science and Technology, KAIST)에서 기증받은 Bcbl-1 세포주 (body cavity based lymphoma) 에서 추출 및 정제된 HHV-8 DNA를 양성 대조군으로 사용하였다.In addition, the HSV-1 and HSV-2 positive controls of the samples were cultured in Vero cells grown on RPMI 1640 medium with the standard virus (HSV-1 (F strain); HSV-2 (G strain) purchased from the National Institutes of Health. After extraction and purification was used. In addition, HHV-8 DNA extracted and purified from Bcbl-1 cell line (body cavity based lymphoma) donated by Korea Advanced Institute of Science and Technology (KAIST) in Guseong-dong, Yuseong-gu, Daejeon, Korea was used as a positive control. It was.

3-1: β-글로빈 시료의 수득3-1: Obtaining β-globin Sample

β-글로빈의 최적 PCR 확립을 위한 구성과 조건은 다음과 같다. 2X PCR 완충용액 (50 mM KCl, 10 mM Tris-HCl, pH 8.3), 0.1 ㎍의 DNA, 2 mM MgCl2, 서열번호 11과 서열번호 12의 25 pmol의 β-글로빈 프라이머, 각 50 μM의 dNTP mixture (TaKaRa), 0.05 nM의 Cy5-dUTP (NEN, USA) 및 2 유니트 Taq 폴리머라제 (2 unitTaqpolymerase, TaKaRa, Japan)를 포함하고 경우에 따라 첨가물로 BSA 및 DMSO등을 사용하여 50 ㎕의 반응혼합물을 PCR 서머싸이클러 (thermocycler, Perkin-Elmer Cetus, CA, USA)에 넣고, 94℃에서 5분간 변성 (denaturation)후, 94℃에서 1분간 변성 (denaturation), 50℃에서 2분간 프라이머 결합 (primer annealing), 72℃에서 30초간 연장 (extension)과정을 5회 반복한 뒤 94℃에서 1분간 변성, 50℃에서 2분간 프라이머 결합, 72℃에서 15초간 연장과정을 35회 반복한다. 그 후 72℃에서 2분간 더 연장 반응을 하여, Cy5가 결합된 증폭된 DNA시료를 수득하였다.The configuration and conditions for establishing the optimal PCR of β-globin are as follows. 2X PCR buffer (50 mM KCl, 10 mM Tris-HCl, pH 8.3), 0.1 μg DNA, 2 mM MgCl 2 , 25 pmol β-globin primers of SEQ ID NO: 11 and SEQ ID NO: 12, 50 μM of each dNTP using a mixture (TaKaRa), 0.05 nM of Cy5-dUTP (NEN, USA) and 2 units Taq polymerase BSA and DMSO, etc. as additives in some cases includes a (second unit Taq polymerase, TaKaRa, Japan) in 50 ㎕ The reaction mixture is placed in a PCR thermocycler (thermocycler, Perkin-Elmer Cetus, Calif., USA), denatured at 94 ° C. for 5 minutes, denatured at 94 ° C. for 1 minute, and conjugated at 50 ° C. for 2 minutes. (primer annealing), repeat the extension process for 30 seconds at 72 ℃ 5 times, denatured for 1 minute at 94 ℃, primer binding for 2 minutes at 50 ℃, and repeat 35 times for 15 seconds at 72 ℃. Thereafter, the reaction was further extended at 72 ° C. for 2 minutes to obtain an amplified DNA sample having Cy5 bound thereto.

3-2: HHV 시료의 수득(서열번호 13, 14, 17 및 18 또는 11, 12, 17 및 18 의 프라이머 사용)3-2: Obtaining HHV Samples (using SEQ ID NOs: 13, 14, 17 and 18 or primers 11, 12, 17 and 18)

HHV의 최적 PCR 증폭 반응을 위해서, 서열번호 13, 14, 및 서열번호 17 및 18을 프라이머로 사용하여 다음과 같이 PCR을 수행하였다: 1 x PCR 완충용액 (50 mM KCl, 10 mM Tris-HCl, pH 8.3), 0.1 ㎍의 DNA, 2 mM MgCl2, 각 25 pmol의 프라이머, 100 μM의 각 dATP, dCTP, dGTP, dTTP (TaKaRa), 5%의 Dimethyl suloxide (DMSO), 0.05 nM의 Cy5-dUTP (NEN, USA) 및 2.5 유니트 Taq 폴리머라제(TaKaRa, Japan)를 포함하는 50 ㎕의 반응혼합물을 PCR 서머싸이클러 (thermocycler, Perkin-Elmer Cetus, CA, USA)에 넣고, 94℃에서 5분간 변성 (denaturation)후, 94℃에서 1분간 변성 (denaturation), 58℃에서 45초간 프라이머 결합 (primer annealing), 72℃에서 30초간 연장 (extension)과정을 35회 반복 후 72℃에서 2분간 더 연장 반응을 하여, Cy5가 결합된 증폭된 DNA시료를 수득하였다. 이에 대한 결과는 도 2 에 나타내었다.For optimal PCR amplification of HHV, PCR was performed using SEQ ID NOs. 13, 14, and SEQ ID NOs: 17 and 18 as primers: 1 × PCR buffer (50 mM KCl, 10 mM Tris-HCl, pH 8.3), 0.1 μg DNA, 2 mM MgCl 2 , 25 pmol primer each, 100 μM each dATP, dCTP, dGTP, dTTP (TaKaRa), 5% Dimethyl suloxide (DMSO), 0.05 nM Cy5-dUTP 50 μl of reaction mixture containing (NEN, USA) and 2.5 unit Taq polymerase (TaKaRa, Japan) was placed in a PCR thermocycler (thermocycler, Perkin-Elmer Cetus, Calif., USA) and denatured at 94 ° C. for 5 minutes. (denaturation), denaturation at 94 ° C. for 1 minute, primer annealing at 58 ° C. for 45 seconds, extension at 72 ° C. for 30 seconds, and then extension reaction at 72 ° C. for 2 minutes To obtain an amplified DNA sample bound to Cy5. The results are shown in FIG. 2.

상기 정제된 HSV-1, -2, HHV-8 DNA를 주형으로 하고, 서열번호 11, 12, 및 서열번호 17 및 18을 프라이머로 사용하여 다음과 같이 PCR을 수행하였다: 1 x PCR 완충용액 (50 mM KCl, 10 mM Tris-HCl, pH 8.3), 0.1 ㎍의 DNA, 2 mM MgCl2, 각 25 pmol의 프라이머, 100 μM의 각 dATP, dCTP, dGTP, dTTP (TaKaRa), 5%의 Dimethyl suloxide (DMSO), 0.05 nM의 Cy5-dUTP (NEN, USA) 및 2.5 유니트 Taq 폴리머라제(TaKaRa, Japan)를 포함하는 50 ㎕의 반응혼합물을 PCR 서머싸이클러 (thermocycler, Perkin-Elmer Cetus, CA, USA)에 넣고, 94℃에서 5분간 변성 (denaturation)후, 94℃에서 1분간 변성 (denaturation), 58℃에서 45초간 프라이머 결합 (primer annealing), 72℃에서 30초간 연장 (extension)과정을 35회 반복한 뒤 72℃에서 2분간 더 연장 반응을 하여, Cy5가 결합된 증폭된 DNA시료를 수득하였다. 이에 대한 PCR 결과는 도 4에 나타내었다.PCR was performed using the purified HSV-1, -2, HHV-8 DNA as a template, and using SEQ ID NOs: 11, 12, and SEQ ID NOs: 17 and 18 as primers: 1 x PCR buffer ( 50 mM KCl, 10 mM Tris-HCl, pH 8.3), 0.1 μg DNA, 2 mM MgCl 2 , 25 pmol primer each, 100 μM each dATP, dCTP, dGTP, dTTP (TaKaRa), 5% Dimethyl suloxide 50 μl of reaction mixture containing (DMSO), 0.05 nM of Cy5-dUTP (NEN, USA) and 2.5 units of Taq polymerase (TaKaRa, Japan) was added to a PCR thermocycler (thermocycler, Perkin-Elmer Cetus, CA, USA). ), Denature for 5 minutes at 94 ° C, denature for 1 minute at 94 ° C, primer annealing for 45 seconds at 58 ° C, and extension for 30 seconds at 72 ° C. After repeated extension reaction at 72 ° C. for 2 minutes, an amplified DNA sample conjugated with Cy5 was obtained. PCR results are shown in FIG. 4.

3-3: HHV 시료의 수득( 서열번호 15 및 16, 17 및 18 프라이머 사용)3-3: Obtaining HHV Samples (using SEQ ID NOs: 15 and 16, 17 and 18 primers)

HSV-1과 HHV-8의 PCR 증폭을 위하여 서열번호 13, 14, 및 서열번호 17 및 18을 프라이머로 사용하여 다음과 같이 PCR을 수행하였다. 1 x PCR 완충용액 (50 mM KCl, 10 mM Tris-HCl, pH 8.3), 0.1 ㎍의 DNA, 1.5 mM MgCl2, 각 10 pmol의 프라이머, 100 μM의 각 dATP, dCTP, dGTP, dTTP (TaKaRa), 0.05 nM의 Cy5-dUTP (NEN, USA) 및 2 유니트 Taq 폴리머라제(TaKaRa, Japan)를 포함하는 50 ㎕의 반응혼합물을 PCR 서머싸이클러 (thermocycler, Perkin-Elmer Cetus, CA, USA)에 넣고, 94℃에서 5분간 변성 (denaturation)후, 94℃에서 1분간 변성 (denaturation), 55℃에서 45초간 프라이머 결합 (primer annealing), 72℃에서 30초간 연장 (extension)과정을 35회 반복한 뒤 72℃에서 2분간 더 연장 반응을 하여, Cy5가 결합된 증폭된 DNA시료를 수득하였다. PCR 결과는 도 5에 나타내었다.For PCR amplification of HSV-1 and HHV-8, PCR was performed using SEQ ID NO: 13, 14, and SEQ ID NO: 17 and 18 as primers as follows. 1 x PCR buffer (50 mM KCl, 10 mM Tris-HCl, pH 8.3), 0.1 μg DNA, 1.5 mM MgCl 2 , primers of 10 pmol each, 100 μM of each dATP, dCTP, dGTP, dTTP (TaKaRa) , 50 μl of reaction mixture containing 0.05 nM of Cy5-dUTP (NEN, USA) and 2 units of Taq polymerase (TaKaRa, Japan) were placed in a PCR thermocycler (Perkin-Elmer Cetus, Calif., USA). After denaturation at 94 ° C. for 5 minutes, denaturation at 94 ° C. for 1 minute, primer annealing at 55 ° C. for 45 seconds, extension at 72 ° C. for 30 seconds, and then repeated 35 times. The reaction was further extended at 72 ° C. for 2 minutes to obtain an amplified DNA sample having Cy5 bound thereto. PCR results are shown in FIG. 5.

3-4: 임상 시료의 수득3-4: Obtaining Clinical Samples

전기 수득한 수포액 또는 조직의 DNA를 주형으로 하고, 서열번호 13, 서열번호 14 및 서열번호 17, 서열번호 18을 갖는 염기서열을 프라이머로 사용하며, 실시예 3-2과 동일한 방법으로 Cy5가 결합된 증폭된 DNA시료를 수득하였다.DNA obtained from the previously obtained blister or tissue was used as a template, and a nucleotide sequence having SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 17, and SEQ ID NO: 18 was used as a primer, and Cy5 was prepared in the same manner as in Example 3-2. Combined amplified DNA samples were obtained.

실시예 4: DNA 칩을 사용한 감염여부의 확인Example 4: Confirmation of Infection Using DNA Chips

상기 실시예 2에서 제조한 DNA 칩에 실시예 3에서 수득한 증폭된 시료를 적용하여, 하이브리디제이션 반응을 다음과 같이 수행하였다. 이때, 하이브리디제이션 반응실 (Hybridization reaction chamber)로 100 ㎕ 용량의 커버슬립 (cover slip, GRACE Bio-Labs, USA, PC4L-1.0)을 사용하였다.By applying the amplified sample obtained in Example 3 to the DNA chip prepared in Example 2, the hybridization reaction was carried out as follows. In this case, a 100 μl cover slip (GRACE Bio-Labs, USA, PC4L-1.0) was used as a hybridization reaction chamber.

표준 바이러스 DNA의 경우 또는 임상시료 DNA의 경우, HHV 증폭산물 15 ㎕와, β-글로빈 증폭산물 5 ㎕의 혼합물을 반응시료로서 사용하였다.전기 반응시료에 3 N 수산화나트륨 (NaOH) 수용액을 10% (v/v) 첨가하여 실온에서 5분간 변성시키고, 1 M Tris-HCl (pH 7.4)을 5% (v/v) 첨가하여 중화시켰다. 그런 후에, 상기 결과물에 3 N 염산을 10% (v/v) 첨가한 후, 얼음에서 5분간 방치하였다. 이어서, 하이브리디제이션 용액 (6X 식염수-소디움 포스페이트-EDTA 완충액 (SSPE, Sigma Chemical Co., St. Louis, MO, USA)과 0.05% 소디움 도데실 설페이트 (SDS)를 사용하여 45℃에서 실릴화된 슬라이드 (silylated slide)에 고정된 프로브와 2시간 동안 반응시키고, 3X SSPE로 2분, 1X SSPE로 2분간 DNA 칩을 세척하여 실온에서 공기 건조하거나 스핀 건조기 (spin dryer)를 사용하여 건조하였다. 이를 콘포칼 레이저 스캐너 (confocal laser scanner, GSI Lumonics, Germany)를 이용하여 형광신호를 분석하였다 (excitation 650 nm, emission 668 nm).For standard viral DNA or for clinical sample DNA, a mixture of 15 μl of HHV amplification product and 5 μl of β-globin amplification product was used as the reaction sample . 10% (v / v) of 3N sodium hydroxide (NaOH) aqueous solution was added to the sample to denature at room temperature for 5 minutes, and neutralized by adding 5% (v / v) of 1M Tris-HCl (pH 7.4). . Thereafter, 10% (v / v) of 3N hydrochloric acid was added to the resultant, and then left for 5 minutes on ice. Then, silylated at 45 ° C using hybridization solution (6X Saline-Sodium Phosphate-EDTA buffer (SSPE, Sigma Chemical Co., St. Louis, MO, USA) and 0.05% sodium dodecyl sulfate (SDS) After 2 hours of reaction with the probe immobilized on the silylated slide, the DNA chip was washed for 2 minutes with 3X SSPE and 2 minutes with 1X SSPE and air dried at room temperature or dried using a spin dryer. Fluorescence signals were analyzed using a confocal laser scanner (GSI Lumonics, Germany) (excitation 650 nm, emission 668 nm).

상기 3-2 실시예에서 서열번호 13, 14, 17 및 18의 프라이머를 사용하여 얻은 HHV 시료를 이용하여 분석한 결과를 도 6a, 6b, 6c, 6d에 나타냈다. 도 6a는 HSV-1을 분석한 결과를 나타내는 사진이고 도 6b는 HSV-2를 분석한 결과를 나타내는 사진이며 도 6c는 HHV-8을 분석한 결과를 나타내는 사진이다. 도 6d는 β-글로빈을 분석한 결과 사진으로 HHV이 검출되지 않은 결과를 나타낸다. 도 6a 내지 6d에서 보듯이, 각 DNA의 증폭산물로부터 기인한 하이브리디제이션 신호가 다른 심각한 교차-하이브리디제이션 (cross-hybridization) 없이 제 위치의 프로브에서만 각각 깨끗하게 나타남을 확인할 수 있었다.6A, 6B, 6C, and 6D show the results of analysis using the HHV samples obtained using the primers of SEQ ID NO: 13, 14, 17, and 18 in Example 3-2. 6A is a photograph showing the result of analyzing HSV-1, FIG. 6B is a photograph showing the result of analyzing HSV-2, and FIG. 6C is a photograph showing the result of analyzing HHV-8. Figure 6d is a result of analyzing the β-globin photograph shows the result that HHV was not detected. As shown in Figures 6a to 6d, it was confirmed that the hybridization signal resulting from the amplification product of each DNA appears to be clear only in the probe in place without other serious cross-hybridization.

상기 3-3 실시예에서 서열번호 15, 16, 17 및 18의 프라이머 사용하여 얻는 HHV 시료를 이용하여 분석한 결과를 도 8a, 8b, 8c에 나타내었다. 도 8a는 HSV-1을 분석한 결과를 나타내는 사진이고 도 8b는 HHV-8을 분석한 결과를 나타내는 사진이다. 도 8c는 β-글로빈을 분석한 결과 사진으로 HHV이 검출되지 않은 결과를 나타낸다.The results of the analysis using the HHV samples obtained using the primers of SEQ ID NO: 15, 16, 17 and 18 in Example 3-3 are shown in FIGS. 8A, 8B and 8C. 8A is a photograph showing the result of analyzing HSV-1, and FIG. 8B is a photograph showing the result of analyzing HHV-8. Figure 8c shows the result of the HHV was not detected in the photograph of the β-globin analysis.

실시예 5: DNA 칩을 사용한 임상시료의 진단결과의 확인Example 5 Confirmation of Diagnostic Results of Clinical Samples Using DNA Chips

상기 실시예 3-4에서 수득한 임상시료에 대하여 실시예 4와 실질적으로 동일한 방법으로 HHV의 유전형 분석실험을 수행하였다. 분석한 결과를 도 9a, 9b 9c에 나타내었다. 그 결과 도 9a는 HSV-1에 감염된 샘플로 분석되었고, 도 9b는 HSV-2에 감염된 샘플로 분석되었고, 도 9c는 HHV-8에 감염된 샘플로 분석되었고, 도 9d는 HHV가 검출되지 않은 결과를 나타낸다.The clinical sample obtained in Example 3-4 was subjected to genotyping assay of HHV in substantially the same manner as in Example 4. The analysis results are shown in FIGS. 9A and 9B 9C. As a result, FIG. 9A was analyzed as a sample infected with HSV-1, FIG. 9B was analyzed as a sample infected with HSV-2, FIG. 9C was analyzed as a sample infected with HHV-8, and FIG. 9D was not detected when HHV was detected. Indicates.

분석실험 결과, 발명의 유전형 분석키트는 손쉽게 HHV를 검출할 수 있을 뿐만 아니라, 감염된 HHV의 유전형을 판별할 수 있었다. 따라서, 본 발명에 따른 DNA 칩을 사용하여 HHV 감염의 진단과 정확한 치료로 인한 포진의 재발 또는 에이즈의 예방에 기여할 수 있을 것이다.As a result of the assay, the genotyping kit of the present invention not only could easily detect HHV, but also could determine the genotype of infected HHV. Therefore, using the DNA chip according to the present invention will be able to contribute to the diagnosis of HHV infection and the prevention of herpes recurrence or AIDS due to the correct treatment.

이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시예일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.As described above in detail specific parts of the present invention, it is apparent to those skilled in the art that such specific descriptions are merely preferred embodiments, and thus the scope of the present invention is not limited thereto. something to do. Thus, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

본 발명의 DNA 칩을 이용한 HHV의 유전형 분석키트 및 분석방법을 사용하여,HHV의 감염여부를 진단할 경우, 신속하고 간단하며 정확하게 HHV 감염여부 및 유전형을 검출할 수 있으므로, STD를 일으키는 HHV의 정확한 진단, 이로 인한 음부포진 또는 카포시 육종등의 예방 및 치료에 기여할 수 있을 것이다.HHV genotyping kit and analysis method using the DNA chip of the present invention, when diagnosing the infection of HHV, it is possible to detect HHV infection and genotype quickly, simply and accurately, so that the exact HHV causing STD Diagnosis, thereby preventing and treating genital herpes or Kaposi's sarcoma.

Claims (18)

서열번호 1 내지 9에 표시된 염기서열을 갖는 올리고뉴클레오타이드, 및 상기 올리고뉴클레오타이드에 상보적인 염기서열을 갖는 올리고뉴클레오타이드로 이루어진 군에서 선택되며, 인체포진 바이러스(Human Herpes Virus, HHV)의 핵산과 상보적으로 결합하는 프로브.Oligonucleotides having the nucleotide sequences shown in SEQ ID NOS: 1 to 9, and oligonucleotides having the nucleotide sequence complementary to the oligonucleotides, are selected from the group consisting of, and complementary to the nucleic acid of the human Herpes Virus (HHV) Binding probes. 서열번호 11 내지 서열번호 20에 나타난 염기서열을 갖는 올리고뉴클레오타이드로 이루어진 군에서 선택되는 1종 이상의 올리고뉴클레오타이드를 포함하는 인체포진 바이러스(Human Herpes Virus, HHV) DNA의 증폭을 위한 프라이머.Primer for amplification of human herpes virus (HHV) DNA comprising at least one oligonucleotide selected from the group consisting of oligonucleotides having the nucleotide sequence shown in SEQ ID NO: 11 to SEQ ID NO: 20. 서열번호 11 및 서열번호 12에 나타난 염기서열을 갖는 프라이머쌍, 또는 서열번호 13 및 서열번호 14에 나타난 염기서열을 갖는 프라이머쌍인 HSV-1 및 HSV-2 DNA를 증폭하기 위한 프라이머.A primer for amplifying HSV-1 and HSV-2 DNA, which is a primer pair having a nucleotide sequence shown in SEQ ID NO: 11 and SEQ ID NO: 12, or a pair of primers having a nucleotide sequence shown in SEQ ID NO: 13 and SEQ ID NO: 14. 서열번호 17 및 서열번호 18에 나타난 염기서열을 갖는 프라이머쌍, 또는 서열번호 19 및 서열번호 20에 나타난 염기서열을 갖는 HHV-8 DNA를 증폭하기 위한 프라이머.A primer pair for amplifying HHV-8 DNA having a nucleotide sequence shown in SEQ ID NO: 17 and SEQ ID NO: 18, or a nucleotide sequence shown in SEQ ID NO: 19 and SEQ ID NO: 20. 서열번호 1 내지 서열번호 9에 표시된 염기서열을 갖는 올리고뉴클레오타이드, 및 이들 올리고뉴클레오타이드에 상보적인 염기서열을 갖는 올리고뉴클레오타이드로 이루어진 군에서 선택된 1종 이상의 HHV 프로브를 포함하는, 인체포진 바이러스(Human Herpes Virus, HHV)의 탐지 또는 유전형 분석용 DNA 칩.Human Herpes Virus (Human Herpes Virus) comprising at least one HHV probe selected from the group consisting of oligonucleotides having the nucleotide sequences shown in SEQ ID NO: 1 to SEQ ID NO: 9, and oligonucleotides having a nucleotide sequence complementary to these oligonucleotides , HHV) DNA chip for detection or genotyping. 제 5 항에 있어서, 서열번호 1 내지 서열번호 3의 염기서열을 갖는 올리고뉴클레오타이드로 이루어진 군에서 1종 이상 선택되는 HSV-1의 프로브, 서열번호 7의 염기서열을 갖는 올리고뉴클레오타이드을 갖는 HSV-2의 프로브, 및 서열번호 8 및 9의 염기서열을 갖는 올리고뉴클레오타이드로 이루어진 군에서 1종 이상 선택되는 HHV-8의 프로브를 포함하는 인체포진 바이러스의 탐지 또는 유전형 분석용 DNA 칩.The method according to claim 5, wherein at least one probe of HSV-1 selected from the group consisting of oligonucleotides having a nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 3 of HSV-2 having an oligonucleotide having a nucleotide sequence of SEQ ID NO: 7 DNA chip for detection or genotyping of a herpes virus comprising a probe and a probe of HHV-8 selected from the group consisting of oligonucleotides having the nucleotide sequences of SEQ ID NOs: 8 and 9. 제 5 항에 있어서, 상기 DNA칩은 β-글로빈, 액틴, 및 글리세르알데히드-3-포스페이트 데하이드로게나제(glyceraldehyde-3-phosphate dehydrogenase) 유전자로 이루어지는 군에서 선택되는 기준마커 프로브를 추가로 포함하는 DNA 칩.6. The DNA chip of claim 5, wherein the DNA chip further comprises a reference marker probe selected from the group consisting of β-globin, actin, and glyceraldehyde-3-phosphate dehydrogenase genes. DNA chip. 제 7 항에 있어서, 상기 β-글로빈 프로브는 서열번호 10에 나타난 염기서열을 갖는 것인 DNA 칩.8. The DNA chip of claim 7, wherein the β-globin probe has a nucleotide sequence shown in SEQ ID NO: 10. 제 5 항에 있어서, 상기 프로브 DNA의 5'말단 아민기가 칩 고체표면의 알데히드기와 시프염기반응으로 고정화되는 것인 DNA칩.The DNA chip according to claim 5, wherein the 5 'terminal amine group of the probe DNA is immobilized by a cip group reaction with an aldehyde group on the surface of the chip solid. (a) 제 5항 내지 9항중 어느 한항에 따른 인체포진 바이러스(Human Herpes Virus, HHV)의 탐지 또는 유전형 분석용 DNA 칩, (b) 시료 HHV DNA를 PCR 방법으로 증폭시키기 위한 프라이머 세트, 및 (c) 상기 DNA 칩과 하이브리드되는 증폭된 DNA를 탐지하기 위한 표지수단을 포함하는 인체포진 바이러스의 탐지 또는 유전형 분석용 키트.(a) a DNA chip for detecting or genotyping human herpes virus (HHV) according to any one of claims 5 to 9, (b) a primer set for amplifying a sample HHV DNA by a PCR method, and ( c) kit for the detection or genotyping of a herpes virus comprising a labeling means for detecting amplified DNA hybridized with the DNA chip. 제 10 항에 있어서, 상기 표지수단은 Cy5, Cy3, 비오틴-결합물질, EDANS(5-(2'-아미노에틸)아미노-1-나프탈렌 황산), 테트라메틸로다민(TMR), 테트라메틸로다민 이소시아네이트(TMRITC), x-로다민 및 텍사스 레드로 이루어지는 군에서 선택되는 것인 인체포진 바이러스의 탐지 또는 유전형 분석용 키트.The method of claim 10, wherein the labeling means is Cy5, Cy3, biotin-binding material, EDANS (5- (2'-aminoethyl) amino-1-naphthalene sulfate), tetramethyltamine (TMR), tetramethyltamine Kit for detection or genotyping of the herpes virus, which is selected from the group consisting of isocyanate (TMRITC), x-rhodamine and Texas red. 제 10 항에 있어서, 상기 프라이머 세트는 서열번호 11 및 12에 나타난 염기서열을 갖는 프라이머쌍, 서열번호 13 및 14에 나타난 염기서열을 갖는 프라이머쌍, 서열번호 15 및 16에 나타난 염기서열을 갖는 프라이머쌍, 서열번호 17 및 18에 나타난 염기서열을 갖는 프라이머쌍, 및 서열번호 19 및 20에 나타난 염기서열을 갖는 프라이머쌍으로 이루어진 군에서 선택된 1쌍 이상의 프라이머쌍을 포함하는 것인 키트.The method of claim 10, wherein the primer set is a primer pair having a nucleotide sequence shown in SEQ ID NO: 11 and 12, a primer pair having a nucleotide sequence shown in SEQ ID NO: 13 and 14, a primer having a nucleotide sequence shown in SEQ ID NO: 15 and 16 And a pair of primer pairs selected from the group consisting of a pair of primers having a nucleotide sequence shown in SEQ ID NOs: 17 and 18, and a pair of primers having a nucleotide sequence shown in SEQ ID NOs: 19 and 20. 제 12 항에 있어서, 상기 프라이머 세트는 서열번호 11 및 12에 나타난 염기서열을 갖는 프라이머쌍, 및 서열번호 13 및 14에 나타난 염기서열을 갖는 프라이머쌍으로 이루어지는 군에서 선택된 HSV-1 및 HSV-2 DNA를 증폭하기 위한 프라이머쌍과,The method of claim 12, wherein the primer set is selected from the group consisting of a primer pair having a nucleotide sequence shown in SEQ ID NO: 11 and 12, and a primer pair having a nucleotide sequence shown in SEQ ID NO: 13 and 14 HSV-1 and HSV-2 Primer pairs for amplifying DNA, 서열번호 17 및 18에 나타난 염기서열을 갖는 프라이머쌍, 및 서열번호 19 및 20에 나타난 염기서열을 갖는 프라이머쌍으로 이루어진 군에서 선택되는 HHV-8 DNA를 증폭하기 위한 프라이머쌍를 포함하는 키트.A kit comprising a primer pair for amplifying HHV-8 DNA selected from the group consisting of a primer pair having a nucleotide sequence shown in SEQ ID NO: 17 and 18, and a primer pair having a nucleotide sequence shown in SEQ ID NO: 19 and 20. 제 10 항에 있어서, 상기 프라이머 세트는 서열번호 21의 염기서열 내지 서열번호 22의 염기서열을 갖는 β-글로빈 DNA 증폭용 프라이머쌍을 포함하는 키트.The kit according to claim 10, wherein the primer set comprises a primer pair for amplifying β-globin DNA having a nucleotide sequence of SEQ ID NO: 21 to a nucleotide sequence of SEQ ID NO: 22. (a) 인체포진 바이러스의 DNA 증폭용 프라이머를 이용하여 시료의 DNA를 증폭하는 단계;(A) amplifying the DNA of the sample using a primer for DNA amplification of the herpes virus; (b) 서열번호 1 내지 9에 표시된 염기서열을 갖는 올리고뉴클레오타이드, 및 이들 올리고뉴클레오타이드에 상보적인 염기서열을 갖는 올리고뉴클레오타이드로 이루어진 군에서 선택된 1종 이상의 HHV 프로브를 포함하는 DNA 칩에 상기 증폭된 DNA를 하이브리드시키는 단계; 및(b) the DNA amplified in the DNA chip comprising oligonucleotides having the nucleotide sequences shown in SEQ ID NOS: 1-9, and at least one HHV probe selected from the group consisting of oligonucleotides having a nucleotide sequence complementary to these oligonucleotides Hybridizing; And (c) 상기 프로브와 하이브리화된 반응물을 검출하는 단계를 포함하는 인체포진 바이러스의 탐지 또는 유전형 분석방법.(c) detecting or genotyping the herpes virus, comprising detecting the probe and the hybridized reactant. 제 15 항에 있어서, 상기 프라이머는 서열번호 11 내지 서열번호 20의 염기서열을 갖는 HHV DNA 증폭용 프라이머로 이루어진 군에서 선택되는 것인 인체포진 바이러스의 탐지 또는 유전형 분석방법.The method of claim 15, wherein the primer is selected from the group consisting of HHV DNA amplification primers having a nucleotide sequence of SEQ ID NO: 11 to SEQ ID NO: 20. 제 15 항에 있어서, 상기 검출은 유전자가 Cy5로 표지된 경우 콘포칼 레이저 스캐너를 이용하여 형광신호를 분석함을 특징으로 하는 인체포진 바이러스의 탐지 또는 유전형 분석방법.16. The method of claim 15, wherein the detection of the herpes virus is characterized in that the fluorescent signal is analyzed using a confocal laser scanner when the gene is labeled with Cy5. (a) 인체포진 바이러스의 DNA 증폭용 프라이머를 이용하여 시료 DNA를 증폭하는 단계;(A) amplifying the sample DNA using a primer for DNA amplification of the herpes virus; (b) 서열번호 1 내지 9에 표시된 염기서열을 갖는 올리고뉴클레오타이드, 및 이들 올리고뉴클레오타이드에 상보적인 염기서열을 갖는 올리고뉴클레오타이드로 이루어진 군에서 선택된 1종 이상의 HHV 프로브와 상기 증폭된 DNA를 하이브리드시키는 단계; 및(b) hybridizing the amplified DNA with at least one HHV probe selected from the group consisting of oligonucleotides having the nucleotide sequences shown in SEQ ID NOS: 1-9, and oligonucleotides having the nucleotide sequences complementary to these oligonucleotides; And (c) 상기 프로브와 하이브리화된 반응물을 검출하는 단계를 포함하는 인체포진 바이러스의 탐지 또는 유전형 분석방법.(c) detecting or genotyping the herpes virus, comprising detecting the probe and the hybridized reactant.
KR10-2002-0054330A 2002-09-09 2002-09-09 PROBE FOR DETECTING Human herpesvirus, GENOTYPING KIT AND GENOTYPING METHOD FOR Human herpes virus USING THE SAME KR100460747B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR10-2002-0054330A KR100460747B1 (en) 2002-09-09 2002-09-09 PROBE FOR DETECTING Human herpesvirus, GENOTYPING KIT AND GENOTYPING METHOD FOR Human herpes virus USING THE SAME

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR10-2002-0054330A KR100460747B1 (en) 2002-09-09 2002-09-09 PROBE FOR DETECTING Human herpesvirus, GENOTYPING KIT AND GENOTYPING METHOD FOR Human herpes virus USING THE SAME

Publications (2)

Publication Number Publication Date
KR20040022800A true KR20040022800A (en) 2004-03-18
KR100460747B1 KR100460747B1 (en) 2004-12-08

Family

ID=37326517

Family Applications (1)

Application Number Title Priority Date Filing Date
KR10-2002-0054330A KR100460747B1 (en) 2002-09-09 2002-09-09 PROBE FOR DETECTING Human herpesvirus, GENOTYPING KIT AND GENOTYPING METHOD FOR Human herpes virus USING THE SAME

Country Status (1)

Country Link
KR (1) KR100460747B1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
MD3299G2 (en) * 2006-09-28 2007-11-30 Институт Генетики, Физиологии И Защиты Растений Академии Наук Молдовы Oligonucleotide primer for I-type herpes simplex virus DNA detection

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU606043B2 (en) * 1985-03-28 1991-01-31 F. Hoffmann-La Roche Ag Detection of viruses by amplification and hybridization
FR2651007B1 (en) * 1989-08-18 1992-09-04 Pasteur Institut NUCLEIC ACID FRAGMENTS AND DIAGNOSTIC REAGENTS DERIVED FROM THE HHV6 / SIE GENOME AND METHOD FOR DIAGNOSING HHV6 INFECTIONS
JPH07203996A (en) * 1994-01-17 1995-08-08 Toyobo Co Ltd Oligonucleotide for detecting human herpes simplex virus and use thereof
JPH07250699A (en) * 1994-03-11 1995-10-03 Toyobo Co Ltd Method for discriminatory detection of human herpes virus and reagent therefor
US5569583A (en) * 1995-04-25 1996-10-29 Health Research Inc. Rapid and sensitive detection of cytomegalovirus
US7338761B2 (en) * 2000-10-24 2008-03-04 Vigen Laboratories Inc. Detection and quantification of human herpes viruses

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
MD3299G2 (en) * 2006-09-28 2007-11-30 Институт Генетики, Физиологии И Защиты Растений Академии Наук Молдовы Oligonucleotide primer for I-type herpes simplex virus DNA detection

Also Published As

Publication number Publication date
KR100460747B1 (en) 2004-12-08

Similar Documents

Publication Publication Date Title
TWI410491B (en) A novel method for simultaneous detection and discrimination of bacterial, fungal, parasitic and viral infections of eye and central nervous system
KR100452163B1 (en) Genotyping kit for diagnosis of human papilloma virus infection
US7393633B1 (en) Genotyping kit for diagnosis of human papillomavirus infection
US20120004113A1 (en) Dna chip, kit for detecting or genotyping bacteria causing sexually transmitted diseases, genotyping antibacterial drug resistance and detecting or genotyping method using the same
JP2651483B2 (en) Detection of human papillomavirus by polymerase chain reaction
RU2410441C2 (en) Set and method for detecting human papilloma virus using set of oligonucleotide granules
JP2905283B2 (en) Method for detecting human papillomavirus and oligonucleotides used therein
KR20070112781A (en) Method for the detection of hpv and probes, primers and kits
JP2013520195A (en) Y-shaped probe and its modified type, and DNA microarray, kit and gene analysis method using the same
US8455632B2 (en) Primer set and probe for detection of human papillomavirus
JP2003529376A (en) Detection and typing of human papillomavirus using PNA probes
KR100517275B1 (en) Genotyping probe for diagnosis of human papilloma virus infection and biochip comprising the same
KR101623489B1 (en) High Definition Probe for detecting microorganism causing sexually transmitted disease and kit using the same
KR100460747B1 (en) PROBE FOR DETECTING Human herpesvirus, GENOTYPING KIT AND GENOTYPING METHOD FOR Human herpes virus USING THE SAME
KR101335483B1 (en) Method of Detecting Human Papilloma Virus and Genotyping Thereof
KR101451780B1 (en) PNA probes, kits and methods for detecting genotypes of Human Papillomavirus
KR20130125046A (en) Kit for analyzing high-risk hpv gene and method for analyzing the same
JP5898831B2 (en) Detection of human papillomavirus
US6818397B1 (en) Methods for detecting and differentiating enteroviruses and the primers and probes therefor
KR101196930B1 (en) Primer and probe for detection of human papilloma virus and method for detecting human papilloma virus using the same
KR100904772B1 (en) Gene chip, method for detecting csfv and bvdv gene using gene chip and detection kit comprising gene chip
KR100532664B1 (en) Probe for detecting chlamydia trachomatis, detection kit and detection method for chlamydia trachomatis using the same
KR20090118777A (en) Pna probes, kits and methods for detecting genotypes of human papillomavirus
KR100532666B1 (en) PROBE FOR DETECTING Treponema pallidum, DETECTION KIT AND DETECTION METHOD FOR Treponema pallidum USING THE SAME
Wild et al. Genotyping Measles Virus by Real-Time

Legal Events

Date Code Title Description
A201 Request for examination
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20121112

Year of fee payment: 9

FPAY Annual fee payment

Payment date: 20131122

Year of fee payment: 10

FPAY Annual fee payment

Payment date: 20141124

Year of fee payment: 11

FPAY Annual fee payment

Payment date: 20151124

Year of fee payment: 12

LAPS Lapse due to unpaid annual fee