CN104946621A - Gene knock-in composition and use method and application thereof - Google Patents
Gene knock-in composition and use method and application thereof Download PDFInfo
- Publication number
- CN104946621A CN104946621A CN201410124307.2A CN201410124307A CN104946621A CN 104946621 A CN104946621 A CN 104946621A CN 201410124307 A CN201410124307 A CN 201410124307A CN 104946621 A CN104946621 A CN 104946621A
- Authority
- CN
- China
- Prior art keywords
- sequence
- recombinase
- dna
- seq
- present
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a gene knock-in composition containing a single incision enzyme or polynucleotide coding the same, recombinase or polynucleotide coding the same, and an optional donor DNA containing an exogenous gene. The invention also provides a corresponding gene knock-in method and a method for preparing a transgenic non-human mammal model. The composition and the methods provided by the invention can be used for realizing efficient homologous recombination integration, and meanwhile various defects of insertion or deletion, genome instability and the like which are generated easily in the prior art can be avoided.
Description
Technical field
The present invention relates to biological technical field.Specifically, the present invention relates to the gene knock-in compoistion and method of use exogenous DNA fragmentation being imported accurately and efficiently mammalian genes group and application.
Background technology
The ultimate principle of current genome fixed point transformation utilizes DNA double chain breach (double-strain break that is spontaneous in target site district or that bring out, DSB), DNA repair mechanism in activating cells is carried out genomic transformation by double-strand breach, and the end in such as non-homogeneous district connects (NHEJ) or homologous recombination (HR) (shown in Fig. 1).
In cell, the probability of the spontaneous generation of optimistic estimate DSB is lower than 10
4if adopted playback endonuclease (homing endonuclease) such as I-SceI, I-AniI by genetically engineered, the nucleases such as FoxI, Cas9 bring out DSB, and efficiency can be increased to more than 10%.But the generation of DSB can cause genomic instability, be included in local near DSB and produce insertion or disappearance (insertions and deletions, indels), such as random disappearance, rearrangement etc.DSB can also produce uncertain change in other regions beyond target site, thus causes the generation of genome unstable (chromosomal instability).Even if deposit in case in homologous sequence template, DSB produces genome and destroys the reaction brought out mainly based on NHEJ, although have partial reaction can carry out recombinational repair with the template with homologous sequence, because the generation of indel also will introduce uncertain sudden change in homologous recombination repair.Therefore, utilize manufacture DSB realize genome precisely fix a point transform efficiency lower.
In sum, physical means and the method that exogenous DNA fragmentation can be imported accurately and efficiently the gene knock-in of mammalian genes group are badly in need of in this area.
Summary of the invention
The object of the present invention is to provide one to increase substantially homologous recombination efficiency, thus carry out accurately and efficiently gene knock-in composition and in gene knock-in or the purposes prepared in transgenic nonhuman mammal model.
Another object of the present invention is to provide a kind of method of carrying out gene knock-in accurately and efficiently.
The present invention also has an object to be to provide a kind of method preparing transgenic nonhuman mammal model.
In first aspect, the invention provides a kind of composition for gene knock-in, described composition comprises following component:
1). single nickase or its coded polynucleotide;
2). recombinase or its coded polynucleotide; With
3). optional, comprise the donor dna of allogenic gene.
In another embodiment, described single nickase produces 2 or more single stranded gaps on the DNA sequence dna for being transformed.
In a preferred embodiment, described single nickase produces 2 single stranded gaps on the DNA sequence dna for being transformed.
In another embodiment, the distance between described 2 or more single stranded gaps is 50-500bp; Preferred 70-400bp; Most preferably 80-200bp.
In a preferred embodiment, described single nickase includes but not limited to: I-SceI, I-AniI, FoxI, Cas9 of genetic engineering modified mistake and synthetic polyribonucleotides, as LNA, PNA etc.
In a preferred embodiment, described single nickase includes but not limited to Cas9-D10A, Cas9-H840A, I-SceI, I-Anil-K227M, FoxI; More preferably Cas9-D10A or Cas9-H840A; Most preferably Cas9-D10A.
In a preferred embodiment, described single nickase is Cas9-D10A, and it is:
The albumen of (i) aminoacid sequence as shown in SEQ ID NO:1; Or
(ii) by aminoacid sequence shown in SEQ ID NO:1 formed through the replacement of or a few amino-acid residue, disappearance or interpolation and there is the albumen derivative by (i) of the protein function of aminoacid sequence as shown in SEQ ID NO:1; Or
The coding nucleotide sequence of described single nickase Cas9-D10A is:
(i) nucleotide sequence as shown in SEQ ID NO:2; Or
(ii) by aminoacid sequence shown in SEQ ID NO:1 formed through the replacement of one or several amino-acid residue, disappearance or interpolation and there is the encoding sequence of aminoacid sequence derived protein of protein function as shown in SEQ ID NO:1;
Or described single nickase is Cas9-H840A, and it is:
The albumen of (i) aminoacid sequence as shown in SEQ ID NO:3; Or
(ii) by aminoacid sequence shown in SEQ ID NO:3 formed through the replacement of or a few amino-acid residue, disappearance or interpolation and there is the albumen derivative by (i) of the protein function of aminoacid sequence as shown in SEQ ID NO:3; Or
The coding nucleotide sequence of described single nickase Cas9-H840A is:
(i) nucleotide sequence as shown in SEQ ID NO:4; Or
(ii) by aminoacid sequence shown in SEQ ID NO:3 formed through the replacement of one or several amino-acid residue, disappearance or interpolation and there is the encoding sequence of aminoacid sequence derived protein of protein function as shown in SEQ ID NO:3.
In another embodiment, described recombinase is one or more combination in RecA or RecA and RecO, RecF and RecR.
In another embodiment, described recombinase is the combination of RecA and RecO, RecF and RecR.
In a preferred embodiment, described recombinase is RecA, and it is:
The albumen of (i) aminoacid sequence as shown in SEQ ID NO:9; Or
(ii) by aminoacid sequence shown in SEQ ID NO:9 formed through the replacement of or a few amino-acid residue, disappearance or interpolation and there is the albumen derivative by (i) of the protein function of aminoacid sequence as shown in SEQ ID NO:9; Or
The coding nucleotide sequence of described recombinase RecA is:
(i) nucleotide sequence as shown in SEQ ID NO:5; Or
(ii) by aminoacid sequence shown in SEQ ID NO:9 formed through the replacement of one or several amino-acid residue, disappearance or interpolation and there is the encoding sequence of aminoacid sequence derived protein of protein function as shown in SEQ ID NO:9;
Described recombinase is RecO, and it is:
The albumen of (i) aminoacid sequence as shown in SEQ ID NO:10; Or
(ii) by aminoacid sequence shown in SEQ ID NO:10 formed through the replacement of or a few amino-acid residue, disappearance or interpolation and there is the albumen derivative by (i) of the protein function of aminoacid sequence as shown in SEQ ID NO:10; Or
The coding nucleotide sequence of described recombinase RecO is:
(i) nucleotide sequence as shown in SEQ ID NO:6; Or
(ii) by aminoacid sequence shown in SEQ ID NO:10 formed through the replacement of one or several amino-acid residue, disappearance or interpolation and there is the encoding sequence of aminoacid sequence derived protein of protein function as shown in SEQ ID NO:10;
Described recombinase is RecF, and it is:
The albumen of (i) aminoacid sequence as shown in SEQ ID NO:11; Or
(ii) by aminoacid sequence shown in SEQ ID NO:11 formed through the replacement of or a few amino-acid residue, disappearance or interpolation and there is the albumen derivative by (i) of the protein function of aminoacid sequence as shown in SEQ ID NO:11; Or
The coding nucleotide sequence of described recombinase RecF is:
(i) nucleotide sequence as shown in SEQ ID NO:7; Or
(ii) by aminoacid sequence shown in SEQ ID NO:11 formed through the replacement of one or several amino-acid residue, disappearance or interpolation and there is the encoding sequence of aminoacid sequence derived protein of protein function as shown in SEQ ID NO:11;
Described recombinase is RecR, and it is:
The albumen of (i) aminoacid sequence as shown in SEQ ID NO:12; Or
(ii) by aminoacid sequence shown in SEQ ID NO:12 formed through the replacement of or a few amino-acid residue, disappearance or interpolation and there is the albumen derivative by (i) of the protein function of aminoacid sequence as shown in SEQ ID NO:12; Or
The coding nucleotide sequence of described recombinase RecR is:
(i) nucleotide sequence as shown in SEQ ID NO:8; Or
(ii) by aminoacid sequence shown in SEQ ID NO:12 formed through the replacement of one or several amino-acid residue, disappearance or interpolation and there is the encoding sequence of aminoacid sequence derived protein of protein function as shown in SEQ ID NO:12.
In second aspect, the invention provides a kind of method of gene knock-in, described method comprises:
1). utilize single nickase or its coded polynucleotide on the DNA sequence dna for being transformed, produce 2 or more single breach; With
2). utilize recombinase allogenic gene to be knocked in the genome of nonhuman mammalian cells.
In a preferred embodiment, single nickase or its coded polynucleotide is utilized to produce 2 single stranded gaps on the DNA sequence dna for being transformed.
In another embodiment, the distance between 2 that the DNA sequence dna for being transformed produce or more single stranded gaps is 50-500bp; Preferred 70-400bp; Most preferably 80-200bp.
In another embodiment, described recombinase is one or more combination in RecA or RecA and RecO, RecF and RecR.
In another embodiment, described recombinase is the combination of RecA and RecO, RecF and RecR.
In a preferred embodiment, described method utilizes composition of the present invention allogenic gene to be knocked in the genome of nonhuman mammalian cells.
In a preferred embodiment, described non-human mammal includes but not limited to: rat, mouse, cavy, rabbit, monkey, sheep, goat; More preferably, described non-human mammal comprises rat, mouse, cavy.
In a preferred embodiment, described method can carry out reaching the precise integration of 8kb (or more long segment) in Mammals.
In a preferred embodiment, described composition or described method bring out the efficiency of homologous recombination integration higher than 40%; More preferably, higher than 50%; Most preferably, described composition or described method bring out the efficiency of homologous recombination integration is 55 ~ 70%.
In the third aspect, the invention provides a kind of method preparing transgenic nonhuman mammal model, said method comprising the steps of:
1). utilize the composition described in first aspect present invention that allogenic gene is imported nonhuman mammalian cells; With
2). the cell regeneration obtained is formed non-human mammal model.
In a preferred embodiment, described non-human mammal includes but not limited to: rat, mouse, cynomolgus monkey, rhesus monkey, pig, cavy, rabbit, sheep, goat; More preferably, described non-human mammal comprises rat, mouse, cynomolgus monkey and pig.
In fourth aspect, the invention provides composition described in first aspect present invention in gene knock-in or the purposes prepared in transgenic nonhuman mammal model.
In a preferred embodiment, described non-human mammal includes but not limited to: rat, mouse, cynomolgus monkey, rhesus monkey, pig, cavy, rabbit, sheep, goat; More preferably, described non-human mammal comprises rat, mouse, cynomolgus monkey and pig.
Should be understood that within the scope of the present invention, above-mentioned each technical characteristic of the present invention and can combining mutually between specifically described each technical characteristic in below (eg embodiment), thus form new or preferred technical scheme.As space is limited, tiredly no longer one by one to state at this.
Accompanying drawing explanation
Fig. 1 shows the genetic modification method of DSB mediation.
Fig. 2 is the schematic diagram of the inventive method.
Fig. 3 is the schematic diagram of gene knock-in site design.
Fig. 4 is the schematic diagram knocking in vector construction.
Fig. 5 shows the expression of EOS fluorescin in rat brain in neurone.
Fig. 6 shows the aminoacid sequence of the present invention single nickase Cas9D10A used, and (Fig. 6 a) and coding nucleotide sequence (Fig. 6 b).
Fig. 7 shows the aminoacid sequence of the present invention single nickase Cas9H840A used, and (Fig. 7 a) and coding nucleotide sequence (Fig. 7 b).
Fig. 8 a-8d shows aminoacid sequence and the coding nucleotide sequence (containing core sequence) of the present invention recombinase RecA, RecO, RecF and RecR (RecOFAR) used respectively.
Fig. 9 shows the nucleotide sequence of donor dna of the present invention, and wherein, green portion is external source EOS gene.
Embodiment
Contriver is through extensive and deep research, unexpectedly find utilize sequence-specific nickase (sequence-specific nickase) target site place or near the one or more collaborative nick of generation, the probability that homologous recombination reaction occurs can be significantly improved, reduce the probability of insertion or disappearance simultaneously and improve genome stability.The present inventor also finds, utilize the homologous recombination repair factor, particularly RecA and RecA and RecO, the combination of RecF, RecR can significantly improve further homologous recombination reaction occur probability.Complete the present invention on this basis.
Therefore, the present invention adopts DNA sequence dna specific karyomit(e) single stranded gaps (nick) generation technique, and realize efficiently in conjunction with the homologous recombination repair factor (recombinase), the transformation of accurate genome fixed point.In other words, the present invention utilizes recombinase to strengthen the methods of homologous recombination of nickase further.
The present invention utilize DNA single chain breach (SSB or nick) but not DSB to mediate recombinational repair, avoid all deficiencies of DSB.Because breach is only present in the strand of DNA, so the probability producing indel is lower; Simultaneously because there is the existence of full complement chain, the probability that genome unstable occurs is also lower.Under normal circumstances, cell is repaired in nick original position by BER mechanism (reparation of base breakpoint); When there is homologous sequence in cell, homologous recombination reaction is able to occur with certain proportion.Bring out generation single stranded gaps at present in sequence-specific region of DNA territory and have different strategies, include but not limited to I-SceI, I-AniI, FoxI, the Cas9 and some synthetic polyribonucleotidess that utilize genetic engineering modified mistake, as LNA, PNA etc.
Be no matter DSB or SSB (or nick) when occurring, the DNA repair mechanism of cell will be activated.As mentioned above, deposit in case having homologous sequence template, cell can carry out recombinational repair by a certain percentage.The template with homologous sequence can from intracellular sister chromosome, also can from the foreign DNA template provided.Intracellular recombinational repair mechanism is relatively guarded between species, is very complicated and exquisite, relates at least tens kinds of albumen.Although detailed cell biological mechanisms is still clear not to the utmost, substantially comprises otch processing (cut processing), autosyndetic pairing (pairing), copy extension (replicative extension), exchange (displacement), connect processes such as (ligation).On the other hand, the albumen (recombinant factor) that whole repair process relates to, its expression level or vigor likely become the rate-limiting factor of recombinational repair.The present inventor filters out wherein 4 kinds of effective recombinant factors (OFAR:RecO, RecF, RecA, RecR), and carry out codon optimized, when when target cell ectopic expression (ectopic expression), the efficiency of recombinational repair significantly improves.
Term definition
Term used herein " target site " refers to, any one section of DNA sequence dna for being transformed in target gene group.DNA sequence dna near target site, allows the integration of exogenous array at target site place, includes but not limited to gene knock-in (knock-in).In a specific embodiment, target dna sequence is double chain DNA sequence, include but not limited to, the DNA sequence dna of DNA sequence dna (such as Mitochondrial Genome Overview), plasmid, virus etc. outside the DNA sequence dna in cell chromosome genome, cell chromosome genome.
Term used herein " gene knock-in " refers to, utilize homologous recombination, functional gene (genome did not originally exist or the gene of inactivation) external source is had to proceed to cell and carry out homologous recombination with the homologous sequence in genome, make it to insert genome, in cell, obtain the technology of expression.
Term used herein " fixed point restructuring " refers to, exogenous array is incorporated into specific target site place by nonrandom mode, comprise be incorporated into certain particular target site 5 ' upstream, between 3 ' downstream or target site.
Term used herein " exogenous DNA array " refers to, expects by the DNA sequence dna at the target site place that fixes a point to recombinate.Exogenous DNA array can be that target site place does not exist or reformed sequence.
Term used herein " the recombinational repair factor " or " recombinant factor " or " recombinase " be the enzyme that phalangeal cell carries out recombinational repair and relates to, and can be Natural wild-type, also can be the enzyme by genetic engineering modified mistake.In a particular embodiment, the recombinase that the present invention is used is RecA.In a preferred embodiment, the recombinase that the present invention is used is one or more combination in RecA and RecO, RecF and RecR.In most preferred embodiments, the recombinase that the present invention is used is the combination of RecA and RecO, RecF and RecR.But, it will be appreciated that, in view of the knowledge of instruction of the present invention and prior art, those skilled in the art's above-mentioned concrete recombinase used to the present invention of being not difficult makes certain modification at gene level or protein level, thus obtains the variant still possessing the present invention's recombinase function used.
Term used herein " double-strand breach (double-strain break, DSB) " refers to all have breach at the relative position of two chains of DNA; Correspondingly, term used herein " single stranded gaps (single-strain break, SSB, or nick) " refers on a certain chain of DNA, to have breach, but do not have breach at the relative position of another chain.In view of the knowledge of instruction of the present invention and prior art, those skilled in the art can know term used herein " single stranded gaps " further and not limit breach quantity, that is, a certain chain that this term not represents DNA only has a breach.In a particular embodiment, generation 2 or more single stranded gaps on the DNA sequence dna for being transformed; In a preferred embodiment, the DNA sequence dna for being transformed produces 2 single stranded gaps; In most preferred embodiments, each generation 1 or 2 single stranded gaps on each chain of the DNA sequence dna for being transformed.
Term used herein " single nickase " (nickase) refers to the enzyme that can produce single-stranded nick (SSB) on DNA.Described enzyme can be the enzyme of Natural wild-type, also can be the enzyme by genetic engineering modified mistake.In a particular embodiment, the present invention's single nickase used includes but not limited to: I-SceI, I-AniI, FoxI, Cas9 of genetic engineering modified mistake and synthetic polyribonucleotides, as LNA, PNA etc.In a preferred embodiment, single nickase that the present invention is used includes but not limited to Cas9-D10A, Cas9-H840A, I-SceI, I-Anil-K227M, FoxI.In further preferred embodiment, the present invention's single nickase used is Cas9-D10A or Cas9-H840A.In most preferred embodiments, single nickase that the present invention is used is Cas9-D10A.
But, in view of instruction of the present invention and prior art, those skilled in the art it is also to be understood that " recombinase " that the present invention is used or " single nickase " also should comprise the variant form of described enzyme, described variant form has and described " recombinase " or " single nickase " same or analogous function, but its aminoacid sequence has a small amount of difference.These variant forms include, but is not limited to: one or morely (be generally 1-50, preferably 1-30, more preferably 1-20,1-10 best, also better for 1-8,1-5) amino acid whose disappearance, insertion and/or replacement, and add one or more (being generally within 20, is preferably within 10, within being more preferably 5) amino acid at C-terminal and/or N-terminal.Such as, those skilled in the art know, and replace with similar nature or similar amino acid, such as, when Isoleucine and leucine replace mutually, can not change the function of gained protein.Again such as, add one or several amino acid at C-terminal and/or N-terminal, the label such as added for ease of separation can not change the function of gained protein usually.
The variant form of polypeptide comprises: homologous sequence, conservative variant, allelic variant, natural mutation, induced mutants, the albumen coded by DNA that can hybridize with the coding DNA of described " recombinase " or " single nickase " under high or low stringency.The present invention also can comprise other polypeptide, as the fusion rotein of " recombinase " as described in comprising or " single nickase " or its fragment.Except the polypeptide of almost total length, the present invention also should comprise the soluble fragments of described " recombinase " or " single nickase ".Usually, this fragment have described " recombinase " or " single nickase " sequence at least about 20 continuous amino acids, usually at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids, more preferably at least about 80 continuous amino acids, best at least about 100 continuous amino acids.
The present invention also provides the analogue of described " recombinase " or " single nickase ".The difference of these analogues and described " recombinase " or " single nickase " can be the difference on aminoacid sequence, can be also the difference do not affected on the modified forms of sequence, or have both at the same time.These polypeptide comprise genetic variant that is natural or induction.Induce variation body can be obtained by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, also by site-directed mutagenesis or the biological technology of other known moleculars.Analogue also comprises the analogue with the residue (as D-amino acid) being different from natural L-amino acids, and has the analogue of amino acid (as β, gamma-amino acid) that is that non-natural exists or synthesis.Should be understood that albumen of the present invention is not limited to the above-mentioned representative albumen exemplified.
(usually the not changing primary structure) form of modification comprises: the chemically derived form of the polypeptide that body is interior or external is as acetylize or carboxylated.Modify and also comprise glycosylation.Modified forms also comprises the sequence with phosphorylated amino acid residue (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Also comprise and modified thus improve its anti-proteolysis performance or optimize the albumen of solubility property.
In the present invention, conservative variation's polypeptide of described " recombinase " or " single nickase " refers to compared with the aminoacid sequence of described " recombinase " or " single nickase ", there are 20 at the most, preferably at the most 10, more preferably at the most 5, best at the most 3 amino acid replace by the similar or close amino acid of character and the polypeptide formed.
Therefore, in view of instruction of the present invention and prior art, those skilled in the art can basis, such as, carry out amino acid replacement shown in following table and produce the mutant of conservative variation.
| Original Residue | Representational replacement residue | Preferred replacement residue |
| Ala(A) | Val;Leu;Ile | Val |
| Arg(R) | Lys;Gln;Asn | Lys |
| Asn(N) | Gln;His;Lys;Arg | Gln |
| Asp(D) | Glu | Glu |
| Cys(C) | Ser | Ser |
| Gln(Q) | Asn | Asn |
| Glu(E) | Asp | Asp |
| Gly(G) | Pro;Ala | Ala |
| His(H) | Asn;Gln;Lys;Arg | Arg |
| Ile(I) | Leu;Val;Met;Ala;Phe | Leu |
| Leu(L) | Ile;Val;Met;Ala;Phe | Ile |
| Lys(K) | Arg;Gln;Asn | Arg |
| Met(M) | Leu;Phe;Ile | Leu |
| Phe(F) | Leu;Val;Ile;Ala;Tyr | Leu |
| Pro(P) | Ala | Ala |
| Ser(S) | Thr | Thr |
| Thr(T) | Ser | Ser |
| Trp(W) | Tyr;Phe | Tyr |
| Tyr(Y) | Trp;Phe;Thr;Ser | Phe |
| Val(V) | Ile;Leu;Met;Phe;Ala | Leu |
Therefore, " containing " used herein, " having " or " comprising " include " comprising ", " primarily of ... form ", " substantially by ... form " and " by ... form "; " primarily of ... form ", " substantially by ... form " and " by ... formation " belong to the subordinate concept of " containing ", " having " or " comprising ".
Albumen of the present invention can be recombinant protein, native protein, synthetic proteins, preferred recombinant protein.Albumen of the present invention can be native purified product, or the product of chemosynthesis, or uses recombinant technology to produce from protokaryon or eucaryon host (such as, bacterium, yeast, higher plant, insect and mammalian cell).The host used according to recombinant production scheme, albumen of the present invention can be glycosylated, can be maybe nonglycosylated.Albumen of the present invention also can comprise or not comprise initial methionine residues.
It will be understood by those skilled in the art that " recombinase " of the present invention or " single nickase " also comprises fragment, derivative and the analogue of described concrete " recombinase " or " single nickase ".As used herein, term " fragment ", " derivative " and " analogue " refer to and substantially keep described " recombinase " or " single nickase " " biological function or the polypeptide of activity.Polypeptide fragment of the present invention, derivative or analogue can be the polypeptide that (i) has one or more conservative or non-conservative amino acid residue (preferred conservative amino acid) and be substituted, and the amino-acid residue of such replacement can may not be and encoded by genetic code, or (ii) has the polypeptide of substituted radical in one or more amino-acid residue, or (iii) mature polypeptide and another compound (such as extend the compound of polypeptide transformation period, such as polyoxyethylene glycol) merge the polypeptide formed, or (iv) additional aminoacid sequence is fused to this peptide sequence and the polypeptide formed (as leader sequence or secretion sequence or be used for the sequence of this polypeptide of purifying or proprotein sequence, or fusion rotein).The known scope of those skilled in the art is belonged to according to these fragments of definition herein, derivative and analogue.
Any one bioactive fragment of described " recombinase " or " single nickase " can be applied to the present invention.In this article, the bioactive fragment of " recombinase " or " single nickase " refers to the fragment of described " recombinase " or " single nickase ", but it still can keep all or part of function of total length " recombinase " or " single nickase ".Under normal circumstances, described bioactive fragment at least keeps the activity of 50% of total length " recombinase " or " single nickase ".Under still more preferential conditions, described active fragments can keep the activity of 60%, 70%, 80%, 90%, 95%, 99% or 100% of total length " recombinase " or " single nickase ".
Present invention also offers the polynucleotide sequence of coding " recombinase " of the present invention or " single nickase " or its conservative variation's polypeptide.
Polynucleotide of the present invention can be DNA form or rna form.DNA form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-strand.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can the varient of or degeneracy identical with the coding region sequence of described concrete " recombinase " or " single nickase ".As used herein, " varient of degeneracy " refers to that coding has the protein of the aminoacid sequence of described " recombinase " or " single nickase " in the present invention, but with the differentiated nucleotide sequence of encoding sequence of described " recombinase " or " single nickase ".
The polynucleotide of coding described " recombinase " or " single nickase " comprising: the encoding sequence of an encoding mature polypeptide; The encoding sequence of mature polypeptide and various additional coding sequence; The encoding sequence (with optional additional coding sequence) of mature polypeptide and non-coding sequence.
Term " polynucleotide of coded polypeptide " can be the polynucleotide comprising coding said polypeptide, also can be the polynucleotide also comprising additional code and/or non-coding sequence.
The invention still further relates to the varient of above-mentioned polynucleotide, its coding has the polypeptide of identical aminoacid sequence or fragment, the sum analogous to general Dedekind sum of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient of non-natural generation.These nucleotide variants comprise and replace varient, Deletion variants and insertion varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be the replacement of one or more Nucleotide, disappearance or insertion, but can not from the function of polypeptide changing in fact its coding.
The invention still further relates to and above-mentioned sequence hybridization and have at least 50% between two sequences, preferably at least 70%, the more preferably polynucleotide of at least 80% homogeny.The present invention be more particularly directed to polynucleotide interfertile with polynucleotide of the present invention under strict conditions.In the present invention, " stringent condition " refers to: (1) compared with the hybridization under low ionic strength and comparatively high temps and wash-out, as 0.2 × SSC, 0.1%SDS, 60 DEG C; Or be added with denaturing agent during (2) hybridization, and as 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 DEG C etc.; Or (3) homogeny only between two sequences, at least more than 90%, is just hybridized when being more preferably more than 95%.Further, the polypeptide of interfertile polynucleotide encoding has identical biological function and activity with the mature polypeptide shown in SEQ ID NO:2.
The invention still further relates to the nucleic acid fragment with above-mentioned sequence hybridization.As used herein, the length of " nucleic acid fragment ", at least containing 15 Nucleotide, is better at least 30 Nucleotide, is more preferably at least 50 Nucleotide, preferably more than at least 100 Nucleotide.Nucleic acid fragment can be used for the amplification technique (as PCR) of nucleic acid to determine and/or to be separated the polynucleotide of coding " recombinase " or " single nickase ".
The Nucleotide full length sequence of " recombinase " of the present invention or " single nickase " or its fragment can obtain by the method for pcr amplification method, recombination method or synthetic usually.For pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the cDNA storehouse prepared by ordinary method well known by persons skilled in the art as template, amplification and relevant sequence.When sequence is longer, usually needs to carry out twice or repeatedly pcr amplification, and then the fragment that each time amplifies is stitched together by proper order.
Once obtain relevant sequence, just relevant sequence can be obtained in large quantity with recombination method.This is normally cloned into carrier, then proceeds to cell, is then separated from the host cell after propagation by ordinary method and obtains relevant sequence.
In addition, also relevant sequence can be synthesized, when especially fragment length is shorter by the method for synthetic.Usually, by first synthesizing multiple small segment, and then carry out connect can obtain the very long fragment of sequence.
At present, the DNA sequence dna of code book invention albumen (or its fragment, or derivatives thereof) can be obtained completely by chemosynthesis.Then this DNA sequence dna can be introduced in various existing DNA molecular (or as carrier) as known in the art and cell.In addition, also by chemosynthesis, sudden change is introduced in protein sequence of the present invention.
Therefore, in a preferred embodiment, described single nickase is Cas9-D10A, and it is:
The albumen of (i) aminoacid sequence as shown in SEQ ID NO:1; Or
(ii) by aminoacid sequence shown in SEQ ID NO:1 formed through the replacement of or a few amino-acid residue, disappearance or interpolation and there is the albumen derivative by (i) of the protein function of aminoacid sequence as shown in SEQ ID NO:1; Or
The coding nucleotide sequence of described single nickase Cas9-D10A is:
(i) nucleotide sequence as shown in SEQ ID NO:2; Or
(ii) by aminoacid sequence shown in SEQ ID NO:1 formed through the replacement of one or several amino-acid residue, disappearance or interpolation and there is the encoding sequence of aminoacid sequence derived protein of protein function as shown in SEQ ID NO:1;
Or described single nickase is Cas9-H840A, and it is:
The albumen of (i) aminoacid sequence as shown in SEQ ID NO:3; Or
(ii) by aminoacid sequence shown in SEQ ID NO:3 formed through the replacement of or a few amino-acid residue, disappearance or interpolation and there is the albumen derivative by (i) of the protein function of aminoacid sequence as shown in SEQ ID NO:3; Or
The coding nucleotide sequence of described single nickase Cas9-H840A is:
(i) nucleotide sequence as shown in SEQ ID NO:4; Or
(ii) by aminoacid sequence shown in SEQ ID NO:3 formed through the replacement of one or several amino-acid residue, disappearance or interpolation and there is the encoding sequence of aminoacid sequence derived protein of protein function as shown in SEQ ID NO:3.
In a preferred embodiment, described recombinase is RecA, and it is:
The albumen of (i) aminoacid sequence as shown in SEQ ID NO:9; Or
(ii) by aminoacid sequence shown in SEQ ID NO:9 formed through the replacement of or a few amino-acid residue, disappearance or interpolation and there is the albumen derivative by (i) of the protein function of aminoacid sequence as shown in SEQ ID NO:9; Or
The coding nucleotide sequence of described recombinase RecA is:
(i) nucleotide sequence as shown in SEQ ID NO:5; Or
(ii) by aminoacid sequence shown in SEQ ID NO:9 formed through the replacement of one or several amino-acid residue, disappearance or interpolation and there is the encoding sequence of aminoacid sequence derived protein of protein function as shown in SEQ ID NO:9;
Described recombinase is RecO, and it is:
The albumen of (i) aminoacid sequence as shown in SEQ ID NO:10; Or
(ii) by aminoacid sequence shown in SEQ ID NO:10 formed through the replacement of or a few amino-acid residue, disappearance or interpolation and there is the albumen derivative by (i) of the protein function of aminoacid sequence as shown in SEQ ID NO:10; Or
The coding nucleotide sequence of described recombinase RecO is:
(i) nucleotide sequence as shown in SEQ ID NO:6; Or
(ii) by aminoacid sequence shown in SEQ ID NO:10 formed through the replacement of one or several amino-acid residue, disappearance or interpolation and there is the encoding sequence of aminoacid sequence derived protein of protein function as shown in SEQ ID NO:10;
Described recombinase is RecF, and it is:
The albumen of (i) aminoacid sequence as shown in SEQ ID NO:11; Or
(ii) by aminoacid sequence shown in SEQ ID NO:11 formed through the replacement of or a few amino-acid residue, disappearance or interpolation and there is the albumen derivative by (i) of the protein function of aminoacid sequence as shown in SEQ ID NO:11; Or
The coding nucleotide sequence of described recombinase RecF is:
(i) nucleotide sequence as shown in SEQ ID NO:7; Or
(ii) by aminoacid sequence shown in SEQ ID NO:11 formed through the replacement of one or several amino-acid residue, disappearance or interpolation and there is the encoding sequence of aminoacid sequence derived protein of protein function as shown in SEQ ID NO:11;
Described recombinase is RecR, and it is:
The albumen of (i) aminoacid sequence as shown in SEQ ID NO:12; Or
(ii) by aminoacid sequence shown in SEQ ID NO:12 formed through the replacement of or a few amino-acid residue, disappearance or interpolation and there is the albumen derivative by (i) of the protein function of aminoacid sequence as shown in SEQ ID NO:12; Or
The coding nucleotide sequence of described recombinase RecR is:
(i) nucleotide sequence as shown in SEQ ID NO:8; Or
(ii) by aminoacid sequence shown in SEQ ID NO:12 formed through the replacement of one or several amino-acid residue, disappearance or interpolation and there is the encoding sequence of aminoacid sequence derived protein of protein function as shown in SEQ ID NO:12.
Composition of the present invention
The present inventor find utilize sequence-specific nickase (sequence-specific nickase) target site place or near the one or more collaborative breach of manufacture; On this basis, 4 the homologous recombination repair factors (OFAR:RecO, RecF, RecA, RecR) of the present invention for providing ectopic expression (ectopic gene expression) optimised in cell to be rebuilt, thus the probability increasing substantially homologous recombination reaction generation.
Based on this, the invention provides a kind of composition for gene knock-in, described composition comprises following component:
1). single nickase or its coded polynucleotide;
2). recombinase or its coded polynucleotide; With
3). optional, comprise the donor dna of allogenic gene.
The homologous recombination probability brought out due to single breach may one or several order of magnitude lower than single DSB itself, so in a particular embodiment, the present invention adopts 2 or individual multiple breach, brings out homologous recombination, improve recombination efficiency so that collaborative at target site place.Therefore, in a particular embodiment, utilize above-mentioned single nickase on the DNA sequence dna for being transformed, produce 2 or more single stranded gaps.In a preferred embodiment, above-mentioned single nickase is utilized to produce 2 single stranded gaps on the DNA sequence dna for being transformed.
In further embodiment, the distance between described 2 or more single stranded gaps is 50-500bp.
In view of instruction of the present invention and relevant knowledge of the prior art, those skilled in the art can understand that composition of the present invention may be used for preparing transgenic nonhuman mammal model.
Based on discovery of the present invention, the present inventor provides a kind of method of gene knock-in further, and described method comprises:
1). utilize single nickase or its coded polynucleotide on the DNA sequence dna for being transformed, produce 2 or more single breach; With
2). utilize recombinase allogenic gene to be knocked in the genome of nonhuman mammalian cells.
In a preferred embodiment, single nickase or its coded polynucleotide is utilized to produce 2 single stranded gaps on the DNA sequence dna for being transformed.
In a preferred embodiment, the distance between 2 that the DNA sequence dna for being transformed produce or more single stranded gaps is 50-500bp; Preferred 70-400bp; Most preferably 80-200bp.
Another preferred embodiment in, described recombinase is one or more combination in RecA or RecA and RecO, RecF and RecR.
In preferred embodiment, described recombinase is the combination of RecA and RecO, RecF and RecR.
In a preference, described method can carry out reaching the precise integration of 8kb (or more long segment) in Mammals.
In a preferred embodiment, composition of the present invention or method bring out the efficiency of homologous recombination integration higher than 40%; More preferably, higher than 50%; Most preferably, described composition or described method bring out the efficiency of homologous recombination integration is 55 ~ 70%.
In a particular embodiment, described method utilizes composition of the present invention allogenic gene to be knocked in the genome of nonhuman mammalian cells.
In a preference, described non-human mammal includes but not limited to: rat, mouse, cynomolgus monkey, rhesus monkey, pig, cavy, rabbit, sheep, goat; More preferably, described non-human mammal comprises rat, mouse, cynomolgus monkey and pig.
Based on discovery of the present invention and the composition for gene knock-in that provides, the present inventor provides a kind of method preparing transgenic nonhuman mammal model further, said method comprising the steps of:
1). utilize composition of the present invention that allogenic gene is imported nonhuman mammalian cells; With
2). the cell regeneration obtained is formed non-human mammal model.
In a preference, described non-human mammal includes but not limited to: rat, mouse, cynomolgus monkey, rhesus monkey, pig, cavy, rabbit, sheep, goat; More preferably, described non-human mammal comprises rat, mouse, cynomolgus monkey and pig.
In view of common practise of the prior art, those skilled in the art know and can adopt in various manners, and composition of the present invention is imported nonhuman mammalian cells by the mode comprising non-invasi, and further, method of the present invention is a kind of method of non-therapeutic.
Advantage of the present invention:
1. the present invention can increase substantially the efficiency of homologous recombination;
2. the present invention can avoid prior art to be easy to produce insertion or lack and the instable shortcoming of genome.
3. the invention provides the method for carrying out accurate, meticulous gene editing in Mammals.
4. the invention provides the method simultaneously can carrying out multiple gene editing in Mammals.
5. the invention provides the method can carrying out reaching 8kb (or more long segment) precise integration in Mammals.
Below in conjunction with specific embodiment, set forth the present invention further.Should be understood that these embodiments are only not used in for illustration of the present invention to limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usual conveniently condition is as people such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or according to the condition that manufacturer advises.
Materials and methods
1. material
Embodiment of the present invention rat used is purchased from Shanghai Si Laike laboratory animal company.
Embodiment of the present invention agents useful for same and instrument are purchased from Biorad, Life technology.
2. method general introduction
Based on method transformation rat Bassoon gene of the present invention, the encoding sequence of fluorescin EOS3.2 will be integrated and (knock in, KI) to rat chromosomal Bassoon gene locus (locus) place, and then Bassoon-EOS3.2 is expressed in transgenic rat.Only have accurate site-directed integration, just likely realize the Bassoon-EOS3.2 Expression pattern (expression pattern) of expecting.Therefore by external fluoroscopic examination and DNA sequencing, can the efficiency of quantitative site-directed integration KI.
Embodiment
Embodiment 1. locates the potential nicks in rat Bassoon conformity goal target site place
The target of rat Bassoon genetic modification builds transgenic rat strain, the gene locus of endogenous Bassoon expressed Basson-EOS3.2 fusion rotein, and does not change other genome sequence.Corresponding genetically modified operation is that (in-frame) is integrated into EOS3.2DNA encoder block (ORF) in terminator codon (stop codon) the front frame of Bassoon.
First in target site district, i.e. determine integration site near the termination codon of Bassoon, i.e. selected single stranded gaps (nick) site, integration site can be selected between nick site or collaborative nick site on certain specific Nucleotide.
The present embodiment adopts the Cas9 of genetic engineering modified mistake, i.e. Cas9-D10A and Cas9-H840A, hereinafter referred to as D10A and H840A, with supporting sgRNA (upstream chain PAM:
cCTtACCGTGACCTATGGCCCTG-SEQ ID NO:13, wherein underscore is depicted as upstream PAM1; Downstream antisense strand PAM:GCAAAAAATTTTCCTCATTC
tGG-SEQ ID NO:14, wherein underscore is depicted as downstream PAM2) coupling.According to sequential analysis, have the nick site (as shown in Figure 3) that two potential near discovery terminator codon, nick1 and nick2 is at a distance of 101bp.According to the crystalline structure of Cas9-DNA, the spacing of 101bp can be held two Cas9 enzyme molecules and work simultaneously, there will not be spatial obstacle (steric hindrance).Foreign gene inserts or integration site can be selected, between two nick sites, to select in the present embodiment in nick2 place.
Sequence chart near rat Bassoon terminator codon, marks two nick sites and integration site:
CCCAGGGGCTCCTGCTGGTCAGCCAGCGGCAGAAGGAGAGAGTGTATTTTCTAAGATCCTCCCTGGTGGGGCAGCAGAGCAAGCCGGAAAGCTGACAGAAGGTATTACTGCCTGGGGTCAGGTCCACACTGGGTGGATGCCTCTCTGGTAGAGGCTGGGGACCGGGTGGTTCCAGGTCCAGTGACCAGGACACAGACCACCTGCTGGTACCCAGGGTTTCTCTGTACTCCTTATCCCTTGAGCCTTAC^C[y1]GTGACCTATGGCCCTGACTAGGAGTCTGACCCAGTTTCTGACATCTCTTTCTGTTTTCTATGTCACAGCTGTCTCTGCTTTTGGCAAAAAATTTTCCTCA^*T[y2]
TCTGGTGA[y3]
[y1]^Nick1
Integration site in [y2] ^Nick2, * the present embodiment
[y3] Bassoon terminator codon
Embodiment 2. designs foreign donor DNA profiling
Design donor dna template as shown in Figure 3, have the homologous sequence (upstream homology arm) of 1kb in the upstream of upstream nick, have the homologous sequence (downstream homology arm) of 1kb in the downstream of downstream nick.Add EOS3.2 encoding sequence at integration site place, wherein the junction of EOS3.2 and Bassoon gene adds linker district to reduce the impact of fluorescin on Bassoon gene protein function.This element containing upstream and downstream homology arm and EOS3.2 encoder block (ORF) is entered (Agilent company plasmid vector) on pBluescript II carrier by molecular cloning, and extracting plasmid through amplification becomes foreign donor DNA (nucleotide sequence is shown in SEQ ID NO:15).
Donor dna builds:
The coding region of 1kb upstream homology arm-CCTCA*+polyG joint+containing * TTCTGG – 1kb downstream, the EOS3.2 coding region homology arm of TAA terminator codon
Embodiment 3. prepares recombinase mixture
From DH5alpha strain gene group, Clone Origin is in 4 kinds of recombinant factors of intestinal bacteria (E.coli), is collectively referred to as the reading frame sequence of OFAR (RecO, RecF, RecA, RecR).Again through mammalian codons optimization after sequence verification, add core sequence (nucleus localization sequence) respectively.Then SP6 promoter sequence (ATTTA GGTGA CACTA TAGAA is added in the upstream of whole section of sequence, SEQ ID NO:16), utilize in-vitro transcription test kit (mMESSAGE mMACHINE T7/SP6kit, Life Technologies) and transcription vector pSP73 (Promega, USA) mRNA adding cap (capped) and add polyA is obtained, frozen in-80 DEG C after mixing, working concentration is 100ng/ul.
Embodiment 4. prepares transgenic rat strain
For simplicity, the present embodiment adopts microinjection rat zygote to obtain transgenic rat strain.
Recombinase mixture final concentration is 100ng/ul; SgRNA final concentration is 50ng/ul; Nickase 100ng/ul; Donor dna 300ng/ul.
Get 4 week age female sd inbred rats to adopt PMSG to add hCG (20IU/ only, Ningbo Sansheng Pharmaceutical Co., Ltd.) to carry out super row, female mouse mates with male SD rat after hCG injection.Within second day, examine female mouse vaginal suppository, cervical dislocation is put to death and is seen the female mouse of bolt, and get uterine tube and be immersed in M-2 substratum (sigma), 1-cell phase zygote embryo is got in punching.Unidasa (sigma) digests embryo's neighboring particles cell, is drawn to M-2 drop washes embryo 3-5 time with suction ovum pin, then draws during embryo cultivates drip to KSOM, in 37 DEG C, 5%CO
2cultivate in cell culture incubator.
Draw pin instrument (SUTTER INSTRUMENT CO.) to draw injection needle with P-97, then the mRNA of-80 DEG C of Refrigerator stores is taken out and be put on ice, after dissolving, entry needle inversion is put in standing about 5min in EP pipe and draws mRNA liquid.Recombinase final concentration is 100ng/ul; SgRNA final concentration is 50ng/ul; Nickase 100ng/ul; Donor dna 300ng/ul.
Embryo is drawn to M-2 injection drip in, inhaling has the entry needle of mRNA liquid to be connected with the IM-300 microinjection instrument (NARISHIGE) being connected with nitrogen, increases nitrogen pressure be above injected in the cytuloplasm of visible pronuclei by mRNA under inverted microscope (Olympus-IX81) by IM-300 instrument (providing).After having injected by embryo transfer to seeing in the bolt rat receptor of 0.5 day.
Injection statistics is as shown in table 1.
Table 1
| Group | Get ovum number | Transplant number | Transplant recipient | Birth number of rats | Survival number |
| E | 232 | 109 | 4 | 40 | 28 |
| F | 308 | 171 | 5 | 34 | 32 |
| G | 372 | 224 | 7 | 31 | 28 |
| H | 310 | 184 | 6 | 25 | 20 |
| I | 59 | 55 | 2 | 7 | 7 |
| J | 70 | 54 | 2 | 22 | 7 |
| K | 155 | 102 | 4 | 21 | 21 |
Embodiment 5. determines the efficiency of site-directed integration
Contriver utilizes integration site be positioned at 5 ' primer of native gene Bassoon gene and be positioned at the 3 ' primer (forward primer: 5 '-TACAAGGACGACGATGACAAG-3 ’ – SEQ ID NO:17 knocking in gene EOS; Reverse primer: 5 '-GTGACCTGCTTACTGACTGC-3 ’ – SEQ ID NO:18) carry out PCR qualification.Identifying positive band is carry the Offspring rat knocking in gene, and qualification result is in table 2.Visible nickase coordinates four recombinases can obtain the highest gene knock-in efficiency.Further, data can find to have lacked any one breach enzyme or recombinase and all can cause knocking in efficiency and obviously decline thus.
Contriver has carried out deep qualification to carrying the rat of knocking in gene, finds the fluorescin (see Fig. 5) lacking foreign gene-carrying EOS coding in positive rats brain.
Table 2. gene knock-in efficiency table, wherein nickase is: Cas9-D10A
| Acceptor | Combination | Efficiency (%) |
| E | Two single stranded gaps+OFAR | 57.1 |
| F | Two single stranded gaps+RecA | 15.6 |
| G | Two single stranded gaps | 3.57 |
| H | Cas9+OFAR | 10 |
| I | Cas9+RecA | 14.3 |
| J | Cas9 | 0 |
| K | Two single stranded gaps+OFAR | 66.6 |
Wherein, " two single stranded gaps " represents that the Cas9-D10A utilizing engineered mutant produces single stranded gaps, thus brings out Homologous integration; " Cas9 " expression utilizes wild-type Cas9 to produce double-strand breach (DSB), thus brings out Homologous integration; " OFAR " expression utilizes 4 kinds of recombinant factors, that is, the mixture of RecO, RecF, RecA, RecR; " RecA " expression utilizes separately recombinant factor RecA.
Discuss:
First, the present invention compares the efficiency utilizing Cas9-D10A or Cas9-H840A etc. of wild-type Cas9 and engineered mutant to bring out Homologous integration.As can be seen from the result of embodiment, utilize wild-type Cas9 to produce double-strand breach and almost cannot bring out Homologous integration, and the efficiency that Homologous integration is brought out in two single stranded gaps couplings is 3.57%, is better than utilizing wild-type Cas9 to produce the efficiency of double-strand breach.Thus prove that single stranded gaps coupling can be brought out homologous recombination and integrate.
Secondly, as can be seen from the result of embodiment, the RecA enzyme of alone genetic engineering modified mistake can improve the efficiency that homologous recombination is integrated, and being wherein 15.6% with the homologous recombination integration efficiency of collaborative single stranded gaps coupling, is 14.3% with the homologous recombination integration efficiency of DSB coupling; And more unexpectedly, OFAR enzyme and collaborative single stranded gaps coupling are brought out the efficiency that homologous recombination integrates and are improved significantly to 57 ~ 66%, and the DSB coupling efficiency that OFAR enzyme and wild-type Cas9 manufacture is only 10%.Thus prove that OFAR enzyme and collaborative single stranded gaps coupling can be brought out efficient homologous recombination and knock in integration.
In sum, the present embodiment proves, the homologous recombination integration efficiency that system of the present invention can realize is far above other combinations comprising prior art.
The all documents mentioned in the present invention are quoted as a reference all in this application, are just quoted separately as a reference as each section of document.In addition should be understood that those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims limited range equally.
Claims (11)
1., for a composition for gene knock-in, described composition comprises following component:
1). single nickase or its coded polynucleotide;
2). recombinase or its coded polynucleotide; With
3). optional, comprise the donor dna of allogenic gene.
2. composition as claimed in claim 1, is characterized in that, described single nickase produces 2 or more individual single stranded gaps on the DNA sequence dna for being transformed.
3. composition as claimed in claim 2, is characterized in that, the distance between described 2 or more single stranded gaps is 50-500bp; Preferred 70-400bp; Most preferably 80-200bp.
4. the composition according to any one of claim 1-3, is characterized in that, described recombinase is one or more combination in RecA or RecA and RecO, RecF and RecR.
5. composition as claimed in claim 4, it is characterized in that, described recombinase is the combination of RecA and RecO, RecF and RecR.
6. a method for gene knock-in, described method comprises:
1). utilize single nickase or its coded polynucleotide on the DNA sequence dna for being transformed, produce 2 or more single breach; With
2). utilize recombinase allogenic gene to be knocked in the genome of nonhuman mammalian cells.
7. method as claimed in claim 6, is characterized in that, the distance between 2 that the DNA sequence dna for being transformed produces or more single stranded gaps is 50-500bp; Preferred 70-400bp; Most preferably 80-200bp.
8. method as claimed in claims 6 or 7, is characterized in that, described recombinase is one or more combination in RecA or RecA and RecO, RecF and RecR.
9. method as claimed in claim 8, it is characterized in that, described recombinase is the combination of RecA and RecO, RecF and RecR.
10. prepare a method for transgenic nonhuman mammal model, it is characterized in that, said method comprising the steps of:
1). utilize the composition according to any one of claim 1-5 that allogenic gene is imported nonhuman mammalian cells; With
2). the cell regeneration obtained is formed non-human mammal model.
Composition according to any one of 11. claim 1-5 is in gene knock-in or the purposes prepared in transgenic nonhuman mammal model.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410124307.2A CN104946621A (en) | 2014-03-28 | 2014-03-28 | Gene knock-in composition and use method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410124307.2A CN104946621A (en) | 2014-03-28 | 2014-03-28 | Gene knock-in composition and use method and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104946621A true CN104946621A (en) | 2015-09-30 |
Family
ID=54161686
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410124307.2A Pending CN104946621A (en) | 2014-03-28 | 2014-03-28 | Gene knock-in composition and use method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104946621A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018033110A1 (en) * | 2016-08-19 | 2018-02-22 | 苏州兰希亚生物科技有限公司 | Method for repairing gene point mutation |
| CN108949830A (en) * | 2018-08-03 | 2018-12-07 | 福州大学 | A method of realizing genome editor, pinpoint gene knock-in in fish |
| CN108998406A (en) * | 2018-08-03 | 2018-12-14 | 福州大学 | A kind of human primary cultured cells' genome editor, fixed point gene knock-in method |
| CN109790551A (en) * | 2016-06-16 | 2019-05-21 | 奥斯陆大学医院Hf | Improved gene editing |
| WO2019140730A1 (en) * | 2018-01-17 | 2019-07-25 | 中国科学院上海生命科学研究院 | Method for preparing non-human primate somatic cell cloned animal |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102124112A (en) * | 2008-09-10 | 2011-07-13 | 金斯瑞公司 | Homologous recombination-based DNA cloning methods and compositions |
-
2014
- 2014-03-28 CN CN201410124307.2A patent/CN104946621A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102124112A (en) * | 2008-09-10 | 2011-07-13 | 金斯瑞公司 | Homologous recombination-based DNA cloning methods and compositions |
Non-Patent Citations (4)
| Title |
|---|
| MICHAEL J. METZGER ET AL.: "Single-strand nicks induce homologous recombination with less toxicity than double-strand breaks using an AAV vector template", 《NUCLEIC ACIDS RESEARCH》 * |
| WATARU FUJII ET AL.: "Efficient generation of genome-modified mice via offset-nicking by CRISPR/Cas system", 《BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS》 * |
| YONG WU ET AL.: "TALE nickase mediates high efficient targeted transgene integration at the human multi-copy ribosomal DNA locus", 《BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS》 * |
| 黄占景: "大肠杆菌RecA蛋白质的生物学活性和生理机能", 《遗传》 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109790551A (en) * | 2016-06-16 | 2019-05-21 | 奥斯陆大学医院Hf | Improved gene editing |
| US11708588B2 (en) | 2016-06-16 | 2023-07-25 | Adam Brian Robertson | Gene editing |
| WO2018033110A1 (en) * | 2016-08-19 | 2018-02-22 | 苏州兰希亚生物科技有限公司 | Method for repairing gene point mutation |
| WO2019140730A1 (en) * | 2018-01-17 | 2019-07-25 | 中国科学院上海生命科学研究院 | Method for preparing non-human primate somatic cell cloned animal |
| CN108949830A (en) * | 2018-08-03 | 2018-12-07 | 福州大学 | A method of realizing genome editor, pinpoint gene knock-in in fish |
| CN108998406A (en) * | 2018-08-03 | 2018-12-14 | 福州大学 | A kind of human primary cultured cells' genome editor, fixed point gene knock-in method |
| CN108949830B (en) * | 2018-08-03 | 2021-11-26 | 福州大学 | Method for realizing genome editing and accurate site-specific gene knock-in fish |
| CN108998406B (en) * | 2018-08-03 | 2022-05-10 | 福州大学 | Human primary culture cell genome editing and site-specific gene knock-in method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP3744844A1 (en) | Extended single guide rna and use thereof | |
| JP6279562B2 (en) | Methods and compositions for generating conditional knockout alleles | |
| US6528313B1 (en) | Procedure for specific replacement of a copy of a gene present in the recipient genome by the integration of a gene different from that where the integration is made | |
| JP5320546B2 (en) | Tol1 element transposase and DNA introduction system using the same | |
| JP7257062B2 (en) | Genome editing method | |
| CN104946621A (en) | Gene knock-in composition and use method and application thereof | |
| WO2015021426A1 (en) | A crispr/cas system-based novel fusion protein and its application in genome editing | |
| Li et al. | One-step efficient generation of dual-function conditional knockout and geno-tagging alleles in zebrafish | |
| CA2479858A1 (en) | Methods and compositions for using zinc finger endonucleases to enhance homologous recombination | |
| JP2005529586A (en) | Mismatch endonuclease and method of use | |
| KR102136132B1 (en) | A method for producing avian leukosis virus(alv)-resistant avian line using crispr/cas9 system | |
| JP2020504612A (en) | Animal embryo base editing composition and base editing method | |
| CN105315352A (en) | Insect targeted gene knock-in composition, use method and application thereof | |
| CN103820452B (en) | A kind of sgRNA fragment and application thereof | |
| US20230272397A1 (en) | Methods for improving the health of porcine species by targeted inactivation of cd163 | |
| CN111733159B (en) | sgRNA composition for pig MBP gene knockout and application | |
| CN101863969B (en) | Separated rice female fertility relevant protein as well as encoding gene and application thereof | |
| CN110129358B (en) | Application of rice Os01g32730 gene | |
| CN113025597A (en) | Improved genome editing system | |
| CN114644692B (en) | Method for creating drought-sensitive corn germplasm by site-directed mutagenesis and application thereof | |
| EP1404842A2 (en) | Perv screening method and use thereof | |
| US20230287459A1 (en) | Single generation targeted gene integration | |
| CN105399806A (en) | Paddy rice male and female fertility-related protein, and coding genes and applications thereof | |
| EP1661992B1 (en) | Method of screening for homologous recombination events | |
| JP2004236642A (en) | Method for introducing foreign dna into genome of insect cell |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20150930 |
|
| WD01 | Invention patent application deemed withdrawn after publication |