JPWO2019075419A5 - - Google Patents

Description

In some embodiments, the uridine at the first position of the antisense strand comprises a phosphate analogue.

Deoxyribonucleotide: As used herein, the term "deoxyribonucleotide" refers to a nucleotide that has a hydrogen at the 2' position of its pentose sugar instead of a hydroxyl, as compared to a ribonucleotide. Modified deoxyribonucleotides are deoxyribonucleotides that have one or more modifications or substitutions of atoms other than the 2' position, including modifications or substitutions in the sugar, phosphate group or base, or of the sugar, phosphate group or base.

Hepatocytes: As used herein, the term “hepatocytes” refers to cells of the parenchyma of the liver. These cells constitute approximately 70-85% of the mass of the liver and produce serum albumin, fibrinogen, and the prothrombin group of clotting factors (with the exception of factors 3 and 4). Markers of hepatocyte lineage cells may include, but are not limited to, transthyretin (Ttr), glutamine synthetase (Glul), hepatocyte nuclear factor 1a (Hnf1a), and hepatocyte nuclear factor 4a (Hnf4a). . Markers of mature hepatocytes may include, but are not limited to, cytochrome P450 (Cyp3a11), fumarylacetoacetate hydrolase (Fah), glucose 6 phosphate (G6p), albumin (Alb), and OC2-2F8. See, eg, Huch et al. (2013), Nature, 494(7436):247-250, which is incorporated herein by reference for hepatocyte markers.

Loop: As used herein, the term "loop" refers to a mismatched region of a nucleic acid (e.g., an oligonucleotide) flanked by two antiparallel regions of nucleic acid that are sufficiently complementary to each other, thus Under appropriate hybridization conditions (e.g., in a phosphate buffer, intracellularly), these two antiparallel regions flanked by unpaired regions hybridize to form a duplex (called a "stem"). do.

Modified Nucleotides: As used herein, the term "modified nucleotides" refers to adenine ribonucleotides, guanine ribonucleotides, cytosine ribonucleotides, uracil ribonucleotides, adenine deoxyribonucleotides, guanine deoxyribonucleotides, cytosine deoxyribonucleotides and thymidine deoxyribonucleotides. Refers to a nucleotide that has one or more chemical modifications compared to the corresponding reference nucleotide of choice. In some embodiments, modified nucleotides are non-naturally occurring nucleotides. In some embodiments, a modified nucleotide has one or more chemical modifications to its sugar, nucleobase and/or phosphate groups. In some embodiments, a modified nucleotide has one or more chemical moieties conjugated to the corresponding reference nucleotide. In some embodiments, modified nucleotides provided herein can contribute to improved temperature stability, degradation resistance, nuclease resistance, solubility, bioavailability, biological activity, reduced immunogenicity, and the like.

Phosphate analogue: As used herein, the term “ phosphate analogue” refers to chemical moieties that mimic the electrostatic and/or steric properties of a phosphate group. In some embodiments, oligonucleotides have a phosphate analogue (referred to as a “4′- phosphate analogue”) at the 4′-carbon position of the sugar of the 5′-terminal nucleotide. An example of a 4'- phosphate analogue is oxymethylphosphonic acid or analogues thereof in which the oxygen atom of the oxymethyl group is attached to the sugar moiety (eg at its 4'-carbon).

Region of Complementarity: As used herein, the term “region of complementarity” allows hybridization between two nucleotide sequences under suitable hybridization conditions, such as in a phosphate buffer, intracellularly, etc. refers to a nucleotide sequence of a nucleic acid (eg, a double-stranded oligonucleotide) that is sufficiently complementary to an antiparallel nucleotide sequence to

Ribonucleotide: As used herein, the term “ribonucleotide” refers to a nucleotide having a ribose as the pentose sugar containing a hydroxyl group at the 2′ position. Modified ribonucleotides are ribonucleotides that have one or more modifications or substitutions of atoms other than the 2' position, including modifications or substitutions of ribose, phosphate groups or bases.

ii. Oligonucleotide Modifications In some embodiments, oligonucleotides of the present disclosure may contain one or more suitable modifications. In some embodiments, a modified nucleotide has modifications to its base (or nucleobase), sugar (eg, ribose, deoxyribose), or phosphate group. In certain embodiments of the oligonucleotides provided herein, all or substantially all of the nucleotides of the oligonucleotide are modified. In certain embodiments, more than half of those nucleotides are modified. In certain embodiments, less than half of those nucleotides are modified.

In some embodiments, the terminal 3' terminal group (eg, 3'-hydroxyl) is a phosphate group or other group, which can be used, for example, to attach linkers, adapters or labels. .

b. 5' Terminal Phosphate Group In some embodiments, the 5' terminal phosphate group of the oligonucleotide enhances interaction with Argonaute-2. However, oligonucleotides containing a 5' phosphate group can be susceptible to degradation by phosphatases or other enzymes, which can limit their in vivo bioavailability. In some embodiments, oligonucleotides include analogs of the 5' phosphate group that are resistant to such degradation.

In some embodiments, oligonucleotides have a phosphate analogue (referred to as a "4'- phosphate analogue") at the 4'-carbon position of the sugar. See, for example, International Application No. PCT/US2017/049909 entitled "4'- Phosphate Analogues and Oligonucleotides Containing Them", filed September 1, 2017 (the content of which is incorporated herein by reference regarding phosphate analogues). incorporated by reference).

In some embodiments, oligonucleotides provided herein include a 4'- phosphate analogue at the 5' terminal nucleotide. In some embodiments, the phosphate analogue is an oxymethylphosphonic acid or analogue thereof with the oxygen atom of the oxymethyl group attached to the sugar moiety (eg, at its 4'-carbon). In another embodiment, the 4'- phosphate analogue is a thiomethylphosphonic acid or aminomethylphosphonic acid or analogues thereof wherein the sulfur atom of the thiomethyl group or the nitrogen atom of the aminomethyl group is attached to the 4'-carbon of the sugar moiety. be. In certain embodiments, the 4'- phosphate analogue is oxymethylphosphonic acid.

In certain embodiments, the phosphate analog attached to the oligonucleotide is methoxyphosphonic acid (MOP). In certain embodiments, the phosphate analog attached to the oligonucleotide is a 5' monomethyl protected MOP. In some embodiments, the uridine nucleotide containing phosphate analogues described below can be used, for example, in the first position of the guide (antisense) strand.

c. Modified Internucleotide Linkages In some embodiments, phosphate modifications or substitutions result in oligonucleotides comprising at least one (e.g., at least one, at least two, at least three, or at least five) modified internucleotide linkages. obtain. In some embodiments, any one of the oligonucleotides disclosed herein comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 modified internucleotide linkages . In some embodiments, at least one modified internucleotide linkage of any one of the oligonucleotides disclosed herein is a phosphorothioate linkage.

RNAi Oligonucleotide LDHA-1: Double-stranded, double-stranded RNA oligonucleotides bearing GalNAc functional groups were chemically synthesized in sterile phosphate -buffered saline (PBS). These oligonucleotides were stored at -20°C. Prior to use, the oligonucleotides were thawed, mixed well (gently vortexed), and then allowed to equilibrate to room temperature for at least 30 minutes.

Claims (24)

Oligonucleotide for reducing expression of lactate dehydrogenase A (LDHA) comprising an antisense strand having a sequence set forth as UCAGAUAAAAGGACAACAUGG (SEQ ID NO: 1) and a sense strand having a sequence set forth as AUGUUGUCCUUUUUAUCUGAGCAGCCGAAAAGGCUGC (SEQ ID NO: 2) and
Positions 1, 2, 4, 6, 7, 12, 14, 16, 18-26 and 31-36 of the sense strand and positions 1, 6 of the antisense strand, all of positions 8, 11-13, 15, 17 and 19-22 are modified with 2′-O-methyl;
3, 5, 8-11, 13, 15 or 17 of the sense strand and 2-5, 7, 9, 10, 14, 16 and 2 of the antisense strand; all of position 18 are modified with 2′-fluoro,
The oligonucleotides are located at positions 1 and 2 of the sense strand, positions 1 and 2 of the antisense strand, positions 2 and 3 of the antisense strand, positions 3 and 4 of the antisense strand, and the anti having phosphorothioate linkages between positions 20 and 21 of the sense strand and positions 21 and 22 of the antisense strand, respectively;
wherein the oligonucleotide has, at position 1 of the antisense strand, the following structure:

including
Each nucleotide of the -GAAA-sequence of the sense strand is conjugated with a monovalent GalNac moiety such that the -GAAA-sequence has the following structure:

An oligonucleotide, characterized in that it comprises : A composition comprising the oligonucleotide of claim 1 and an excipient. Na ⁺ 3. The composition of claim 2, further comprising a counterion. 3. The composition of claim 2 for treating a subject having or at risk of having primary hyperoxaluria. 3. The composition of claim 2, wherein said excipient comprises phosphate buffered saline. 5. The composition of claim 4, which is administered intravenously. 5. The composition of claim 4, which is administered subcutaneously. 5. The composition of claim 4, wherein said excipient comprises phosphate buffered saline. 5. The composition of claim 4, wherein the primary hyperoxaluria is selected from PH1, PH2, PH3, and idiopathic hyperoxaluria. 3. The composition of claim 2 for reducing hepatic oxalate production in a subject. 11. The composition of claim 10, which is administered intravenously. 11. The composition of claim 10, which is administered subcutaneously. 11. The composition of claim 10, wherein said excipient comprises phosphate buffered saline. An oligonucleotide for reducing the expression of lactate dehydrogenase A (LDHA), characterized by having the following formula.

15. A composition comprising the oligonucleotide of claim 14 and an excipient. 16. The composition of claim 15, wherein said excipient comprises phosphate buffered saline. 16. The composition of claim 15 for treating a subject having or at risk of having primary hyperoxaluria. 18. The composition of claim 17, which is administered intravenously. 18. The composition of claim 17, which is administered subcutaneously. 18. The composition of claim 17, wherein said primary hyperoxaluria is selected from PH1, PH2, PH3, and idiopathic hyperoxaluria. 16. The composition of claim 15 for reducing hepatic oxalate production in a subject. 22. The composition of claim 21, which is administered intravenously. 22. The composition of claim 21, which is administered subcutaneously. 22. The composition of claim 21, wherein said excipient comprises phosphate buffered saline.