JPWO2019141052A5 - - Google Patents

Description

TECHNICAL FIELD The present invention relates to the field of mammalian breeding technology, and specifically to a method for producing a non-human primate somatic cell clone animal.

BACKGROUND ART Since non-human primates are evolutionarily close to humans, they are very similar to humans in many aspects such as brain structure and functional activities. Non-human primates have a unique advantage over other experimental animals in solving human problems, particularly those related to the brain. Thus, it is not only an important experimental animal suitable for studying normal higher brain functions of the human brain, but also a suitable model animal for studying disease mechanisms and therapeutic methods of the brain. Japan has a very rich resource of non-human primates, and various non-human primates have been developed by transgenic technology in order to make full use of non-human primates to study brain diseases and normal higher functions of the human brain. There is a need to construct human primate brain disease models and tool models such as optogenetics.

Currently, the most used methods for obtaining genetically modified animal models of non-human primates are the lentiviral-infected oocyte method and the editable nuclease method (such as CRISPR-Cas9). The rapid development of gene-editing technologies, particularly CRISPR-Cas9, has made it easier for scientists to edit genes in non-human primates. Nevertheless, many important problems remain in the construction of non-human primate transgenic animal models with existing transgenic technology. For example, first, the chimerism phenomenon is common in primary (F0) animal models, whether transgenic animals are obtained by the lentiviral-infected oocyte method or gene-knockout animals are obtained by editable nuclease technology. exist, which precludes the use of primary animal models by such methods for scientific research. Conventional rodents such as rats and mice can be passaged to obtain an F1 generation animal model without chimerism, but in non-human primate animal models, it is necessary to obtain an F1 generation animal model. , usually takes about 5 years. Second, for non-human primate models with complex genetic alterations (conditional knockouts or gene knockins), site-specific DNA double-strand breaks are introduced by injecting editable nucleases into current embryos. The method of inserting a foreign fragment into a predetermined site by injecting a homologous fragment at the same time is very inefficient at the mammalian level, and there are no reports of success at the non-human primate level. Third, most currently used rodent models, whether for drug screening or mechanistic studies, are preferably inbred strains, which minimizes differences in genetic backgrounds and increases the rigor and accuracy of experimental results. can be guaranteed. Rats and mice can achieve genetic background consistency by repeated inbreeding, but non-human primates, which have a long sexual maturation cycle, achieve genetic background consistency by such inbreeding. It is unrealistic to In summary, the above three important issues make non-human primate genetically modified animal models eagerly awaited, but currently non-human primate genetically modified animal models are not yet widely used in scientific research. .

Currently, no successful somatic cell-derived clonal monkeys have yet been reported. The factors that have not yet succeeded in this task are, firstly, the high demands on the technology, and the difficulty of primate nuclear transfer technology is much higher than that of other mammals that have already been successful at present. Second, the developmental efficiency of cloned embryos is low, and currently the developmental efficiency of monkey somatic cell cloned embryos is much lower than that of other mammals.
Therefore, in this field, the successful construction of non-human primate cloned animals derived from somatic cells is eagerly desired.

SUMMARY OF THE INVENTION It is an object of the present invention to provide somatic cell-derived non-human primate clones.
Another object of the present invention is to provide a method for optimizing the process of non-human primate somatic cell nuclear transfer engineering to improve the efficiency of non-human primate somatic cell nuclear transfer. And we obtained healthy surviving somatic cell nuclear transfer cloned monkeys by optimized manipulation and method.

In the first aspect of the present invention, a method for producing a non-human primate somatic cell clone animal, comprising:
(i) providing a reconstructed egg derived from the non-human primate animal;
(ii) forming an activated reconstructed egg or a reconstructed embryo comprising the activated reconstructed egg by subjecting the reconstructed egg to activation treatment, wherein the reconstructed embryo is at the 2-, 4-, or 8-cell stage;
(iii) the reprogrammed reconstructed egg or the reprogrammed embryo by reprogramming the embryonic cells of (a) the activated reconstructed egg or (b) the activated reconstructed embryo ; obtaining a reconstructed embryo , and
(iv) obtaining a non-human primate SCNT cloned animal by regenerating said reprogrammed reconstructed egg or reprogrammed reconstructed embryo .

In another preferred example, in step (iii), a reprogramming treatment is performed with a reprogramming activator.
In another preferred example, the reprogramming activator is
(a1) Kdm4d protein,
(a2) mRNA encoding Kdm4d protein,
(a3) DNA encoding the Kdm4d protein, and
(a4) is selected from the group consisting of any combination of (a1), (a2) and (a3) above.
In another preferred example, the reprogramming activator is
(a1) Kdm4d protein,
(a2) mRNA encoding Kdm4d protein,
(a3) DNA encoding the Kdm4d protein, and
(a4) A reprogramming activator selected from the group consisting of any combination of (a1), (a2), and (a3) above.

In another preferred example, the reprogramming activator further comprises
(b1) Kdm4a protein,
(b2) mRNA encoding Kdm4a protein,
(b3) DNA encoding the Kdm4a protein, and
(b4) A reprogramming activator selected from the group consisting of any combination of (b1), (b2) and (b3) above.
In another preferred example, the reprogramming activator further comprises
(c1) Kdm4b protein,
(c2) mRNA encoding Kdm4b protein,
(c3) DNA encoding the Kdm4b protein, and
(c4) A reprogramming activator selected from the group consisting of any combination of (c1), (c2) and (c3) above.

In another preferred embodiment, the reconstructed egg or embryo is a non-genetically engineered reconstructed egg or embryo or a genetically engineered reconstructed egg or embryo .
In another preferred example, said genetic engineering includes ZFN (zinc-finger nucleases), TALEN or Crispr technology.
In another preferred embodiment, the non-genetically engineered reconstructed egg or embryo is a gene-knocked-out reconstructed egg or embryo .
In another preferred embodiment, said reprogramming treatment comprises injecting mRNA encoding Kdm4d protein into embryonic cells of said reconstructed egg or reconstructed embryo.
In another preferred embodiment, said reprogramming treatment comprises injecting mRNA encoding one or more of Kdm4a, Kdm4b or Kdm4d proteins into embryonic cells of said reconstructed egg or reconstructed embryo. include.

Another preferred embodiment comprises injecting 10 ² to 10 ⁸ (preferably 10 ⁴ to 10 ⁶ ) copies/cell of mRNA encoding Kdm4d protein into said reconstructed egg or said embryonic cell.
In another preferred example, mRNA encoding one or more of the Kdm4a, Kdm4b or Kdm4d proteins at 10 ² to 10 ⁸ (preferably 10 ⁴ to 10 ⁶ ) copies/cell of said reconstructed egg or said embryo. Including injecting cells.
In another preferred example, said reconstructed embryo is at the 4-cell or 8-cell stage.
In another preferred example, the mRNA encoding the Kdm4d protein is present in solution and the concentration of the mRNA is 10-6000 ng/μL (preferably 50-4000 ng/μL, more preferably 80-3000 ng/μL). μL).
In another preferred example, said Kdm4a or Kdm4b-encoding mRNA is present in solution and said mRNA has a concentration of 10-6000 ng/μL (preferably 50-4000 ng/μL, more preferably 80-3000 ng/μL). /μL).

In another preferred embodiment, said regeneration is performed in the uterus of a non-human primate surrogate animal.
In another preferred embodiment, said surrogate mother animal and said reconstructed egg are of the same species.
In another preferred embodiment said regeneration is performed in an artificial womb.
In another preferred embodiment, in the method, in step (ii), an activated reconstructed embryo is obtained, and in step (iii), a reprogramming treatment is performed on the reconstructed embryo . .

In another preferred embodiment, in the method, in step (iv), a non-human primate SCNT cloned animal is obtained by regenerating the reprogrammed reconstructed embryo .
In another preferred example, said step (iv) comprises
(iv1) culturing the reprogrammed reconstructed egg in vitro or in vivo to form a reconstructed embryo ; and
(iv2) obtaining a SCNT cloned animal of the non-human primate by transplanting the reconstructed embryo into the oviduct of the non-human primate.
In another preferred example, said implantation is a non-invasive implantation (ie no scarring occurs).
In another preferred embodiment, the method is non-therapeutic and non-diagnostic.

In another preferred example, the reconstructed egg comprises
(a) providing one nucleus-removed non-human primate cytoplasm-donating oocyte and one nucleus-donating non-human primate somatic cell;
(b) by an in vitro method comprising the step of injecting the nucleus donor non-human primate animal somatic cells directly into the cytoplasmic donor oocyte from which the nucleus has been removed by microinjection to form a reconstructed oocyte; manufactured.
In another preferred example, the somatic cells are fibroblasts, cumulus cells, embryonic stem cells, spermatogonia, Sertoli cells, mesenchymal stem cells, skin cells, mammary cells, oviduct cells, ear cells, ovarian cells. selected from the group consisting of cells, epithelial cells, endothelial cells, muscle cells, nerve cells, osteoblasts, or combinations thereof.

In another preferred example, in step (ii), an activation treatment is performed with an activation treatment agent.
In another preferred example, the activation conditions for the activation treatment are
Ionomycin for 2-6 minutes, 6-DMAP for 3-6 hours, and TSA for 5-15 hours at 37° C., 5% CO ₂ .
In another preferred example, the activation treatment agent is selected from the group consisting of calcium ion activators, histone deacetylase inhibitors, 6-DMAP, Cycloheximide (CHX), or combinations thereof. .

In another preferred embodiment, said histone deacetylase inhibitor is selected from the group consisting of TSA, Scriptaid, or combinations thereof.
In another preferred example, the concentration of the activating agent is 0.1 nM-100 mM, preferably 1 nM-50 mM. For ionomycin, for example, the concentration is between 0.5 mM and 30 mM, preferably between 0.8 mM and 15 mM, more preferably between 1 and 10 mM.
In another preferred example, among the activating agents, the histone deacetylase inhibitor (TSA) has a concentration of 0.5 to 80 nM, preferably 1 to 50 nM, more preferably 3 to 30 nM. be.

In another preferred example, said step (ii) comprises
(i) activating in a calcium ion activator for 0.5 min to 1 h, preferably 1 min to 30 min, more preferably 2 min to 10 min,
(ii) activation in TSA and 6-DMAP for 0.5 h to 20 h, preferably 0.8 h to 10 h, more preferably 1 h to 8 h;
(iii) activating in TSA for 0.5 h to 24 h, preferably 0.8 h to 15 h, more preferably 10 to 12 h.
In another preferred embodiment, in step (iii), the activated reconstructed egg is activated again for 2-10 hours, preferably 3-7 hours.

In a second aspect of the invention,
(a) a first container containing a reprogramming activator, said reprogramming activator comprising:
(a1) Kdm4d protein,
(a2) mRNA encoding Kdm4d protein,
(a3) DNA encoding the Kdm4d protein,
(a4) a container selected from the group consisting of any combination of (a1), (a2), and (a3) above;
(b) a second container containing an activating treatment;
(c) provide kits containing labels or instructions;

In another preferred example, the reprogramming activator further comprises
(b1) Kdm4a protein,
(b2) mRNA encoding Kdm4a protein,
(b3) DNA encoding the Kdm4a protein, and
(b4) A reprogramming activator selected from the group consisting of any combination of (b1), (b2) and (b3) above.
In another preferred example, the reprogramming activator further comprises
(c1) Kdm4b protein,
(c2) mRNA encoding Kdm4b protein,
(c3) DNA encoding the Kdm4b protein, and
(c4) A reprogramming activator selected from the group consisting of any combination of (c1), (c2) and (c3) above.

In another preferred embodiment, the label or instructions describe the method according to the first aspect of the invention.
A third aspect of the present invention provides a use of the kit according to the second aspect of the present invention for producing a kit for producing a non-human primate somatic cell clone animal.
A fourth aspect of the present invention provides a non-human primate SCNT cloned animal produced by the method according to the first aspect of the present invention.

Of course, it is understood that within the scope of the present invention, each of the above technical features of the present invention and each of the technical features specifically described below (such as the embodiments) can be combined with each other to form new or preferred technical solutions. be done. Due to space limitations, I will not describe each one here.

Description of the drawing
FIG. 1 shows the optimization of the process of nuclear transfer engineering of somatic cells of cynomolgus monkeys. Here, A is a fetal cynomolgus monkey fibroblast used as a nucleus donor, B is a cynomolgus monkey oocyte nucleus (spindle-chromosome complex) in the spindle visualization system, and C is a cynomolgus monkey oocyte nucleus (spindle-chromosome complex) in the spindle visualization system. Removal of cynomolgus monkey oocyte nuclei using the Peizo micromanipulation system, D to F laser zona pellucida dissection, HVJ-E virus-mediated fusion of donor cells and enucleated oocytes, and G somatic cells and enucleated eggs. Spindle-chromosome complexes re-formed by the cell nucleus after mother cell fusion. Scutellum developed from an embryo injected with the demethylase Kdm4d mRNA.

FIG. 2 shows the efficiency statistics of fetal monkey fibroblasts and adult monkey cumulus cells as nuclear donors in different conditions. Here, A is the statistics of scutellum development of fibroblast nuclear transfer embryos under three conditions: normal activation conditions, treatment with the histone deacetylase inhibitor TSA, and injection of TSA and H3K9me3 demethylase Kdm4d. , B, Statistics of high-quality scutellum development in fibroblast nuclear transfer embryos under three conditions: normal activation conditions, treatment with the histone deacetylase inhibitor TSA, and injection of TSA and the H3K9me3 demethylase Kdm4d. C, statistics of scutellum development in cumulus cell nuclear transfer embryos under two conditions: treatment with the histone deacetylase inhibitor TSA and injection of TSA and H3K9me3 demethylase Kdm4d; D, histone deacetylation. Statistics of high-quality scutellum development of cumulus cell nuclear transfer embryos under two conditions: treatment with the enzyme inhibitor TSA and injection of TSA and H3K9me3 demethylase Kdm4d. E, H3K9me3 demethylation at the transcriptome level. This is a verification of the effect of improving monkey somatic cell nuclear transfer by the enzyme Kdm4d.

FIG. 3 shows the transfer pregnancy rate and fetal development statistics of cynomolgus monkey somatic cell nuclear transfer embryos. Here, A and B are ultrasound B-mode images of pregnant nuclear transfer recipients. A recipient has only a gestational sac and no fetus, B recipient has a gestational sac and fetus, Pregnancy rate statistics of different cell donors and fetal bearing rate statistics of pregnant recipients, where E is the final developmental status of pregnant recipients bearing a fetus.

Figure 4 shows genetic analysis of somatic cell nuclear transfer clone monkeys. A, B are two healthy clonal monkeys 'Nakanaka' and 'Hanahua' obtained in fibroblasts, and C is a schematic of the analysis of three microsatellite sites in the nuclear genomes of two clonal monkeys. D, E are schematics of SNP analysis of mitochondria of two cloned monkeys. FIG. 5 shows nuclear transfer of embryonic cynomolgus monkey fibroblasts. Here, A is the spindle-chromosome complex re-formed by the cell nucleus after fusion of the somatic cell and the nuclear-depleted oocyte (corresponding to Fig. 1G), and B is the 1 after in vitro activation of the nuclear transfer embryo. Formation of the pronucleus (corresponding to Fig. 1H), C is the developmental state of the embryo after activation under normal conditions, D is the developmental state of the embryo after activation under normal conditions and treated with TSA. is.

FIG. 6 shows activation and reprogramming treatments for somatic cell nuclear transfer of cynomolgus monkey cumulus cells and reconstructed eggs. Here, A is a cynomolgus monkey cumulus cell, B is a spindle-chromosome complex in which the cell nucleus re-forms after fusion of a cumulus cell and a nuclear-depleted oocyte, and C and D are in vitro activities of nuclear transfer embryos. E is the developmental situation of embryos after activation under normal conditions and treatment with TSA; This is the scutellum that developed from the injected embryo.

FIG. 7 shows further mitochondrial SNP site analysis of fibroblast nuclear transfer clone monkeys “Nakanaka” and “Hanahua” (corresponding to FIG. 4D). Figure 8 shows the genetic analysis of cumulus cell somatic cell nuclear transfer clone monkeys "A" and "B". Here, A is a schematic representation of the analysis of three microsatellite sites in the nuclear genomes of two cloned monkeys, and B and C are the analyzes of SNP sites in the mitochondria of two cloned monkeys.

Figure 9 shows the production of BMAL1 gene-edited monkey fibroblasts. (A) Schematic of the production of gene-edited cynomolgus monkey fibroblasts. (B) BMAL1 edited monkey A6. (C) Dermal fibrocytes from A6 monkey, Bar=200 μm. (D) A6 fibroblasts have a normal karyotype. (E) Analysis of genotypes of ear tip tissue, blood cells, and fibroblasts from A6 monkeys. (F) Single-cell genotypic analysis of A6 fibroblasts. Figure 10 shows the construction of BMAL1 gene-edited cloned monkeys. (A) Schematic of the construction of BMAL1 gene-edited cloned monkeys. (B) Monkey SCNT embryos at different stages, Bar=120 μm. (C) B1-B5 are 5 clonal monkeys with SCNT from A6 fibroblasts. (D) BMAL1 mutation analysis of ear tissue from 5 cloned monkeys, 4 monkeys with heterozygous mutant gene ('-8/-8, +4,2PM') and 1 monkey with homozygous mutation. Has a mutated gene ("-8/-8").

Figure 11 shows BMAL1 genotyping and expression analysis of cloned monkeys. (A-E) Single nucleotide polymorphism analysis of B1-B5 showed that mitochondrial DNA SNPs were similar to oocyte donor monkeys but different from recipient monkeys and donor fibroblasts. (F) Short tandemly duplicated sequences of ear tissue from five cloned monkeys (B1-B5) whose nuclear DNA is similar to donor fibroblasts but distinct from oocyte donor and recipient monkeys. was shown. (G) RT-PCR analysis of BMAL1 expression in clone monkey B1 blood samples showed that the wild-type BMAL1 transcript was completely deleted.

Specific Embodiments After extensive and deep research, extensive screening and trials, the present inventors have unexpectedly developed for the first time a method capable of constructing somatic cell clones of non-human primates. Specifically, the present inventors tested a reconstructed egg or reconstructed embryo (gene The edited reconstructed egg or reconstructed embryo ) is subjected to a reprogramming treatment and optionally combined with a specific activating treatment (e.g. calcium ion activator (e.g. ionomycin), histone deacetylating agent). By activating reconstructed eggs with an enzyme inhibitor (TSA), 6-DMAP, or a combination thereof, we succeeded in obtaining somatic cell clones of non-human primates (for example, monkeys) for the first time. Based on this, the present inventor completed the present invention.

Terminology Typically, a “reconstructed egg” is a reconstructed egg obtained by injecting a somatic cell (cell nucleus derived from a somatic cell) into an oocyte from which the nucleus has been removed.
As used herein, the terms "reconstructed embryo " and "reconstructed embryo " refer to embryos developed or differentiated from reconstructed eggs, particularly embryos at the 2- to 16-cell stage, but can be used Typically, a reconstructed embryo is an embryo formed by injecting a somatic cell (cell nucleus derived from the somatic cell) into an oocyte from which the nucleus has been removed, and dividing the reconstructed egg, and an embryo developed from this embryo. Embryos in all different cell stages.

Activation Treatment As used herein, the term “activation treatment” refers to activation treatment on a reconstructed egg or reconstructed embryo under appropriate activation treatment conditions to It is to promote cell division of the egg or reconstructed embryo .
In the present invention, the activation treatment can be performed under normal activation treatment conditions in this field. Typically, activation treatment can be performed with an activation treatment agent at a constant temperature (eg, 37±2° C.) for a constant time (eg, 0.1 to 24 hours).
Typical activation conditions for activation treatment are 37° C. and 5% CO ₂ for activation treatment.

In the present invention, the type of activation treatment agent is not particularly limited, but representative examples include calcium ion activators, histone deacetylase inhibitors, 6-DMAP, cycloheximide (CHX), or Including but not limited to combinations.
Representative histone deacetylase inhibitors include, but are not limited to, TSA, Scriptaid, or combinations thereof.
Representative calcium ion activators include, but are not limited to ionomycin, calcium ion carrier A23187, ethanol, strontium chloride, or combinations thereof.

In another preferred example, the concentration of the activating agent is 0.1 nM-100 mM, preferably 1 nM-50 mM.
For ionomycin, for example, the concentration is between 0.5 mM and 30 mM, preferably between 0.8 mM and 15 mM, more preferably between 1 and 10 mM.
In another preferred example, among the activation treatment agents, the concentration of the calcium ion activator is 0.2-80 μM, preferably 0.5-50 μM, more preferably 0.8-20 μM, further preferably 1-15 μM. be.
In another preferred example, among the activating agents, the histone deacetylase inhibitor (TSA) has a concentration of 0.5 to 80 nM, preferably 1 to 50 nM, more preferably 3 to 30 nM. be.
In another preferred example, the concentration of ionomycin in the activating agent is 0.2-80 μM, preferably 0.5-50 μM, more preferably 0.8-20 μM, still more preferably 1-15 μM.
In another preferred example, the concentration of Cycloheximide (CHX) in the activation treatment agent is 0.2-80 μg/ml, preferably 0.5-50 μg/ml, more preferably 1-20 μg/ml. .

In one embodiment of the invention, the activation treatment comprises treatment with ionomycin for 2-6 minutes, 6-DMAP for 3-6 hours, and TSA for 5-15 hours.
From the experimental results of the present invention, unexpectedly, when TSA is used as an activating agent together with the specific reprogramming treatment agent of the present invention, the success rate of the production of non-human primate somatic cell cloned animals is remarkably improved. was shown to be possible.

In the present invention, one preferred activation treatment method is to immerse the reconstructed embryo , which has been injected with somatic cells, in ionomycin dissolved in 5 μM TH3 operating solution for a certain period of time (for example, 2 to 20 minutes, preferably about 5 minutes). minutes) (preferably under conditions of 37°C and 5% CO ₂ ), then transfer the embryos to a solution of 2 mM DMAP dissolved in HECN-9 and TSA at a concentration of 10 nM for a certain period of time (for example, 3-8 hours). ) (preferably at 37°C and 5% CO ₂ ), and then transferred to a solution of 10 nM TSA dissolved in hamster embryo culture medium 9 (HECM-9) for a certain period of time (for example, 3 ~8 hours) including processing.

Reprogramming Treatment As used herein, the term "reprogramming treatment" refers to the treatment of a reconstructed egg or embryo to identify a specific gene in the treated reconstructed egg or reconstructed embryo . Transcription and translation of genes associated with fertilized egg development by altering the transcription and/or translation state of .
In primates, due to the complexity of the genome, prior to the present invention, various reprogramming and/or reactivation treatments were attempted on reconstructed eggs (or reconstructed embryos ), but none have been used. was also unsuccessful. Also, due to the complexity of the primate genome (e.g., currently little is known about the genes involved in the development of primate fertilized eggs), prior to the present invention, reconstructed primate eggs ( It is not possible to predict whether SCNT cloned animals can be produced by effective and accurate reprogramming treatment of the reconstructed embryos .

However, the present inventors have unexpectedly found that only one specific substance (i.e., Kdm4d, Kdm4a, or Kdm4b proteins or their encoding mRNAs, or a combination thereof) can be highly effective and accurately sited against reconstructed eggs. We have found that specific reprogramming is possible, and that the effect of such reprogramming is effective, with no observable side effects (eg, embryo malformation, abortion, etc.).
One typical reprogramming treatment condition is to perform the reprogramming treatment using an inverted microscope at a temperature at which cell activity can be maintained (eg, room temperature, preferably 25-35° C.).

In the present invention, the type of reprogramming treatment agent is not particularly limited, but representative examples include (a1) Kdm4d protein, (a2) mRNA encoding Kdm4d protein, (a3) DNA encoding Kdm4d protein, and ( a4) Including, but not limited to, any combination of (a1), (a2), and (a3) above.
Another preferred embodiment comprises injecting 10 ² to 10 ⁸ (preferably 10 ⁴ to 10 ⁶ ) copies/cell of mRNA encoding Kdm4d protein into said reconstructed egg or said embryonic cell.
In another preferred example, the mRNA encoding the Kdm4d protein is present in solution and the concentration of the mRNA is 10-6000 ng/μL (preferably 50-4000 ng/μL, more preferably 80-3000 ng/μL). μL).

In one preferred embodiment, from the experimental results of the present invention, unexpectedly, when Kdm4d protein or mRNATSA encoding Kdm4d protein is used as a reprogramming treatment agent, and optionally together with an activating treatment agent of the present invention, non- It was shown that the success rate of the production of somatic cell cloned animals of human primates can be remarkably improved.
In one preferred embodiment of the invention, the method of the invention involves activating embryos in 6-DMAP and TSA, followed by transfer to HECM-9 containing TSA only, and injection of Kdm4d mRNA after 1-2 hours. involves transferring embryos to TH3 working solution containing 5 μg/ml cytochalasin CB and injecting Kdm4d mRNA into activated embryos using a Piezo micromanipulation system.

Applications According to this method, cells cultured in vitro are first genetically manipulated, transgene-positive cells are screened, and these cells are used as donor cells for somatic cell nuclear transfer. Positive cloned animals can be obtained. When transgenic offspring are obtained by somatic cell nuclear transfer technology, these cloned animals not only match genotypes, but also solve problems such as off-targets and chimeras, and at the same time, constructing individuals can be used for subsequent research. , the construction time is also basically shortened to the monkey's gestation period (about 5.5 months).
Based on the method of the present invention, somatic cell clone animals of various primates can be effectively produced. These cloned non-human primates can be used as model animals for scientific research, drug screening and other studies.

Further, in the present invention, the reconstructed egg or reconstructed embryo may be non-genetically engineered or genetically engineered. Representative genetic engineering manipulations include gene editing (e.g., CRISPR/Cas9-based gene editing), genetic recombination, lentiviral transgenes, Bacterial Artificial Chromsomes (BAC) transgenes, TALEN-based transgenes, but these is not limited to
In the present invention, the genetic manipulation can be performed before, during and/or after the production of reconstructed eggs. In addition, in the present invention, the genetic manipulation can be performed before, during and/or after the production of the reconstructed embryo .
In another preferred embodiment, the reconstructed egg, reconstructed embryo or SCNT cloned animal of the invention has a mutated gene (including a knock-in or knock-out gene).

Representative mutation cases include, but are not limited to:
Gene knock-in:
(1) Knock-in of green fluorescent protein to AAVS1 site: AAVS1-GFP Knock In,
(2) knock-in of cre sequence to AAVS1 site: AAVS1-Cre Knock In,
(3) LSL-CHR2 sequence knock-in to AAVS1 site: AAVS1-LSL-CHR2 Knock In,
(4) Knock-in of light-sensitive on-channel rhodopsin CHR2 to CamkIIa site: CamkIIa-CHR2-EYFP Knock In,
(5) Knock-in of the calcium imaging protein Gcamp6s into the CamkIIa site: CamkIIa-Gcamp6s Knock In,
(6) Knock-in of cre sequence into CamkIIa site: CamkIIa-Cre Knock In,
(7) Knock-in of light-sensitive on-channel rhodopsin CHR2 to Vgat site: Vgat-CHR2-EYFP Knock In,
(8) Knock-in of the calcium imaging protein Gcamp6s into the Vgat site: Vgat-Gcamp6s Knock In,
(9) Knock-in of cre sequence to Vgat site: Vgat-Cre Knock In,
(10) Knock-in of cre sequence to Chat (Choline acetyltransferase) site: Chat-Cre Knock in,
(11) Chr2 sequence knock-in to Chat site: Chat-CHR2-EFYP Knock in,
(12) Knock-in of Gcamp6s sequence to Chat site: Chat-gcamp6s Knock in,
(13) Knock-in of cre sequence to Drd1 (dopamine receptor D1, Dopamine receptor D1): Drd1-Cre Knock In,
(14) Chr2 sequence knock-in to Drd1: Drd1-Chr2-EYFP Knock In,
(15) Cre sequence knock-in to Drd2 (dopamine receptor D1, Dopamine receptor D2): Drd2-Cre Knock In,
(16) Chr2 sequence knock-in to Drd2: Drd2-Chr2-EYFP Knock In,
(17) Chr2 sequence knock-in to GFAP site: GFAP-CHR2-EFYP Knock in,
(18) Knock-in of cre sequence into GFAP site: GFAP-Cre Knock In,
(19) Knockin of gcamp6s sequence into GFAP site: GFAP-gcamp6s Knock In,
(20) Knock-in of cre sequence to TH (hydroxytryptamine) site: TH-Cre Knock In,
(21) Knock-in of Chr2 sequence to TH site: TH-Chr2-EYFP Knock In,
(22) Knock-in of cre sequence into Nestin site: Nestin-Cre Knock In,
(23) Other tissue- or cell-specific gene knock-ins.

Point mutation:
(1) SOD1 A4V point mutation,
(2) SOD1 H46R point mutation;
(3) SOD1 G93A point mutation;
(4) Foxp2 T327N+N349S point mutation.

Gene knockout:
(1) PRRT2 gene knockout that matches the genetic background of the clone,
(2) FMR1 gene knockout that matches the genetic background of the clone;
(3) an ASPM gene knockout that matches the genetic background of the clone;
(4) DISC1 gene knockout that matches the genetic background of the clone;
(5) MKRN3 gene knockout that matches the genetic background of the clone;
(6) SNCA gene knockout with matching genetic background of the clone,
(7) LRRK2 gene knockout with matching genetic background of the clone,
(8) GBA gene knockout with matching genetic background of the clone,
(9) PRKN gene knockout that matches the genetic background of the clone,
(10) PINK1 gene knockout with matching genetic background of the clone,
(11) PARK7 gene knockout with matching clone genetic background,
(12) VPS35 gene knockout with matching clone genetic background,
(13) EIF4G1 gene knockout with matching clone genetic background,
(14) Bmal1 gene knockout that matches the genetic background of the clone,
(15) LRRK2+PINK1+PARK7 gene knockout with matching clone genetic background.

Somatic Cell Nuclear Transfer As used herein, the term "somatic cell nuclear transfer", also referred to as somatic cell cloning, involves injecting somatic cell nuclei into nucleus-eliminated oocytes and transferring somatic cell nuclei into oocytes. It refers to a method of reprogramming with , reconstructing it as a new embryo, and obtaining an individual animal.
In the present invention, an animal model having a specific genetic modification can be obtained by genetically modifying somatic cells cultured in vitro and then obtaining cloned animals using the genetically modified somatic cells as nuclear donors. . According to this method, an animal model having a complex gene modification can be obtained, and the obtained F0 generation animal model has no chimerism, can be used without passage, and can be obtained with cells of the same strain. The animal model used has a consistent genetic background. Therefore, the present invention constructs a genetically modified non-human primate model by somatic cell nuclear transfer technology.

The main advantages of the invention are as follows.
(1) In the present invention, for the first time, a method for constructing a somatic cell-derived non-human primate cloned animal, comprising a reprogramming activator (e.g., Kdm4d protein, mRNA encoding Kdm4d protein, mRNA encoding Kdm4d protein DNA, or a combination thereof) and an activating treatment (e.g., a calcium ion activator (e.g., ionomycin), histone deacetylase inhibitor (TSA), 6-DMAP, or a combination thereof) to reconstitute eggs (gene Methods are provided for obtaining somatic cell clones of non-human primates (eg, monkeys) by subjecting them to activation and reprogramming treatments (including edited or non-gene-edited ones).

(2) In the present invention, for the first time, a reprogramming activator (for example, H3K9me3 demethylase Kdm4d) significantly improves the developmental ability of non-human primate animal (for example, monkey) nuclear transfer embryos. It was found that it is possible.
(3) In the present invention, for the first time, a dose of 10 to 6000 ng /μl (preferably 50 to 4000 ng/μl, more preferably 80 to Injection of H3K9me3 demethylase Kdm4d (3000 ng/μl) can markedly improve the developmental capacity of SCNT embryos, with more than 50% of embryos developing to the blastoderm stage and 3% of embryos developing to the blastoderm stage. developed to mature individuals.
(4) In the present invention, for the first time, nuclear transfer using Crispr/Cas9-edited cells as nuclear donors is highly efficient and the resulting gene-edited non-human primates (e.g., monkeys) exhibit an off-target phenomenon. It was found that there was no

The present invention will be further described by the following specific examples. It should be understood that these examples are only used to illustrate the invention and are not intended to limit the scope of the invention. In the following examples, experimental methods for which specific conditions are not described were generally carried out under normal conditions or conditions recommended by the manufacturer. Percentages and parts are calculated by weight unless otherwise stated.
Unless otherwise specified, all materials or reagents in the examples are commercially available.

common way
1. Isolation and Culture of Monkey Fetal Fibroblast Cells Take aborted monkey fetuses, remove tissues such as internal organs, head, limbs, and tails, cut the rest of the trunk into small chunks with scissors, and add 1 mg/ml DNA enzyme. and 0.5 mg/ml type IV collagenase in cell culture medium (DMEM+10% FBS+antibiotics+non-essential amino acids+glutamine) for 4 hours (37° C., 5% CO ₂ ). After the digested and dissociated cells were transferred to a 10-centimeter petri dish and grown to fill the dish, the detached primary cells were digested, resuspended in cell culture medium containing 10% DMSO, and cryopreserved. Ready for use. Prior to somatic cell nuclear transfer, the cryopreserved primary cells are recovered and cultured in 6-well plates for subsequent 3 days of cell confluency before use in somatic cell nuclear transfer experiments.

2. Isolation and preparation of cumulus cells from adult female monkeys Collect follicular fluid from cynomolgus/rhesus monkey eggs, centrifuge and wash twice with TH3, resuspend in a small amount of TH3, and store at 4°C in a refrigerator. ready for use.
3. Monkey Superovulation and Oocyte Collection
Healthy, regularly menstruating female cynomolgus monkeys aged 6-12 years are selected to serve as oocyte donors. Inject FSH from the 3rd day of menstruation, 25 IU each time, twice daily for 8 consecutive days. 1000 IU of HCG is injected on the 11th day of menstruation, and 36 hours after the injection of HCG, laparoscopic egg retrieval surgery is started. By laparoscopic surgery, follicular fluid 2-8 mm in diameter is aspirated with a negative pressure aspirator, and oocytes are picked from the follicular fluid with a glass tube in a stereoscope and transferred to CMRL-1066 maturation medium for use.

Four. Cynomolgus Monkey Somatic Cell Nuclear Transfer Engineering Process Oocyte nucleus removal: Transfer 15-20 stage MII oocytes with a glass bottom to an oil-sealed TH3 operating solution containing 5 μg/ml CB, assisted by a spindle visualization system. Observe the position of the oocyte nucleus under an inverted microscope and fix the oocyte with a holding needle to orient the oocyte nucleus at 3 o'clock. A Piezo micromanipulation system breaks the zona pellucida with a 10 μm diameter flat-mouthed needle and aspirates the oocyte nucleus. After completing the nucleation of a set of oocytes, the nucleated oocytes are transferred to HECM-9 medium.
Injection of fibroblasts into enucleated oocytes: Transfer 15-20 enucleated oocytes to an oil-sealed TH3 working solution containing 5 μg/ml CB and fix the oocytes with a holding needle. , orient the polar body at 12 o'clock or 6 o'clock. A single slit is formed by breaking the zona pellucida using a laser zona pellucida incision system, fibroblasts are aspirated with an oblique needle with a diameter of 15-18 μm, the cells are transferred to HVJ-E, soaked for 10 seconds, and the cells are aspirated. , the somatic cell is injected into the perivitelline space of the enucleated oocyte through the slit of the zona pellucida, and the somatic cell fuses with the oocyte in about 10 minutes.

Injection of cumulus cells into enucleated oocytes: Transfer 15-20 enucleated oocytes to an oil-sealed TH3 working solution containing 5 μg/ml CB, fix the oocytes with a holding needle, Position the polar body at 12 o'clock or 6 o'clock. A single slit is formed by breaking the zona pellucida with a laser zona pellucotomy system, cumulus cells are aspirated with an oblique needle with a diameter of 10 μm, the cells are transferred to the HVJ-E and soaked for 10 seconds, then the cells are aspirated and translucent. The nucleus-removed oocyte is injected in the 9 o'clock direction through the slit in the belt, and the somatic cell fuses with the oocyte in about 10 minutes.
In Vitro Activation of Nuclear Transfer Embryos: Embryonic activation can be performed 1-1.5 hours after fusion of somatic cells and nuclear-depleted oocytes. Embryos were transferred to TH3 containing 5 μM ionomycin for 5 min, then transferred to HECM-9 medium containing 2 mM 6-DMAP and 10 nM TSA for 5 h, followed by HECM-9 containing 10 nM TSA. and cultured for 5 hours, and finally transferred to HECM-9 medium and cultured.
Injection of Kdm4d mRNA: After activating the embryos for 5-6 hours, transfer the activated embryos to an oil-sealed TH3 working solution containing 5 μg/ml CB, fix the embryos with a holding needle, and perform Piezo micromanipulation. According to the system, a flat-mouth injection needle with a diameter of 2-3 μm is used to break the zona pellucida deep into the embryo, break the cell membrane of the embryo, and inject 1000 ng/μl of Kdm4d mRNA into the embryo, injecting about 10 pl into each embryo. After injection, embryos are transferred to HECM-9 medium and cultured at 37° C., 5% CO ₂ .

Five. Culture of Cloned Embryos and Embryo Transfer Embryo Culture: Cloned embryos are first cultured in HECM-9 medium and when they reach the 8-cell stage, they are transferred to HECM-9 medium containing 5% FBS for 7-8 days. Change the solution every other day until the scutellum appears in the eye.
Embryo transfer: Healthy adult female monkeys at the macrofollicular stage or ovulatory stage are selected to be used for embryo transfer. Three to seven 2-cell to blastoderm stage embryos are transferred into the oviducts of female monkeys by microwound surgery.

6. In vitro transcription of Kdm4d mRNA
Primer containing T7 promoter
(F: TTAATACGACTCACTATAGGGATGGAAACTATGAAGTCTAAGGCCAACT (SEQ ID NO: 1), R: ATATAAAGACAGCCCGTGGACTTAGG (SEQ ID NO: 2)) by amplifying the human Kdm4d gene CDS region from a plasmid carrying the Kdm4d gene sequence, purifying and recovering the amplified fragment, and using mMESSAGE mMACHINE. After in vitro transcription by T7 ULTRA kit (Life Technologies, AM1345), the transcript was purified by MEGA clear kit (Life Technologies, AM1908) and dissolved in RNAse-free water.

7. Animal Ethics Statement The use and care of cynomolgus monkeys (Macaca fascicularis) is in accordance with the review dossier entitled "Somatic Cell Nuclear Transfer in a Genetically Modified Monkey Model (ION-2018002)" approved by the Animal Committee of the Shanghai Academy of Life Sciences, Chinese Academy of Sciences. . In the experiment, the monkeys used were placed in an air-conditioned environment (temperature: 22 ± 1°C, humidity: 50% ± 5% RH) and subjected to a 12-hour light/12-hour dark cycle (07:00-19:00). :00). All feeds were purchased from Suzhou AMUFI Co., Ltd., twice daily, and the silage feed was mainly fruits and vegetables, replenished once daily.

8. Fibroblast Culture, Genetic Analysis and Karyotyping Construction of BMAL1 Editing from the Outer Thigh Anesthetized Primary Monkey A6 Skin A piece of skin is excised. Tissues are washed three times with PBS containing penicillin and streptomycin, then cut into small pieces (1-2 mm ² ) and cultured in 6 cm Petri dishes. After 10 days, fibroblasts grown from tissue explants are passaged into 10 cm Petri dishes and every 3 days thereafter at a 1:3 ratio.
A6 monkey ear tissue, blood cells and cultured fibroblasts are taken and used for genotypic analysis. The forward primer for the BMAL1 detection site was ACCATCGGCTGCGTACACCTCTAT and the reverse primer was ATTTCAGGTGTGAGCCACTCCACC, and the PCR product was TA cloned prior to sequencing analysis.
Karyotype analysis: A6 fibroblasts grown in 10 cm dishes were treated with 100 ng/ml demecolcine for 4-6 hours, then digested with 0.25% trypsin-EDTA, and treated with 0.075 M potassium chloride for 30 minutes at 37°C. do. Hypopermeabilized cells are fixed in methanol and acetic acid (3:1) for 30 minutes before being dropped onto slides and finally subjected to Giemsa staining and chromosome counting.

9. Superovulation and Embryo Collection Cynomolgus monkey superovulation and oocyte collection methods are described above. Healthy female monkeys are injected into muscle with 25 IU of recombinant human ovarian stimulating hormone twice daily from day 3 to day 11 of menstruation.
1000 IU of human chorionic gonadotropin (hCG) is injected intramuscularly on the night of the 11th day of menstruation, and oocyte collection is performed the following day with a laparoscopic egg and negative pressure aspiration system. Collected oocytes are cultured in equilibrated HECM-9 medium. The oocyte in the second meiotic metaphase is designated as SCNT.

Ten. Somatic Cell Nuclear Transfer, Embryo Culture, Embryo Transfer Spindle-chromosome complexes are rapidly removed with a piezo-driven nucleus removal needle in the Oosight system. After punching a hole in the zona pellucida of the oocyte whose nucleus has been removed with a laser, fibroblasts labeled with HVJ-E are injected into the perivitelline space with an oblique needle to induce their fusion. Reconstructed nuclear transfer embryos were activated in TH3 (HEPES-buffered TALP medium, containing 0.3% bovine serum albumin), first treated for 5 minutes in TH3 containing 5 mM ion carrier, followed by 2 mM 6-dimethylamine. Treat for 5 h in TH3. Nuclear transfer embryos are treated with 10 nM Trichostatin (TSA) for 10 h and injected with 10 pl of 1000 ng/ml Kdm4d mRNA 6 h after activation.
Cultivation of embryos was performed in HECM-9 medium and the incubator conditions were 37° C. and 5% carbon dioxide. When embryos reach the 8-cell stage, they are transferred to HECM-9 medium with 5% fetal bovine serum, followed by one medium change every other day until the blastoderm stage. Well-developed 2- to 8-cell stage embryos are transferred into the oviducts of synchronous female monkeys (with ovulation point or corpus luteum).

11. Genetic Analysis of Cloned Monkeys Genomic DNA is extracted from ear tissue of cloned monkeys and used for short tandem overlap (STR) analysis. Site-specific primers containing fluorescent dyes (FAM/HEX/TMR) are used for PCR amplification. Fluorescent dye-labeled STR amplicons are diluted in a mixture of ROX500 and deionized formamide, followed by capillary electrophoresis on an ABI PRISM 3730 genetic analyzer to obtain raw data. The source data were converted to Excel files with Gene Marker 2.2.0 and included size and genotype information, DNA samples and graphs.
For single nucleotide polymorphism (SNP) analysis, mtDNA is also extracted from monkey ear tissue samples. The mtDNA is amplified with specific primers (F: CCACTTCACATCAAACCATCACTT R: CAAGCAGCGAATACCAGCAAAA) and the PCR products are used for sequencing and SNP analysis.

12. RT-PCR
0.5 mL each of blood is collected from A6, B1 and 2 wild-type monkeys and mRNA is extracted by total RNA TRIzol® Reagent (Invitrogen) kit. Total RNA was then reverse transcribed into cDNA by PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time, Takara, Japan) kit. A 201 bp target fragment of wild-type BMAL1 is amplified with BMAL1 primers (forward primer: 5'-TAACCTCAGCTGCCTCGTTG-3', reverse primer 5'-TATTCATAACACGACGTGCC-3'), followed by electrophoretic analysis.

Example 1 Establishment and Optimization of Manipulation Process of Monkey Nuclear Transfer Technology Cell nuclei of rat and mouse oocytes are clearly recognizable under an ordinary inverted microscope and can be easily aspirated and removed with a micromanipulation needle. On the other hand, the cell nuclei of primate oocytes cannot be clearly recognized under an ordinary inverted microscope, and conventional methods for removing monkey oocyte nuclei include the fluorescence localization method after Hoechst staining and the aspiration method. Both of these two methods result in very large loss of embryos and are likely to affect the subsequent development efficiency of the embryos. In this study, we used a polarization-based spindle visualization system (Oosigt Imaging System) in which monkey oocyte nuclei are clearly visible and do not affect oocyte quality. After extensive training, the monkey oocyte nucleus was aspirated out by breaking the transparent body with a piezo-driven 10 μm micromanipulation needle after clearly recognizing the position of the monkey oocyte nucleus with the spindle visualization system. In order to inject the somatic cells into the nucleus-eliminated oocytes, a laser zona incision system was used to assist the injection of the somatic cells, and inactivated Sendai virus was used to inject the monkey fetal somatic cells and the nucleus-eliminated oocytes. induced the fusion of After fusion, the somatic cell nucleus assembles again in the form of an oocyte nucleus. (Fig. 1A-H, Fig. 5A, B)

Example 2 Study of the effects of histone deacetylase inhibitors on the developmental efficiency of monkey clone embryos One of the reasons for the low efficiency of somatic cell nuclear transfer at present is that somatic cell DNA has abnormalities in the reprogramming process of oocytes. It is believed that this occurs and results in an abnormal increase in DNA methylation. In addition, increasing histone acetylation levels can reduce DNA methylation levels. In our experiments, when cynomolgus monkey SCNT embryos were cultured in vitro after normal activation (ionomycin and dimethylaminopyridine (6-DMAP)), 4/30 embryos reached the blastoderm stage. Although developed, all four scutellums were of poor quality and lacked a prominent inner cell mass. On the other hand, when the histone deacetylase inhibitor TSA (10 nM, 10 h) was added during and after embryo activation, 5/31 of the TSA-treated embryos developed to the scutellum. rice field. Although the scutellum rate was close to I/D activation, in the TSA-supplemented group, the quality of the scutellum was slightly improved, with inner cell mass in 2 out of 5 scutellums. (Figure 2A, B, Figure 5C, D)

Example 3 Study of Effect of Optimization of Embryo Activation Conditions on Developmental Efficiency of Monkey Cloned Embryos In studies of human somatic cell nuclear transfer cloned embryos, activation of embryos with conventional ionomycin and dimethylaminopyridine (6-DMAP) was performed. It was reported that, besides transduction, electrical stimulation and puromycin can also markedly improve the developmental efficiency of human cloned embryos. In experiments to optimize the activation conditions of the present invention, electrical stimulation, ionomycin, dimethylaminopyridine, puromycin and the histone deacetylase inhibitor TSA were used comprehensively to generate 54 somatic cloned embryos of cynomolgus monkeys. Of these, 18 (33.3/%) developed to the scutellum, 8 of which had prominent inner cell masses.
Compared to simple ionomycin and dimethylaminopyridine embryo activation and experimental ionomycin, dimethylaminopyridine and TSA treatments, optimized embryo activation conditions markedly improved the developmental potential of monkey somatic cell nuclear transfer embryos. was able to improve Embryos constructed by this method were transferred into the oviducts of female monkey recipients, and although several donors were transferred, monkey somatic cell nuclear transfer did not result in a pregnant donor.

Example 4 Effects of Embryo Assembly Method on Efficiency of Non-Human Primate Somatic Cell Nuclear Transfer It is useful as one of the indicators of superiority or inferiority of the quality of cell aggregates. In the present study, the number of cells at the blastoderm stage of mouse cloned embryos was half that of normal IVF embryos, and similarly, the number of ICMs in the scutellum of mouse cloned embryos was about half that of IVF embryos. was found to be The abundance of ICM in cloned embryos is closely related to the expression of Oct4 gene in ICM. In the monkey somatic cell nuclear transfer embryo aggregation experiment of the present invention, first, a normal cynomolgus monkey embryo obtained by one single sperm injection and three somatic cell nuclear transfer embryos were aggregated and grown together, and 10 transplanted Of the donors, 3 gestational recipients and 2 live-lived monkeys were obtained, but genetic analysis indicated that the 2 surviving monkeys were both from normal monkey embryos obtained by monosperm injection. However, SCNT embryos were not involved in individual development. Then, 3-4 all-SCNT embryos were grouped and grown together. Several pregnant recipients were obtained, but all had premature abortions and no survivors.

Example 5 Effect of H3K9me3 Demethylase on Efficiency of Monkey Somatic Cell Nuclear Transfer In the process of somatic cell nuclear transfer, defects in the somatic cell nuclear reprogramming process of oocytes lead to decreased efficiency. Analyzing the reasons for reprogramming defects and resolving these defects accordingly can improve the efficiency of somatic cell nuclear transfer.
In this example, 38 nuclear transfer embryos could be constructed using fetal cynomolgus monkey fibroblasts, and after undergoing Kdm4d mRNA injection, 17 developed to the blastoderm stage, 11 of which were prominent in the blastoderm. There was a large inner cell mass (Fig. 1I, Fig. 2A, B). To determine the effect of Kdm4d on other donor somatic cell nuclear transfer embryos, and using adult monkey cumulus cells as somatic cell donors, 33 nuclear transfer embryos could be constructed, and after Kdm4d mRNA injection, 24 nuclear transfer embryos could be constructed. developed to the scutellum stage, 15 of which had a prominent inner cell mass (Fig. 6, Fig. 2C,D).

Furthermore, in order to understand the mechanism by which Kdm4d mRNA enhances the developmental ability of monkey nuclear transfer embryos, we investigated 4- and 8-cell stage embryos obtained by single sperm injection (ICSI) of normal monkeys and Kdm4d-injected and Kdm4d-uninjected embryos. Transcriptome sequencing was performed on 8-cell stage embryos from monkey nuclear transfer. By comparing the transcriptomes of normal ICSI 4-cell and 8-cell stage embryos and picking out regions whose expression levels were >5-fold higher at the 8-cell stage than at the 4-cell stage, 3997 transcriptional activations got the realm. We then analyzed these 3997 regions in the transcriptome of 8-cell stage nuclear transfer embryos uninjected with Kdm4d and found that 2465 regions were not activated. is called the reprogramming resistance region. We compared and analyzed the reprogramming resistance regions in the transcriptome of Kdm4d-injected 8-cell stage nuclear transfer embryos, and found that the expression levels of 2178 regions were significantly enhanced.
These results indicate that the H3K9me3 demethylase Kdm4d can remarkably improve the developmental ability of monkey nuclear transfer embryos. (Fig.2E)

Example 6 Effect of H3K4me3 Demethylase on Efficiency of Monkey Somatic Cell Nuclear Transfer In this example, verification was performed at the level of cynomolgus monkey somatic cell nuclear transfer embryos.
A total of 20 monkey somatic cell nuclear transfer embryos were injected and two scutellums were obtained, with a scutellum rate of only 10%, and the H3K4me3 demethylase Kdm5b was significant in improving the efficiency of monkey somatic cell nuclear transfer embryos. shown to be ineffective.

Example 7 Acquisition of Somatic Cell Nuclear Transfer Cloned Monkeys Using Fetal Cynomolgus Monkey Fibroblasts In this Example, somatic cell nuclear transfer cloned monkeys were constructed using primary fibroblasts of female cynomolgus monkey fetuses as donor cells.
A total of 127 stage MII oocytes were manipulated by processes in a common manner, and 109 1-pronuclei were generated after undergoing processes such as oocyte nucleus removal, somatic cell injection and embryo activation. embryos were obtained (Fig. 6). The 109 embryos were injected with Kdm4d mRNA, and 79 of the 2-, 2-4-, 8-, 8-16-, or blastoderm stage embryos were subdivided into 21 embryos. After transplantation into recipient female monkeys and verification by ultrasound B-mode, 6 pregnant female monkeys could be obtained. Of these, four pregnant female monkeys had gestational sacs and fetuses in their wombs, while the other two pregnant female monkeys had only gestational sacs and no fetuses. Of the 4 fetal female monkeys, 2 had premature abortions. Two other pups were obtained by caesarean section at 155 days (note: transplanted into surrogates at the 8-16 cell stage) and 141 days respectively. These two pups were named 'Chuchu' and 'Hanahua' (note: they were transplanted into surrogate mothers at the 2-4 cell stage). The two pups are in good health at 28 and 18 days of age. (Fig. 3A-E, Fig. 4A, B)

Example 8 Acquisition of Somatic Cell Nuclear Transfer Cloned Monkeys Using Adult Cynomolgus Monkey Cumulus Cells In this example, cloned monkeys were constructed using adult female cynomolgus monkey cumulus cells as cell nucleus donors.
A total of 290 MII-stage oocytes were manipulated by the same process as in Example 7, and after undergoing processes such as oocyte nucleus removal, somatic cell injection and embryo activation, 192 1 Pronuclear embryos were obtained. The 192 embryos were injected with Kdm4d mRNA, and 181 of the 2-cell-blastoderm stage embryos were transferred to 42 recipient female monkeys and verified by B-mode ultrasound. , we were able to obtain 22 pregnant female monkeys. Of these, 12 pregnant females had gestational sacs and fetuses in their wombs, while the other 10 pregnant females had only gestational sacs and no fetuses. Of the 12 fetal-bearing female monkeys, 8 aborted prematurely and 2 aborted at 84 and 94 days, respectively. The remaining 2 were able to develop over 130 days and 2 live born pups were obtained by caesarean section at 137 and 135 days. The two pups were named 'A' and 'B'. Baby monkey A had stagnation in physical development and died of respiratory failure after only 3 hours of life after birth. rice field. (Fig. 3C, D, E)

Example 9 Obtaining Somatic Cell Nuclear Transfer Cloned Monkeys Using Adult Rhesus Cumulus Cells Currently, the two most used non-human primates in scientific research include cynomolgus monkeys and rhesus monkeys. Studies in the above examples of the present invention have already suggested that the above specific treatment methods of the present invention significantly improve the efficiency of nuclear transfer in mammals.
In this example, the common method was applied to somatic cell nuclear transfer embryos of rhesus monkeys to further verify the efficiency of H3K9me3 demethylase in non-human primate somatic cell nuclear transfer.
result
Of 10 rhesus somatic cell nuclear transfer embryos injected with H3K9me3 demethylase, 7 developed to the blastoderm stage. This embryo transfer also now yielded a pregnant recipient of a rhesus somatic cell nuclear transfer embryo and a rhesus monkey clone "C" that developed to 130 days. This result indicated that the method of the present invention can be applied to other non-human primates, especially monkeys.

Example 10 Genetic Analysis of Clonal Monkeys Derived from Somatic Cell Nuclear Transfer
Single nucleotide polymorphism (SNP) and microsatellite sequence (STR) analyzes were performed on the four pups to verify the genetic origin of the nuclear genomic and mitochondrial DNA of the five pups born. rice field. We analyzed 27 microsatellite sites in the pups "Chuchu" and "Huahua", the donor cells, the respective surrogate female monkeys and the respective egg donor female monkeys. '' matched the genomes of the donor cells, but not those of the surrogate female monkey and the egg donor female monkey. SNP analysis was performed by sequencing the ND3 gene in the mitochondrial DNA of the pups "Chong Chu" and "Hua Hua", the donor cells, the respective surrogate female monkeys and the respective egg donor female monkeys. The mitochondrial genomes of "Naka" and "Hua Hua" matched those of donor cell monkeys, but not those of surrogate female monkeys and egg donor female monkeys. By the same method, SNP and STR analysis was performed on ``A'' and ``B'' who died after birth, and the nuclear and mitochondrial genomes of ``A'', ``B'' and ``C'' monkeys were and cumulus cell donor monkeys, differing from surrogacy recipients. These genetic analyzes proved that these five pups were indeed cloned by cloning technology. (Figures 4C, D, E, Figures 7 and 8)
Analysis of 27 STR sites in 4 somatic cloned monkeys and their oocyte donors, somatic donors and pregnant recipients showed that the nuclear DNA of these 4 somatic cloned monkeys was indeed derived from donor somatic cells. confirmed to be from

Example 11 Construction of genetically modified animal models of non-human primates by somatic cell nuclear transfer technology (using cynomolgus monkeys/rhesus monkeys as examples)
In the present invention, the reason for making efforts to realize clonal monkeys by somatic cell nuclear transfer technology is the scientific significance of the technology itself, as well as the superiority of this technology in the construction of genetically modified animal models. In the present invention, an animal model having a specific genetic modification can be obtained by genetically modifying somatic cells cultured in vitro and then obtaining cloned animals using the genetically modified somatic cells as nuclear donors. . According to this method, an animal model having a complex gene modification can be obtained, and the obtained F0 generation animal model has no chimerism, can be used without passage, and can be obtained with cells of the same strain. The animal model used has a consistent genetic background. Therefore, constructing a genetically modified non-human primate model by somatic cell nuclear transfer technology can solve all the above problems. Presently, in the present invention, genetically modified non-human primate models that are being performed by this technology are as follows.

1. Accurate gene knock-in model of cynomolgus/rhesus monkey constructed by somatic cell nuclear transfer technology:
(1) Knock-in of green fluorescent protein to AAVS1 site: AAVS1-GFP Knock In,
(2) knock-in of cre sequence to AAVS1 site: AAVS1-Cre Knock In,
(3) LSL-CHR2 sequence knock-in to AAVS1 site: AAVS1-LSL-CHR2 Knock In,
(4) Knock-in of light-sensitive on-channel rhodopsin CHR2 to CamkIIa site: CamkIIa-CHR2-EYFP Knock In,
(5) Knock-in of the calcium imaging protein Gcamp6s into the CamkIIa site: CamkIIa-Gcamp6s Knock In,
(6) Knock-in of cre sequence into CamkIIa site: CamkIIa-Cre Knock In,
(7) Knock-in of light-sensitive on-channel rhodopsin CHR2 to Vgat site: Vgat-CHR2-EYFP Knock In,
(8) Knock-in of the calcium imaging protein Gcamp6s into the Vgat site: Vgat-Gcamp6s Knock In,
(9) Knock-in of cre sequence to Vgat site: Vgat-Cre Knock In,
(10) Knock-in of cre sequence to Chat (Choline acetyltransferase) site: Chat-Cre Knock in,
(11) Chr2 sequence knock-in to Chat site: Chat-CHR2-EFYP Knock in,
(12) Knock-in of Gcamp6s sequence to Chat site: Chat-gcamp6s Knock in,
(13) Knock-in of cre sequence to Drd1 (dopamine receptor D1, Dopamine receptor D1): Drd1-Cre Knock In,
(14) Chr2 sequence knock-in to Drd1: Drd1-Chr2-EYFP Knock In,
(15) Cre sequence knock-in to Drd2 (dopamine receptor D1, Dopamine receptor D2): Drd2-Cre Knock In,
(16) Chr2 sequence knock-in to Drd2: Drd2-Chr2-EYFP Knock In,
(17) Chr2 sequence knock-in to GFAP site: GFAP-CHR2-EFYP Knock in,
(18) Knock-in of cre sequence into GFAP site: GFAP-Cre Knock In,
(19) Knockin of gcamp6s sequence into GFAP site: GFAP-gcamp6s Knock In,
(20) Knock-in of cre sequence to TH (hydroxytryptamine) site: TH-Cre Knock In,
(21) Knock-in of Chr2 sequence to TH site: TH-Chr2-EYFP Knock In,
(22) Knock-in of cre sequence into Nestin site: Nestin-Cre Knock In,
(23) Other tissue- or cell-specific gene knockins models.

2. A cynomolgus/rhesus monkey point mutation model constructed by somatic cell nuclear transfer technology:
(1) SOD1 A4V point mutation,
(2) SOD1 H46R point mutation;
(3) SOD1 G93A point mutation;
(4) Foxp2 T327N+N349S point mutation.

3. A disease or developmental disorder model of genetic knockout in multiple genetically matched cynomolgus/rhesus monkeys cloned by somatic cell nuclear transfer technology:
(1) PRRT2 gene knockout monkey model with matching clone genetic background,
(2) FMR1 gene knockout monkey model with matching clone genetic background,
(3) an ASPM gene knockout monkey model that matches the genetic background of the clone;
(4) a DISC1 gene knockout monkey model in which the genetic background of the clone matches;
(5) MKRN3 gene knockout monkey model with matching clone genetic background,
(6) SNCA gene knockout monkey model with matching genetic background of clones,
(7) an LRRK2 gene knockout monkey model in which the genetic background of the clone matches;
(8) a GBA gene knockout monkey model in which the genetic background of the clone matches;
(9) a PRKN gene knockout monkey model in which the genetic background of the clone matches;
(10) a PINK1 gene knockout monkey model in which the genetic background of the clone matches;
(11) a PARK7 gene knockout monkey model in which the genetic background of the clone matches;
(12) a VPS35 gene knockout monkey model in which the genetic background of the clone matches;
(13) an EIF4G1 gene knockout monkey model in which the genetic background of the clone matches;
(14) a Bmal1 gene knockout monkey model in which the genetic background of the clone matches;
(15) LRRK2+PINK1+PARK7 gene knockout monkey model with matching genetic background of clones.

Four. Transgenes for studying diseases such as Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, autism, depression, and Huntington's disease with matching genetic backgrounds cloned by somatic cell nuclear transfer technology and a cynomolgus/rhesus monkey model of gene knockout.

Example 12 Production of Somatic Cells from BMAL1 Gene Knockout Cynomolgus Monkeys
ARNT-like 1 (BMAL1) is a transcription factor that regulates the day-night rhythm. In the present invention, five individual BMAL1 gene-edited cynomolgus monkeys were obtained by the CRISPR/Cas9 method. Among them, monkey A6 was selected and cloned as a donor cell-providing monkey because the expression of BMAL1 protein was not detected in this monkey, and the physiological circulation of blood hormones was suppressed, frequent nighttime activities, and rapid eyeballs were observed. It showed marked physiological disorders, including decreased motor (REM) and periods of non-rapid eye movement sleep, and behaviors associated with psychiatric disorders. Therefore, A6 monkey skin fibroblasts were taken, cultured and used for SCNT (Fig. 9A-C).
The fibroblast karyotype after culture shows a normal diploid, with 42 chromosomes (Fig. 9D). Genotypic analysis was performed on A6 monkey ear cusp tissue, blood cells and fibroblasts, and single clone sequencing of the PCR products revealed both "-8bp" and "-8bp, +4bp,2bp PM , two types of BMAL1 mutations were found (Fig. 9E). After that, genotype analysis of a single fibroblast revealed that the BMAL1 gene had a homozygous gene mutation of "-8bp/-8bp" or a heterogeneous gene mutation of "-8bp/-8bp, +4bp, 2bpPM". It was shown to be present (Figure 9F).

1. SCNT using BMAL1-edited monkey fibroblasts
SCNT was performed using fibroblasts derived from BMAL1 gene-edited monkey A6. Female monkeys were superovulated to obtain mature oocytes. SCNT oocytes were then obtained by fusing single fibroblasts and nuclear-depleted oocytes with the help of Sendai virus and incubated with calcium ion carriers and 6-dimethylamine. To promote reprogramming of the epigenome after nuclear transfer, SCNT embryos were incubated with the histone deacetylase inhibitor Trichostatin (TSA) and simultaneously injected with the mRNA of the H3K9me3 demethylating factor Kdm4d (Fig. 10A, B). When SCNT was performed on BMAL1 gene-edited monkey A6 fibroblasts, a high percentage of scutellum formation was obtained (10/17, 58.8%). Of these scutellums, 80% (8/10) formed a prominent inner cell mass (ICM), a signature of normal development of the embryo. Due to the high efficiency of blastocyst formation and ICM formation, 325 SCNT embryos were transferred early in development (2-8 cells) to 65 surrogate female monkeys, of which 16 female monkeys became pregnant. Finally, five live-born cloned monkey individuals (B1-B5) were obtained, and all of them are currently living in artificial rearing (currently 51-141 days old) (Fig. 10C, Table 1). We also studied the relationship between the number of passages of cultured fibroblasts in SCNT and the cloning efficiency, and found that, as shown in Table 1, fibroblasts passaged four times were recipients after performing SCNT. Although monkey pregnancy rates and monkey live birth rates were the best, it was shown that the clonal success rate may be related to the number of passages in culture of the donor cells.

2. Genotype Analysis of Cloned Monkeys First, BMAL1 genotypes were analyzed by taking auricle apical tissue from five cloned monkeys. Four cloned monkeys (B1, B3, B4, B5) had homozygous mutations (-8bp/-8bp, +4bp, 2bpPM) in the BMAL1 gene, and one monkey (B2) had a heterozygous mutation in the BMAL1 gene. It was found to have a mutation (“-8bp/-8bp”) (Fig. 10D). This is similar to previously detected mutant genotypes in donor fibroblasts and in monkey A6.
To confirm the genetic origin of clonal monkeys, we analyzed single nucleotide polymorphisms (SNPs) in mitochondrial DNA (mtDNA) and short tandem duplications in nuclear DNA. The ND3 gene in the mitochondrial DNA of the cloned monkeys was found to be similar to that of the respective oocyte donor monkeys, but different from the recipient monkeys and donor fibroblasts (FIGS. 11A-E). STR analysis of 29 sites showed that the nuclear DNA of donor fibroblasts and monkey A6 from 5 cloned monkeys was similar but different from that of recipient and oocyte donor monkeys. was shown (Fig. 11F).
Although whole-genome sequencing and PCR analysis demonstrated that the BMAL1 gene-edited monkey A6 had no off-target events, off-target analysis was performed on the genomic DNA of five cloned monkey ear tissues. No mutations were found at sites other than the expected potential targets. Also, wild-type BMAL1 transcripts were not detected in the blood of B1 clone monkeys (the remaining four clones were not yet old enough to draw blood). (Fig. 11G).

Discussion In the present invention, we knocked out the key gene BMAL1 associated with rhythm in the cynomolgus monkey genome by the CRISPR/Cas9 system, and obtained five gene-edited monkeys. In this study, fibroblasts isolated from the skin of one monkey with remarkable findings were used as somatic cell nucleus donors, and five BMAL1 gene-edited clone monkeys were obtained. Sequence alignments and microsatellite analyzes and comparisons of mitochondrial DNA for the constructed founder monkeys and cloned monkeys showed that these cloned monkeys had a similar genetic background to the constructed founder monkeys. These results indicate that the CRISPR/Cas9-edited cynomolgus monkey disease model is useful as a donor for nuclear transplantation and that cloned monkeys with matching genetic backgrounds can be obtained. offered a favorable future.

Applicants noted that in previous studies fibroblasts from a single aborted female monkey fetus were used as nuclear donors and cloned to yield 'Chuchu' and 'Huahua'. The difference is that this experiment used fibroblasts isolated from the skin of a single 16-month-old juvenile monkey, and for the first time demonstrated the feasibility of male cells as nuclear donors. . Although the current cloning efficiency is still low, we further optimized the fibroblast culture conditions and found, for example, that fibroblasts have a higher efficiency of cloning after several passages than that of primary cells. served. In addition, Kdm4d, as a demethylase of H3K9me3, can significantly improve reprogramming efficiency in mice and monkeys by removing reprogramming methylated regions in nuclear transfer embryos. Xist-mediated X chromosome silencing is also likely to be conserved in mice, pigs and primates. Alternatively, DNA remethylation and deletion of H3K27me3 may also be factors affecting cloning efficiency.

In theory, positive cells that have undergone in vitro gene editing and screening are the most ideal choice as nuclear donors. Applicants used cells isolated from adult edited monkeys in this experiment because the BMAL1 gene of this construct primary monkey was completely knocked out and exhibited a dysrhythmia phenotype similar to humans. selected as a donor. There are two main genotypes in primary monkeys constructed by detection: homozygous for 8bp knockout (“-8bp/-8bp”) and heterozygous for 8bp knockout, 4bp knockout and 2bp point mutation (“-8bp/-8bp/-8bp”). 8bp, +4bp, 2bp PM'). Since each of the five cloned monkeys had one genotype, indicating that this chimerism was absent in the five cloned monkeys, the present inventors have matured the current cloning methods and clonal monkey phenotypes are further analyzed.

All documents pertaining to the present invention are incorporated by reference in this application, as if each document were individually cited. Also, after reading the above contents of the present invention, those skilled in the art may make various variations and modifications of the present invention, and equivalent forms thereof should be included in the scope of the claims of the present invention. should be understood.

Claims (6)

A method for producing a non-human primate somatic cell clone animal, comprising:
(i) providing a reconstructed egg derived from the non-human primate animal;
(ii) obtaining an activated reconstructed egg by performing an activation treatment on the reconstructed egg ;
(iii ) obtaining a reprogrammed reconstructed egg by reprogramming the activated reconstructed egg ;
(iv) obtaining a non-human primate SCNT cloned animal by regenerating the reprogrammed reconstructed egg ;
In the step (ii), activation treatment is performed with electrical stimulation and an activation treatment agent, and the activation treatment agent is a calcium ion activator, a histone deacetylase inhibitor, and dimethylaminopyridine (6-DMAP). , and puromycin combinations,
In the step (iii), reprogramming treatment is performed with a reprogramming activator, and the reprogramming activator contains mRNA encoding Kdm4d protein.
the aforementioned method. 2. The method of claim 1, wherein said reprogramming activator is the mRNA encoding the Kdm4d protein. 2. The method of claim 1, wherein said reprogramming process comprises injecting mRNA encoding Kdm4d protein into said reconstructed eggs . 4. The method of claim ³ , comprising injecting 102-108 copies/cell of mRNA encoding ^Kdm4d protein into said reconstructed eggs . The step (iv) is
(iv1) culturing the reprogrammed reconstructed egg in vitro or in vivo to form a reconstructed embryo ; and
(iv2) obtaining the SCNT cloned animal of the non-human primate by transplanting the reconstructed embryo into the oviduct of the non-human primate. Less than:
(a) a first container containing a reprogramming activator, wherein said reprogramming activator comprises an mRNA encoding a Kdm4d protein;
(b) a second container containing an activating agent, wherein the activating agent comprises a calcium ion activator, a histone deacetylase inhibitor, dimethylaminopyridine (6-DMAP), and puro said second container comprising a combination of mycins;
(c) a kit for producing non-human primate SCNT cloned animals for use in the method according to any one of claims 1 to 5, comprising a label or instructions;