KR20200132740A - Composition for preventing or treating Gout comprising stem cells overexpressing Uricase - Google Patents

Abstract

The present invention relates to a composition for preventing or treating gout containing stem cells overexpressing uricase as active components. It is confirmed that mesenchymal stem cells transformed with a minicircle vector comprising a gene encoding an uricase protein according to the present invention overexpresses uricase in vitro, and also confirmed that uricase-expressing mesenchymal stem cells effectively inhibit inflammation when the uricase-expressing mesenchymal stem cells is administered to a mouse model administered with a high concentration of uric acid crystals. Thus, the composition of the present invention can be usefully used as a composition for preventing or treating acute gout or chronic nodular gout.

Description

Composition for preventing or treating gout comprising stem cells overexpressing uric acidase as an active ingredient {Composition for preventing or treating Gout comprising stem cells overexpressing Uricase}

The present invention relates to a composition for the prevention or treatment of gout comprising stem cells overexpressing urate enzyme as an active ingredient, and more particularly, to a minicircle vector comprising a gene encoding a uricase protein. It relates to a composition for preventing or treating acute gout or chronic nodular gout comprising transformed mesenchymal stem cells and the mesenchymal stem cells as an active ingredient.

Gout is a disease in which urate crystals are deposited in the cartilage, tendons, and surrounding tissues of joints as the concentration of uric acid in the blood increases. The deposition of urate crystals induces joint inflammation, causing recurrent seizures with extreme pain, and as tophi is deposited, joint deformity and disability occur. In addition to joint abnormalities, nephrolithiasis (nephrolithiasis), which causes various kidney diseases and stones in the kidneys due to uric acid, may also appear.

As the last metabolite of purine, uric acid is synthesized in the liver and small intestine, which has an enzyme called xanthine oxidase, and exists as monosodium urate, an ionized form of uric acid in plasma, body fluids, and joint fluids. 2/3 to 3/4 of urate is excreted through the kidneys and the rest is excreted through the intestine. Hyperuricemia in which the concentration of uric acid in the blood exceeds 7.0 mg/dL can be divided into cases where uric acid is excessively produced and uric acid excretion is decreased. Gout occurs mainly in men, because men's ability to remove uric acid from the kidneys decreases with age, whereas women's ability to remove uric acid from the kidneys is maintained until menopause under the influence of female hormones.

Gout can be divided into acute gout and chronic gout.Acute gout starts with mild symptoms from the beginning, and usually shows extreme pain and swelling symptoms accompanied by heat in both big toes.It is more severe at night, alcohol, intense exercise, Dehydration, surgery, bleeding, trauma, excessive medications that affect uric acid excretion, and other factors that cause remission and recurrence are repeated. Chronic nodular gout, gouty nephropathy, which causes white toothpaste-like nodules. Loss of function and even deformity occurs

Colchicine, nonsteroidal anti-inflammatory drugs, and steroids, which are representative drugs used for gout patients with severe pain, have been reported to suffer from complications such as metabolic syndrome and kidney disease and shorten their lifespan due to side effects from drugs. In addition, the treatment of chronic gout is treated with the concept of management rather than the concept of cure, and if there are two or more acute gout attacks, uric acid-lowering drugs are used, and there is a refractory gout that is not controlled even with the administration of these uric acid-lowering drugs. In the case of chronic nodular gout, it may take several years or more to be removed with drug treatment. Therefore, there is a need to develop a new gout treatment that has no side effects and is excellent in effect.

Mesenchymal stem cells (MSCs) are being studied as therapeutics for various diseases due to their immunomodulatory, anti-inflammatory and regenerative effects, and mesenchymal stem cells engineered with specific genes have been reported to have improved therapeutic effects. Yes (Republic of Korea Patent Publication No. 10-2018-0072644; Republic of Korea Patent Publication No. 10-2012-0018724; Dai, F. et al. , Tissue Eng. , 12 : 2583-2590, 2006). With regard to the technology of gene delivery to stem cells, non-viral gene delivery technology is attracting attention as a safe method. This is because commercial DNA vector plasmids contain sequences derived from bacteria, and thus an immune response against bacterial proteins can be induced. For this, a mini-circle vector can be used. The mini-circle vector refers to a vector having a relatively small size by removing an antibiotic resistance gene, a gene encoding a bacterial structural protein, and a transcription unit gene. The minicircle vector has the advantage of being small in size and avoiding the immune response, as well as the ability to express foreign genes at high levels in vitro and in vivo , which can have advantages in preclinical gene therapy studies. It is attracting attention.

Accordingly, in the present invention, as a result of earnest efforts to develop a gout therapeutic agent with no side effects and excellent effect, mesenchymal stem cells transformed with a minicircle vector containing a gene encoding a uric acid enzyme protein were prepared. It was confirmed that the mesenchymal stem cells prepared in the present invention express uric acidase in vitro, and as a result of administering urate-expressing mesenchymal stem cells to a mouse model administered with a high concentration of uric acid crystals, it effectively suppresses inflammation. It was confirmed, and the present invention was completed.

An object of the present invention is a mesenchymal stem cell transformed with a minicircle vector containing a gene encoding a uricase protein, and a pharmaceutical for the prevention or treatment of gout comprising the mesenchymal stem cell as an active ingredient To provide a composition.

To achieve the above object,

The present invention comprises (a) a promoter, a gene encoding a uricase protein, and a gene expression cassette comprising a transcription terminator,

(b) containing the att attachment sequence of the bacteriophage lambda, located outside the gene expression cassette of (a); And

(c) It provides a stem cell overexpressing a uric acid degradation enzyme into which a non-viral vector that does not contain a replication initiation point and an antibiotic resistance gene is introduced.

In a preferred embodiment of the present invention, the gene encoding the uric acidase protein may include the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2.

In another preferred embodiment of the present invention, the promoter of step (a) is a CMA promoter, and the transcription terminator may include an SV40 polyadenylation sequence.

In another preferred embodiment of the present invention, the stem cells may be mesenchymal stem cells, and the mesenchymal stem cells may be bone marrow-derived mesenchymal stem cells.

The present invention also provides a pharmaceutical composition for preventing or treating gout comprising the mesenchymal stem cells as an active ingredient.

In a preferred embodiment of the present invention, the gout may be acute gout or chronic nodular gout.

The mesenchymal stem cells transformed with the minicircle vector containing the gene encoding the uric acidase protein of the present invention not only confirmed that uric acidase was overexpressed in vitro, but also uric acid in a mouse model administered with a high concentration of uric acid crystals. As a result of administration of the mesenchymal stem cells expressing the degrading enzyme, it was confirmed that it effectively suppressed inflammation, so it can be usefully used as a composition for preventing or treating acute gout or chronic nodular gout.

1 is a schematic diagram of the production of mesenchymal stem cells overexpressing the uric acid degradation enzyme of the present invention.
2 is a gel image (A) of a parental plasmid and a minicircle vector into which a gene encoding a uric acidase protein was introduced, and a restriction enzyme was treated to confirm whether a uric acidase was inserted into the minicircle vector. It is data (B).
3 is data confirming the expression level of uric acidase when a minicircle vector into which a gene encoding a uric acidase protein is introduced is transformed into HEK293T cells. A is a photograph of cells observed under a fluorescence microscope, B is data showing transformation efficiency, and C is data confirming the uric acid degradation ability according to the expression of uric acid enzyme.
Figure 4a is a minicircle vector into which a gene encoding a pegloticase is introduced, Figure 4b is a minicircle vector into which a gene encoding a Rasburicase is introduced, a mesenchymal stem cell under various conditions This is the data confirming the transformation efficiency and cell viability when transformed into.
5 is data confirming the concentration of the uric acid digesting enzyme contained in the culture medium of the mesenchymal stem cells overexpressing the uric acid digesting enzyme according to the transformation conditions.
6 is data confirming the level of mRNA expression of the uric acid degradation enzyme and stem cell marker expressed in mesenchymal stem cells overexpressing the uric acid degradation enzyme. A is data confirming the mRNA expression level using PCR, and B is data showing the relative expression level of GAPDH.
7 is data confirming the uric acid decomposition ability of mesenchymal stem cells overexpressing the uric acid decomposing enzyme.
8 is data confirming the phenotype of mesenchymal stem cells overexpressing uric acid degradation enzymes as stem cells.
9 is a photograph of observing the cell shape of mesenchymal stem cells (MSC) and mesenchymal stem cells (eMSC) overexpressing uric acid degradation enzymes in an inflammatory environment (IL-1b, IFN-γ, TNF-α).
Fig. 10 Anti-inflammatory genes of mesenchymal stem cells (MSC) and mesenchymal stem cells (eMSC) overexpressing uric acid degradation enzymes in an inflammatory environment (IL-1b, IFN-γ, TNF-α) This is the data confirming the level of mRNA expression.
11 is data confirming the efficacy of inhibiting acute inflammation when mesenchymal stem cells overexpressing uric acid decomposing enzymes were administered twice. A is a photograph of the sole of a mouse after one injection of stem cells (7 days) and two injections of MSU + stem cells (14 days), and B is data showing the thickness of the sole after MSU administration.
FIG. 12 is data (A) observed by immunochemical staining of the footpad tissue of a mouse administered with mesenchymal stem cells overexpressing uric acid decomposing enzyme, and data (B) showing the degree of inflammation through staining. .
13 is data confirming the expression level of inflammatory cytokines TNFα and IL-1β in the footpad tissues of mice administered with mesenchymal stem cells overexpressing uric acid degradation enzymes (A) and expression of TNFα and IL-1β These are data obtained by quantifying the degree (B and C).
14 is data showing the size of injected high concentration uric acid crystals according to administration of mesenchymal stem cells overexpressing uric acid decomposing enzymes in an inflammatory mouse model.
FIG. 15 is a data showing the size of injected high concentration uric acid crystals according to administration of mesenchymal stem cells overexpressing uric acid decomposing enzymes in an inflammatory mouse model.

Hereinafter, the present invention will be described in detail.

The present invention from a point of view,

(a) a promoter, a gene encoding a uricase protein, and a gene expression cassette comprising a transcription terminator,

(b) containing the att attachment sequence of the bacteriophage lambda, located outside the gene expression cassette of (a); And

(c) It relates to a stem cell overexpressing a uric acid degradation enzyme into which a non-viral vector that does not contain a replication initiation point and an antibiotic resistance gene is introduced.

In the present invention, the gene encoding the uric acid degrading enzyme protein may include the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2.

SEQ ID NO: 1 is a gene encoding Rasburicase, and SEQ ID NO: 2 is a gene encoding pegloticase. In the present invention, rasburicase and peclodicase were used among uric acid degradation enzymes, but genes encoding various known uric acid degradation enzymes or genes encoding novel recombinant uric acid degradation enzymes were used in non-viral vectors depending on the purpose. It can be introduced and used.

The non-viral vector refers to a "minicircle vector", and the minicircle vector refers to a vector having a relatively small size by removing an antibiotic resistance gene, a gene encoding a bacterial structural protein, and a transcription unit gene.

The term "stem cell" used in the present invention refers to a cell that has the ability to differentiate into various cells and has the ability to self-proliferate, and embryonic stem cells isolated from early embryos, primitive reproduction of embryonic stages Includes embryonic germ cells isolated from cells and multipotent adult stem cells isolated from adult bone marrow.

Stem cells usable in the present invention include all pluripotent stem cells derived from mammalian embryos or fetuses, cord blood, or adult tissues such as adult organs or bone marrow, skin or blood, and traits similar to embryonic stem cells. It includes stem cells having In this case, the term "an embryonic stem cell-like trait" means that an embryonic stem cell has a specific surface (antigen) marker, expresses an embryonic stem cell-specific gene, or has a teratoma-forming function, Alternatively, it can be defined as a cell biological property specific to embryonic stem cells, such as having the ability to form chimeric mice. Examples of adult stem cells include mesenchymal stem cells, hematopoietic stem cells, neural stem cells, and fat stem cells. In the present invention, mesenchymal stem cells were preferably used, more preferably bone marrow-derived mesenchymal stem cells.

The present invention introduces a gene encoding a uric acid-degrading enzyme protein having a therapeutic effect on acute gout or chronic nodular gout into stem cells, transfers it to a diseased site in the body, and expresses it at the site, thereby degrading the existing protein therapy in vivo. Accordingly, problems such as a reduction in half-life and a decrease in physiological activity can be solved, problems of delivery efficiency and stability of existing gene therapy agents can be solved, and therapeutic effects can be continuously and stably supplied.

In addition, in the present invention, in order to solve both problems of biological stability such as immunogenicity of viral vector systems that have been used for gene therapy, and problems of delivery efficiency of non-viral vector systems, therapeutic genes are used as target cells. A vector system with high biological safety and high biological safety was applied to stem cells, which can efficiently deliver to and express therapeutic genes for a long time.

Specifically, the vector system of the present invention includes a gene expression cassette composed of only minimal essential elements such as a promoter, a gene encoding a uric acid degradation enzyme, and a transcription terminator, and the replication initiation point and antibiotic resistance used in the existing vector system. It is characterized in that it does not contain a selection marker gene such as a gene.

The starting point of replication is a sequence mainly derived from bacteria and can cause unnecessary immune reactions in the human body, and selection marker genes such as antibiotic resistance genes can be transmitted to bacteria existing in the body. If administered, there is a problem that can cause unnecessary antibiotic resistance. Accordingly, in the present invention, by not including the replication initiation point and the selection marker gene, unnecessary problems of immune response and antibiotic resistance can be eliminated. In addition, it is possible to reduce the immune response by removing the unmethylated CpG motif derived from prokaryotic cells. In addition, due to this, the vector of the present invention has a smaller physical size than that of the conventional vector, so that it is easy to manufacture, increase delivery efficiency, and improve biological stability.

The vector of the present invention is characterized by being a double-stranded DNA in the form of a circular supercoil.

The promoter used in the vector of the present invention may be a promoter used in the art without particular limitation, may include an inducible or constitutive promoter, and preferably may be a CMV (cytomegalovirus) promoter.

The transcription terminator used in the vector of the present invention may be a terminator used in the art without particular limitation, but may preferably include a SV40 polyadenylation sequence.

The vector of the present invention further includes a site specific recombination outside of a gene expression cassette composed of a promoter, a gene encoding a uric acid degradation enzyme, and a transcription terminator.

The site-specific recombination region refers to a region in which recombination can occur between two specific nucleotide sequences on DNA, and the gene cloning method using this site-specific recombination region is a conventional method using a restriction enzyme and a ligase. It is useful as a genetic manipulation method that can replace. Preferably, the site-specific recombination region in the present invention is an att attachment sequence derived from E. coli or bacteriophage lambda, and may be a substrate sequence of attB or attP, or a hybrid sequence of attR or attL.

In the present invention, the vector expressing the uric acid degrading enzyme is a number of known methods, for example, transient transfection, microinjection, transduction, electroporation, DEAE Dextran mediated transfection , Monocationic liposome fusion, polycationic liposome fusion, protoplast fusion, lipofectamine, and naked DNA delivery, etc., and can be introduced into cells or tissues.

In a specific embodiment of the present invention, in order to prepare a minicircle vector into which a gene encoding a uric acid degradation enzyme protein was introduced, a minicircle vector expressing a uric acid degradation enzyme protein was prepared in the same manner as the schematic diagram of FIG. 1, The gene encoding the uric acid degradation enzyme protein was used as a gene encoding Rasburicase of SEQ ID NO: 1 and a gene encoding Pegloticase as SEQ ID NO: 2.

As a result of checking the size of the parental plasmid and minicircle vector into which the gene encoding the uric acidase protein was introduced, it was confirmed that the approximate size of the minicircle vector into which the uric acidase protein was introduced is 4 kb ( 2A), as a result of checking by electrophoresis after cutting with a restriction enzyme, the size of rasburicase was 957 bp, and the size of pegloticase was 966 bp (FIG. 2B).

In addition, as a result of confirming whether the uric acid-degrading enzyme protein inserted into the minicircle vector can be significantly expressed in cells, as shown in FIG. 3, transformation with the minicircle vector into which the gene encoding the uric acid-degrading enzyme protein was introduced It was confirmed that uric acid degrading enzyme was normally expressed in the HEK293T cells, and as a result of confirming whether uric acid was degraded by the generated uric acid degrading enzyme, it was confirmed that the uric acid concentration was decreased compared to the control.

In another specific embodiment of the present invention, the minicircle vector into which the gene encoding the uric acid degrading enzyme protein produced in the present invention was introduced was transformed into mesenchymal stem cells using an electroporation method (hereinafter , "eMSC" is used interchangeably).

4A and 4B show the transformation efficiency when mcPegloticase and mcRasburicase were transformed under various conditions, and it was confirmed that the optimal transformation efficiency was different depending on the type of uric acid degradation enzyme, and both minicircles were pulsed in consideration of cell viability. voltag 1400, Pulse width 20, Pluse no. Transformation was performed under two conditions. As shown in FIG. 5, it was confirmed that uric acid-degrading enzyme was generated in the culture medium of mesenchymal stem cells when transformed under the above conditions.

6 is a check of the mRNA expression level of the uric acid decomposing enzyme and stem cell marker expressed in the mesenchymal stem cells, and it was confirmed that the marker gene of the mesenchymal stem cell was significantly expressed, and encoding the uric acid decomposing enzyme protein. It was confirmed that the mRNA of the gene was significantly expressed.

In addition, as a result of confirming the degree of uric acid degrading enzyme in the culture medium of mesenchymal stem cells overexpressing uric acid degrading enzyme, statistically significant uric acid reduction in the culture medium of mesenchymal stem cells introduced with Rasburicase or Pegloticase. Was observed (Fig. 7). In order to confirm the phenotype of mesenchymal stem cells overexpressing uric acid degradation enzymes as stem cells, the expression of positive (CD73, CD105) and negative (CD34, CD45) markers of mesenchymal stem cells was confirmed. As a result, it was confirmed that the phenotype of the transformed mesenchymal stem cells was maintained as it was when compared with non-transformed general mesenchymal stem cells (FIG. 8).

In another specific embodiment of the present invention, as a result of confirming whether the uric acid-degrading enzyme overexpressing mesenchymal stem cells exhibit an anti-inflammatory effect in an inflammatory environment (IL-1b, IFN-γ, TNF-α treatment), apoptosis is inhibited. It was confirmed (Fig. 9). In addition, it was confirmed that the mesenchymal stem cells overexpressing uric acid degradation enzymes did not affect the mRNA expression of NLRP3, which is a pro-inflammatory mechanism, but anti-inflammatory genes IL-1RN, IL-10, and TGF- It was confirmed that the mRNA expression of β was significantly increased (Fig. 10).

In yet another specific embodiment of the present invention, uric acid degrading enzyme overexpressing mesenchymal stem cells (eMSC) are first injected into the blood vessels of mice twice every 7 days prior to administration of MSU, and then MSU is injected into the hind paws of the mouse to obtain acute A ventilated mouse model was created.

As a result, it was confirmed that acute inflammation was suppressed in the group administered with stem cells compared to the group administered with high concentration uric acid crystals (control group) (FIG. 11). As a result of observing the footpad tissue of the mouse administered with the mesenchymal stem cells overexpressing uric acid degradation enzyme by immunochemical staining, it was confirmed that tissue necrosis and inflammation were reduced compared to the control group (Fig. 12), and the inflammatory cytokine expression was also It was confirmed that it decreased (Fig. 13).

In yet another specific embodiment of the present invention, in order to confirm the efficacy of treating chronic gout with uric acid-degrading enzyme overexpressing mesenchymal stem cells (eMSC), high concentration uric acid crystals (MSU) are injected by subcutaneous injection, and then injected 7 days later. MSC or uric acid degradation enzyme overexpressing mesenchymal stem cells (eMSC) were injected into the MSU site. As a result, in the case of the MSU alone administration group, it was confirmed that the injected MSU was maintained continuously (FIG. 14). On the other hand, in the case of the mcRasburicase-MSC and mcPegloticase-MSC administration group, it was confirmed that the MSU size was significantly reduced (FIG. 15).

That is, it was confirmed that the mesenchymal stem cells overexpressing the uric acid degradation enzyme of the present invention can continuously and stably express the uric acid degradation enzyme, and effectively reduce the inflammation caused by gout due to the uric acid degradation enzyme expressed in stem cells. This is because when the uric acid-degrading enzyme overexpressing mesenchymal stem cells prepared in the present invention are applied to acute or/and chronic nodular gout, it can effectively degrade uric acid as well as improve inflammation, so acute or/and chronic nodular gout It can be usefully used in the prevention and treatment of

Accordingly, in another aspect, the present invention relates to a pharmaceutical composition for preventing or treating gout comprising the mesenchymal stem cells as an active ingredient.

In the present invention, the gout may be characterized in that acute gout or chronic nodular gout.

The composition of the present invention may contain a pharmaceutically acceptable carrier. The composition including a pharmaceutically acceptable carrier may be in various oral or parenteral formulations. In the case of formulation, it is prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants that are usually used. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and these solid preparations include at least one excipient in one or more compounds, such as starch, calcium carbonate, sucrose, or lactose ( lactose), gelatin, etc. In addition, in addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral administration include suspensions, liquid solutions, emulsions, and syrups.In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as humectants, sweeteners, fragrances, and preservatives may be included. have. Preparations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, and suppositories. As the non-aqueous solvent and suspension, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate may be used. As a base for suppositories, witepsol, macrogol, tween 61, cacao butter, laurin paper, glycerogelatin, and the like may be used.

The composition of the present invention is administered in a pharmaceutically effective amount. The term "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is the type and severity of the subject, age, sex, type of infected virus, and Activity, sensitivity to drugs, time of administration, route of administration and rate of excretion, duration of treatment, factors including drugs used concurrently, and other factors well known in the medical field. However, for a desirable effect, the compound of the present invention is preferably administered at 0.0001 to 1000 mg/kg per day, preferably 0.001 to 100 mg/kg. The composition of the present invention may be administered as an individual therapeutic agent or administered in combination with other therapeutic agents, and may be administered sequentially or simultaneously with a conventional therapeutic agent. And can be administered single or multiple. It is important to administer an amount capable of obtaining the maximum effect in a minimum amount without side effects in consideration of all the above factors, and can be easily determined by a person skilled in the art.

The administration route of the composition may be administered through any general route as long as it can reach the target tissue. The composition of the present invention may be administered intraperitoneally, intravenously, intramuscularly, subcutaneously, intradermal, oral, intranasal, intrapulmonary, or rectal, as desired, but is not limited thereto. In addition, the composition can be administered by any device capable of moving the active substance to the target cell.

Hereinafter, the present invention will be described in more detail through examples.

These examples are for illustrative purposes only, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not construed as being limited by these examples.

Preparation of minicircle vector into which the gene encoding the uric acid enzyme protein is inserted

1-1: Preparation of minicircle vector expressing uric acid degradation enzyme

In order to induce the expression of uric acid decomposing enzyme in the present invention, a minicircle vector was prepared in the same manner as in FIG. 1.

Specifically, a gene encoding Rasburicase represented by the nucleotide sequence of SEQ ID NO: 1 and a gene (cDNA) encoding pegloticase represented by the nucleotide sequence of SEQ ID NO: 2 were used. Each of the above genes was inserted into a parental plasmid (CMV-MCS-EF1-RFP-SV40-PolyA; Manufacturer: System Biosciences, Mountain View, USA), which is a mock vector. Upon insertion, the uric acid degrading enzyme sequence was inserted into the sequence between XbaI and BamHI in the multiple cloning site present under the CMV promoter to prepare a parent vector containing the growth factor gene. Each parent vector (ppRasburicase, ppPegloticase) containing Rasburicase or Pegloticase was transformed into ZYCY10P3S2T E.coli cells, respectively. The transformed cells were separated into a single colony unit, inoculated into 2 ml of LB medium containing 500 μg/ml kanamycin, and initially cultured at 30° C. for 2 hours. Then, 200 ml terrific broth (TB) was added to a 1 liter culture flask, and 100 µl of the initially cultured medium was inoculated, followed by incubation for 15 hours at 30° C. with shaking at 200 rpm. In order to convert the parent vector plasmid into a minicircle vector after cultivation, 200 ml of LB medium containing 200 μl of 4% 1N NaOH and 20% L-arabinose was added to the culture flask. The flask to which the medium was added was cultured again at 30° C. at 200 rpm for 5 hours. After completion of the culture, cells were obtained and plasmid DNA was extracted using a NucleoBond Xtra plasmid purification kit (Macherey-Nagel, Duren, Germany). The extracted DNA was double-cut with XbaI and BamHI to confirm the size of the minicircle and the inserted Rasburicase or Pegloticase gene. Each vector into which Rasburicase or Pegloticase was inserted was named mcRasburicase and mcPegloticase. In order to prepare a negative control, a minicircle vector (mcMock) was prepared in the same manner using a parental plasmid (ppMock) to which Rasburicase or Pegloticase was not inserted.

As a result, as shown in FIG. 2A, it was confirmed that the approximate size of the minicircle vector into which the uric acid decomposing enzyme was introduced was 4 kb and mcMock was 3 kb, and as shown in FIG. 2B, after digestion with a restriction enzyme As a result of electrophoresis, mcRasburicase was shown as two bands: a Rasburicase gene of 957bp and a minicircle of about 3kb, and mcPegloticase was a pegloticase gene of 966bp and a minicircle of about 3kb. It was confirmed that it appeared as two bands of.

1-2: Confirmation of transduction efficiency of uric acid degrading enzyme

To confirm whether rasburicase or pegloticase can exhibit significant expression activity when transduced into cells, the expression level of RFP (rhodamine) present together in mcRasburicase or mcPegloticase is measured. I did.

Specifically, in Opti-MEM medium (Thermo Fisher Scientific), mcRasburicase or mcPegloticase prepared in Example 1-1 was mixed with lipofectamine for 20 minutes. Then, the mixed vector-lipofectamine mixture was added to HEK293T cells and incubated for 6 hours in a 5% CO ₂ incubator at 37°C. After cultivation, the cells were examined for their morphology with a phase contrast microscope, and then the level of RFP expression in HEK293T cells was observed using a fluorescence microscope.

As a result, as shown in FIGS. 3A and 3B, it was confirmed that the uric acid digesting enzyme was normally expressed in HEK293T cells transformed with the minicircle vector into which the gene encoding the uric acid digesting enzyme protein was introduced.

In addition, a uric acid assay kit (abcam) was used to confirm the uric acid degradation enzyme present in the cell culture medium. Specifically, HEK293T cells transformed with mcRasburicase or mcPegloticase were recovered to a number of 5×10 ⁶ cells, and then centrifuged at 1100 rpm for 2 minutes to remove dead cells, and a culture medium supernatant was obtained. Then, 3 sets of the culture medium supernatant obtained above for each group were added to a container containing 40 nmol/ml uric acid using a uric acid assay kit, and then reacted at 37° C. for 30 minutes. Thereafter, an OD value of 570 nm was measured to measure the amount of undissolved uric acid.

As a result, as shown in FIG. 3C, when transformed with mcRasburicase or mcPegloticase, it was confirmed that the uric acid concentration decreased compared to the control group. That is, it was confirmed that the uric acid degrading ability of the uric acid degrading enzyme expressed in the transformed HEK293T cells was normally maintained.

Preparation of mesenchymal stem cells overexpressing uric acid degradation enzyme

2-1: Preparation of mesenchymal stem cells transformed with a minicircle vector expressing uric acid degradation enzyme protein

In the present invention, mcRasburicase or mcPegloticase prepared in Example 1-1 was transformed into mesenchymal stem cells to prepare mesenchymal stem cells overexpressing uric acid degradation enzymes.

Mesenchymal stem cells were used as bone marrow derived MSCs (passage 4) provided by the Catholic Central Medical Center's Cell Treatment Center, and mesenchymal stem cells are known to be difficult to transform, so the transformation efficiency is high. Mesenchymal stem cells were transformed with mcRasburicase or mcPegloticase using a high electroporation method.

Specifically, mesenchymal stem cells were inoculated into a culture vessel so that 1×10 ⁵ cells/well, and then mcRasburicase and mcPegloticase were added at 0.5 μg/μl, respectively. Thereafter, in order to establish the optimal transformation conditions, after transforming the cells under various conditions (Pulse voltag 850 ~ 1700, Pulse width 10 ~ 40, Pluse no. 1 ~ 3 times), the cells are subjected to the morphology of the cells under a phase contrast microscope. ), and then observed the RFP expression level in mesenchymal stem cells using a fluorescence microscope.

As a result, in the case of mcPegloticase, as shown in FIG. 4A, Pulse voltag 1400, Pulse width 20, Pluse no. 2 times condition and Pulse voltag 950, Pulse width 30, Pluse no. It was confirmed that the transformation efficiency was high in the two conditions. mcRasburicase, as shown in Figure 4b, Pulse voltag 1400, Pulse width 20, Pluse no. 2 times condition and Pulse voltag 1600, Pulse width 10, Pluse no. It was confirmed that the transformation efficiency was high in the three conditions.

However, since the electroporation method has a problem that the cell viability decreases, in consideration of this, the subsequent experiments are performed in both the mcPegloticase and mcRasburicase Pulse voltag 1400, Pulse width 20, Pluse no. Transformation was performed under two conditions.

2-2: Confirmation of uric acid degradation enzyme protein expression

In the present invention, it was attempted to confirm whether a uric acid digesting enzyme is actually synthesized in mesenchymal stem cells overexpressing a uric acid digesting enzyme.

The amount of uric acid degrading enzyme was measured using the Uricase ELISA kit, and the cell culture solution maintained for 3 days to overexpress the uric acid degrading enzyme was adjusted to pH 8.0 with 1N NaOH, and then performed according to the manual provided by the Uricase ELISA kit. I did. Uricase working regent and cell culture solution for each group were added to each well by 50 µl, and then, after 30 minutes, it was confirmed at 450 nm.

As a result, as shown in Fig. 5, it was confirmed that the uric acid-degrading enzyme was generated in the culture medium of the mesenchymal stem cells overexpressing the uric acid decomposing enzyme.

2-3: Confirmation of uric acid degradation enzyme mRNA expression

In the present invention, in order to confirm whether the uric acid degrading enzyme overexpressing mesenchymal stem cells prepared in Example 2-1 express uric acid degrading enzyme while maintaining the characteristics of the stem cell, the mRNA expression level of the uric acid degrading enzyme and the stem cell marker Confirmed.

First, mesenchymal stem cells overexpressing uric acid degrading enzyme were obtained, suspended in Trizol (Trizol, Thermo Fisher Scientific) to disrupt the cells, and mRNA was extracted. Using the extracted mRNA as a template, cDNA was synthesized with RevertAid ^TM First Strand cDNA synthesis kit (Thermo Fisher Scientific). Using the synthesized cDNA as a template again, PCR was performed for the MSC marker genes CD45, CD90, CD44, and CD105, Rasburicase, and Pegloticase to confirm the expression level of each gene. The same gene was repeated three times for quantitative analysis, and then each gene expression level value was corrected based on the level of GAPDH expression in the same cell.

Primer information for PCR Primer sequence (5'-3') order
number CD45 AGCACCTACCCTGCTCAGAA 3 TTCAGCCTGTTCCTTTGCTT 4 CD90 CTAGTGGACCAGAGCCTTCG 5 TGGAGTGCACACGTGTAGGT 6 CD44 AAGGTGGAGCAAACACAACC 7 AGCTTTTTCTTCTGCCCACA 8 CD105 CACTAGCCAGGTCTCGAAGG 9 CTGAGGACCAGAAGCACCTC 10 Rasburicase ATCACGGCTAAGCAGAACCC 11 ACATTGCGCTTCTCTTCGGA 12 Pegloticase AAGTGGAATTCGTCCGCACT 13 TAAGGCCCTGCGAACTTCTG 14 GAPDH CGAGGACAGCGTGATCTTCA 15 CTTAGCGAGATCCGGTGGAG 16

As a result, as shown in FIG. 6, it was confirmed that the marker genes of mesenchymal stem cells were significantly expressed, and the genes encoding the uric acid degradation enzymes Rasburicase and Pegloticase It was confirmed that mRNA was significantly expressed.

2-4: Confirmation of uric acid degradation enzyme activity

The activity of the uric acid degradation enzyme produced by the mesenchymal stem cells overexpressing the uric acid degradation enzyme was confirmed. Enzyme activity was measured using a uric acid assay kit (abcam), and was carried out in the same manner as in Example 1-2.

As shown in FIG. 7, as a result of confirming the degree of uric acid degrading enzyme in the mesenchymal stem cell culture medium overexpressing the uric acid degrading enzyme, the culture medium of mesenchymal stem cells into which Rasburicase or Pegloticase was introduced A statistically significant decrease in uric acid was observed in.

2-5: Confirmation of phenotype of mesenchymal stem cells overexpressing uric acid degradation enzyme

To confirm the phenotype of mesenchymal stem cells overexpressing uric acid degradation enzymes as stem cells, it was confirmed whether the positive (CD73, CD105) and negative (CD34, CD45) markers of mesenchymal stem cells were expressed.

First, the prepared mesenchymal stem cells overexpressing the uric acid degradation enzyme were treated with TE buffer (Gibco), and then reacted at 37° C. for 2 minutes to separate them into single cells. After obtaining each isolated cell to be 1×10 ⁵ cells, the cells were fixed using a Fixation/Permeabilization kit (Invitrogen), positive (CD73-BV421, CD105-PE-Cy7) and negative (CD34-APC, CD45-PE). ) The antibody was attached to the cell surface membrane and the distribution was confirmed using a FACS instrument.

As a result, as shown in FIG. 8, when compared with non-transformed normal mesenchymal stem cells, it was confirmed that the phenotype of the transfected mesenchymal stem cells with mcRasburicase or mcPegloticase was maintained.

Confirmation of anti-inflammatory effects of mesenchymal stem cells overexpressing uric acid degradation enzyme in inflammatory environment

In the present invention, it was confirmed whether the mesenchymal stem cells overexpressing uric acid degradation enzymes exhibit anti-inflammatory effects in an inflammatory environment.

The prepared uric acid-degrading enzyme overexpressing mesenchymal stem cells and untransformed mesenchymal stem cells were inoculated so that they were 5x10 ⁵ each, and then treated with IL-1b, IFN-γ and TNF-α 50 ng/ml for 48 hours. It created a (mimic) inflammatory environment. After 48 hours, stem cells were obtained and suspended in Trizol (Trizol, Thermo Fisher Scientific) to disrupt the cells, and mRNA was extracted. Using the extracted mRNA as a template, cDNA was synthesized with RevertAid ^TM First Strand cDNA synthesis kit (Thermo Fisher Scientific). Using the synthesized cDNA as a template again, PCR was performed for the anti-inflammatory marker genes IL-1RN, IL-10, TGF-β, and NLRP3 to confirm the expression level of each gene. The same gene was repeated three times for quantitative analysis, and then each gene expression level value was corrected based on the level of GAPDH expression in the same cell.

Primer information for PCR Primer sequence (5'-3') order
number IL-1RN AGAAGACCTCCTGTCCTATG 17 TACTCGTCCTCCTGGAAGTA 18 IL-10 TGCCTTCAGCAGAGTGAAGA 19 CTCAGACAAGGCTTGGCAAC 20 TGF-β TGGTTGTACAGGGCCAGGA 21 TGCGGCAGCTGTACATTGA 22 NLRP3 AGCTGACCAACCAGAGCTTC 23 TTCGACATCTCCTTGGTCCT 24 GAPDH CGAGGACAGCGTGATCTTCA 15 CTTAGCGAGATCCGGTGGAG 16

As shown in Figure 9, when treated with IL-1b, IFN-γ, and TNF-α, in general MSC and mcMock MSC, it was observed that the morphology of cells was changed or cells were killed, whereas uric acid degradation enzyme overexpression mesenchyme Stem cells (eMSCs) were observed to inhibit cell death.

In addition, as shown in FIG. 10, it was confirmed that the mesenchymal stem cells overexpressing the uric acid degradation enzyme did not affect the mRNA expression of NLRP3, which corresponds to the pro-inflammatory mechanism, but IL-1RN, which is an anti-inflammatory gene. , IL-10, TGF-β mRNA expression was significantly increased.

Confirmation of acute gout inhibition efficacy of mesenchymal stem cells overexpressing uric acid enzyme

4-1: Animal model production

In the present invention, it was attempted to confirm the inhibitory effect of acute gout of mesenchymal stem cells overexpressing uric acid degradation enzyme.

Male DBA1/j mice (25 g, 6 weeks old) were purchased from Orient Bio. They were divided into 5 groups and purified for 1 week under standard conditions, and then used for experiments (temperature 22±2 ℃, humidity 55±5%, 12 h-light/dark cycle, food/water free diet). All experiments were conducted in accordance with the guidelines of laboratory animal care standards and the Catholic University IACUC (Institutional Animal Care and Use Committee). Mice were divided into 5 groups of 5 as follows.

Group 1: High-concentration uric acid crystal (MSU; 3 mg/µl) alone administration group (MSU)

Group 2: MSU + positive control group (colchicine)

Group 3: MSU + mesenchymal stem cell administration group (MSC)

Group 4: MSU + mcRasburicase transformed mesenchymal stem cell administration group (mcRasburicase-MSC)

Group 5: MSU + mcPegloticase-transformed mesenchymal stem cell administration group (mcPegloticase-MSC)

Mesenchymal stem cells or mesenchymal stem cells overexpressing uric acid degradation enzymes were prepared to be 1×10 ⁵ cells, and then injected into the blood vessels of mice every 7 days prior to administration of MSU. After mesenchymal stem cell injection, MSU was injected into the right hind paw of the mouse at 3 mg/µl on the 7th or 14th day.

As shown in FIG. 11, as a result of checking the thickness of the foot 24 hours after MSU injection, compared to the group administered with uric acidase overexpression mesenchymal stem cells once at 7 day intervals, uric acidase overexpression mesenchyme twice at 7 days intervals It was confirmed that acute inflammation was suppressed in the group administered with stem cells.

4-2: Confirmation of acute gout inhibition effect by mesenchymal stem cells overexpressing uric acid degradation enzyme

As a result of checking the thickness of the foot 24 hours after the MSU injection, as shown in FIG. 11, compared to the group administered with the uric acidase overexpressing mesenchymal stem cells once at 7 days intervals, the uric acidase overexpressing mesenchyme twice at 7 days intervals It was confirmed that acute inflammation was suppressed in the group administered with stem cells.

In addition, the footpad tissues of mice administered with mesenchymal stem cells overexpressing uric acid degradation enzymes were observed by immunochemical staining.

A 4% paraformalin solution was added to the mouse foot tissue about 10 times the tissue, and then stored at 4° C. for 1 day. Thereafter, the 20% acidic demineralization solution was changed at intervals of 2 days for 3 weeks, followed by washing with water, a process of removing water from the tissue, and then stored in paraffin for one day. Paraffin blocks are made through an embedding process, a process that hardens the entire tissue piece in a certain shape and at the same time fills the space in the tissue so that structural deformation of the tissue does not occur, and a section slide is produced with a thickness of 4 μm. I did. The prepared slide was reacted overnight on a slide plate at 60°C, and then paraffin was removed using xylene and ethanol (diparaffine step), and hematoxylin-eo (Hematoxylin & Eosin) solution.

As a result, as shown in FIG. 12, it was confirmed that tissue necrosis was decreased compared to the control group (MSU alone administration group), and inflammation was significantly reduced in the mcRasburicase or mcPegloticase transformed mesenchymal stem cell administration group compared to the general MSC administration group. Confirmed.

Furthermore, in order to confirm the expression level of inflammatory cytokines TNFα and IL-1β, the footpad tissues of mice administered with mesenchymal stem cells overexpressing uric acid degradation enzymes were stained with TNFα and IL-1β antibodies, respectively. Inflammatory cells were observed, and these were numerically expressed.

As a result, as shown in FIG. 13, it was confirmed that the expression levels of TNFα and IL-1β decreased in the mcRasburicase or mcPegloticase-transformed mesenchymal stem cell administration group compared to the control group. In particular, it was confirmed that the mcPegloticase-transformed mesenchymal stem cell administration group decreased IL-1β expression to a level similar to that of the positive control group (colchicine) administration group.

Confirmation of the efficacy of chronic gout treatment of mesenchymal stem cells overexpressing uric acid enzyme

5-1: Animal model production

In the present invention, in order to confirm the efficacy of treating chronic gout of mesenchymal stem cells (eMSC) overexpressing uric acid enzymes, mice were prepared as in Example 4, and the mice were divided into 5 groups of 5 mice as follows.

Group 1: MSU alone administration group (MSU)

Group 2: MSU + mesenchymal stem cell administration group (MSC)

Group 3: MSU + mesenchymal stem cells transformed with mock vector (mcMock-MSC)

Group 4: MSU + mcRasburicase transformed mesenchymal stem cell administration group (mcRasburicase-MSC)

Group 5: MSU + mcPegloticase-transformed mesenchymal stem cell administration group (mcPegloticase-MSC)

A high-dose MSU animal model was prepared by injecting 100 µl of high-concentration uric acid crystals (MSU) by subcutaneous injection into each group of mice. After MSU injection, MSC or eMSC is injected directly into the Tophi site (the area where high concentration uric acid crystals injected subcutaneously) so as to be 1x 10 ⁶ /100µl every 7 days, and then observe MSU up to 14 days every 7 days. I did.

5-2: MSU size comparison

MSU was observed for up to 14 days at 7-day intervals for each group of Example 5-1, and the size difference of the high-concentration MSU was confirmed through CT. The MSU size was numerically expressed using the analysis program ITK-SNAP.

In Figs. 14 and 15, the 7 days group means that 7 days after the high-concentration MSU injection, and the 14-day group means that the MSC or eMSC is injected 7 days after the high-concentration MSU injection and then observed 7 days later.

As a result, as shown in Fig. 14, in the case of the MSU-only administration group, it was confirmed that the injected MSU was maintained continuously. On the other hand, as shown in Figure 15, in the case of the mcRasburicase-MSC and mcPegloticase-MSC administration group, it was confirmed that the MSU size was significantly reduced.

In addition, when staining was performed to enable tracking on MSC cell membranes and then proceeded in the same manner as in Example 5-1, it was not confirmed that MSCs migrated from the back to other sites.

<110> CATHOLIC UNIVERSITY INDUSTRY ACADEMIC COOPERATION FOUNDATION <120> Composition for preventing or treating Gout comprising stem cells overexpressing Uricase <130> 1067388 <150> KR 10-2019-0057014 <151> 2019-05-15 <160> 24 <170> KoPatentIn 3.0 <210> 1 <211> 960 <212> DNA <213> Artificial Sequence <220> <223> Rasburicase <400> 1 atgggatgga gctatatcat cctctttttg gtggccacag cggccgatgt ccactcgtca 60 gctgttaagg ccgcgagata tggtaaggat aatgttcgag tgtacaaggt tcataaagac 120 gaaaaaacag gggtacagac ggtgtatgaa atgaccgtct gtgtgctctt ggaaggggag 180 atagagacgt catacacaaa agctgacaac agtgttatcg tcgcgacgga cagtatcaaa 240 aacactatct atatcacggc taagcagaac ccggttacgc ctccagaatt gtttggatct 300 attctcggta cacatttcat cgaaaaatac aatcatatac atgcggctca tgtgaacatc 360 gtgtgccaca gatggacccg catggatata gacgggaaac cacacccgca tagttttatc 420 cgagactccg aagagaagcg caatgttcag gtagacgtgg tggagggcaa gggtatagat 480 atcaagagca gcctgagcgg cctcactgtg ttgaagtcca caaactcaca gttttgggga 540 ttcttgagag atgaatatac tacactgaag gaaacgtggg accgcattct ctccacagat 600 gtggacgcta catggcaatg gaaaaatttt agtgggcttc aggaggttcg gtctcacgtt 660 ccaaaattcg acgcaacgtg ggctactgcg cgggaagtca cgctcaaaac atttgccgaa 720 gataattctg catccgtgca agcaacgatg tacaaaatgg cggagcagat cctggcacga 780 cagcaactga tcgagaccgt cgagtactcc ctgccaaaca agcattattt cgaaatcgac 840 ctttcttggc acaaagggtt gcagaatacc gggaagaatg ccgaagtatt tgcacctcag 900 agtgatccta acggtctcat taagtgtaca gtggggagat ccagtttgaa gtcaaagctc 960 960 <210> 2 <211> 951 <212> DNA <213> Artificial Sequence <220> <223> Pegloticase <400> 2 atgggatgga gctatatcat cctctttttg gtggccacag cggccgatgt ccactcgaca 60 tacaaaaaaa atgacgaagt ggaattcgtc cgcactggct acgggaagga tatgattaag 120 gtcttgcaca ttcagagaga cgggaaatat cattcaatta aggaagttgc gactacggta 180 cagttgaccc tcagttccaa aaaagattac ctccacgggg acaattcaga tgtcattcct 240 actgatacga ttaaaaatac cgtaaacgta ttggcgaagt ttaaggggat taaatcaatc 300 gagacatttg cggtcactat ctgcgagcat tttctcagct cattcaaaca tgtcatacga 360 gcccaagttt atgtcgagga ggtgccctgg aagcgatttg agaagaacgg tgtgaagcac 420 gtacatgcgt ttatatacac gcctacaggc acgcactttt gtgaagtgga acaaattaga 480 aacggtcccc cggttatcca cagtggaata aaagatctca aagtactcaa gacgacccag 540 tctgggtttg aaggattcat caaggatcag tttaccactc ttccagaggt taaagatcga 600 tgttttgcca cacaggtgta ttgtaaatgg agatatcatc aggggcgcga cgtggatttt 660 gaggctacat gggacactgt gcggtccata gttctccaga agttcgcagg gccttatgac 720 aagggcgagt acagcccgtc tgtccagaaa accttgtacg acatacaggt tcttaccctc 780 ggccaggttc ccgaaataga agacatggag atctctctcc ctaacataca ctacctcaat 840 atcgatatgt ctaaaatggg ccttattaat aaagaagagg tcctgctccc actggacaac 900 ccctacggga agataactgg cactgtgaaa aggaaattgt cttcccggct t 951 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CD45_F <400> 3 agcacctacc ctgctcagaa 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CD45_R <400> 4 ttcagcctgt tcctttgctt 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CD90_F <400> 5 ctagtggacc agagccttcg 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CD90_R <400> 6 tggagtgcac acgtgtaggt 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CD44_F <400> 7 aaggtggagc aaacacaacc 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CD44_R <400> 8 agctttttct tctgcccaca 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CD105_F <400> 9 cactagccag gtctcgaagg 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CD105_R <400> 10 ctgaggacca gaagcacctc 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Rasburicase_F <400> 11 atcacggcta agcagaaccc 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Rasburicase_R <400> 12 acattgcgct tctcttcgga 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Pegloticase_F <400> 13 aagtggaatt cgtccgcact 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Pegloticase_R <400> 14 taaggccctg cgaacttctg 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_F <400> 15 cgaggacagc gtgatcttca 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_R <400> 16 cttagcgaga tccggtggag 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-1RN_F <400> 17 agaagacctc ctgtcctatg 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-1RN_R <400> 18 tactcgtcct cctggaagta 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-10_F <400> 19 tgccttcagc agagtgaaga 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-10_R <400> 20 ctcagacaag gcttggcaac 20 <210> 21 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> TGF-b_F <400> 21 tggttgtaca gggccagga 19 <210> 22 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> TGF-b_R <400> 22 tgcggcagct gtacattga 19 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NLRP3_F <400> 23 agctgaccaa ccagagcttc 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NLRP3_R <400> 24 ttcgacatct ccttggtcct 20

Claims (6)

(a) a promoter, a gene encoding a uricase protein, and a gene expression cassette comprising a transcription terminator,
(b) containing the att attachment sequence of the bacteriophage lambda, located outside the gene expression cassette of (a); And
(c) Uric acid degrading enzyme overexpressing stem cells introduced with a non-viral vector that does not contain an initiation point of replication and an antibiotic resistance gene.
The stem cell of claim 1, wherein the gene encoding the uric acidase protein comprises a nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2.
The stem cell of claim 1, wherein the stem cell is a mesenchymal stem cell.
The stem cell of claim 1, wherein the mesenchymal stem cell is a bone marrow-derived mesenchymal stem cell.
A pharmaceutical composition for the prevention or treatment of gout comprising the stem cells overexpressing the uric acid degradation enzyme of any one of claims 1 to 4 as an active ingredient.
The pharmaceutical composition for preventing or treating gout according to claim 5, wherein the gout is acute gout or chronic nodular gout.

Images