KR100418465B1 - Gene theraphy and gene therapeutic composition for insulin dependent diabetes mellitus - Google Patents

Abstract

Disclosed are a recombinant vector for use in gene therapy for insulin-dependent diabetes mellitus and a therapeutic composition thereof. Following the injection of a beta -galactosidase expression vector having a K14 promoter gene, along with a Drosophola's P transposase expression helper vector, into murine skin in a liposome-mediated manner, the beta -galactosidase gene is expressed in the keratinocyte layer from 24 hours to 20 weeks after injection as measured by X-gal staining. With the enhancement effect and tissue specificity, the K14 promoter is applied for the expression of a human insulin gene in keratinocytes, thereby suggesting a new gene therapy method for treating insulin-dependent diabetes mellitus. When, in combination with the P-element expression helper vector, a human insulin expression vector with the K14 promoter is injected into the skin of diabetic mice, which lack insulin-producing beta -cells of the pancreas, their blood glucose levels are maintained in a normal range. <IMAGE>

Description

Gene theraphy and gene therapeutic composition for insulin dependent diabetes mellitus}

The present invention relates to a method for gene therapy of insulin-dependent diabetes and a composition for treating the same. More specifically, the present invention provides a cloned vector of the K14 promoter and the human insulin gene, the K14 promoter and the β-galactosidase gene, and the P-transferase of yellow fruit flies by liposome method and pressure injection method. When administered to the skin tissue of the mouse together with the helper vector expressing a, β-galactosidase gene is inserted on the mouse chromosome by the transferase expressed in the helper vector, expressed from 24 hours to 20 weeks, K 14 Promoters confirmed the specificity of tissues expressing β-galactosidase gene in keratinocytes layer.Insulin-dependent expression of insulin produced in keratinocytes by insulin vector expression in diabetic mice lowered blood glucose levels. It relates to an insulin expression vector and gene therapy using the same for the treatment of diabetes.

Gene therapy is a method of artificially regulating gene transfer and expression of genes to correct mutated genetic information of patients by genetic recombination, which has been developed for the treatment of various types of pathologies, including nervous system disturbances, cardiovascular disease, arthritis or cancer. come. Conventional studies on gene therapy have been known in retro-published publication No. 1997-27310 for retroviral vectors and their use in gene therapy, and in international publication no. 1997-34009 for recombinant adenoviruses for the treatment of human tumor genes. Vectors are known. However, these known methods require a lot of time and high cost by using viral vectors and are limited to the treatment of genetic diseases due to safety and complexity of the process. Non-viral insulin vectors as in the present invention are not known. .

Diabetes is a body metabolic disorder caused by insulin deficiency when the β-cells of the insulin producing pancreas are damaged. Insulin-dependent diabetes mellitus (IDDM), called type I, develops by 3% each year and affects one in 7,000 children. In order to treat insulin-dependent diabetes, blood glucose measurement, insulin administration, dietary use, exercise therapy, etc. are being performed, but only 50-70% of cases can reduce the worsening of diabetes despite intensive treatment. This situation is required.

On the other hand, epithelial cells and their appendages, which are capable of self-renewal, are composed of parts of stem cells, covering the surface of the human body, and proliferating. Cultivation of human dermal keratinocytes, which can be propagated for hundreds of generations, studied by Green, is now widely used by culturing and transplanting keratinocytes for burn treatment in major hospitals. Gene transfer into cultured keratinocytes has been demonstrated by various products expressed using various external promoters. Keratinocytes in epithelial cells are: (1) hepatocytes with unlimited growth capacity or proliferation; (2) TA cells, which are generated from hepatocytes and repeat a limited number of cycles until their final differentiation, It is reproduced by two categories of cloned cells. Stem cells are slow in cycles and poorly labeled on the nucleotide analogues, but once labeled they persist for long periods of time. Hepatocytes and TA cells (transient amplifiying cells) are located at the base of the final differentiated and epithelial cells forming the super-basal layer. Hepatocytes, their divided cells and final differentiated cells form separate spatial arrangements and are called 'epidermal proliferation units'. Keratin 14 (K 14) and Keratin 5 (K 5) are the main proteins expressed by the active cells of the epithelium and its appendages. Genes encoding such keratin are highly transcribed in cultured human keratinocyte cultures. For this reason, the use of K14 and K5 promoters is ideal for keratinocyte-mediated gene therapy.

Since the discovery of the involvement of the P transfer factor in hybrid dysgenesis in the 1970s, many studies have been reported. In 1982, the gene cloned with the P transfer factor was cloned from the fruit fly embryo. Has been reported (Rubin, GM et al. Science. 1982, 218: 348-353). However, the known method has been known to be inactive even in recent years. In particular, the application of the P transfer factor of yellow fruit flies in mammals as in the present invention has not been reported to date.

In view of the above, the present inventors cloned the K14 promoter and the human insulin gene, the K14 promoter and the β-galactosidase gene, to prepare a recombinant vector of the present invention, and yellow fruit flies by liposome method and pressure injection method. As a result of administration to a skin tissue with a helper vector expressing a transferase, the expression of the insulin vector produces insulin in the skin keratinocytes and lowers the blood glucose level. Thus, the recombinant gene vector of the present invention is effective in treating insulin-dependent diabetes. By confirming that the present invention was completed.

Accordingly, an object of the present invention is to provide a non-viral insulin expression recombinant vector and method for producing the same, which are effective for treating insulin-dependent diabetes gene.

It is another object of the present invention to use the P transfer factor of Drosophila as a mammalian nonviral vector.

Another object of the present invention is to administer the non-viral insulin expression recombinant vector and the yellow fruit fly P transferase expression recombinant helper vector to the skin by liposome method and pressure injection method, and the insulin gene is inserted into the chromosome to maintain the insulin-dependent diabetes mellitus for a long time. In providing a therapeutic composition of the.

The object of the present invention is to prepare a vector cloned from the K14 promoter and the human insulin gene, the K14 promoter and the β-galactosidase gene, and a helper vector expressing the yellow fruit fly transferase by liposome method and autoinjection method. After administration to the skin tissue, the expression of β-galactosidase gene was confirmed by X-gal staining, and β-gal by transposase made from helper vector by PCR and Southern blot analysis. The lactosidase gene is integrated into the chromosome of the mouse, and H / E (Hematoxylin / Eosin) staining method confirms tissue specificity in which β-galactosidase gene is expressed in the keratinocyte layer and immunostaining ( Immunostaining observed the distribution of α, β, and δ cells in the pancreas, indicating that little β cells were present. Achieved by confirming lowering blood glucose levels.

Hereinafter, the configuration and operation of the present invention.

Figure 1a is a schematic diagram of the production of β-galactosidase expression vector constructed by introducing the lac Z gene, K14 promoter (pUC KZ), lac Z gene (pUC4.3Z).

1B is a schematic diagram of a helper vector (pπ25.7wc ?? 2-3) expressing P-transferase of yellow fruit flies.

FIG. 2 shows the results of confirming lac Z expression by X-gal staining over time (1 day to 20 weeks) in skin tissue of mice administered pUCK-Z.

Figure 3 is the result of X-gal staining and H / E (Hematoxylin / Eosin) staining the expression of β-galactosidase gene over time of the mouse skin tissue administered pUCK-Z.

Figure 4 is a result of PCR to confirm the insertion of β-galactosidase gene on the chromosome by transposase.

5 is a result of Southern blot analysis to confirm the insertion of β-galactosidase gene on the chromosome by transposase.

Fig. 6 is a schematic diagram showing the production of the present invention insulin vector (pUCK14-INS).

Figure 7 shows the nucleotide sequence of the K14 promoter and insulin gene of the insulin vector of the present invention.

Figure 8a is a graph showing the result of measuring the blood glucose change by treating the streptozotocin (STZ) at a concentration of 65 mg / kg and then treated with pUCK14-INS.

Figure 8b is a graph showing the result of measuring the change in blood glucose by treating the streptozotocin (STZ) at a concentration of 200mg / kg and then treated with pUCK14-INS.

9 is a photograph showing the shape of the pancreas and the distribution of the island of Langerhans.

10 shows the results of immunostaining of Langerhans island of diabetic mice treated with normal mice, diabetic mice and insulin expression vectors.

The present invention comprises the steps of constructing a β-galactosidase expression vector with a K14 promoter (pUC KZ) and a β-galactosidase expression vector without a K14 promoter (pUC-4.3Z); Preparing a DNA / liposomal mixture by mixing liposomes to the vector and adding a helper vector expressing the P-transferase of yellow fruit flies; Administering the DNA / liposome mixture to the mouse skin by autoinjection and obtaining skin tissue over time; Confirming the expression of β-galactosidase by X-gal staining of the skin tissue; Confirming that the insulin gene is expressed in the keratinocyte layer by staining the skin tissue with H / E (Hematoxylin / Eosin); Extracting genomic DNA from the skin tissue; PCR using lac Z primer to determine whether the mouse chromosome is inserted; Southern blot analysis to determine whether the mouse chromosome is inserted; As a result of the experiment, the tissue specificity of the vector and the transition to the chromosome were confirmed. Based on the results, primers were prepared from the known human preproinsulin gene and the nucleotide sequence of the K 14 promoter region, and PCR was performed using the primers. Amplifying and cloning into pUChsneo and pGEM T-easy vectors, respectively, and inserting into pUChsneo to prepare insulin expression vectors; Sequencing the prepared insulin expression vector; Inducing diabetes in mice by administering streptozotocin (STZ) to a concentration of 60 mg / kg and 200 mg / kg; Injecting 1 μg, 50 μg, 100 μg of the insulin expression vector of the present invention into a diabetic-induced mouse and measuring blood glucose level; Observing the distribution of pancreatic morphology and islets of Langerhans in mice receiving an insulin expression vector through H / E staining; Immuno staining of the Langerhans islet consists of measuring the distribution of α, β and δ cells.

Needles jet injector used in the pressure injection method of the present invention was purchased from MADA MEDICAL PRODUCTS, INC (USA, NJ).

The blood glucose meter (Super Glucocard II kit) and strip (Glucocard test strip II) used in the present invention were purchased from Arkray KDK Corp (Kyoto, Japan).

GENEPORTER ^™ transfection reagent was purchased from GTS INC (San diego CA, USA) and STZ (streptozotocin) was purchased from Sigma.

Mice, which are experimental animals of the present invention, were purchased from Biolink Co., Ltd., having a weight of about 26 g of 12 to 14 weeks.

The insulin expression vector of the present invention or a composition for treating the same can be obtained by combining the above known methods alone or suitably.

Hereinafter, the present invention will be described in more detail with reference to the following Examples, but the scope of the present invention is not limited to these Examples.

Experimental Example 1 Expression of β-galactosidase Gene in Mouse Skin

Step 1: construct β-galactosidase expression vector

In order to confirm the activity (activieity) with or without the K14 promoter, cloned the K14 promoter at the Eco R I site of pUCheo as shown in Figure 1a and then cloned 4.3kb lac Z gene of cpwβ-22 to Bam HI and Sal I site pUC KZ was prepared and pUC 4.3Z was prepared by inserting only the lac Z gene without the K 14 promoter. The two kinds of vectors were transformed into Escherichia coli, and then plasmids were extracted with phenol / chloroform / isoamialcohol to confirm cloning by restriction map.

Step 2: Build a Helper Vector

Since pUCHshneo itself cannot be transferred onto a chromosome, a helper vector expressing a yellow Drosophila transferase as shown in FIG. 1B was constructed. Helper vector (pπ25.7wcΔ2-3) The intron between ORF 2 and ORF 3 was controlled to produce a transferase.

Step 3: preparing the DNA / ribosome complex

The β-galactosidase expression vector prepared in step 1 was purified by QIAGEN plasmid maxi kit, and the Gene PORTER ^™ gene transfer reagent was hydrated in 0.75 mL of hydration buffer. 2 µg, 5 µg, 10 µg, 50 µg 100 µg purified plasmid DNA and 5 uL, 10 uL and 20 uL liposomes were mixed to form a complex and express the P-transposase of yellow fruit flies. Helper vector (pπ25.7wc2-3) was added to 40% (w / v) of the purified plasmid DNA, and then the same amount of GenePOPTER ^™ transfection reagent was added and the PBS solution was mixed and left at room temperature for 30 minutes. do.

Step 4: administer DNA to the mouse

The average weight of 26g mice aged 10-12 weeks is filled with the DNA / liposome complex prepared in the third step in the Needless jet injector (Madajet XL) and injected into the hind limb of the mouse by a pressure injection method. During the period, cervical dislocation was used to prepare a sample, and the skin of the administration site was scraped off, and skin tissue was cut with sterile scissors.

5th step: X-gal staining

The skin tissues cut in step 4 were washed in PBS buffer and fixed at 4 ° C. for 30 minutes in fixed solution (2% Paraformaldehyde, 0.2% glutaraldehyde in 0.1M sodium phosphate buffer, pH 7.3). X-gal solution (1.3 mM MgCl _2, 3 mM K ₄ Fe (CN) _6, 1 mg / mL X-gal, 0.1M sodium phosphate buffer, Ph 7.3) was prepared immediately before use and 3 hours at 37 ° C. Soak. In order to compare lac Z expression in skin tissues, only mice were injected with liposomes, stained in the same manner as above, and observed under a microscope.

As a result of microscopic observation, when the plasmid vector without promoter (pUC 4.3Z) was administered, it was expressed at low concentration only up to 5 days and appeared light blue when stained with X-gal. On the other hand, when the pUCK-Z vector containing K 14 promoto was administered, β-galactosidase gene was strongly expressed up to 5-6 weeks as shown in FIG. It lasted up to 20 weeks. In addition, tissue specificity by enhancement of the K 14 promoter was shown.

6th step: H / E (Hematoxylin / Eosin) dyeing

The skin tissue shown blue in Example 5 was washed twice in PBS and fixed in formalin for H / E (Hematoxylin / Eosin) staining. Fixing was carried out for 16 hours to 3 days, and performed by the general H / E staining method, the section was carried out to a thickness less than 10um.

As shown in FIG. 3, when the pUCK-Z vector was administered, β-galactosidase gene was expressed in the keratinocyte layer, indicating tissue specificity, and persisted strongly from 4 days to 5-6 weeks.

Step 7: Extract Mouse Genomic DNA

Cut the mouse skin, chop it in tail tip buffer (60 mM Tris pH 8.0, 100 mM EDTA, 0.5% SDS), mix, add 600 uL of tail tip buffer, then treat RNase A (20 mg / mL) and at 37 ° C. It was left for 30 minutes. Proteinase K was added to 500 µg / ml and reacted at 50 to 55 ° C. After centrifugation at 20 ° C. and 12000 rpm for 30 minutes, the intermediate layer was removed and recentrifuged. The upper layer was treated with 3 phenol / chloroform and 1 chloroform and centrifuged at 10,000 rpm for 20 minutes at 20 ° C. 1/10 of 3M NaOAc was added, ethanol precipitated and dried. The pellet was dissolved in TE buffer, diluted to 1/5000, and the O.D value was measured at 260 nm.

Step 8: PCR screening for confirmation of β-galactosidase insertion on chromosomes

In order to confirm the insertion of the lac Z gene on the mouse chromosome, genomic DNA was extracted and PCR from the administration site (radius 2 cm) of the skin tissue of the mouse 5 to 4 weeks old by the method of step 7 above. The identification of lac Z was performed using the following primers, and the PCR product was estimated to be about 3110 bp. PCR reactions were carried out under the conditions shown in Table 1.

lacZ forward-5 'TCACTCTAGAAACAGCTCTGA 3'

lacZ reverse-5 'TCGACCCGGTTATTATTA 3'

PCR reaction concentration and condition of lacZ gene Reaction concentration primer 10 pmol (lac5 ', lac3') Estimated Size of PCR Product 3110 bp Reaction volume 20 uL Ex Taq 0.5 unit 10 × Ex Taq Buffer 2 uL Template DNA concentration 50 pmol dNTPs 200 umol PCR reaction condition 1 cycle 35 cycles 1 cycle Denaturation annealing extension 90 ° (180 sec) 52 ° (60 sec) 72 ° (60 sec) 94 ° (30 sec) 52 ° (60 sec) 72 ° (60 sec) 94 ° (60 sec) 52 ° (60 sec) 72 ° (60 sec)

As a result, as shown in FIG. 4, 3100 bp PCR products were amplified in five samples (5 to 4 weeks), and it was confirmed that β-galactosidase gene was inserted onto the mouse chromosome.

Step 9: Southern blotting to confirm insertion of β-galactosidase on the chromosome

Southern blots were performed using pUCK-Z DNA as a positive control and mice administered with β-galactosidase expression vector, mice not administered as a negative control. Electrophoresis on 0.8% agarose gel, 1 × TAE, transfer to Hybond N + membrane, dry at 80 ° C for 2 hours, hybridization buffer (5 × SSC, 1/20 diluted liquid block, 0.1 % SDS, 5% Dextran sulphate) and hybridized using a probe labeled [α- ³² P] dCTP. After hybridization, wash with 2 × SSC, 0.1% SDS at 42 ℃ for 10 minutes, then wash again with 1 × SSC, 0.1% SDS for 10 minutes at 42 ℃, and finally at 1 × SSC, 0.1% SDS at 65 ℃ Rinse twice for a minute.

As a result, as shown in Fig. 5, the band is unclear from 5 days to 1 week of administration but the rest of the band is clear, confirming that the β-galactosidase gene by the transferase expressed in the helper vector is inserted on the mouse chromosome. Could.

Example 1 Preparation of Insulin Expression Vectors of the Invention

PCR primers as shown in Table 2 were prepared from the known human preproinsulin gene and the nucleotide sequence of the K 14 promoter region, and PCR amplification using the primers was then cloned into pUChsneo and pGEM T-easy vectors, respectively. As shown in the vector schematic diagram of the vector, a Sal I site was inserted into pUChsneo to prepare an insulin expression vector and named pUCK14-INS.

K14 promoter and insulin gene primer for producing insulin expression vectors. primer Sequence Insulin forwardinsulin reverse 5'CCTGCCTGTCTCCCAGAGCTCTGTCCTTCT 3'5'GCAGGGCTGGTTCTAGAGCTTTATTCCATC 3 ' K 14 promoter forwardk 14 5'ATTGCTGAAGTTTTGATCTAGACACCTCCA 3'5'CTGAGTGAAGAGAAGGAGCTCGGGTAAATT 3 '

The insulin expression recombinant vector pUCK14-INS of the present invention was deposited with the accession number KCTC 0928BP to the Bank of Biotechnology on January 10, 2001.

Example 2 Sequence Analysis of Insulin Vectors

The insulin vector prepared in Example 1 was purified by QUAGEN Plasmid mini and sequenced by ABI Prism 377 XL. The analysis results are shown in FIG. 7.

The K 14 promoter is linked to the Sac I site and consists of proinsulin peptide B, proinsulin peptide C, proinsulin peptide A and intron 790 bp of the C-chain.

Example 3 Induction of Diabetes in Mice and Changes in Blood Glucose When Administered Insulin Expression Vectors of the Invention

Streptozotocin (STZ) was dissolved in cold 0.1M citrate solution (ph4.5) and then administered to mice at concentrations of 65 mg / kg and 200 mg / kg to induce diabetes. DNA injection after STZ treatment was repeated at 4 day intervals and changes were analyzed by blood glucose measurement.

Blood samples were measured by dropping a drop of blood from the tail of the rat onto a Glucocard test strip and placing it in a blood glucose meter (Super Glucocard ^TM Ⅱ).

As a control, the blood glucose of normal mice was measured every 2 hours, and the blood glucose ranged from 65 mg / dL to 145 mg / dL and the mean blood sugar was 105 mg / dL.

In order to induce diabetes in the mice, streptozotocin (STZ) was administered to 10 times to 65 mg / kg and 200 mg / kg, and blood glucose was measured every time and is shown in Table 3. As described above, 4 days after streptozotocin (STZ) treatment, insulin vectors were administered at 1 μg, 2 μg, 3 μg and 10 μg, 50 μg, 100 μg, and blood glucose was measured by administering 4 objects per group.

As a result of administering the insulin vector, as shown in Tables 4 and 5 and FIGS. 8A and 8B, the blood glucose level was observed to decrease dose-dependently, and the reaction was repeated depending on the number of times while repeatedly administering 65 mg / kg STZ and the insulin vector. The hypoglycemic effect was reduced and the hypoglycemic effect of the insulin vector continued. In addition, in the mouse group administered with STZ at a concentration of 200 mg / kg, the blood glucose level rapidly increased in a relatively short time, and diabetes was induced, and the insulin vector also had a dose-dependently lowering effect.

Blood Glucose Levels in Diabetic Mice Induced by Streptozotocin Dose (mg / kg) Number of doses Blood glucose level (mg / dl) 65 0 105 65 1,2 119,128 65 3.4.5 130,238,280 65 6 320 65 10 More than 600 200 0 105 200 1,2 339,448 200 3.4.5 574, 600,600 or more 200 6 More than 600 200 10 More than 600

Changes in blood glucose levels when insulin vectors were administered to diabetic mice treated with STZ 65 mg / kg Blood glucose level before treatment (mg / dl) Blood Sugar Value After Treatment (mg / dl) Insulin vector 2 μg insulin vector Insulin vector 150 116 147 121 200 148 99 114 300 105 121 263 400 196 204 215 500 207 245 234 600 328 342 344

Changes in blood glucose levels when insulin vector was administered to diabetic mice treated with STZ 200 ㎎ / ㎏ concentration Blood glucose level before treatment (mg / dl) Blood Sugar Value After Treatment (mg / dl) Insulin vector 50 μg insulin vector Insulin vector 100 µg 150 76 62 61 200 138 99 68 300 58 182 108 400 293 * * 500 300 * * 600 375 * * * When the insulin expression vector was administered at 50 µg / uL and 100 µg / uL, blood glucose level was not higher than 320 mg / dl in all groups and maintained between 85 and 120 mg / dl.

Example 5: Immunohistochemistry of Langerhans Island

The pancreas of normal mice, 65 mg / kg, 200 mg / kg STZ-induced diabetic mice, mice administered with 1 μg, 50 μg, 100 μg insulin vector were isolated and fixed in 10% formalin fixed solution. Immunostaining and H / E (Hematoxylin / Eosin) staining were performed using anti-insulin Ab, anti-glucagon Ab, and anti-somatostatin Ab to analyze the presence of Langerhans island and insulin-producing β cells.

As a result, as shown in FIG. 9, mice whose blood glucose levels recovered normally after administration of the vector were selected, and the beta-cells producing insulin of the pancreas were observed. As a result, the number of islands of Langerhans was significantly reduced or almost absent. Had. Immunoassay was performed using anti-insulin Ab, anti-glucagon Ab, and anti-somatostatin Ab to see which of the remaining cells of α, β, and δ cells of the Langerhans island. As shown, almost β cells were absent, the site was mostly filled with α cells, and δ cells were distributed at the edges. Thus, it was concluded that insulin produced in keratin cells lowers blood glucose levels by expression of an insulin vector administered in place of pancreatic insulin cells in mice whose blood glucose levels, which were induced by STZ and returned to normal levels, returned to normal.

As described above, the recombinant insulin vector of the present invention cloned from the K14 promoter and the human insulin gene, together with the helper vector expressing the yellow Drosophila P-transferase, was subjected to the skin by liposome method and pressure injection method. As a result of administration to the tissue, the expression of the insulin vector is very useful in the pharmaceutical industry because the insulin produced from keratinocytes provides a recombinant vector for treating insulin dependent diabetes mellitus by treating the insulin dependent diabetes mellitus. It is an invention.

Claims (7)

delete delete delete A non-virus having the nucleotide sequence of SEQ ID NO: 1 constructed by PCR with an insulin gene primer (I) and a K 14 promoter primer (II) having the following nucleotide sequence and then inserting the amplified insulin gene and the K 14 promoter into pUChsneo A composition for the treatment of insulin-dependent diabetes mellitus, characterized in that a liposome is put into a sex insulin expression vector pUCK14-INS (Accession No. KCTC 0928BP) to make a mixture, and then a helper vector expressing the transferase of yellow fruit flies is added and contained as an active ingredient. . Insulin forward: 5'CCTGCCTGTCTCCCAGAGCTCTGTCCTTCT 3'5'GCAGGGCTGGTTCTAGAGCTTTATTCCATC 3 ' ---- (I) K 14 promoter forward: k 14 promoter reverse: 5'ATTGCTGAAGTTTTGATCTAGACACCTCCA 3'5'CTGAGTGAAGAGAAGGAGCTCGGGTAAATT 3 ' ---- (Ⅱ) delete A method for treating insulin-dependent diabetes in mammals other than humans, characterized in that the composition for treating insulin-dependent diabetes according to claim 4 is administered to the skin tissue by autoinjection. The method of claim 6, wherein the method for treating diabetes mellitus is characterized in that the insulin gene is specifically expressed in keratinocytes (Keratinocytes) of hepatocytes using a K14 promoter.