ES2858403T3 - Ligand-modified double-stranded nucleic acids - Google Patents

Abstract

A double stranded nucleic acid (dsNA) comprising: an upstream strand comprising 21 to 83 nucleotides; an antisense strand comprising 15 to 39 nucleotides; a double formed by said sense and antisense strand, having a length of 15 to 35 base pairs; wherein the dsNA comprises a discontinuity between the 5 'terminus of the sense strand and the 3' terminus of the antisense strand or between the 3 'terminus of the sense strand and the 5' terminus of the antisense strand; wherein the sense strand comprises a tetraloop and the tetraloop comprises at least one nucleotide conjugated to the ligand; wherein each ligand is conjugated to a nucleotide of the tetraloop through an acetal linker and wherein said antisense strand is complementary to a target mRNA along at least 15 nucleotides of said antisense strand and said dsNA reduces the expression of the target gene when introduced into a mammal or a mammalian cell.

Description

DESCRIPTION

Ligand-modified double-stranded nucleic acids

Background

Double-stranded RNA (dsRNA) agents having strand lengths of 25 to 35 nucleotides have been described as effective inhibitors of target gene expression in mammalian cells (Rossi et al., U.S. Patent Publication Nos. 2005/0244858 and 2005/0277610). DsRNA agents of such length are believed to be processed by the RNA interference pathway (iRNA) enzyme Dicer, leading such agents to be referred to as "Dicer substrate siRNA" ("siDARN") agents. Certain modified structures of DARNsi agents were previously described (Rossi et al., US Patent Publication No. 2007/0265220). United States Patent Publication No. 2014/350074 (Brown) describes an si DARN comprising a first and a second strand each 26-60 nucleotides in length and forming a double where the first strand comprises a loop adjacent to said double and wherein said molecule comprises a discontinuity between a terminal of said first strand and a terminal of said second strand characterized in that said conjugate in the loop with a non-nucleic acid structural unit.

Brief summary of the invention

The present invention provides a double stranded nucleic acid (dsNA) comprising an upstream strand comprising 21 to 83 nucleotides; an antisense strand comprising 15 to 39 nucleotides; a double consisting of the sense and antisense strand, which is 15 to 35 base pairs in length; wherein the dsNA comprises a discontinuity between the 5 'terminus of the sense strand and the 3' terminus of the antisense strand or between the 3 'terminus of the sense strand and the 5' terminus of the antisense strand; wherein the sense strand comprises a tetraloop and the tetraloop comprises at least one ligand conjugated nucleotide, wherein each ligand is conjugated to a nucleotide of the tetraloop through an acetal linker and wherein the antisense strand is complementary to a target mRNA together with at least 15 nucleotides of the antisense strand and the dsNA reduces the expression of the target gene when introduced into a mammal or a mammalian cell.

A stem and a tetraloop can be formed by the sense strand, a stem comprising a region of base pairs of 1 to 20 nucleotides, and the tetraloop comprising 4 unpaired nucleotides.

In one embodiment, the antisense strand has a length range of: 15-30 nucleotides, 18-25 nucleotides, or 19-24 nucleotides.

In another embodiment, the double has a length range of: 15-22 nucleotides or 15-30 nucleotides.

In another embodiment, the discontinuity is flanked on each side by a phosphorothioate modified nucleotide.

In another embodiment, at least one strand of the dsNA comprises a 3 'extension.

In another embodiment, the 3 'extension is 1-2, 1-4, or 1-6 nucleotides in length.

In another embodiment, the 3 'extension is 1-10, 10-20 or 20-30 nucleotides in length.

In another embodiment, a stem comprises a base pair region of at least 15 nucleotides and further comprises one or more mismatches.

In another embodiment, a stem comprises a base pair region of at least 15 nucleotides and further comprises 1-10 consecutive or non-consecutive mismatches.

In another embodiment, the dsNA has at least two ligand-conjugated nucleotides, where each ligand-conjugated nucleotide is separated from a second ligand-conjugated nucleotide by at least one spacer nucleotide.

In another embodiment, the dsNA has at least two ligand-conjugated nucleotides, wherein the ligand-conjugated nucleotides are adjacent.

In another embodiment, the ligand is selected from the group consisting of: a lipophilic, a steroid, a protein, a vitamin, a carbohydrate, and a terpene.

In another embodiment, the ligand is selected from the group consisting of: cholesterol, cholic acid, adamantine acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-Bis-O (hexadecyl) glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3- (oleoyl) lithocholic acid, O3- (oleoyl) cholenic acid, dimethoxytrityl or phenoxazine), bile acid, PEG, folate, vitamin A, vitamin E , biotin, pyridoxal, a peptide, mimic peptide, mannose-6-phosphate, galactose, fructose, ribose, xylose, arabinose, lixose, allose, altrose, gulose, iodose, glucose, talose, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, polysaccharide , an endosomolytic component, uvaol, hecigenin, diosgenin, triterpenosarsasapogenin, Friedelin, epifriedelanol-derived lithocholic acid, a cationic lipid, and an antibody.

In another embodiment, the ligand comprises cholesterol.

In another embodiment, the ligand comprises mannose-6-phosphate.

In another embodiment, a 5 'single-stranded extension is 1-10, 10-20, or 20-30 nucleotides in length.

In another embodiment, the dsNA comprises at least one modified nucleotide.

In another embodiment, the nucleotides of said dsNA are selected from the group consisting of: ribonucleotides, deoxyribonucleotides, abasic nucleotides, inverted abasic nucleotides, sugar-modified nucleotides, backbone modified nucleotides, nucleotide analogs, and non-nucleoside analogs.

In another embodiment, the nucleotide is a locked nucleic acid (LNA) or an unlocked nucleic acid (UNA).

In another embodiment, a 3 'extension provides a 3' overhang that is 1-2, 1-4, or 1-6 nucleotides in length.

In another embodiment, at least one nucleotide of said 3 'extension comprises a sugar and / or a backbone modification.

In another embodiment, at least one nucleotide comprises a sugar and / or a backbone modification.

In another embodiment, the one or more nucleotides comprise a sugar modification selected from the group consisting of: 2'-O-methyl, 2'-methoxyethoxy, 2'-fluoro, 2'-allyl, 2'-0- [2 - (methylamino) -2-oxoethyl], 4'-thio, 4'-CH ² -0-2'-bridge, 4 '- (CH ² ) ² -0-2'-bridge, 2'-amino and modification 2'-O- (N-methylcarbamate).

In another embodiment, the dsNA comprises a backbone modification selected from the group consisting of: phosphonate, phosphorothioate, phosphotriester, methylphosphonate, morpholino, SATE (S-acyl-2-thioethyl) modified phosphate, BMEG (isobutyryl mercapto ethyl) modified phosphate glycol).

In another embodiment, the dsNA comprises a region containing at least one phosphorothioate bond.

In another embodiment, the dsNA comprises a region containing 1-5, 1-10, or 1-20 phosphorothioate linkages.

In another embodiment, the dsNA comprises a region containing at least two consecutive phosphorothioate linkages

In another embodiment, the dsNA comprises a nucleic acid analog selected from the group consisting of: hypoxanthine (I), xanthine (X), 3p-D-ribofuranosyl- (2,6-diaminopyrimidine) (K), 3 pD-ribofuranosyl - (1-methyl-pyrazolo [4,3-d] pyrimidine-5.7 (4H, 6H) -dione) (P), iso-cytosine (iso-C), iso-guanine (iso-G), 1 -pD-ribofuranosyl- (5-nitroindole), 1-pD-ribofuranosyl- (3-nitropyrrole), 5-bromouracil, 2-aminopurine, 4-thio-dT, 7- (2-thienyl) -imidazo [4,5 -b] pyridine (Ds), pyrrole-2-carbaldehyde (Pa), 2-amino-6- (2-thienyl) purine (S), 2-oxopyridine (Y), difluorotolyl, 4-fluoro-6-methylbenzimidazole, 4-methylbenzimidazole, 3-methyl isocarbostyryl, 5-methyl isocarbostyryl, 3-methyl-7-propynyl isocarbostyryl, 7-azaindolyl, 6-methyl-7-azaindolyl, imidizopyridinyl, 9-isocarbostyryl, 7-methyl-imidizopyridinyl, pyrrolopyryl-7-propynyl-pyridinyl, isocarbostyrylyl, propynyl-7-azaindolyl, 2,4,5-trimethylphenyl, 4-methylindolyl, 4,6-dimethylindolyl, phenyl, naphthalenyl, anthracenyl, phenanthracenyl, pyrenyl, seti Benzyl, tetracenyl and pentacenyl.

In another embodiment, the sense and antisense strands are aligned for maximum complementarity in the double region.

In another embodiment, the dsNA is a Dicer cleavage substrate.

In another embodiment, the dsNA is not a Dicer cleavage substrate.

In another embodiment, 1 to 30 consecutive 3 'terminal nucleotides of said antisense strand do not pair with said sense strand, forming a 1 to 30 nucleotide 3' single-stranded extension.

In another embodiment, the 3 'single-stranded extension is 1-10, 10-20, or 20-30 nucleotides in length.

In another embodiment, the double comprises one or more nucleotides selected from the group consisting of: ribonucleotides, deoxyribonucleotides, modified nucleotides, abasic nucleotides, inverted abasic nucleotides, nucleotide analogs, and combinations thereof.

In another embodiment, the 3 'extension comprises one or more nucleotides selected from the group consisting of: ribonucleotides, deoxyribonucleotides, modified nucleotides, abasic nucleotides, inverted abasic nucleotides, nucleotide analogs, and combinations thereof.

In another embodiment, the 5 'extension comprises one or more nucleotides selected from the group consisting of: ribonucleotides, deoxyribonucleotides, modified nucleotides, abasic nucleotides, inverted abasic nucleotides, and nucleotide analogs.

In another embodiment, the 5 'single-stranded extension comprises at least 10 deoxyribonucleotides.

In another embodiment, the 5 'single stranded extension comprises at least one phosphorothioate modified nucleotide. In another embodiment, the 5 'single chain extension comprises 1-5, 1-10 or 1-20 phosphorothioate linkages.

In another embodiment, the 5 'single-chain extension comprises at least two consecutive phosphorothioate linkages. In another embodiment, the ligand is a non-nucleic acid building block.

In another embodiment, the ligand is a peptide or an organic compound.

In another embodiment, the organic compound is a colorant.

In another embodiment, the organic compound is cholesterol.

In another embodiment, the non-nucleic acid building block comprises a detectable marker.

In another embodiment, the ligand-conjugated nucleotide has increased cell targeting compared to a dsNA that lacks a ligand-conjugated nucleotide.

In another embodiment, the ligand-conjugated nucleotide has improved cell uptake compared to a dsNA that lacks a ligand-conjugated nucleotide.

In another embodiment, the ligand-conjugated nucleotide has improved delivery compared to a dsNA that lacks a ligand-conjugated nucleotide.

In another embodiment, the ligand-conjugated nucleotide has increased stability compared to a dsNA that lacks a ligand-conjugated nucleotide.

In another embodiment, dsNA comprising a ligand-conjugated nucleotide has increased tracking compared to a dsNA lacking a ligand-conjugated nucleotide.

In another embodiment, the dsNA that comprises a ligand-conjugated nucleotide has an increased binding affinity for a target compared to a dsNA that lacks a ligand-conjugated nucleotide.

In another embodiment, dsNA comprising a ligand-conjugated nucleotide has decreased immunogenicity compared to a dsNA lacking a ligand-conjugated nucleotide.

In another embodiment, dsNA comprising a ligand-conjugated nucleotide has improved pharmacokinetic properties compared to a dsNA lacking a ligand-conjugated nucleotide.

In another embodiment, dsNA comprising a ligand-conjugated nucleotide has improved biodistribution properties compared to a dsNA lacking a ligand-conjugated nucleotide.

In another embodiment, the 5 'terminus of the sense and / or antisense strand contains an unmodified phosphate.

In another embodiment, the 5 'terminus of the sense and / or antisense strand contains a chemically modified phosphate. In another embodiment, the 3 'extension comprises a phosphorothioate modification.

In another embodiment, the double comprises an abasic nucleotide.

In another embodiment, the sense strand consists of up to 100% chemically modified nucleotides. In another embodiment, the antisense strand consists of up to 100% chemically modified nucleotides. In another embodiment, both sense and antisense strands consist of up to 100% chemically modified nucleotides.

In another embodiment, the sense strand is resistant to nuclease degradation in the absence of a modified nucleotide.

In another embodiment, the antisense strand is resistant to nuclease degradation in the absence of a modified nucleotide.

In another embodiment, the dsNA comprises more than one species of ligand.

In another embodiment, the dsNA comprises a GalNac-conjugated nucleotide and a cholesterol-conjugated nucleotide.

In another embodiment, the dsNA comprises a nucleotide conjugated to GalNac and a nucleotide conjugated to mannose-6-phosphate.

In another embodiment, the dsNA comprises a GalNac-conjugated nucleotide, a mannose-6-phosphate-conjugated nucleotide, a folate-conjugated nucleotide, and / or a cholesterol-conjugated nucleotide.

In another embodiment, the dsNA molecule comprises a nucleotide conjugated to at least two ligands.

The inclusion of one or more modified nucleotides, phosphate backbone modifications, and / or nucleotide analogs within the single-stranded region of an extended single-stranded dsNA may impart certain advantages to such a modified dsNA molecule, including, for example, improved efficacy. (including improved potency and / or improved duration of effect), presentation of a recognition domain, and other attributes associated with a single-stranded nucleotide region.

The invention also provides a pharmaceutical composition for reducing the expression of a target gene in a cell of a subject, said composition comprising the dsNA of the invention in an amount effective to reduce the expression of the target gene in said cell and a pharmaceutically acceptable carrier.

By way of example, the invention provides a ligand-conjugated nucleotide comprising: a nucleotide and a ligand conjugated by a linker, wherein the linker is selected from the group consisting of:

to.

and

b.

where n = 0-20

wherein said ligand is conjugated to the sugar or base of said nucleotide; and wherein said ligand-conjugated nucleotide is used to synthesize the dsNA of claim 1.

Also disclosed is a method for increasing the potency and half-life of a dsNA by conjugating a ligand to a nucleotide of said dsNA, wherein said ligand is selected from the group consisting of cholesterol, mannose-6-phosphate, GalNAc and folate.

A method for producing a dsNA of the invention is also disclosed, the method comprising: providing a plurality of nucleotides selected from the group consisting of DNA nucleotides, RNA nucleotides, abasic nucleotides, inverted abasic nucleotides, nucleotide analogs, or modified nucleotides; wherein one or more nucleotides are conjugated to a ligand; and synthesizing a dsNA comprising nucleotides that are not conjugated to a ligand and nucleotides that are conjugated ligands, wherein the nucleotides of said dsNA are in a predetermined pattern, thus producing the dsNA.

In another embodiment, the linker (L) comprises the structure of formula VI:

where:

B is a nucleobase or H;

Z is O, S, N (R1), or CH2;

V and W are each O;

R1 and R2 are each H;

m and n are each independently 1 - 20.

X is a ligand selected from the group consisting of: GalNAc, folate, mannose-6-phosphate, and cholesterol.

By way of example, the linker (L) may comprise the structure of formula VII:

B is a nucleobase;

m and n are each independently 1-20;

X has the structure

The above features of the embodiments will be more readily understood with reference to the following detailed description, taken with reference to the accompanying drawings.

Brief description of the drawings

Figures 1A and 1B show some structures and predicted Dicer-mediated processing of example single-stranded extended Dicer substrates. In Figure 1A, Panel A represents a DARNsi without a single braided extension. Panel B depicts an "extended leader strand" siDNA agent, having a 5 'leader strand protruding from 1 to 30 nucleotides in length (15 nucleotides as shown). Panel C depicts an example "extended leader strand" siDNA agent, having a 5 'leader strand protruding from 1 to 30 nucleotides in length (15 nucleotides as shown), with a short oligo complementary to the extended region. single-stranded (discontinuous complement "; discontinuous complement for 3 transients as shown). Panel D represents an exemplary" extended transient "siDNA agent, having a 3 'transient strand that protrudes 1-30 nucleotides in length ( 15 nucleotides as shown.) Panel E represents an "extended strand" siRNA agent, having a 5 'transient strand protruding from 1 to 50 nucleotides in length (15 nucleotides as shown). In each pair of strands of oligonucleotides that form a siDNA, the upper strand is the passenger strand and the lower strand is the guide strand. Target = nucleotide (eg, a ribonucleotide, deoxyribonucleotide, modified ribonucleotide). Figure 1B shows modifies Exemplary single-stranded extended Dicer substrate modifications and nucleotide tions. Panel A represents a DARNsi without a single stranded extension. Panel B depicts an "extended leader strand" siDNA agent, having a 5 'leader strand protruding from 1 to 50 nucleotides in length (15 nucleotides as shown). Panel C represents an agent of Exemplary "extended leader strand" siRNA, having a 5 'leader strand that protrudes 1-50 nucleotides in length (15 nucleotides as shown), with a short oligo complementary to the extended single-stranded region (discontinuous complement ";complement"). discontinuous for 3 transients as shown.) Panel D represents an example of an "extended transient strand" siRNA agent, which has a 3 'transient strand that protrudes 1-50 nucleotides in length (15 nucleotides as shown). each pair of oligonucleotide strands that make up a siDNA, the upper strand is the passenger strand and the lower strand is the guide strand. Blue = ribonucleotide or modified ribonucleotide (for example, 2'-O-methyl ribonucleotide); Gray = deoxyribonucleotide or ribonucleotide; White = ribonucleotide; Dark yellow = deoxyribonucleotide, ribonucleotide, or modified nucleotide (e.g., 2'-O-methyl ribonucleotide, deoxyribonucleotide phosphorothioate; deoxyribonucleotide methylphosphonate or). Small arrow = Dicer cleavage site; large arrow = discontinuity. A = position from the leader strand nucleotide residue that is complementary to the 5 'terminal nucleotide residue of the passenger strand (position 1A); B = position from the 5 'terminal nucleotide residue of the leader strand (position 1B); C = position from the 5 'terminal nucleotide of the short oligo complementary to the extended single-stranded region (position 1C); D = position from the 3 'terminal nucleotide residue of the passing strand (position ID); E = position from the 3 'terminal nucleotide residue of the passing strand (position IE); F = position starting from the 5 'terminal nucleotide consecutive to the 5' protruding single-stranded antisense strand (IF position). Small arrows indicate predicted Dicer cleavage sites; a large arrow indicates a discontinuity.

Figure 2 shows the structure and Dicer-mediated predicted processing of example "extended leader strand" siDNA agents, which have a 5 'leader strand that protrudes 1-30 nucleotides in length (10-15 nucleotides as shown ). Blue = 2'-O-methyl ribonucleotide; Gray = deoxyribonucleotide; Blank = ribonucleotide; Dark yellow = deoxyribonucleotide phosphorothioate; Green = phosphorothioate 2'-O-methyl ribonucleotide; Pink = phosphorothioate ribonucleotide; Light yellow = deoxyribonucleotide methylphosphonate. A = position from the nucleotide residue of said strand in the sense that it is complementary to the 5 'terminal nucleotide residue of the passing strand (position 1A); B = position from the 5 'terminal nucleotide residue of the leader strand (position 1B). Arrows indicate predicted Dicer cleavage sites.

Figure 3 shows the structure and Dicer-mediated predicted processing of example "extended passenger strand" siDNA agents, which have a 3 'passenger strand that protrudes 1-30 nucleotides in length (10 15 nucleotides, as shown ). Blue = 2'-O-methyl ribonucleotide; Gray = deoxyribonucleotide; Blank = ribonucleotide; Dark yellow = deoxyribonucleotide phosphorothioate; Green = phosphorothioate 2'-O-methyl ribonucleotide; Pink = phosphorothioate ribonucleotide; Light yellow = deoxyribonucleotide methylphosphonate. A = position from the nucleotide residue of said strand in the sense that it is complementary to the 5 'terminal nucleotide residue of the passing strand (position 1A); D = position from the 3 'terminal nucleotide residue of the passing strand. Arrows indicate predicted Dicer cleavage sites.

Figure 4 shows the structure and Dicer-mediated predicted processing of exemplary "extended leader strand" siRNA agents, having a 5 'leader strand projecting 1 to 30 nucleotides in length. Extended single-stranded leader siRNA agents having a passing strand with the modification pattern represented by DP1301P and a leader strand with a modification pattern represented by DP1337G; DP1339G; DP1371G; and Dp 1338G were generated. In addition, single-stranded extended siDNA agents having a passing strand with the modification pattern represented by DP1301P, a guide strand with a modification pattern represented by DP1337G; DP1339G; DP1371G; and DP1338G, and a "discontinuous 3 'passenger complement" strand was generated with a modification pattern represented by DP1372P and DP1373P. DRNAs having a guide strand with the depicted modification DP1370G were used as a reference. Blue = 2'-O-methyl ribonucleotide; Gray = deoxyribonucleotide; Blank = ribonucleotide; Dark yellow = deoxyribonucleotide phosphorothioate; Green = phosphorothioate 2'-O-methyl ribonucleotide; Pink = phosphorothioate ribonucleotide; Light yellow = deoxyribonucleotide methylphosphonate. Arrows indicate predicted Dicer cleavage sites.

Figure 5 shows the structure and Dicer-mediated predicted processing of example "extended passenger strand" siRNA agents, which have a 3 'passenger strand that protrudes 1-30 nucleotides in length. Single stranded passenger extended DARNsi agents having a guide strand with the modification pattern represented by DP1XXXG and a passing strand with a modification pattern represented by DP1YYXP; Dp1YxxP; and DP1YxxP were generated. DARNsi agents having a transient strand with the depicted modification DP1301P were used as a reference. Blue = 2'-O-methyl ribonucleotide; Gray = deoxyribonucleotide; Blank = ribonucleotide; Dark yellow = deoxyribonucleotide phosphorothioate; Green = phosphorothioate 2'-O-methyl ribonucleotide; Pink = phosphorothioate ribonucleotide; Light yellow = deoxyribonucleotide methylphosphonate. Arrows indicate predicted Dicer cleavage sites.

Figure 6 shows the sequence, structure, and predicted Dicer-mediated processing of example "extended leader strand" DRNA agents targeting KRAS-249M, which have a 5 'leader strand protruding from 1 to 15 nucleotides in length. Extended single-stranded leader siRNA agents having a passenger strand represented by DP 1301 P (SEQ ID NO: 13) and a guide strand represented by DP1337G (SEQ ID NO: 15); DP1338G (SEQ ID NO: 16); DP1340G (SEQ ID NO: 17); DP1341G (SEQ ID NO: 18); and DP1342G (SEQ ID NO: 18) were generated and tested. SiDARN agents having a transient strand represented by DP1301P and a guide strand represented by DP 1336G were used as a reference. Descriptions of the discontinuous plug-in modding patterns are labeled on the right. RNA = ribonucleotide; PS = phosphorothioate; DNA = deoxyribonucleotide; 2'OMe = 2'-O-methyl; Underlined = 2'-O-methyl ribonucleotide; Bold = leading 5 'overhang; Lower = deoxyribonucleotide; Top = ribonucleotide. Arrows indicate predicted Dicer cleavage sites. DP1336 G is SEQ ID NO: 14.

Figure 7 is a histogram showing the normalized fold expression of KRAS-249M using DRNA si agents having the passing strands and guide strands depicted in Figure 5. Hela cells were treated with 0.1 nM of the DRNA si agents in IARNMAX , 24 h.

Figure 8 shows the sequence, structure, and Dicer-mediated predicted processing of exemplary "extended leader strand" siDNA agents targeting HPRT 1, which have a 5 'leader strand that protrudes 1-15 nucleotides from length. Extended single stranded leader siRNA agents having a passenger strand represented by DP 1001 P (SEQ ID NO: 19) and a guide strand represented by DP1350G (SEQ ID NO: 21); DP1351G (SEQ ID NO: 22); DP1352G (SEQ ID NO: 22); DP1353G (SEQ ID NO: 23); DP1354G (SEQ ID NO: 24); and DP1355G (SEQ ID NO: 24) were generated and tested. SiDARN agents having a passing strand represented by DP 1001 P and a guide strand represented by DP 1002G were used as a reference. Descriptions of the discontinuous plug-in modding patterns are labeled on the right. RNA = ribonucleotide; PS = phosphorothioate; DNA = deoxyribonucleotide; 2'OMe = 2'-O-methyl; Underlined = 2'-O-methyl ribonucleotide; Bold = leading 5 'overhang; lower = deoxyribonucleotide; Top = ribonucleotide. Arrows indicate predicted Dicer cleavage sites. DP 1002G is SEQ ID NO: 20.

Figure 9 is a histogram showing normalized folding expression of HPRT1 using DRNA si agents having the passing strands and guide strands depicted in Figure 7. Hela cells were treated with 0.1 nM of the DRNA si agents in IARNMAX, 24 h.

Figure 10 is an image of a gel showing Dicer activity in single-stranded guide (passenger + guide strands) extended DRNAs directed at KRAS-249M or HPRT1. Treatment: 2 hours at 37 C Turbo Dicer (1 U / reaction). Gel: 18% Tris 90 '@ 10 W. Loading: (1 µl 50 µM + 50 µl of buffer and load 10 µl) or (5 µl of reaction + 20 | µl of buffer and load 10 µl).

Figure 11 shows the sequence and structure of examples of short oligos that complement leader strand extensions ("discontinuous complements"), which are 1-16 nucleotides in length, base paired with 5 'leader strand extensions. Extended single-stranded siRNA agents having a discontinuous complement represented by DP 1365P; DP 1366P; DP1367P; DP1368P; and DP1369P were generated and tested. Descriptions of the discontinuous plug-in modding patterns are labeled on the right. RNA = ribonucleotide; PS = phosphorothioate; DNA = deoxyribonucleotide; 2'OMe = 2'-O-methyl; Underlined = 2'-O-methyl ribonucleotide; Bold = leading 5 'overhang; Lower = deoxyribonucleotide; Top = ribonucleotide. Arrows indicate predicted Dicer cleavage sites. The lower strand in each oligonucleotide pair is SEQ ID NO: 27.

Figure 12 is a histogram showing normalized folding expression of KRAS-249M using siDNA agents having the passing strands and guide strands depicted in Figure 7 and the discontinuous complements depicted in Figure 10. The discontinuous complements used are labeled above each set of the three bars corresponding to siDNA agents having a 5 'guide single-stranded extension (1.-r. DNA, RNA, 2'OMe RNA). The Hela cells were treated with 0.1 nM of the DRNA si agents in IARNMAX, 24 hours.

Figure 13 is a histogram showing the expression of normalized HPRT1 folds using siDNA agents having the passing strands and guide strands depicted in Figure 7 and the discontinuous complements depicted in Figure 10. The discontinuous complement used is marked above of each set of the three bars corresponding to the siDNAs having a 5 'guide single-stranded extension (1.-r. DNA, RNA, 2'OMe RNA). The Hela cells were treated with 0.1 nM of the DRNA si agents in IARNMAX, 24 hours.

Figure 14 shows the structure and Dicer-mediated processing of example single-stranded extended Dicer substrates in an in vivo experiment (Experimental conditions: Treatment: 10 mg / kg one injection; Target: KRAS; Transfection: Fectamine in vivo; Tissue: Liver). Panel A represents a modification pattern used in a negative control siDNA without a single-stranded extension. Panel B represents a modifying pattern used in a positive control siDNA without a single braided extension. Panel C represents a modification pattern used in a test DRNA without a single braided extension. Panel D depicts a modification pattern used in an "extended leader strand" siDNA test agent, having a 5 'leader strand protruding from 1 to 30 nucleotides in length (10 nucleotides as shown). Panel E depicts a modification pattern used in an "extended leader strand" siDNA test agent, having a 5 'leader strand that protrudes 1-30 nucleotides in length (10 nucleotides as shown). In each pair of oligonucleotide strands that form a siDNA, the upper strand is the passing strand and the lower strand is the guide strand. Blue = ribonucleotide or modified ribonucleotide (eg, 2'-O-methyl ribonucleotide); Gray = deoxyribonucleotide or ribonucleotide; Blank = ribonucleotide; Dark yellow = deoxyribonucleotide, ribonucleotide, or modified nucleotide (eg, 2'-O-methyl ribonucleotide, deoxyribonucleotide phosphorothioate; deoxyribonucleotide methylphosphonate). Small arrow = Dicer cleavage site; large arrow = discontinuity. A = position a starting from the nucleotide residue of said strand in the sense that it is complementary to the 5 'terminal nucleotide residue of the passing strand (position 1A); B = position from the 5 'terminal nucleotide residue of the leader strand. Small arrows indicate predicted Dicer cleavage sites; a large arrow indicates a discontinuity.

Figure 15 shows the sequence, structure and Dicer-mediated predicted processing of example "extended leader strand" DRNA agents targeting KRAS-249M and HPRT 1, which have a 5 'leader strand that protrudes by 1-15 nucleotides. of length. The sequence and structure of the exemplary short oligos that complement the leader strand extensions ("discontinuous complements") are shown paired with bases of 5 'leader strand extension sequences. Extended single-stranded leader DARNsi agents having a passing strand with the modification pattern represented by DP 1301 P and a guide strand with a modification pattern represented by DP1337G, DP1338G, DP1339G (SEQ ID NO 16), DP1371G (SEQ ID NO 16 ), and DP 1352G were generated. Furthermore, single-stranded extended siRNA agents having a passing strand with the modification pattern represented in DP 1301 P (SEQ ID NO 13), a guide strand with a modification pattern represented by DP1337G (SEQ ID NO 15), DP1338G ( SEQ ID NO 13), DP1339G (SEQ ID NO 16), DP 1371G (SEQ ID NO 16) and DP1352G (SEQ ID NO 22); and a "discontinuous complement" strand was generated with a modification pattern represented by DP1372P (SeQ ID NO 28) and DP1373P (SeQ ID NO 28). DARNsi agents having a passing strand with the modification represented by DP1301P (SEQ ID NO 13) were used as a reference and a guide strand with the modification represented by DP1370G (SEQ ID NO 13) was used as a reference. The dosing of passing strands, guide strands, and discontinuous complements are labeled on the right. Descriptions of the discontinuous plugin mod patterns are also labeled on the right. RNA = ribonucleotide; PS = phosphorothioate; DNA = deoxyribonucleotide; 2'OMe = 2'-O-methyl; Underlined = 2'-O-methyl ribonucleotide; Bold = leading 5 'overhang; Lower = deoxyribonucleotide; Top = ribonucleotide. Arrows indicate predicted Dicer cleavage sites. SEQ ID NO: 28 is the base paired with SEQ ID NO: 29. DP1370G is SEQ ID NO: 14.

Figure 16 is a histogram showing expression of the normalized mKRAS fold in the liver of individual animals treated with siDNAs having the passing strands and guide strands depicted in Figures 14 and / or 15. Animals were treated with an injection of 10 mg / kg of the siDNA agents in fectamine in vivo and liver samples were analyzed.

Figure 17 is a histogram showing expression of the normalized mKRAS fold in the liver of animals treated with siDNA agents having the passing strands and guide strands depicted in Figures 14 and / or 15. Animals were treated with a injection of 10 mg / kg of the siDNA agents into fectamine in vivo and liver samples were analyzed.

Figure 18 are graphs showing the expression of normalized mKRAS folds in the liver of siDARN treated animals having the passing strands and guide strands depicted in Figures 14 and / or 15. Animals were treated with an injection of 10 mg / kg of the siDARN agents in fectamine in vivo and liver samples were analyzed.

Figure 19 is a histogram showing expression of the normalized mKRAS fold in the spleen of individual animals treated with siDNAs having the passing strands and guide strands depicted in Figures 14 and / or 15. Animals were treated with an injection of 10 mg / kg of the DRNA agents in fectamine in vivo and spleen samples were analyzed.

Figure 20 is a histogram showing expression of the normalized mKRAS fold in the spleen of animals treated with siDNAs having the passing strands and guide strands depicted in Figures 14 and / or 15. Animals were treated with an injection of 10 mg / kg of the DRNA agents in fectamine in vivo and spleen samples were analyzed.

Figure 21 are graphs showing the expression of normalized mKRAS folds in the spleen of siRNA-treated animals having the passing strands and guide strands depicted in Figures 14 and / or 15. Animals were treated with an injection of 10 mg / kg of the siRNA agents in fectamine in vivo and spleen samples were analyzed.

Figure 22 is a histogram showing normalized mKRAS fold expression in kidney of individual animals treated with siDNAs having the passing strands and guide strands depicted in Figures 14 and / or 15. Animals were treated with an injection of 10 mg / kg of the siDNA agents into fectamine in vivo and kidney samples were analyzed.

Figure 23 is a histogram showing mKRAS normalized fold expression in kidney of animals treated with siDNA agents having the passing strands and guide strands depicted in Figures 14 and / or 15. Animals were treated with a injection of 10 mg / kg of the siDNA agents into fectamine in vivo and kidney samples were analyzed.

Figure 24 are graphs showing mKRAS normalized fold expression in kidney of siRNA-treated animals having the passing strands and guide strands depicted in Figures 14 and / or 15. The Animals were treated with an injection of 10 mg / kg of the siDNA agents in fectamine in vivo and kidney samples were analyzed.

Figure 25A shows the activity of oligomers containing N-acetylgalactosamine (DP2421P: DP2460G; DP2421P: DP2461G; DP2422P: DP2462G and DP2286P-GalNac: DP2281G) in primary cultures of mouse hepatocytes. Panel 1 shows the activity of DP2421P: DP2460G with respect to concentration, panel 2 shows the activity of DP2421P: DP2461G with respect to concentration, Panel 3 shows the activity of DP2422P: DP2462G with respect to concentration, and the panel 4 shows the activity of DP2286P-GalNac: DP2281G with respect to concentration. Self-administration activities exhibited by different classes of oligomers were examined with dsNA oligomers constructed with a 5 'extension of the antisense or sense strand, containing the 0 extension to four N-acetylgalactosamine ligands or tri-stranded ligands, as well as dsNA oligonucleotides. having a tetraloop, with three or four N-acetylgalactosamine ligands or looped tetraloop, or one N-acetylgalactosamine tri-stranded ligand in the loop, or three or four N-acetylgalactosamine ligands placed on the stem.

Figure 25B shows the activity of the oligomers that contain N-acetylgalactosamine (DP2421P: DP2460G, DP2421P: DP2461G; DP2422P: DP2462G; DP2463P: DP2382G; DP2464P: DP2382G; DP2465P: DP2382G; DP2466G2; DP2467NAc382G; DP2466G238; DP2467NAc2G: DP2467NA-Gal2) : DP2281G) in primary cultures of mouse hepatocytes. Panel 1 shows the activity of DP2421P: DP2460G with respect to concentration, panel 2 shows the activity of DP2421P: DP2461G with respect to concentration, panel 3 shows the activity of DP2422P: DP2462G with respect to concentration, panel 4 shows DP2463P: DP2382G activity with respect to concentration, Panel 5 shows DP2464P: DP2382G activity with respect to concentration, Panel 6 shows DP2465P: DP2382G activity with respect to concentration, Panel 7 shows the activity of DP2466P: DP2382G with respect to concentration, and Panel 8 shows the activity of DP2467: DP2382G with respect to concentration and Panel 9 shows the activity of DP2286P-GalNAc: DP2281G with respect to concentration. Self-administration activities exhibited by different classes of oligomers were examined with dsNA oligomers constructed with a 5 'extension of the antisense or sense strand, containing the 0 extension to four N-acetylgalactosamine ligands or tri-stranded ligands, as well as dsNA oligonucleotides. that have a tetraloop, in some examples the tetraloop has three or four N-acetylgalactosamine ligands placed on the loop, or one N-acetylgalactosamine tri-stranded ligand on the loop, or three or four N-acetylgalactosamine ligands placed on the stem .

Figure 26 shows the binding affinities of ligands containing N-acetylgalactosamine (DP2421P: DP2460G, DP2421P: DP2461G; DP2422P: DP2462G; DP2463P: DP2382G; DP2464P: DP2382G; DP2465P: DP2382G; DP2466G2; DP24672G; DP2466P382- DP22382G; DP2466G2-8) GalNAc: DP2281G) to ASGPr using fluorescence polarization measurements. Panel 1 shows the binding affinity of DP2421P: DP2460G towards ASGPr with respect to concentration, Panel 2 shows the binding affinity of DP2421P: DP2461G towards ASGPr with respect to concentration, Panel 3 shows the binding affinity of DP2422P : DP2462G towards ASGPr with respect to concentration, Panel 4 shows the binding affinity of DP2463P: DP2382G towards ASGPr with respect to concentration, Panel 5 shows the binding affinity of DP2464P: DP2382G towards ASGPr with respect to concentration, Panel 6 shows the binding affinity of DP2465P: DP2382G towards ASGPr with respect to concentration, Panel 7 shows the binding affinity of DP2466P: DP2382G towards ASGPr with respect to concentration, and Panel 8 shows the binding affinity of DP2467 : DP2382G towards ASGPr with respect to concentration and Panel 9 shows the binding affinity of DP2286P-GalNAc: DP2281G towards ASGPr with respect to concentration. The binding affinities exhibited by different groups of oligomers were examined, including dsNA oligomers having a 5 'antisense or sense strand extension, the extension containing three or four N-acetylgalactosamine ligands or tri-stranded ligands. Additional oligomers comprising dsNAs that form a tetraloop with three or four N-acetylgalactosamine ligands or a N-acetylgalactosamine triplex ligand in the loop, or that have three or four N-acetylgalactosamine ligands in the stem.

Figure 27 and Figure 28 show CTNNB1 mRNA clearance activity in mice treated with N-acetylgalactosamine siDNA conjugates. Each conjugate in the figures contains a tetraloop but has different nucleotide modifications. The removal efficiency of several of the oligomers was examined, including dsNA oligomers with 5 'extensions of the antisense or sense strand containing three or four N-acetylgalactosamine ligands or dsNA oligonucleotide triplet ligands having a tetraloop with three or four N-acetylgalactosamine or tri-stranded N-acetylgalactosamine ligands on the loop, and those having the N-acetylgalactosamine ligands placed on the stem of the tetraloop.

Figure 29 shows HAO1 mRNA clearance activity in mice treated with N-acetylgalactosamine siDNA at a dose of 25 mpk. The removal efficiency of oligomers with 5 'extensions or tetraloop configurations, including those with 5' extensions of the sense and antisense strands, and a tetraloop, each with the ligand N-acetylgalactosamine attached to the 5 'extension or to the tetraloop, where configurations of three or four ligands or tri-stranded ligands attached to the 5 'extension or to the stem or loop of the tetraloop. In Figure 29, the first six dsNA molecules after the PBS sample are tetra-loop molecules and the next six dsNA molecules are extension molecules. The six tetraloop molecules differ from each other in the patterns of modification and the six extension molecules also differ from each other in the patterns of chemical modification. The details of the modification patterns are described in Table 3.

Figure 30 shows the results of a dose response study administering an N-acetylgalactosamine DRNA si HAO1 conjugate to mice. Dose response data is shown for oligonucleotides administered to mice constructed with a 5 'extension in the sense or antisense strand, and for a tetraloop configuration, where three or four N-acetylgalactosamine ligands were bound to the extension 5 'or to the stem or loop of the tetraloop configuration.

Figures 31, 31A, 31B, 31C and 31D show some structures. Figure 31A shows an "antisense notched" dsNA containing a sense strand with an extended loop (Region E) at the 5 'terminal, a double region formed by the antisense strand with the single-stranded portion of the sense strand (Region E). B). When the dsNA is duplicated, there is a discontinuity where Dicer cuts the antisense strand (shown with a black arrow). Figure 31B shows an "antisense notched" dsNA containing a sense strand with an extended loop (Region E) at the 5 'end, a double region formed by the antisense strand with the single-stranded portion of the sense strand (Region E). B), and a 3 'overhang on the antisense strand (Region F, shown with a dashed circle). When the dsNA is duplicated, there is a discontinuity where Dicer cuts the antisense strand (shown with a black arrow). Figure 31C shows a "notched sense" dsNA containing a sense strand with an extended loop (Region J) at the 3 'end, and a double region formed by the antisense strand with the single-stranded portion of the sense strand. (Region H). When the dsNA is duplicated, there is a discontinuity where Dicer cuts the strand in the direction (shown by a black arrow). The nucleotide immediately proximal to the Dicer cleavage site must be a ribonucleotide (gray). Figure 31D shows a "notched sense" dsNA containing a sense strand with an extended loop (Region J) at the 3 'terminal, and a double region formed by the antisense strand with the single-stranded portion of the sense strand. (Region H), and a 3 'overhang on the antisense strand (Region F shown by a dashed circle). When the dsNA is duplicated, there is a discontinuity where Dicer cuts the strand in the direction (black arrow). The nucleotide immediately proximal to the Dicer cleavage site must be a ribonucleotide (gray).

Figures 32A and 32B show how nucleotide positions are calculated from the 5 'and 3' ends of the sense and antisense strands of the dsNAs. Figure 32A depicts how nucleotide positions from the 5 'and 3' ends of the sense and antisense strands are calculated when the sense strand has a loop extended with a tetraloop (i.e., the discontinuity is at the same side of dsNA as antisense strand) Dicer cleavage site is shown on the sense strand (short, black arrow). Figure 32B depicts how the nucleotide positions are calculated from the 5 'and 3' ends of the sense and antisense strands when the antisense strand has a loop extended with a tetraloop (i.e., the discontinuity is in the same side of the dsRNA than the sense strand). The Dicer cleavage site is shown on the antisense strand (short black arrow).

Figures 33A-33C depict examples of dsNA where there is a discontinuity on the same side of the dsNA molecule as the antisense strand, ie, "notched antisense dsNA." Figure 33A depicts examples of "antisense notched" dsRNAs having a blunt end. Figure 33B depicts examples of "notched antisense" having a 3 'overhang of 2 nucleotides. Figure 33C depicts examples of "notched antisense" dsNAs having a 3 'overhang of 4 nucleotides. When the dsNA is duplicated, there is a discontinuity where Dicer cuts the antisense strand (black arrow).

Figures 34A-34C depict examples of dsNAs in which there is a discontinuity on the same side of the dsNA molecule as the sense strand, ie, "notched sense dsNA." Figure 34A depicts examples of "notched sense" dsRNAs having a blunt end. Figure 34B depicts examples of "notched sense" dsNAs having a 3 'overhang of 2 nucleotides. Figure 34C depicts examples of "notched sense" dsNAs of the invention having a 4 nucleotide 3 'overhang. When the dsNA is duplicated, there is a discontinuity where Dicer cuts the strand in the direction (black arrow).

Figures 35A and 35B depict locations where modifications may be present in dsNAs. Figure 35A depicts a dsNA showing the positions of 2'-0-methyl modifications (shown by O) in Region C of the molecule. Figure 35B depicts a dsNA where the sense strand has an extended loop with a tetraloop (ie, the discontinuity is on the same side of the dsNA as the antisense strand; shown with a black arrow). In the dsNA depicted in Figure 35B, the 5 'end of the sense strand may be phosphorylated (shown by a "p-"); the 5 'end of the guide strand may be dephosphorylated; the antisense strand can be modified at the 1, 2 and 3 positions from the 3 'end of the antisense strand with 2'-0-methyl (shown by O); and the antisense strand can be modified at odd positions starting at position 5 from the 3 'end of the antisense strand with 2'-0-methyl (shown by O). In the dsNA depicted in Figure 35B, the sense strand may contain deoxyribonucleotides (shown by •) at positions 11 and 12 of the 3 'end of the antisense strand.

Figures 36A and 36B depict locations where modifications in dsNAs may be present. Figure 36A depicts a dsNA showing the positions of 2'-0-methyl modifications (shown by O) in Region C of the molecule. Figure 36B depicts a dsNA in which the antisense strand has an extended loop with a tetraloop (ie, the discontinuity is on the same side of the dsRNA as the sense strand; shown with a black arrow). In the dsNA depicted in Figure 34B, the 5 'end of the sense strand may be phosphorylated (shown by a "p-"); the 5 'end of the guide strand may be dephosphorylated; the antisense strand can be modified at positions 1, 2 and 3 from the 3 'end of the antisense strand with 2'-0-methyl (shown by O); and the antisense strand can be modified at odd positions starting at position 5 from the 3 'end of the antisense strand with 2'-0-methyl (shown by O). In the dsNA depicted in Figure 36B, the antisense strand may contain deoxyribonudeotides (shown by •) at positions 3 and 4 of the 5 'end of the antisense strand.

Figure 37 shows dsRNA constructs for use in experiments comparing the effect of a dsRNA without a tetraloop, the effect of a dsRNA with a tetraloop (i.e., UUCG), the effect of a dsRNA with a tetraloop (i.e., UUCG) in combination with a notch on the same side as the sense strand, the effect of a dsRNA with a tetraloop (i.e., UUCG) in combination with a notch on the same side as the antisense strand, and the effect of another tetraloop ( i.e. GAAA) in combination with a notch on the same side as the antisense strand. All sequences in the dsRNAs are based on human hypoxanthine phosphoribosyltransferase 1 (HPRT-1CC; NCBI databases Nos. NM-000194 and GI: 164518913).

Figure 38 shows dsRNA constructs for use in experiments that modify the discontinuous antisense strand to determine its effects on the RNAi pathway in the Dicer processing step and post-Dicer cleavage steps (e.g., Ago2 interaction, recognition of objectives, split Aug2). All sequences in the dsRNAs are based on human hypoxanthine phosphoribosyltransferase 1 (HPRT-1CC; NCBI databases Nos. NM-000194 and GI: 164518913).

Figure 39 shows dsRNA constructs for use in experiments that modify the extended sense strand to determine its effects on the RNAi pathway in the Dicer processing step and steps prior to Dicer cleavage. All sequences in the dsRNAs are based on human hypoxanthine phosphoribosyltransferase 1 (HPRT-1CC; NCBI databases Nos. NM-000194 and GI: 164518913).

Figure 40 shows how the placement of a discontinuity defines the cleavage products manufactured by Dicer. The notched dsNA structure directs a unique cleavage product with the advantage that a defined 21 base antisense strand is produced and loaded into RISC. By moving the notch, productions of other antisense strand lengths are directed. Chemical modifications dictate the production of non-21-mer products.

Figure 41 shows that DNA tetraloops and DNA ends control Dicer activity in dsRNA. Double-stranded RNA constructs are used in experiments comparing the effect of a dsRNA without a tetraloop, the effect of a dsRNA with a tetraloop DNA (i.e., d (GTTA)), the effect of a dsRNA with a tetraloop DNA (i.e. , d (GTTA)) in combination with a notch on the same side as the sense strand, the effect of a dsRNA with a tetraloop DNA (i.e., d (GTTA)) in combination with a notch on the same side as the antisense strand, and the effect of another tetraloop DNA (ie, d (TTTT)) in combination with a notch on the same side as the antisense strand. All sequences in the dsRNAs are based on human hypoxanthine phosphoribosyltransferase 1 (HPRT-1CC; NCBI databases Nos. NM-000194 and GI: 164518913).

Figure 42 shows a ligand conjugate design wherein the dsNA molecule comprises a notched tetraloop and the ligand, eg, GalNac, cholesterol, folate, mannose 6-phosphate.

Figure 43 shows a ligand-conjugated dsNA comprising a 5 'extension on the leader strand and comprising a ligand, eg, GalNac, cholesterol, folic acid, and mannose-6-phosphate.

Figure 44 shows a ligand-conjugated dsNA comprising a 5 'extension on the passenger strand and a ligand, eg, GalNac, cholesterol, folic acid, and mannose-6-phosphate.

Figure 45 shows the possible iterative combinations of a single-stranded extension in the dsNA molecule, the dsNA molecule is also seen with one or two overhangs at the ends without extensions.

Figure 46 presents dsNAs.

Figure 47 presents the dsNAs with a tetraloop.

Detailed description

The disclosure provides compositions and methods for reducing the expression of a target gene in a cell, which involves contacting a cell with an isolated double-stranded nucleic acid in an amount effective to reduce the expression of a target gene in a cell. In addition to the tetraloop-containing dsNAs of the invention, the application also provides dsNAs that possess a single-stranded nucleotide region at the 5 'end of the antisense strand, the 3' end of the sense strand, the 5 'end of the sense strand or the 3 'end of the antisense strand or combinations thereof wherein the extension is conjugated to at least one ligand as defined herein. These structures are effective RNA interference agents (see Figures 25-30 and associated Examples). In most embodiments, the single chain extension comprises at least one modified nucleotide and / or phosphate modification. Surprisingly, as demonstrated herein, single-stranded Dicer-extended substrate siRNAs (siRNAs) or substrate-free siRNA-Dicer conjugated to a ligand or in absence of a ligand are effective RNA inhibitory agents compared to corresponding siDNAs or non-Dicer siRNA substrate.

The ability to conjugate ligands to the tetraloop region of the dsNA molecules according to the claimed invention allows delivery of the dsNA molecules to the region of interest which, for example, may be hepatocytes.

The findings reported in this paper provide motivation to generate functional siRNAs that have an extended region that allows the attachment of additional and / or distinct functional groups, inclusion / design of stabilizing modifications (e.g., PS-NA building blocks), or other forms of Modifications capable of adding additional functionality and / or enhancing, for example, pharmacokinetics, pharmacodynamics or biodistribution of said extended siDNAs, compared to siDNAs that do not contain said extended DNA or RNA or single stranded DNA / RNA hybrid domains.

The advantages of a siDNA with a 5 'extended guide strand, 3' extended passenger strand, 5 'extended passenger strand, or 3' extended guide strand that has higher activity than a processed post-Dicer compared to the siRNA agent of similar length is emphasized by the results presented here. The ability to extend the 5 'guide strand, 3' passenger strand, 5 'passenger strand, or 3' guide strand of si DRNA agents without observing a corresponding reduction in RNA silencing activity allows certain functional groups to bind to such agents that could not be added to unextended molecules without interfering with RNA silencing activity due to more stringent settings. The surprising discovery that single-stranded extended non-Dicer substrates reduce the expression of a target gene as well as non-extended dsNAs allows the generation of functional non-Dicer substrates that have an extended region that allows the attachment of additional and / or distinct functional groups, inclusion / design of stabilizing modifications (for example, PS-NA structural units) or other forms of modifications such modifications or attached structural units that add additional functionality and / or improve, for example, pharmacokinetics, pharmacodynamics or biodistribution of said extended DNA, in comparison with dsRNA agents of corresponding length that do not contain such unique DNAs or RNAs or hybrid DNA / RNA extended domains.

The advantage provided by the new ability to elongate the 5 'guide strand, 3' passenger strand, or 5 'passenger strand of non-Dicer substrates containing double dsNA while retaining the activity of processed siRNA agent after Dicer levels greater than doubled for dsRNAs of similar length is emphasized by the results presented here. The ability to extend the 5 'guide strand, 3' passenger strand, or 5 'passenger strand of non-Dicer substrates without observing a corresponding reduction in RNA silencing activity may also allow certain functional groups to bind to such agents that would not otherwise be possible, due to the ability of such functional groups to interfere with RNA silencing activity when present in more stringent configurations.

In addition, single-stranded extended siRNAs can include a third short oligonucleotide (1-16 nucleotides in length) that pairs with the single-stranded extended siRNA region, for example, which base pairs to a guide 5 'single-stranded extended region. The third oligo works advantageously: (a) to stabilize the single-stranded extension and (b) to provide a separate entity to which a targeted molecule (or other active agent) could bind, and which could then bind to the DRNA si single strand fusion extended (versus direct binding of the targeting molecule to extended single stranded siDNA).

The tetraloop provides greater stability to the oligomer, including greater resistance to nuclease compared to an oligomer that lacks a tetraloop. The presence of a notch in the antisense strand allows the oligomer to function as a siRNA molecule and as a Dicer substrate; depending on the length of the double. The oligomer includes a precut antisense strand due to the presence of the notch, which provides a cleavable Dicer substrate and / or a Dicer binding substrate. The tetraloop structure can be covalently attached to a ligand at various locations within the structure, including the stem and loop regions. Surprisingly, the addition of a ligand does not affect the structure of the tetraloop. In particular, the oligomers containing the tetraloop and the notch where the nucleotides of the tetraloop were conjugated to the ligand surprisingly maintained their function as siRNA molecules (see, for example, Example 22-24). The presence of a notch in the oligomer provides for the use of a variety of chemical modifications to the antisense strand. The tetraloop structure described herein does not require Dicer cleavage for RNAi activity.

The surprising discovery that single-stranded non-Dicer substrates comprising a tetraloop do not exhibit decreases in efficiency allows the generation of non-Dicer substrates that remain effective while providing greater space for, for example, the attachment of non-Dicer substrates to one another and / or distinct functional groups, inclusion / design of stabilizing modifications (for example, PS-NA structural units) or other forms of modifications capable of adding additional functionality and / or enhancing, for example, pharmacokinetics, pharmacodynamics or biodistribution of such agents, as in comparison with dsRNA agents of corresponding length that do not contain such extended single-stranded DNA domains.

In one embodiment of the present invention, the tetraloop is located at the 5 'end of the sense strand. In another embodiment, the tetraloop is located at the 3 'end of the sense strand. In another embodiment, the tetraloop is located at the 5 'end of the antisense strand. In another embodiment, the tetraloop is located at the 3 'end of the antisense strand. The tetraloop, located at any position in the dsNA molecule, 5 'or 3' end, sense or antisense strand, can be easily conjugated to one or more ligands such as GalNAc, mannose-6 phosphate, cholesterol, and folic acid. Provided herein are dsNA synthesis methods, conjugation methods, assays for the activity of a dsNA comprising a tetraloop located at the 5 'end of the sense strand or at the 5' end of a dsNA to a ligand and the strand antisense. The described methods of conjugation and synthesis can be modified to generate dsNA molecules that comprise a tetraloop at the 3 'end of the sense strand or at the 3' end of the antisense strand.

Definitions

Unless otherwise defined, all technical and scientific terms used in this document have the meaning commonly understood by one of ordinary skill in the art to which this invention belongs. The following references provide those of skill with a general definition of many of the terms used in this invention: Singleton et al., Dictionary of Microbiology and Molecular Biology (2nd ed. 1994); The Cambridge Dictionary of Science and Technology (Ed. Walker, 1988); The Glossary of Genetics, 5th Ed., R. Rieger et al. (eds.), Springer Verlag (1991); and Hale and Marham, The Harper Collins Dictionary of Biology (1991). As used in this document, the following terms have the meanings attributed to them below, unless otherwise specified.

As used herein, the term "nucleic acid" refers to deoxyribonucleotides, ribonucleotides, or modified nucleotides, and their polymers in single or double-stranded form. The term encompasses nucleic acids that contain known nucleotide analogs or modified backbone residues or linkages, that are synthetic, natural, and non-natural, that have binding properties similar to the reference nucleic acid, and that, in certain cases, are metabolized. in a manner similar to the reference nucleotides. Examples of such analogs include, without limitation, phosphorothioates, phosphoramidates, methylphosphonates, chiral methylphosphonates, 2-O-methyl ribonucleotides, peptide nucleic acids (PNAs).

As used herein, "nucleotide" is used as recognized in the art to include those with natural (standard) bases and modified bases well known in the art. Said bases are generally located in the 1 'position of a nucleotide sugar structural unit. Nucleotides generally comprise one base; sugar and a phosphate group. Nucleotides also include ribonucleotides, deoxyribonucleotides, abasic nucleotides, inverted abasic nucleotides, and nucleotide analogs. Nucleotides can be unmodified or modified in the sugar, phosphate and / or base structural unit, (also referred to interchangeably as nucleotide analogs, modified nucleotides, non-natural nucleotides, non-standard nucleotides, and others; see, for example, Usman and McSwiggen, supra; Eckstein, et al., PCT International Publication No. WO 92/07065; Usman et al., PCT International Publication No. WO 93/15187; Uhlman and Peyman, supra). Some of the known examples of modified nucleotides include a base analog selected from the group consisting of: hypoxanthine (I), xanthine (X), 3p-D-ribofuranosyl- (2,6-diaminopyrimidine) (K), 3p-D -ribofuranosyl- (1-methyl-pyrazolo [4,3-d] pyrimidine-5.7 (4H, 6H) -dione) (P), iso-cytosine (iso-C), iso-guanine (iso-G) , 1-pD-ribofuranosyl- (5-nitroindole), 1-pD-ribofuranosyl- (3-nitropyrrole), 5-bromouracil, 2-aminopurine, 4-thio-dT, 7- (2-thienyl) -imidazo [4 , 5-b] pyridine (Ds), pyrrole-2-carbaldehyde (Pa), 2-amino-6- (2-thienyl) purine (S), 2-oxopyridine (Y), difluorotolyl, 4-fluoro -6- methylbenzimidazole, 4-methylbenzimidazole, 3-methyl isocarbostyrylyl, 5-methyl isocarbostyrylyl, 3-methyl-7-propynyl isocarbostylrile, 7-azaindolyl, 6-methyl-7-azaindolyl, imidizopyridinyl, 9-methylinylimidizopyridinyl, 9-methylinylimidizopyridinyl, 7-methylpyrinylimidizopyridinyl, 9-methylinylimidizopyroloxy isocarbostyrylyl, propynyl-7-azaindolyl, 2,4,5-trimethylphenyl, 4-methylindolyl, 4,6-dimethylindolyl, phenyl, naphthalenyl, anthracenyl, fe nanthracenyl, pyrenyl, stilbenzyl, tetracenyl, and pentacenyl. Some of the common modifications to the sugar moiety are selected from the group comprising 2'-O-methyl, 2'-methoxyethoxy, 2'-fluoro, 2'-allyl, 2'-O- [2- (methylamino) -2-oxoethyl], 4'-thio, 4'-Ch2-O-2'- bridge, 4 '- (Ch2) 2-O-2'- bridge, 2'-LNA, 2'-amino, or modifications 2'-O- (N-methylcarbamate). Other examples of modified nucleic acid bases are known in the art, for example, as summarized in Limbach et al., Nucleic Acids Res. 22: 2183, 1994. Some of the non-limiting examples of base modifications that can be introduced in nucleic acid molecules include, hypoxanthine, purine, pyridin-4-one, pyridin-2-one, phenyl, pseudouracil, 2,4,6-trimethoxybenzene, 3-methyl uracil, dihydrouridine, naphthyl, aminophenyl, 5-alkylcytidines ( e.g. 5-methylcytidine), 5-alkyluridines (e.g. ribothymidine), 5-halouridine (e.g. 5-bromouridine) or 6-azapyrimidines or 6-alkylpyrimidines (e.g. 6-methyluridine), propine and others ( Burgin, et al., Biochemistry 35: 14090, 1996; Uhlman and Peyman, supra). By "modified bases" in this regard is meant nucleotide bases other than adenine, guanine, cytosine, and uracil at the 1 'position or their equivalents.

As used herein, the term "monomer" is used interchangeably with "nucleotide."

As used herein, a "double-stranded nucleic acid" or "dsNA" is a molecule that comprises two oligonucleotide strands that form a double. A dsNA can contain ribonucleotides, deoxyribonucleotides, modified nucleotides, and combinations thereof. The dsNA molecules can be a Dicer substrate or a non-Dicer substrate. In embodiments where the dsNA molecule is a Dicer substrate, the dsNA molecule is referred to as a Dicer NA (dsiNA) substrate. In embodiments where the dsiNA comprises a plurality of RNAs, it is referred to as a Dicer substrate siRNA (siRNA). DRNA molecules comprise DNA and RNA molecules. DARNsi is a subset of DsiNA that is a subset of dsNA. Therefore, the term dsNA includes dsiNA, double DNA, double DNA / RNA, double RNA and DARNsi. The double-stranded NAs of the present invention include substrates for proteins and protein complexes in the RNA interference pathway, eg, Dicer and RISC. The exemplary structure of the dsNAs is shown in Figure 1, B. In certain embodiments, the dsNAs comprise an RNA double in a region that is capable of functioning as a Dicer substrate siRNA (siRNA) and a single-stranded region, which is in a position 5 'of the projected Dicer cleavage site of the second strand of the DRNA / DNA agent. In another embodiment, the dsNA comprises a RNA double in a region that is capable of functioning as a Dicer substrate siRNA (siRNA) and a single-stranded region, which is located at a position 3 'of the projected Dicer cleavage site of the first strand of the DARNsi / DNA agent. In another embodiment, the dsNA comprises a RNA duplex that is a Dicer substrate siRNA (siDNA) and a single-stranded region comprising at least one modified nucleotide and / or phosphate modification, which is located at a 3 'position of the site. projected Dicer cleavage of the second strand of the DARNsi / DNA agent. In alternative embodiments, the dsNA comprises a RNA double that is a Dicer substrate siRNA (siDNA) and a single-stranded region comprising at least one modified nucleotide modification and / or phosphate backbone, which is located at a 5 'position. of the projected Dicer cleavage site of the first strand of the DARNsi / DNA agent.

As used herein, the term "oligomer" is used interchangeably with "double-stranded nucleic acid" (dsNA). An oligomer (dsNA molecule) comprises monomers (nucleotides).

As used herein, the term "plurality" means a number greater than two, eg, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50 or more.

As used herein, the term "spacer" means a nucleotide that separates ligand-modified nucleotides from each other.

As used herein, the term "releasable linker" refers to a linker that is capable of undergoing cleavage of the link that connects a ligand to a nucleotide under physiological conditions within a cell or animal or under conditions in vivo. A releasable linker includes a biolabile linker and, upon cleavage, releases the ligand from the dsNA molecule. Linker structural units are also capable of cleavage under various conditions. Suitable conditions for cleavage can include, but are not limited to, pH, UV irradiation, enzymatic activity, temperature, hydrolysis, removal and substitution reactions, and also thermodynamic properties of the bond. Releasable linkers can be photolabile in nature in which the linkers are cleaved under particular UV wavelengths, dsNAs containing photolabile linkers can be used to deliver compounds to a target cell or tissue of interest and can be subsequently released in the presence of a source. UV.

As used herein, the term "biodegradable linker" refers to a nucleic acid or non-nucleic acid molecule that is designed to be biodegradable and serves as a linker to connect one molecule to another molecule, for example, a bioactive molecule. The stability of the biodegradable linker can be modulated through the use of various combinations of nucleotides, deoxyribonucleotides and chemically modified nucleotides, for example 2'-O-methyl, 2'-O-fluoro, 2'-amino, 2'-O-amino , 2'-C-allyl, 2'-O-allyl and other 2'-modified or base-modified nucleotides. The biodegradable linker can be a dimer, trimer, tetramer or longer, for example, an oligonucleotide of about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length or may comprise a single nucleotide in length with a phosphorous-based bond. The biodegradable linker can also comprise a nucleic acid backbone, nucleic acid sugar, or nucleic acid base modifications.

As used herein, the term "biodegradable" refers to degradation in a biological system, eg, enzymatic degradation or chemical degradation.

As used herein, the term "detectable label" refers to any suitable label known in the art and includes, but is not limited to, radiolabeled, chemiluminescent, and fluorescent labels. In many cases, the tag is of a type that does not substantially alter cellular uptake of the tagged nucleic acid molecules.

As used herein, the term "dye" refers to a tag that can be detected by chemiluminescence or fluorescence, commonly used examples include, but are not limited to, TAMRa, fluorescein, cy3 and cy5, etc. The signal (s) generated by the tag (s) can be measured in a number of ways, including visually (eg, by microscopy) or fluorescence activated cell sorting (FACS). In either case, the measurement of the generated signal (s) tag (s) can be used to determine (a) the number or percentage of cells that have taken the tag (s), (b) the amount of one or more tags taken up by individual cells or groups of cells, or (c) both (a) and (b).

As used herein, the term "half-life" refers to the time it takes for a molecule, for example, a dsNA, a metabolite, a pharmaceutical product, a radioactive nucleotide, a therapeutic molecule, a dye, or a signaling molecule to use half its pharmacological, physiological or radiological activity or half its intensity.

As used herein, the terms "ligand-modified nucleotide" or "ligand-conjugated nucleotide" or "ligand-containing nucleotide" are used interchangeably to denote a nucleotide to which a ligand is attached, the sugar binding being or the base or the terminal phosphate through the use of a linker.

As used herein, a "siRNA" or Dicer substrate siRNA agent is a molecule that comprises two oligonucleotide strands that form a double. An siDNA agent can contain ribonucleotides, deoxyribonucleotides, modified nucleotides, and combinations thereof. The DRNA si agents must be processed by the Dicer enzyme of the IRNA interference pathway.

In certain embodiments, the siDNAs of the invention may possess deoxyribonucleotide residues at sites immediately adjacent to the projected Dicer enzyme cleavage site (s). For example, in all DRNAsi shown in Figure 2 and in the sixth, seventh, eighth, ninth, tenth, eleventh, and twelfth DRNAs shown in Figure 3, deoxyribonucleotides can be found (starting at the 5 'terminal residue of the first strand as position 1) at position 24 and sites 3 'from position 24 (eg, 24, 25, 26, 27, 28, 29, 30, etc.). Deoxyribonucleotides can also be on the second strand that begins at the nucleotide that is complementary to position 20 of the first strand, and also at positions on the second strand that lie in the 5 'direction of this nucleotide. Thus, certain effective siRNAs of the invention possess only 19 duplicated ribonucleotides prior to the start of the introduction of deoxyribonucleotides into the first strand, the second strand and / or both strands of said siDARNs.

As used herein, "double" refers to a double helical structure formed by the interaction of two single-stranded nucleic acids. In accordance with the present invention, a double may contain first and second strands that are sense and antisense, or a target and antisense strand of the dsNA. A double is typically formed by pairwise hydrogen base bonding, ie, "base pairing," between two single-stranded nucleic acids that are oriented antiparallel to each other. As used herein, the term "double" refers to regions of the first and second strands that align in such a way that, if the aligned bases of the strands are complementary, they can form a Watson-Crick base pair. . The term "double" does not include one or more single stranded nucleotides comprising one or more 5 'or 3' terminal single stranded nucleotides. In some embodiments, the double includes a region of first and second aligned strands that can be completely (100%) base-paired and a region of first and second aligned strands that contains 1, 2, 3, 4, 5 or more bases without pairing, as provided that the 5 'terminal nucleotide of the first strand of the double and the 3' terminal nucleotide of the first strand of the double are Watson-Crick bases paired with a corresponding nucleotide of the second strand. As used herein, "fully duplicated" refers to all nucleotides between the paired 5 'and 3' terminal nucleotides that are base-paired. As used herein, "substantially double" refers to a double between strands where there are 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 , 15, 16, 17, 18, 19, 20, 21,22, 23, 24, 25, 30, 40, 50 unpaired base pairs (consecutive or non-consecutive) between the 5 'and 3' terminal nucleotides of the first strand.

In the context of "substantially duplicated", "consecutive", "consecutive", as it refers to duplicated nucleotides, it means a stretch of more than two adjacent nucleotides in one sense or an antisense strand that does not form the base pairing. Watson-Crick with the other strand.

In the context of "substantially duplicate", "non-consecutive", as it refers to duplicate nucleotides, means non-matches in the sense or antisense strand that are separated by more than one nucleotide from each other.

Double pairing usually occurs by Watson-Crick base pairing, for example, guanine (G) forms a base pair with cytosine (C) in DNA and RNA (hence the cognate nucleotide of a guanine deoxyribonucleotide is a cytosine deoxyribonucleotide, and vice versa), adenine (A) forms a base pair with thymine (T) in DNA, and adenine (A) forms a base pair with uracil (U) in RNA. Conditions under which base pairs can be formed include physiologically or biologically relevant conditions (eg, intracellular: pH 7.2, 140 mM potassium ion; extracellular pH 7.4, 145 mM sodium ion). Furthermore, the doubles are stabilized by stacking interactions between adjacent nucleotides. As used herein, a double can be established or maintained by base pairing or stacking interactions. A double is made up of two complementary nucleic acid strands, which can be substantially complementary or completely complementary (see below).

As used herein, "corresponds to" or "corresponding to" refers to the bases of the first and second strands that are double aligned so that the nucleotide residue of the second strand lines up with the residue. of the first strand, when the first strand at position 1 is paired with a nucleotide of said second strand such that said second strand comprises a 3 'single strand overhang of 1-6 nucleotides in length. "Corresponds to" does not require pairing by Watson-Crick base pair formation, but includes first strand / second strand aligned and unpaired nucleotides as well as first strand / second strand matched and aligned nucleotides.

By "complementary" or "complementarity" is meant that a nucleic acid can form hydrogen bonds with another nucleic acid sequence through traditional Watson-Crick or Hoogsteen base pairing. With reference to the nucleic acid molecules of the present disclosure, the binding free energy for a molecule of nucleic acid with its complementary sequence is sufficient to allow the relevant function of the nucleic acid to proceed, eg, RNAi activity. Determination of free binding energies for nucleic acid molecules is well known in the art (see, eg, Turner, et al., CSH Symp. Quant. Biol. LII, pp.

123-133, 1987; Frier, et al., Proc. Nat. Acad. Sci. USA 83: 9373-9377, 1986; Turner, et al., J. Am. Chem. Soc. 109: 3783-3785, 1987). A percent complementarity indicates the percentage of contiguous residues in a nucleic acid molecule that can hydrogen bond (eg, Watson-Crick base pairing) with a second nucleic acid sequence (eg, 5, 6, 7 , 8, 9 or 10 nucleotides out of a total of 10 nucleotides in the first oligonucleotide that is paired with a second nucleic acid sequence that has 10 nucleotides represents 50%, 60%, 70%, 80%, 90% and 100% complementary , respectively). To determine that a percentage of complementarity is at least a certain percentage, the percentage of contiguous residues in a nucleic acid molecule that can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second acid sequence nucleic acid is calculated and rounded to the nearest whole number (for example, 12, 13, 14, 15, 16, or 17 nucleotides out of a total of 23 nucleotides in the first oligonucleotide that is based paired with a second nucleic acid sequence that has 23 nucleotides represents 52%, 57%, 61%, 65%, 70% and 74%, respectively; and has at least 50%, 50%, 60%, 60%, 70% and 70% complementarity, respectively ). As used herein, "substantially complementary" refers to the complementarity between the strands such that they are capable of hybridizing under biological conditions. Substantially complementary sequences have 60%, 70%, 80%, 90%, 95%, or even 100% complementarity. Furthermore, techniques for determining whether two strands are capable of hybridizing under biological conditions by examining their nucleotide sequences are well known in the art.

As used herein, the "3 'region" with respect to the antisense strand refers to consecutive nucleotides of the antisense strand that are 3' distal (on the antisense strand) to the nucleotide of the antisense strand that is aligned. with corresponding positions 1-19, 1-20 or 1-21 of the sense strand. For the avoidance of doubt, the "3 'region", when referring to the antisense strand, should encompass antisense nucleotides in a double formed between the antisense strand and its 3' cognate target RNA distal to (in the antisense strand that corresponds to the nucleotides in the target RNA that is 5 'distal to) the projected cleavage site of Argonaute 2 (Ago2).

As used herein, "synthon" means a nucleotide or non-nucleotide structural unit that can be used in solid phase synthesis methods to produce a modified DNA, RNA, or DNA / RNA molecule having a particular sequence of interest. In certain embodiments, a synthon is a nucleotide or non-nucleotide building block conjugated to a ligand, for example, GalNac, mannose-6-phosphate, cholesterol, or folate, where the conjugated nucleotide or non-nucleotide building block can be used in phase synthesis. solid to produce a nucleic acid molecule of interest. In certain embodiments, a synthon further comprises a linker through which the nucleotide or non-nucleotide moiety is conjugated to the ligand.

The term "alkyl" includes saturated aliphatic groups, including straight-stranded alkyl groups (eg, methyl, ethyl, propyl, butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, etc.), branched-stranded alkyl groups (isopropyl, tert-butyl, isobutyl, etc.), cycloalkyl (alicyclic) groups (cyclopropyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl), alkyl substituted cycloalkyl groups and cycloalkyl substituted alkyl groups. In certain embodiments, a straight-stranded or branched-stranded alkyl has 6 or fewer carbon atoms in its main strand (eg, C1-C6 for straight strand, C3-C6 for branched strand), and more preferably 4 or less. Also, preferred cycloalkyls have 3-8 carbon atoms in their ring structure, and more preferably have 5 or 6 carbons in the ring structure. The term C1-C6 includes alkyl groups containing 1 to 6 carbon atoms.

Furthermore, unless otherwise specified, the term alkyl includes both "unsubstituted alkyls" and "substituted alkyls", the latter of which refers to alkyl moieties having independently selected substituents that replace a hydrogen in one or more carbons of the main strand of hydrocarbons. Such substituents can include, for example, alkenyl, alkynyl, halogen, hydroxyl, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy, aryloxycarbonyloxy, carboxylate, alkylcarbonyl, arylcarbonyl, alkoxycarbonyl, aminocarbonyl, alkylaminocarbonyl, dialkylaminocarbonyloxy, alkoxycarbonyloxy, alkoxycarbonyloxy, phosatoxycarbonyl, alkoxylaminocarbonyl, phosatoxycarbonyl, alkoxycarbonyloxy amino (including alkylamino, dialkylamino, arylamino, diarylamino, and alkylarylamino), acylamino (including alkylcarbonylamino, arylcarbonylamino, carbamoyl and ureido), amidino, imino, sulfhydryl, alkylthio, arylthio, thiocarboxylate, sulfates, alkylsulfinyl, sulfonate, sulfamoyl, sulfonamido, sulfonate, sulfamoyl, sulfonamido trifluoromethyl, cyano, azido, heterocyclyl, alkylaryl, or an aromatic or heteroaromatic building block. Cycloalkyls can be further substituted, for example, with the substituents described above. An "alkylaryl" or "arylalkyl" moiety is an alkyl substituted with an aryl (eg, phenylmethyl (benzyl)). The term "alkyl" also includes the natural and unnatural amino acid side strands. The term "n-alkyl" means a straight-stranded (ie, unbranched) unsubstituted alkyl group.

The term "alkenyl" includes unsaturated aliphatic groups of analogous length and possible substitution of the alkyls described above, but which contain at least one double bond. For example, the term "alkenyl" includes straight-stranded alkenyl groups (eg, ethylenyl, propenyl, butenyl, pentenyl, hexenyl, heptenyl, octenyl, nonenyl, decenyl, etc.), branched-stranded alkenyl groups, cycloalkenyl groups (alicyclic ) (cyclopropenyl, cyclopentenyl, cyclohexenyl, cycloheptenyl, cyclooctenyl), alkyl or alkenyl substituted cycloalkenyl groups, and cycloalkenyl substituted cycloalkyl or alkenyl groups. In certain embodiments, a straight-stranded or branched-stranded alkenyl group has 6 carbon atoms or less in its main strand (e.g., C2-C6 for straight strand, C3-C6 for branched strand). Also, cycloalkenyl groups can have 3 to 8 carbon atoms in their ring structure, and more preferably they have 5 or 6 carbons in the ring structure. The term C2-C6 includes alkenyl groups containing from 2 to 6 carbon atoms.

Furthermore, unless otherwise specified, the term alkenyl includes both "unsubstituted alkenyls" and "substituted alkenyls", the latter of which refers to alkenyl moieties having independently selected substituents that replace a hydrogen in one or more carbons of the main strand of hydrocarbons. Such substituents can include, for example, alkyl groups, alkynyl, halogen, hydroxyl, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy, aryloxycarbonyloxy, carboxylate, alkylcarbonyl, arylcarbonyl, alkoxycarbonyl, aminocarbonyl, alkylaminocarbonyl, dialkylaminocarbonyloxy, alkylaminocarbonyloxy, alkylaminocarbonyloxy, phosatoxycarbonyloxy, alkoxycarbonyl, phosatoxycarbonyl, alkylaminocarbonyl, dialkylaminocarbonyloxy, cyano, amino (including alkylamino, dialkylamino, arylamino, diarylamino, and alkylamino), acylamino (including alkylcarbonylamino, arylcarbonylamino, carbamoyl, and ureido), amidino, imino, sulfhydryl, alkylthio, arylthio, thiocarboxylate, sulfates, alkylsulfinyl, sulfonate, sulfamoyl, sulfonate, sulfamoyl nitro, trifluoromethyl, cyano, azido, heterocyclyl, alkylaryl, or an aromatic or heteroaromatic building block.

The term "alkynyl" includes unsaturated aliphatic groups of analogous length and possible substitution to the alkyls described above, but which contain at least one triple bond. For example, the term "alkynyl" includes straight-stranded alkynyl groups (eg, ethynyl, propynyl, butynyl, pentynyl, hexynyl, heptynyl, octynyl, nonynyl, decynyl, etc.), branched-stranded alkynyl groups, and substituted cycloalkyl or cycloalkenyl alkynyl groups. In certain embodiments, a straight-stranded or branched-stranded alkynyl group has 6 carbon atoms or less in its main strand (eg, C2-C6 for straight strand, C3-C6 for branched strand). The term C2-C6 includes alkynyl groups containing from 2 to 6 carbon atoms.

Furthermore, unless otherwise specified, the term alkynyl includes both "unsubstituted alkynyl" and "substituted alkynyl", the latter of which refers to alkynyl moieties having independently selected substituents that replace a hydrogen in one or more carbons of the main strand of hydrocarbons. Such substituents can include, for example, alkyl groups, alkynyl, halogen, hydroxyl, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy, aryloxycarbonyloxy, carboxylate, alkylcarbonyl, arylcarbonyl, alkoxycarbonyl, aminocarbonyl, alkylaminocarbonyl, dialkylaminocarbonyloxy, alkylaminocarbonyloxy, alkylaminocarbonyloxy, phosatoxycarbonyloxy, alkoxycarbonyl, phosatoxycarbonyl, alkylaminocarbonyl, dialkylaminocarbonyloxy, cyano, amino (including alkylamino, dialkylamino, arylamino, diarylamino, and alkylamino), acylamino (including alkylcarbonylamino, arylcarbonylamino, carbamoyl, and ureido), amidino, imino, sulfhydryl, alkylthio, arylthio, thiocarboxylate, sulfates, alkylsulfinyl, sulfonate, sulfamoyl, sulfonate, sulfamoyl nitro, trifluoromethyl, cyano, azido, heterocyclyl, alkylaryl, or an aromatic or heteroaromatic building block.

Unless the carbon number is specified otherwise, "lower alkyl" as used herein means an alkyl group, as defined above, but having one to five carbon atoms in its backbone. "Lower alkenyl" and "lower alkynyl" have strand lengths of, for example, 2-5 carbon atoms.

The term "alkoxy" includes substituted and unsubstituted alkyl, alkenyl, and alkynyl groups covalently attached to an oxygen atom. Examples of alkoxy groups include methoxy, ethoxy, isopropyloxy, propoxy, butoxy, and pentoxy groups. Examples of substituted alkoxy groups include halogenated alkoxy groups. The alkoxy groups may be substituted with independently selected groups, such as alkenyl, alkynyl, halogen, hydroxyl, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy, aryloxycarbonyloxy, carboxylate, alkylcarbonyl, arylcarbonyl, alkoxycarbonyl, aminocarbonyl, alkylaminocarbonyloxy, dialkylaminocarbonyl, alkylaminocarbonyloxy, dialkylaminocarbonyl, alkylaminocarbonyl, alkylaminocarbonyl, alkoxycarbonyloxy , phosphinate, cyano, amino (including alkylamino, dialkylamino, arylamino, diarylamino, and alkylamino), acylamino (including alkylcarbonylamino, arylcarbonylamino, carbamoyl, and ureido), amidino, imino, sulfhydryl, alkylthio, arylthio, thiocarboxylate, sulfates, alkylsulfinyl, sulfonate , sulfonamido, nitro, trifluoromethyl, cyano, azido, heterocyclyl, alkylaryl or aromatic or heteroaromatic structural units. Examples of halogen substituted alkoxy groups include, but are not limited to, fluoromethoxy, difluoromethoxy, trifluoromethoxy, chloromethoxy, dichloromethoxy, trichloromethoxy, etc.

The term "heteroatom" includes atoms of any element other than carbon or hydrogen. Preferred heteroatoms are nitrogen, oxygen, sulfur, and phosphorus.

The term "hydroxy" or "hydroxyl" includes groups with an -OH or -O- (with an appropriate counter ion).

The term "halogen" includes fluorine, bromine, chlorine, iodine, and the like. The term "perhalogenated" generally refers to a structural unit where all hydrogens are replaced by halogen atoms.

The term "substituted" includes independently selected substituents that can be placed on the structural unit and that allow the molecule to perform its intended function. Examples of substituents include alkyl, alkenyl, alkynyl, aryl groups, (CR'R ") 0-3NR'R", (CR'R ") 0-3CN, NO2, halogen, (CR'R") 0-3C ( halogen) 3, (CR'R ") 0-3CH (halogen) 2, (CR'R") 0-3CH2 (halogen), (CR'R ") 0-3CONR'R", (CR'R ") 0-3S (O) 1-2NR'R ", (CR'R") 0-3CHO, (CR'R ") 0-30 (CR'R") 0-3H, (CR'R ") 0- 3S (O) 0-2R ', (CR'R ") 0-3O (CR'R") 0-3H, (CR'R ") 0-3COR', (CR'R") 0-3CO2R ', or (CR'R ") 0-30R '; wherein each R' and R" are each independently hydrogen, a C1-C5 alkyl, C2-C5 alkenyl, C2-C5 alkynyl, or aryl group, or R 'and R "taken together is a benzylidene group or a - (CH2) 2O (CH2) 2- group.

The term "amine" or "amino" includes compounds or structural units in which a nitrogen atom is covalently attached to at least one carbon or heteroatom. The term "alkylamino" includes groups and compounds in which the nitrogen is attached to at least one additional alkyl group. The term "dialkyl amino" includes groups in which the nitrogen atom is attached to at least two additional alkyl groups.

The term "ether" includes compounds or structural units that contain an oxygen attached to two different carbon atoms or heteroatoms. For example, the term includes "alkoxyalkyl," which refers to an alkyl, alkenyl, or alkynyl group covalently attached to an oxygen atom that is covalently attached to another alkyl group.

The first and second strands of the agents of the invention (sense and antisense oligonucleotides) are not required to be completely complementary in the duplicated region. In one embodiment, the RNA sequence of the antisense strand contains one or more mismatches (1, 2, 3, 4, 5, 6, consecutive or non-consecutive), that is, mismatched with respect to the duplicate sense strand of the isolated double-stranded nucleic acid according to the invention, contains one or more (1, 2, 3, 4 or 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 , 20 consecutive or non-consecutive), modified nucleotides (base analogs). In an exemplary embodiment, such mismatches occur within the 3 'region, as defined above, of the RNA sequence of the antisense strand. In one aspect, two, three, four, or five mismatches or modified nucleotides with base analogs are incorporated into the RNA sequence of the antisense strand that is 3 'to the antisense strand of the projected Ago2 cleavage site of the sequence. of target RNA when the target RNA sequence hybridizes.

The use of mismatches or decreased thermodynamic stability (specifically at or near the 3'-terminal sense / 5'-terminal residues of the antisense region of RNAsis) has been proposed to facilitate or favor entry of the antisense strand in RISC (Schwarz et al., 2003; Khvorova et al., 2003), presumably by affecting some unwinding steps that limit the speed that occur with the entry of siRNA into RISC. Therefore, the composition of the terminal base has been included in the design algorithms to select double active 21-mer siRNA (Ui-Tei et al., 2004; Reynolds et al., 2004).

The inclusion of such mismatches within the siDNA agents of the present invention may allow such agents to exert inhibitory effects that resemble those of natural miRNAs, and optionally may be directed against not just natural miRNA target RNAs (e.g., 3 'UTR regions of target transcripts) but also against RNA sequences for which a natural antagonist miRNA is not known to exist. For example, siDNAs of the invention that possess mismatched base pairs that are designed to look like and / or function as miRNA can be synthesized to target repetitive sequences within genes / transcripts that might not be targeted by naturally occurring miRNA (e.g. For example, repeated sequences within the Notch protein can be targeted, where individual repeats within Notch may differ from each other (e.g. be degenerate) at the nucleic acid level, but can be effectively targeted through a miRNA mechanism. which allows for mismatch (s) but also allows for a more promiscuous inhibitory effect than a corresponding perfect match siRNA agent). In such embodiments, cleavage of target RNA may or may not be necessary for the mismatched siDNA agent to exert an inhibitory effect.

In one embodiment, a double-stranded nucleic acid molecule of the invention comprises or functions as a microRNA (miRNA). By "microRNA" or "miRNA" is meant a small double-stranded RNA that regulates the expression of target messenger RNAs, either by mRNA cleavage, translation repression / inhibition, or heterochromatic silencing (see, for example, Ambros, 2004, Nature, 431, 350-355; Bartel, 2004, Cell, 116, 281-297; Cullen, 2004, Virus Research., 102, 3-9; He et al., 2004, Nat. Rev. Genet., 5, 522- 531; and Ying et al., 2004, Gene, 342, 25-28). In one embodiment, the microRNA of the invention has partial complementarity (i.e. less than 100% complementarity) between the sense strand (e.g. the first strand) or the sense region and the antisense strand (e.g. the second strand) or the antisense region of the miRNA molecule or between the antisense strand or antisense region of the miRNA and a corresponding target nucleic acid molecule (eg, target mRNA). For example, partial complementarity can include various mismatches or non-basic paired nucleotides (e.g., 1, 2, 3, 4, 5 or more mismatches or non-based paired nucleotides, such as nucleotide overhangs) within the structure of the double-stranded nucleic acid molecule, which can result in protrusions, loops, or protrusions that result between the sense strand or sense region and the antisense strand or the antisense region of miRNA or between the antisense strand or the antisense region of miRNA and a corresponding target nucleic acid molecule.

Single-stranded nucleic acids that pair at various bases are said to "hybridize." Hybridization is typically determined under physiologically or biologically relevant conditions (eg, intracellular: pH 7.2, 140 mM potassium ion; extracellular, pH 7.4, 145 mM sodium ion). Hybridization conditions generally contain a monovalent cation and a biologically acceptable regulator and may or may not contain a divalent cation, complex anions, for example potassium gluconate, uncharged species such as sucrose, and inert polymers to reduce the activity of water in the sample. , for example, PEG. Such conditions include conditions under which base pairs can form.

Hybridization is measured by the temperature required to dissociate the single-stranded nucleic acids that form a double, that is, (the melting temperature; Tm). Hybridization conditions are also conditions under which base pairs can be formed. Various stringency conditions can be used to determine hybridization (See, for example, Wahl, GM and SL Berger (1987) Methods Enzymol. 152: 399; Kimmel, AR (1987) Methods Enzymol. 152: 507). Stringent temperature conditions will typically include temperatures of at least about 30 ° C, more preferably at least about 37 ° C, and most preferably at least about 42 ° C. The hybridization temperature for hybrids that is expected to be less than 50 base pairs in length should be 5-10 ° C less than the melting temperature (Tm) of the hybrid, where Tm is determined according to the following equations. For hybrids less than 18 base pairs in length, Tm (° C) = 2 (# of bases A + T) +4 (# of bases G + C). For hybrids between 18 and 49 base pairs in length, Tm (° C) = 81.5 + 16.6 (log 10 [Na +]) + 0.41 (% G + C) - (600 / N), where N is the number of bases in the hybrid, and [Na +] is the concentration of sodium ions in the hybridization regulator ([Na +] for 1xSSC = 0.165 M). For example, the hybridization determination regulator is shown in Table 1

Table 1

Useful variations in hybridization conditions will be readily apparent to those of skill in the art. Hybridization techniques are well known to those of skill in the art and are described, for example, in Benton and Davis (Science 196: 180, 1977); Grunstein and Hogness (Proc. Natl. Acad. Sci., USA 72: 3961, 1975); Ausubel et al. (Current Protocols in Molecular Biology, Wiley Interscience, New York, 2001); Berger and Kimmel (Antisense to Molecular Cloning Techniques, 1987, Academic Press, New York); and Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York.

As used herein, "oligonucleotide strand" is a single-stranded nucleic acid molecule. An oligonucleotide can comprise ribonucleotides, deoxyribonucleotides, modified nucleotides (eg, nucleotides with 2 'modifications, synthetic base analogs, etc.) or combinations thereof. Such modified oligonucleotides may be preferred over native forms because of properties such as, for example, improved cell uptake and greater stability in the presence of nucleases.

Certain dsNAs of the invention are chimeric dsNAs. "Chimeric dsNAs" or "chimeras", in the context of this invention, are dsNAs that contain two or more chemically distinct regions, each composed of at least one nucleotide. The chimeric dsNAs can be Dicer substrates or non-Dicer substrates. In some embodiments, these dsNAs typically contain at least one region that primarily comprises ribonucleotides (optionally including modified ribonucleotides) that form a Dicer substrate siRNA molecule ("siDNA"). This region of siDNA is covalently linked, eg, by conventional phosphate linkages or by modified phosphate linkages (eg, phosphorothioate) to a second region comprising a single-stranded nucleotide region ("a single-stranded extended region") that confers one or more beneficial properties (such as, for example, increased efficiency, for example, increased potency and / or duration of siDNA activity, function as a recognition domain or a means of targeting a chimeric dsNA to a specific location, for example , when administered to cultured cells or a subject, which functions as an extended region for better binding of functional groups, payloads, detection / detectable building blocks, which function as an extended region allowing more desirable modifications and / or improved spacing of such modifications, etc.). This second region can also include modified or synthetic nucleotides and / or modified or synthetic deoxyribonucleotides.

As used herein, the term "ribonucleotide" encompasses natural and synthetic, unmodified and modified ribonucleotides. Modifications include changes in the sugar moiety, in the base moiety, and / or in the linkages between ribonucleotides in the oligonucleotide. As used herein, the term "ribonucleotide" specifically excludes a deoxyribonucleotide, which is a nucleotide that possesses a single group of protons at the position of the 2 'ribose ring.

As used herein, the term "deoxyribonucleotide" encompasses natural and synthetic, unmodified and modified deoxyribonucleotides. Modifications include changes in the sugar moiety, in the base moiety, and / or in the inter-deoxyribonucleotide linkages in the oligonucleotide. As used herein, the term "deoxyribonucleotide" also includes a modified ribonucleotide that does not allow Dicer cleavage of a dsNA agent, eg, a 2'-O-methyl ribonucleotide, a phosphorothioate modified ribonucleotide residue , etc., which does not allow Dicer cleavage to occur at a bond of said residue.

As used herein, the term "PS-NA" refers to a phosphorothioate modified nucleotide residue. Therefore, the term "PS-NA" encompasses both phosphorothioate-modified ribonucleotides ("PS-RNA") and phosphorothioate-modified deoxyribonucleotides ("PS-DNA").

In certain embodiments, a chimeric siDNA / DNA agent of the invention comprises at least one double region of at least 23 nucleotides in length, within which at least 50% of all nucleotides are unmodified ribonucleotides. As used herein, the term "unmodified ribonucleotide" refers to a ribonucleotide that possesses a hydroxyl group (-OH) at the 2 'position of the ribose sugar.

In certain embodiments, a siDNA / DNA chimeric agent of the invention comprises at least one region, located 3 'from the Dicer cleavage site projected on the first strand and 5' from the Dicer cleavage site projected on the second strand, having a length of at least 2 nucleotides base pairs in length, wherein at least 50% of all nucleotides within this region of at least 2 nucleotides base pairs in length are unmodified deoxyribonucleotides. As used herein, the term "unmodified deoxyribonucleotide" refers to a ribonucleotide that possesses a single proton at the 2 'position of the ribose sugar.

As used herein, the antisense strand, the leader strand, and the second oligonucleotide refer to the same strand of a given Dicer substrate molecule in accordance with the invention; whereas the sense strand, the passing strand and the first oligonucleotide refer to the same strand of a given Dicer substrate.

As used herein, "antisense strand" refers to a single-stranded nucleic acid molecule that has a sequence complementary to that of a target RNA. When the antisense strand contains nucleotides modified with base analogs, it is not necessarily complementary over its entire length, but must at least be complementary enough to hybridize to a target RNA. In certain embodiments, the antisense strand is sufficiently complementary to inhibit expression of the target, eg, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary.

As used herein, "sense strand" refers to a single stranded nucleic acid molecule that has a sequence complementary to that of an antisense strand. When the antisense strand contains nucleotides modified with base analogs, the sense strand need not be complementary over the entire length of the antisense strand, but must at least be able to form a hybrid and therefore be able to duplicate with the antisense strand.

As used herein, "leader strand" refers to a single stranded nucleic acid molecule of a dsNA or dsNA containing molecule, which has a sequence sufficiently complementary to that of a target RNA to cause RNA interference. In some embodiments, Dicer cleavage is not necessary for incorporation of a guide strand into RISC. In some embodiments after cleavage of dsNA or the dsNA-containing molecule by Dicer, a leader strand fragment remains associated with RISC, binds to a target RNA as a component of the RISC complex, and promotes cleavage of a target RNA. by RISC. A leader strand is an antisense strand.

As used herein, "target RNA" refers to an RNA that would be subject to antisense strand-guided modulation, such as directed cleavage or steric blocking. The target RNA could be, for example, genomic viral RNA, mRNA, a preRNA or an antisense RNA. The preferred target is mRNA, such as mRNA encoding a disease-associated protein, such as ApoB, Bc12, Hif-1 alpha, Survivin, or a p21 ras, such as Ha-ras, K-ras, or N-ras.

As used herein, "passing strand" refers to an oligonucleotide strand of a molecule containing dsNA or dsNA, which has a sequence that is complementary to that of the guide strand. A passing strand is a sense strand.

As used herein, "Dicer" refers to an endoribonuclease in the RNase III family that cleaves a dsRNA or dsRNA-containing molecule, eg, double-stranded RNA (dsRNA) or pre-microRNA (miRNA), in fragments. of double-stranded nucleic acid approximately 19-25 nucleotides in length, generally with a two-base overhang at the 3 'end. With respect to the dsNAs of the invention, the duplex formed by a dsRNA region of a dsNA of the invention is recognized by Dicer and is a Dicer substrate in at least one strand of the duplex. Dicer catalyzes the first step in the RNA interference pathway, which consequently results in the degradation of a target RNA. The protein sequence of human Dicer is provided in the NCBI database under accession number NP-085124.

Dicer "cleavage" is determined as follows (eg, see Collingwood et al., Oligonucleotides 18: 187-200 (2008)). In a Dicer cleavage assay, RNA doubles (100 pmol) are incubated in 20 pL of 20 mM Tris pH 8.0, 200 mM NaCl, 22.5 mM MgCl with or without 1 unit of recombinant human Dicer (Stratagene, La Jolla , California) at 37 ° C for 18-24 hours. Samples are desalted using a 96-well Performa SR plate (Edge Biosystems, Gaithersburg, Md.). Electrospray ionization liquid chromatography mass spectroscopy (ESI-LCMS) of double RNA before and after Dicer treatment is performed using an Oligo HTCS system (Novatia, Princeton, NJ; Hail et al., 2004), consisting of on a ThermoFinnigan TSQ7000, Xcalibur data system, ProMass data processing software, and Paradigm MS4 HPLC (Michrom BioResources, Auburn, California). In this assay, Dicer cleavage occurs when at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or even 100% of Dicer of a substrate dsRNA (i.e. 25-35 by dsRNA, preferably 26-30 by dsRNA, optionally extended as described herein) is split into a shorter dsRNA (eg 19-23 by dsRNA, preferably 21-23 by dsRNA).

As used herein, "Dicer cleavage site" refers to the sites at which Dicer cleaves a dsRNA (eg, the dsRNA region of a dsNA of the invention). Dicer contains two RNase III domains that typically cut both sense and antisense strands of a dsRNA. The average distance between the RNase III domains and the PAZ domain determines the length of the short fragments of double-stranded nucleic acid it produces and this distance can vary (Macrae I, et al. (2006) "Structural basis for double-stranded RNA processing by Dicer. "Science 311 (5758): 195-8.). As shown, for example, in Figure 2, Dicer is projected to cleave certain double-stranded nucleic acids of the present invention that possess an antisense strand having a 2 'overhang of 2 nucleotides at a site between nucleotides 21 and 22 deleted from the 3 'end of the antisense strand, and at a corresponding site between nucleotides 21 and 22 removed from the 5' end of the sense strand. The projected and / or prevalent Dicer cleavage sites for dsNA molecules other than those depicted in Figure 2 can be similarly identified through art recognized methods, including those described in Macrae et al. While the Dicer cleavage event depicted in Figure 2 generates an siRNA of 21 nucleotides, it is observed that the cleavage of a dsNA by Dicer (for example, DRNAsi) can result in the generation of siRNA lengths processed by Dicer 19 to 23 nucleotides in length. Indeed, in one aspect of the invention described in greater detail below, a double-stranded DNA region is included within a dsNA in order to direct the prevalent Dicer cleavage of a typically non-preferred 19-mer siRNA.

As used herein, "overhang" refers to unpaired nucleotides, in the context of a double that has two or four free ends at the 5 'or 3' terminus of a dsNA. In certain embodiments, the overhang is a 3 'or 5' overhang on the antisense strand or sense strand. "Outstanding" and "extension" are used synonymously at all times.

As used herein, "target" refers to any nucleic acid sequence whose expression or activity is to be modulated. In particular embodiments, the target refers to RNA that duplicates a single stranded nucleic acid that is an antisense strand in a RISC complex. Hybridization of the target RNA with the antisense strand results in processing by the RISC complex. Consequently, the expression of the RNA or proteins encoded by the RNA, eg, mRNA, is reduced.

As used herein, the term "RNA processing" refers to processing activities performed by components of the siRNA, miRNA, or RNase H pathways (eg, Drosha, Dicer, Argonaute2, or other RISC and RNaseH endoribonucleases), They are described in more detail below (see "RNA Processing" section below). The term is explicitly distinguished from post-transcriptional processes of RNA 5 'limitation and RNA degradation through non-RISC-mediated or RNase-free H processes. Such "degradation" of an RNA can take various forms, for example, dedenylation (removal of a poly (A) 3 'tail) and / or nuclease digestion of part or all of the RNA body by any of several endo- or exonucleases (e.g., RNase III, RNase P, RNase Tl, RNase A (1, 2, 3, 4/5), oligonucleotidase, etc.).

As used herein, "reference" means a standard or control. As is apparent to one of ordinary skill in the art, an appropriate reference is when only one item is changed to determine the effect of an item.

As used herein, "modified nucleotide" refers to a nucleotide that has one or more modifications to the nucleoside, the nucleobase, the furanose ring, or the phosphate group. For example, modified nucleotides exclude ribonucleotides containing adenosine monophosphate, guanosine monophosphate, Uridine monophosphate and cytidine monophosphate and deoxyribonucleotides containing deoxyadenosine monophosphate, deoxyguanosine monophosphate, deoxythymidine monophosphate and monophoscytidine. Modifications include those that occur naturally as a result of modification by nucleotide-modifying enzymes, such as methyltransferases. Modified nucleotides also include non-naturally occurring or synthetic nucleotides. Synthetic or unnatural modifications to nucleotides include those with 2 'modifications, eg, 2'-methoxyethoxy, 2'-fluoro, 2'-allyl, 2'-O- [2- (methylamino) -2-oxoethyl] , 4'-thio, 4-CH2-O-2'-bridge, 4 '- (CH2) 2-O-2'-bridge, 2'-LNA and 2'-O- (N-methylcarbamate) or those that comprises base analogs. In relation to 2'-modified nucleotides as described for the present disclosure, by "amino" is meant 2'-NH2 or 2'-O-NH2, which may or may not be modified. Such modified groups are described, for example, in Eckstein et al., US Pat. 5,672,695 and Matulic-Adamic et al., US Patent No. 6,248,878.

The term "in vitro" has its art recognized meaning, eg, involving purified reagents or extracts, eg, cell extracts. The term "in vivo" also has its art recognized meaning, eg, involving living cells, eg, immortalized cells, primary cells, cell lines, and / or cells in an organism.

In reference to the nucleic acid molecules of the present disclosure, nucleotides can be specified at certain positions on any of the strands of the dsNA. With reference to Figures 1-3, the conventions for denoting positions of the DRNAs of the invention are shown in Table 2.

With reference to the nucleic acid molecules of the present disclosure, modifications can exist in patterns on one strand of the dsNA. As used herein, "alternate positions" refers to a pattern where either any other nucleotide is a modified nucleotide or there is an unmodified nucleotide (eg, an unmodified ribonucleotide) between each modified nucleotide by a defined length of one strand of the dsNA (eg, 5'-MNMNMN-3 '; 3'-Mn MNMN-5'; where M is a modified nucleotide and N is an unmodified nucleotide). The modification pattern begins from the first nucleotide position at the 5 'or 3' end according to any of the position numbering conventions described herein (in certain embodiments, position 1 is designated in reference to the terminal residue of a strand following a projected Dicer cleavage event of an siDNA agent of the invention; therefore, position 1 does not always constitute a 3 'terminal or 5' terminal residue of a preprocessed agent of the invention).

Table 2: Description of the numbering convention regarding positions in the strand

Position 1: A position located in the passing strand is denoted by a number without a superscript tag. (for example, position 1). Position 1 of the passenger strand is the 5 'terminal nucleotide, except for the 5' extended passenger strands, where the 5 'terminal nucleotide occurs in the extended region and is assigned the highest number with a superscript E (see below and Figure 1A).

Position A: A position located on the leader strand is designated by a superscript A (for example, position 1A. The leader strand is numbered such that the first base-paired nucleotide at its 3 'terminal is called (for example, position 1A) When the leader strand contains a 1-6 nucleotide 3 'terminal single strand overhang, those nucleotides are simply referred to as unpaired 3' terminal strand residues or single stranded residues.

Position A1: A position located on the guide strand in the extended 5 'region is marked with a superscript B (eg, position 1B represents the 5' terminal nucleotide of an extended guide strand (see Figure 1A)).

Position C: A position located on the third oligonucleotide. The third oligonucleotide is complementary to the extended region of the guide strand and is discontinuous with the passing strand. Position 1C (see Figure 1A) represents the 5 'terminal nucleotide of the third oligonucleotide.

Position D: A position located on a 3 'extended passenger strand, such that position 1D refers to the 3' terminal nucleotide residue of the extended passenger strand.

E position: A position located in the extended region of a 5 'extended 1E position of the passenger strand, which is an unpaired nucleotide of the 5' single stranded extension (see Figure 1A).

IE position: is the unpaired nucleotide consecutive (ie, adjacent) to the first base paired nucleotide of the passing strand (see Figure 1A).

Position F: A position located in the double region of a 5 'extended passenger strand, so that the IF position refers to the first base-paired nucleotide on the 5' passenger strand (starting from the 5 'end).

The pattern of nucleotides modified in alternate positions can run the entire length of the strand, but in certain embodiments includes at least 4, 6, 8, 10, 12, 14 nucleotides containing at least 2, 3, 4, 5, 6 or 7 modified nucleotides, respectively. As used herein, "alternate pairs of positions" refers to a pattern where two consecutive modified nucleotides are separated by two consecutive unmodified nucleotides. over a defined length of a dsNA strand (eg, 5'-MMNNMMNNMMNN-3 ';3'-MMNNMMNNMMNN-5'; where M is a modified nucleotide and N is an unmodified nucleotide). The modification pattern starts from the first nucleotide position at the 5 'or 3' end according to any of the position numbering conventions described herein. The pattern of nucleotides modified in alternate positions can run the entire length of the strand, but preferably includes at least 8, 12, 16, 20, 24, 28 nucleotides containing at least 4, 6, 8, 10, 12 or 14 nucleotides modified, respectively. It is emphasized that the above modification patterns are exemplary and are not intended to be limitations on the scope of the invention.

As used herein, "base analog" refers to a heterocyclic structural unit found at the 1 'position of a sugar nucleotide structural unit in a modified nucleotide that can be incorporated into a nucleic acid double (or the equivalent position in a nucleotide substitution of sugar moiety that can be incorporated into a nucleic acid double). In the dsNAs of the invention, a base analog is generally a purine or pyrimidine base, excluding the common bases guanine (G), cytosine (C), adenine (A), thymine (T) or uracil (U). Base analogs can be duplicated with other bases or base analogs in dsRNAs. Base analogs include those useful in the compounds and methods of the invention, for example, those described in US Patent Nos. 5,432,272 and 6,001,983 to Benner and US Patent Publication No. 20080213891 to Manoharan. Non-limiting examples of bases include hypoxanthine (I), xanthine (X), 3p-D-ribofuranosyl- (2,6-diaminopyrimidine) (K), 3-pD-ribofuranosyl- (1-methyl-pyrazolo [4,3- d] pyrimidine-5,7 (4H, 6H) -dione) (P), iso-cytosine (iso-C), iso-guanine (iso-G), 1-pD-ribofuranosyl- (5-nitroindole), 1 -pD-ribofuranosyl- (3-nitropyrrole), 5-bromouracil, 2-aminopurine, 4-thio-dT, 7- (2-thienyl) -imidazo [4,5-b] pyridine (Ds) and pyrrole-2- carbaldehyde (Pa), 2-amino-6- (2-thienyl) purine (S), 2-oxopyridine (Y), difluorotolyl, 4-fluoro-6-methylbenzimidazole, 4-methylbenzimidazole, 3-methyl isocarbostyrylyl, 5-methyl isocarbostyrylyl, and 3-methyl-7-propynyl isocarbostyrylyl, 7-azaindolyl, 6-methyl-7-azaindolyl, imidizopyridinyl, 9-methyl-imidizopyridinyl, pyrrolopyrizinyl, isocarbostyryl, 7-propynyl isocarbostyryl, 7-propynyl-isocarbostyryl , 5-trimethylphenyl, 4-methylindolyl, 4,6-dimethylindolyl, phenyl, naphthalenyl, anthracenyl, phenanthracenyl, pyrenyl, stilbenzyl, tetracenyl, pentacenyl and structural derivatives rales thereof (Schweitzer et al., J. Org. Chem., 59: 7238-7242 (1994); Berger et al., Nucleic Acids Research, 28 (15): 2911-2914 (2000); Moran et al., J. Am. Chem Soc., 119: 2056-2057 (1997); Morales et al., J. Am. Chem Soc., 121: 2323-2324 (1999); Guckian et al., J. Am. Chem Soc., 118: 8182-8183 (1996); Morales et al., J. Am. Chem Soc., 122 (6): 1001-1007 (2000); McMinn et al., J. Am. Chem Soc., 121: 11585-11586 (1999); Guckian et al., J. Org. Chem., 63: 9652-9656 (1998); Moran et al., Proc. Natl. Acad. Sci., 94: 10506-10511 (1997); Das et al., J. Chem. Soc., Perkin Trans., 1: 197-206 (2002); Shibata et al., J. Chem. Soc., Perkin Trans., 1: 1605-1611 (2001); Wu et al., J. Am. Chem Soc., 122 (32): 7621-7632 (2000); O'Neill et al., J. Org. Chem., 67: 5869-5875 (2002); Chaudhuri et al., J. Am. Chem Soc., 117: 10434-10442 (1995); and US Patent No. 6,218,108.). Base analogs can also be a universal base.

As used herein, "universal base" refers to a heterocyclic moiety located at the 1 'position of a nucleotide sugar moiety in a modified nucleotide, or the equivalent position in a nucleotide sugar moiety substitution. , which, when present in a nucleic double acid, can be positioned against more than one type of base without altering the double helical structure (eg, the phosphate backbone structure). Furthermore, the universal base does not destroy the ability of the single stranded nucleic acid where it resides to duplicate itself to a target nucleic acid. The ability of a single-stranded nucleic acid containing a universal base to duplicate a target nucleic can be analyzed by methods apparent to one of skill in the art (eg, UV absorbance, circular dichroism, gel shift, sensitivity to single-stranded nuclease, etc. ). In addition, the conditions under which double formation is observed can be varied to determine stability or double formation, e.g. temperature, since melting temperature (Tm) correlates with the stability of acid doubles. nucleic. Compared to a reference single-stranded nucleic acid that is exactly complementary to a target nucleic acid, the single-stranded nucleic acid containing a universal base forms a double with the target nucleic acid that has a lower Tm than a double formed with the nucleic acid. complementary. However, compared to a reference single-stranded nucleic acid where the universal base has been replaced by a base to generate a single mismatch, the single-stranded nucleic acid containing the universal base forms a double with the target nucleic acid that has a Tm. higher than a double formed with the nucleic acid having the base mismatch.

Some universal bases are capable of pairing bases by forming hydrogen bonds between the universal base and all guanine (G), cytosine (C), adenine (A), thymine (T), and uracil (U) bases under pairing conditions. bases. A universal base is not a base that forms a base pair with a single complementary base. In a double, a universal base may not form hydrogen bonds, one hydrogen bond, or more than one hydrogen bond with each of G, C, A, T, and U opposite it on the opposite strand of a double. Preferably, the universal bases do not interact with the base opposite it on the opposite strand of a double. In a double, base pairing between a universal base occurs without altering the double helical structure of the phosphate backbone. A universal base can also interact with bases on adjacent nucleotides on the same nucleic acid strand by stacking interactions. Such stacking interactions stabilize the double, especially in situations where the universal base does not form any hydrogen bond with the base positioned opposite it on the opposite strand of the double. Non-limiting examples of universally binding nucleotides include inosine, 1-pD-ribofuranosyl-5-nitroindole, and / or 1 -pD-ribofuranosyl-3-nitropyrrole (US Patent, Publ. No. 20070254362 to Quay et al .; Van Aerschot et al., An acyclic 5-nitroindazole nucleoside analogue as ambiguous nucleoside. Nucleic Acids Res. 1995 Nov. 11; 23 (21): 4363-70; Loakes et al., 3-Nitropyrrole and 5-nitroindole as universal bases in primers for DNA sequencing and PCR. Nucleic Acids Res. 1995 Jul. 11; 23 (13): 2361-6; Loakes and Brown, 5-Nitroindole as a universal base analogue. Nucleic Acids Res. 1994 Oct. 11; 22 (20): 4039-43).

As used herein, "loop" refers to a single-stranded structure of a nucleic acid, in which complementary regions flanking a particular region of single-stranded nucleotides hybridize in a manner that the single-stranded nucleotide region between complementary regions are excluded from double formation or Watson-Crick base pairing. A loop is a region of single stranded nucleotides of any length, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more. Examples of loops include the unpaired nucleotides present in structures such as hairpins, stem loops, or extended loops.

As used herein, "extended loop" in the context of a dsRNA refers to a single-stranded loop and further 1, 2, 3, 4, 5, 6, or up to 55 base pairs or double flanking the loop. In an extended loop, the nucleotides flanking the loop on the 5 'side form a double with nucleotides flanking the loop on the 3' side. An extended loop can form a hairpin or a stem loop.

As used herein, "tetraloop" in the context of a dsRNA refers to a loop (a single-stranded region) consisting of four nucleotides that form a stable secondary structure that contributes to the stability of the adjacent Watson-hybridized nucleotides. Crick. Without being limited to theory, a tetraloop can stabilize an adjacent Watson-Crick base pair by stacking interactions. Furthermore, the interactions between the four nucleotides in a tetraloop include, but are not limited to, non-Watson-Crick base pairing, stacking interactions, hydrogen bonding, and contact interactions (Cheong et al., Nature 1990 Aug 16; 346 ( 6285): 680-2; Heus and Pardi, Science 1991 Jul 12; 253 (5016): 191-4). A tetraloop confers an increase in the melting temperature (Tm) of an adjacent double that is higher than expected from a single pattern loop sequence consisting of four random bases. For example, a tetraloop can confer a melting temperature of at least 50 ° C, at least 55 ° C, at least 56 ° C, at least 58 ° C, at least 60 ° C, at least 65 ° C, or at least 75 ° C in 10 mM NaHPO4 to a hairpin comprising a double of at least 2 base pairs in length. A tetraloop can contain ribonucleotides, deoxyribonucleotides, modified nucleotides, and combinations thereof. Examples of RNA tetraloops include the UNCG family of tetraloops (eg, UUCG), the GNRA family of tetraloops (eg, GAAA), and the CUUG tetraloop. (Woeseetal., ProcNatlAcad Sci USA. 1990 Nov; 87 (21): 8467-71; Antao et al., Nucleic Acids Res. 1991 Nov 11; 19 (21): 5901-5). Examples of DNA tetraloops include the d (GNNA) family of tetraloops (e.g., d (GTTA), the d (GNRA) family) of tetralocks, the d (GNAB) family of tetraloops, the d (CNNG) family of tetralocks , the d (TNCG) family of tetraloops (eg, d (TTCG)). (Nakano et al. Biochemistry, 41 (48), 14281-14292, 2002. SHINJI et al. Nippon Kagakkai Koen Yokoshu VOL. 78th; NO. 2; PAGE 731 (2000)).

As used herein, "increase" or "enhance" is intended to positively alter by at least 5% compared to a reference in an assay. An alteration can be twice or three times or four times or five times or ten times or 100 times or, 5%, 10%, 25%, 30%, 50%, 75%, or even 100% compared to a reference in an essay. By "enhancing Dicer cleavage", it is meant that processing of a quantity of dsRNA or dsRNA-containing molecule by Dicer results in more Dicer cleaved dsRNA products, that the Dicer cleavage reaction occurs more rapidly compared to processing the same amount of a reference dsRNA or a molecule containing dsRNAs in an in vivo or in vitro assay of this disclosure, or that Dicer cleavage is directed to cleavage at a specific and preferred site within a dsNA and / or generating a higher prevalence of a preferred population of cleavage products (eg, by including DNA residues as described herein). In one embodiment, the enhanced or enhanced Dicer cleavage of a dsNA molecule is above the level observed with an appropriate reference dsNA molecule. In another embodiment, the enhanced or increased Dicer cleavage of a dsNA molecule is above the level observed with an inactive or attenuated molecule. The increase in the binding affinity of a ligand-conjugated dsNA of the invention means, for example, that the ligand-conjugated dsNA binds to its target with an affinity that is 2-fold, 3-fold, 4-fold. , 5 times, 10 times or more than a dsNA that is not conjugated to a ligand, but targets the same target. The increase in cellular uptake means, for example, that the amount of ligand-conjugated dsNA that is taken up by cells, for example, by receptor-mediated endocytosis is 2-fold, 3-fold, 4-fold, 5 times, 10 times or more than a dsNA that is not conjugated to a ligand. Increased tracking means that the progression or movement of a dsRNA can be more easily determined.

As used herein, "reduce" is intended to negatively alter by at least 5% compared to a reference in an assay. An alteration can be twice or three times or four times or five times or ten times or 100 times or more or 5%, 10%, 25%, 30%, 50%, 75%, or even 100% compared with a reference in an essay. By "reducing expression" is meant the expression of the gene, or level of RNA molecules or equivalent RNA molecules encoding one or more proteins or protein subunits, or level or activity of one or more proteins or protein subunits encoded by a gene target, is reduced below that observed in the absence of the nucleic acid molecules (eg, dsRNA molecule or dsRNA-containing molecule) in an in vivo or in vitro assay of this disclosure. In one embodiment, the inhibition, down-regulation, or reduction with a dsNA molecule is below that level observed in the presence of an inactive or attenuated molecule. In another embodiment, the inhibition, downregulation, or reduction with dsNA molecules is below that level observed in the presence of, for example, a sequence-encoded or mismatched dsNA molecule. On In another embodiment, the inhibition, down-regulation or reduction of gene expression with a nucleic acid molecule of the instant description is greater in the presence of the nucleic acid molecule than in its absence.

As used herein, "cell" is intended to include both prokaryotic (eg, bacterial) and eukaryotic (eg, mammalian or plant) cells. Cells can be somatic or germline in origin, they can be totipotent or pluripotent, and they can divide or not divide. The cells can also be derived from or can comprise a gamete or an embryo, a stem cell or a fully differentiated cell. Therefore, the term "cell" is intended to retain its usual biological meaning and can be present in any organism, such as, for example, a bird, a plant, and a mammal, including, for example, human, cow, sheep, apes, monkeys, pigs, dogs and cats. Within certain aspects, the term "cell" refers specifically to mammalian cells, such as human cells, that contain one or more isolated dsNA molecules of the present disclosure. In particular aspects, a cell processes dsRNA or dsRNA-containing molecules that result in RNA interference from target nucleic acids, and contains proteins and protein complexes required for RNAi, eg, DiceryRISC.

As used herein, "animal" means a multicellular eukaryotic organism, including a mammal, pig, monkey, dog, cat, mouse, horse, cow, rat, or more preferably a human. Methods generally comprise administering an effective amount of the agents herein, such as an agent of the formula structures herein, to a subject (eg, animal, human) in need, including a mammal, eg, pig, monkey, dog, cat, mouse, horse, cow, rat, or more preferably a human. Such treatment will be suitably administered to subjects, particularly humans, who suffer from, have, are susceptible to or are at risk of a disease or a symptom thereof.

By "pharmaceutically acceptable carrier" is meant a composition or formulation that allows effective delivery of the nucleic acid molecules of the instant release to the most suitable physical location for their desired activity.

The present disclosure is directed to compositions comprising both a double stranded NA ("dsNA") and an extended single-stranded region, in most embodiments, a double dsDNA within the same agent, and methods for preparing them. , which are capable of reducing the expression of target genes in eukaryotic cells. One of the strands of the dsNA region contains a nucleotide sequence region ranging in length from about 15 to about 22 nucleotides that can direct the destruction of the transcribed RNA from the target gene. As indicated hereinbefore, an extended loop containing a tetraloop may be present at the 3 'terminus of the sense strand.

In some embodiments, the dsNA agents are Dicer substrates and are cleaved by Dicer. In other embodiments, the dsNA agents are not Dicer substrates and Dicer does not cleave.

In some embodiments the double contains a 1-50 nucleotide stretch that is found on the sense strand or the antisense strand or both. The extension in the embodiment could be at the 5 'end of the sense strand or at the 5' end of the antisense strand or both. The extension in another embodiment could be at the 3 'end of the sense strand or the 3' end of the antisense strand or both. In another embodiment, the extension is at the 5 'end of the sense strand or the 3' end of the antisense strand or both. The dsNA agents of the mentioned embodiments also comprise at least one ligand-modified nucleotide.

"Extended" dsNA agents can be "guided extended" (the nucleotide region at the 5 'end of the antisense strand that is present in the molecule in addition to the 15-35 base antisense sequence required for participation of the antisense strand on a Dicer substrate) or "extended passages" (the nucleotide region at the 3 'end of the sense strand that is optionally present in the molecule in addition to the 15-35 base sensory sequence required for strand participation sense on a Dicer substrate; or the nucleotide region at the 5 'end of the sense strand that is optionally present on the sense strand in addition to the 15-35 base sequence required for participation of the sense strand on a Dicer substrate). Therefore, as used herein, the term "extended" does not refer to the 3 'protruding antisense (or second strand, or guide strand) of 1-6 single stranded nucleotides; rather "extended", as used herein, refers to the opposite end of the Dicer substrate molecule, ie, an extended 5 'sense or antisense strand, where the extended region is 1-50, preferably 10-15 nucleotides in length or a 3 'extended strand, where the extended region is 1-30, preferably 10-15 nucleotides in length. The 5 'extended antisense strand can be single stranded, and optionally can be duplicated with a third nucleic acid molecule that is complementary, preferably completely (100%) complementary, to the 5' extended single strand region of the antisense strand. Therefore, in some embodiments, that is, when the third nucleic acid molecule is present, the 5 'extended region of the antisense strand is not single-stranded, but is a double-stranded or double-stranded region. Preferably, the third nucleic acid molecule, ie, the sense region that is complementary to the 5 'extended antisense region is not present unless a cognate 5' extended antisense region is present.

The extended dsNA agents of the present invention can enhance the following attributes of such agents relative to dsNAs lacking extension as defined herein: in vitro efficacy (e.g., potency and duration of effect), efficacy in vivo (eg potency, duration of effect, pharmacokinetics, pharmacodynamics, intracellular uptake, reduced toxicity). In certain embodiments, the 5 'extended region of the first or second strand may optionally provide an additional agent, such as an aptamer or fragment thereof; or a binding site (eg, a "decoy" binding site) for an exogenously introduced native or capable structural unit. Thus, the structural unit can be attached to the extension in a non-sequence-selective or sequence-specific manner via the binding site. For example, the extended region of a dsNA can be designed to comprise one or more transcription factor recognition sequences and / or a sequence-specific recognition domain for a probe, marker, etc.).

As used herein, the term "pharmacokinetics" refers to the process by which a drug is absorbed, distributed, metabolized, and eliminated by the body. In certain embodiments of the present invention, improved pharmacokinetics of a 3 'long extended 5' or 3 'extended second strand dsNA agent relative to an appropriate control dsNA relates to increased absorption and / or distribution of said agent, and / or slow metabolism and / or elimination of said dsNA agent extended 5 'from the second strand or dsNA agent extended 3' from the first strand of a subject to whom said agent was administered.

As used herein, the term "pharmacodynamics" refers to the action or effect of a drug in a living organism. In certain embodiments of the present invention, the improved pharmacodynamics of a 5 'second strand extended dsNA agent or a 3' first strand extended dsNA agent relative to an appropriate control dsNA refers to an action or effect increased (e.g., more potent or longer) of a 5 'second strand extended dsNA agent or a 3' first strand extended dsNA agent, respectively, on a subject administered said agent, relative to an appropriate control dsNA.

As used herein, the term "stabilization" refers to a state of enhanced persistence of an agent in a selected environment (eg, in a cell or organism). In certain embodiments, the 5 'second strand extended dsNAs or the 3' first strand extended dsNA agents of the present invention exhibit improved stability over appropriate control dsNAs. Such improved stability can be achieved through the improved resistance of such agents to degrading enzymes (eg, nucleases) or other agents.

In addition to the attributes described above for extended 5 'antisense dsNAs, the optional third nucleic acid detection molecule of 10-30, and preferably 10-15 nucleotides, when present, stabilizes the dsNA, and / or increases potency, prolongs the action or effect, increases the pharmacodynamic or pharmacological effects, and / or provides an additional agent (or part thereof), such as an aptamer or fragment thereof; or a binding site (eg, a "decoy" binding site) for a native or exogenously introduced structural unit (eg, a tag).

DRNAs Design / Synthesis

Longer dsRNA species of 25 to about 30 nucleotides (siDNAs) were previously shown to produce unexpectedly effective RNA inhibitory results in terms of potency and duration of action, compared to 19-23-mer siRNA agents. Without wishing to be limited to the underlying theory of the dsRNA processing mechanism, it is believed that the longer dsRNA species serve as a substrate for the Dicer enzyme in the cytoplasm of a cell. In addition to cleaving the dsNA of the invention into shorter segments, Dicer is believed to facilitate the incorporation of a single-stranded cleavage product derived from the cleaved dsNA into the RISC complex that is responsible for the destruction of the cytoplasmic or target gene-derived RNA. Previous studies (Rossi et al., United States Patent Application No. 2007/0265220) have shown that cleavage of a dsRNA species (specifically, a siDNA agent) by Dicer corresponds to a higher potency and duration of the action of dsRNA species. The present invention, at least in part, provides for the design of RNA inhibitory agents that target the Dicer cleavage site such that preferred species of Dicer cleavage products are generated.

In a DRNA processing model, the Dicer enzyme binds to a DRNA si agent, resulting in cleavage of the DRNA si at position 19-23 nucleotides removed from a 3 'projection sequence associated with the Dicer PAZ domain of the antisense strand of the DRNAsi agent. This Dicer cleavage event results in the cleavage of those previously duplicated nucleic acids located at the 3 'end of the passenger strand (sense) and the 5' end of the guide strand (antisense). Cleavage of a siDNA generally produces a double 19-mer with 2-base overhangs at each end. As currently modeled in Figure 2, this Dicer cleavage event generates a 21-23 (antisense) nucleotide guide strand (or, in certain cases where a longer guide strand 3 'overhang is present, 24 -27 nucleotide guide strands could result from the cleavage of Dicer) capable of directing specific inhibition of the target mRNA sequence as a RISC component.

The first and second oligonucleotides of the siDNA agents of the present invention are not required to be completely complementary in the duplicated region. In one embodiment, the 3 'end of the sense strand contains one or more mismatches. In one aspect, approximately two mismatches are incorporated at the 3 'end of the sense strand. In another embodiment, the siDNA is a double-stranded RNA molecule that contains two RNA oligonucleotides in the range of 25-66 nucleotides in length and, when collected from each other, have a two nucleotide mismatch at the 3 'end of the sense strand (the 5'-terminus of the antisense strand). The use of mismatches or decreased thermodynamic stability (specifically in the antisense / 3 'sense position) has been proposed to facilitate or favor entry of the antisense strand into RISC (Schwarz et al., 2003; Khvorova et al., 2003), presumably by affecting some unwinding steps that limit the speed that occur with the entry of siRNA into RISC. Therefore, the composition of the terminal base has been included in the design algorithms to select double active 21-mer siRNA (Ui-Tei et al., 2004; Reynolds et al., 2004). With Dicer cleavage of the dsRNA region of this embodiment, the small terminal end sequence containing the mismatches will either not pair with the antisense strand (become part of a 3 'overhang) or will cleave entirely from the 21- mere end siRNA. These specific forms of "mismatches" therefore do not persist as mismatches in the final RNA component of RISC. The finding that base mismatches or segment destabilization at the 3 'end of the strand downstream of the Dicer substrate improved the potency of synthetic doubles in RNAi, presumably by facilitating Dicer processing, was a surprising finding. from past works describing design and use. of 25-30-mer dsRNAs (also referred to as "DARNsi"herein; Rossi et al., US Patent Application Nos. 2005/0277610, 2005/0244858 and 2007/0265220). Examples of mismatched or fluctuating base agent pairs that have mismatches are G: A, C: A, C: U, G: G, A: A, C: C, U: U, I: A, I : U and I: C. The base pair strength of such agents can also be decreased by modifying the nucleotides of such agents, including, for example, 2-amino or 2,6-diamino modifications of guanine and adenine nucleotides. Dicer substrates and non-Dicer substrate molecules can have any of the structures contemplated below. Figures 43-46 present dsNA molecules that comprise extensions. Figure 47 shows a dsNA molecule comprising a tetraloop located at the 5 'or 3' end or at both ends of the antisense strand.

Sample structures of dsNA agents

The compositions of the invention comprise a dsNA that is a precursor molecule, that is, the dsNA of the present invention is processed in vivo to produce a small active interfering nucleic acid (siRNA). Dicer processes the dsNA into an active siRNA that is incorporated into RISC. In some embodiments, the dsNA molecule of the invention is not cleaved by Dicer, but is still incorporated into RISC. The dsNAs can have any of the structures described below for dRNAs.

In one aspect, the present disclosure provides compositions for RNA interference (RNAi) having a first or second strand having at least 8 consecutive ribonucleotides. In certain aspects, a dsNA agent has 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 or more (e.g. 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 26 or more, up to full strand length) ribonucleotides, modified ribonucleotides (2'-O-methyl ribonucleotides, phosphorothioate linkages). In certain aspects, ribonucleotides or modified ribonucleotides are consecutive.

In one aspect, the present invention provides RNA interference (RNAi) compositions possessing one or more deoxyribonucleotides within a region of a double-stranded nucleic acid that is positioned 3 'of a projected-strand Dicer cleavage site and correspondingly 5 'of a projected antisense strand Dicer cleavage site. In one example, at least one leader strand nucleotide between and including the corresponding leader strand nucleotides and thus the base paired with positions 24 of the passenger strand to the 3 'terminal nucleotide residue of the passenger strand it is a deoxyribonucleotide. In some embodiments, the double-stranded nucleic acid possesses one or more base-paired deoxyribonucleotides within a region of the double-stranded nucleic acid that is positioned 3 'of a projected-stranded Dicer cleavage site and correspondingly 5' of a cleavage site. Dicer of projected antisense strand

In certain embodiments, the dsNA agents can have any of the following exemplary structures:

In one such embodiment, the dsNA comprises:

5'-XXXXXXXXXXXXXXXXXXXXXXXXXN * -3 'where "X" = RNA, "Y" is an optional overhang domain composed of 0-10 RNA monomers that are optionally 2'-O-methyl RNA monomers; In certain embodiments, "Y" is an overhang domain composed of 0-4 RNA monomers that are optionally 2'-O-methyl RNA monomers, "Z" = DNA, RNA, or modified nucleotide, and "N" = 1 to 50 or more, but is optionally 1-30 or optionally 1-15 or optionally 1-10. In one embodiment, N comprises at least 9 consecutive phosphorothioate linkages. "N *" = 0 to 15 or more, but optionally 0, 1, 2, 3, 4, or 5. In one embodiment, the upper strand is the sense strand and the lower strand is the antisense strand. Alternatively, the lower strand is the sense strand and the upper strand is the antisense strand.

In one such embodiment, the dsNA comprises:

5'-Zm (Z) ² Zm (Z) ² Zm (Z) ² Zm (Z) 25N-3 '

3'-Y (Z) 25N-5 '

wherein "Y" is an optional overhang domain composed of 0-10 RNA monomers that are optionally 2'-O-methyl RNA monomers and / or 2'-fluoro monomers in certain embodiments, "Y" is a domain of the outstanding composed of RNA 0-4 monomers that are optionally 2'-O-methyl RNA monomers or 2'-fluoro monomers, "Z" = DNA, RNA or modified nucleotide that are optionally 2'-O methyl RNA monomers and / or 2'-fluoro monomers, Zm is a ligand-modified nucleotide that is optionally thymine or adenosines conjugated to GalNac through the sugar or nucleotide base, and "N" = 1 to 50 or more, but is optionally 1 -30 or optionally 1-15 or optionally 1-10. In one embodiment, N comprises at least 9 consecutive phosphorothioate linkages. In one embodiment, the upper strand is the sense strand and the lower strand is the antisense strand. Alternatively, the lower strand is the sense strand and the upper strand is the antisense strand.

In one such embodiment, the dsNA comprises:

5'-Zm (Z) Zm (Z) Zm (Z) Zm (Z) ²⁵ N-3 '

3'-Y (Z) ²⁵ N-5 '

wherein "Y" is an optional overhang domain comprised of 0-10 RNA monomers that are optionally 2'-O-methyl RNA monomers and / or 2'-fluoro-monomers in certain embodiments, "Y" is a overhang domain composed of 0-4 RNA monomers that are optionally 2'-O-methyl RNA monomers or 2'-fluoro monomers, "Z" = DNA, RNA or modified nucleotide that are optionally 2'- RNA monomers O-methyl and 2'-fluoro monomers, Zm is a ligand-modified nucleotide that is optionally thymine or adenosine conjugated to GalNac through the sugar or nucleotide base, and "N" = 1 to 50 or more, but is optionally 1-30 nucleotides or optionally 1-15 nucleotides or optionally 1-10 nucleotides. In one embodiment, N comprises at least 9 consecutive phosphorothioate linkages. In one embodiment, the upper strand is the sense strand and the lower strand is the antisense strand. Alternatively, the lower strand is the sense strand and the upper strand is the antisense strand.

In one such embodiment, the dsNA comprises:

5 '- (Zm) ⁴ (Z) ²⁵ N-3'

3'-Y (Z) ²⁵ N-5 '

wherein "Y" is an optional overhang domain composed of 0-10 RNA monomers that are optionally 2'-O-methyl RNA monomers and / or 2'-fluoro monomers in certain embodiments, "Y" is a domain of the outstanding composed of RNA monomers 0-4 which are optionally 2'-O-methyl RNA monomers or 2'-fluoro monomers, "Z" = DNA, RNA or modified nucleotide which are optionally 2'-O RNA monomers methyl and / or 2'-fluoro monomers, Zm is a ligand-modified nucleotide that is optionally thymines or adenosines conjugated to GalNac through the sugar or nucleotide base, and "N" = 1 to 50 or more, but is optionally 1-30 nucleotides or optionally 1-15 nucleotides or optionally 1-10 nucleotides. In one embodiment, N comprises at least 9 consecutive phosphorothioate linkages. In one embodiment, the upper strand is the sense strand and the lower strand is the antisense strand. Alternatively, the lower strand is the sense strand and the upper strand is the antisense strand.

In one such embodiment, the dsNA comprises:

5 '- (Zm) ⁴ (Z) ⁸ N (Z) ²⁵ NDD-3'

3'-DDY (Z) ²⁵ N-5 '

wherein "Y" is an optional overhang domain composed of 0-10 RNA monomers that are optionally 2'-O-methyl RNA monomers and / or 2'-fluoro monomers in certain embodiments, "Y" is a domain of the outstanding composed of RNA monomers 0-4 which are optionally 2'-O-methyl RNA monomers or 2'-fluoro monomers, "Z" = DNA, RNA or modified nucleotide which are optionally 2'-O RNA monomers methyl and / or 2'-fluoro monomers, Zm is a ligand-modified nucleotide which are optionally thymine or adenosines conjugated to GalNac through the sugar or nucleotide base, "D" = DNA "and" N "= 1 to 50 nucleotides or more, but is optionally 1-30 nucleotides or optionally 1-15 nucleotides or optionally 1-10. In one embodiment, N comprises at least 9 consecutive phosphorothioate linkages. In one embodiment, the upper strand is the upper strand. sense, and the lower strand is the antisense strand. Alternatively, the lower strand is the sense strand and the lower strand is the sense strand. top strand is the antisense strand.

In a related embodiment, the dsNA comprises:

5'-XXXXXXXXXXXXXXXXXXXXXXXN * DD-3 '

3 -YXXXXXXXXXXXXXXXXXXXXXXXN * XXZN-5r

where "X" = RNA, "Y" is an optional overhang domain composed of 0-10 RNA monomers that are optionally 2'-O-methyl RNA monomers; In certain embodiments, "Y" is an overhang domain composed of 1-4 RNA monomers that are optionally 2'-O-methyl RNA monomers, "D" = DNA, "Z" = DNA, Modified RNA or nucleotide, and "N" = 1 to 50 or more, but is optionally 1-30 or optionally 1-15 or optionally 1-10. In one embodiment, N comprises at least 9 consecutive phosphorothioate linkages. "N *" = 0 to 15 or more, but optionally 0, 1, 2, 3, 4, or 5. In one embodiment, the upper strand is the sense strand and the lower strand is the antisense strand. Alternatively, the lower strand is the sense strand and the upper strand is the antisense strand.

In any of the structures depicted above, the 5 'end of the sense strand or the antisense strand optionally comprises a phosphate group. In another such embodiment, the DARNsi comprises:

5 '-XXXXXXXXXXXXXXXXXXXXXXXXXN * IEN - 3'

3 YXXXXXXXXXXXXXXXXXXXXXXXXXN * ZN-5f

where "X" = RNA, "X" = 2'-O-methyl RNA, "Y" is an optional overhang domain composed of 0-10 RNA monomers that are optionally 2'-O-methyl RNA monomers, In certain embodiments, "Y" is an overhang domain comprised of 1-4 RNA monomers that are optionally 2'-O-methyl RNA monomers, "Z" = DNA, RNA, or modified nucleotide, and "N" = 1 at 50 nucleotides or more, but is optionally 1-30 or optionally 1-15 or optionally 1-10. "E" = modified DNA, RNA or nucleotide, "|" = a discontinuity, and "N" = 1 to 50 or more, but is optionally 1-15 or optionally 1-10. "N *" = 0 to 15 or more, but optionally 0, 1, 2, 3, 4, or 5. In one embodiment, the upper strand is the sense strand and the lower strand is the antisense strand. Alternatively, the lower strand is the sense strand and the upper strand is the antisense strand. In one example, the upper strand is the sense strand and the lower strand is the antisense strand. Alternatively, the lower strand is the sense strand and the upper strand is the antisense strand, with 2'-O-methyl RNA monomers located at alternating residues along the upper strand, rather than the lower strand currently represented in the above scheme.

In another such embodiment, the dsNA comprises:

5'-XXXXXXXXXXXXXXXXXXXXXXXXXN * | EN-3 '

3'-YXXXXXXXXXXXXXXXXXXXXXXXXXN * ZN-5 '

wherein "X" = RNA "Y" is an optional overhang domain composed of 0-10 RNA monomers that are optionally 2'-O-methyl RNA monomers, - in certain embodiments "Y" is a compound overhang domain by 0-4 RNA monomers which are optionally 2'-O-methyl RNA monomers, "Z" = DNA, RNA or modified nucleotide, and "N" = 1 to 50 or more, but is optionally 1-30 u, optionally 1-15 or optionally 1 10. "E" = DNA, RNA or modified nucleotide, "1" = a discontinuity, and "N" = 1 to 50 or more, but is optionally 1 15 or optionally 1 -10. In one embodiment, N comprises at least 9 consecutive phosphorothioate linkages. "N *" = 0 to 15 or more, but is optionally 0, 1, 2, 3, 4, or 5. In one embodiment, the upper strand is the sense strand and the lower strand is the antisense strand. Alternatively, the lower strand is the sense strand and the upper strand is the antisense strand.

In one embodiment, the upper strand is the sense strand and the lower strand is the antisense strand. Alternatively, the lower strand is the sense strand and the upper strand is the antisense strand, with 2'-O-methyl RNA monomers located at alternating residues along the upper strand, rather than the lower strand currently represented in the above scheme.

In a related embodiment, the dsNA comprises:

5'-XXXXXXXXXXXXXXXXXXXXXXXN * DD | EN-3 '

3'-YXXXXXXXXXXXXXXXXXXXXXXXN * XXZN-5 '

wherein "X" = RNA "Y" is an optional overhang domain composed of 0-10 RNA monomers that are optionally 2'-O-methyl RNA monomers - in certain embodiments "Y" is an overhang domain composed of 1-4 RNA monomers that are optionally 2'-O-methyl RNA monomers, "D" = DNA, "Z" = DNA, RNA, or modified nucleotide, and "N" = 1 to 50 or more, but is optionally 1-30 or optionally 1-15 or optionally 1-10. In one embodiment, N comprises at least 9 consecutive phosphorothioate linkages. "N *" = 0 to 15 or more, but is optionally 0, 1, 2, 3, 4, or 5. In one embodiment, the upper strand is the sense strand and the lower strand is the antisense strand. Alternatively, the lower strand is the sense strand and the upper strand is the antisense strand.

In another such embodiment, the dsNA comprises:

5'-XXXXXXXXXXXXXXXXXXXXXXXXXN * ZN-3 '

3'-YXXXXXXXXXXXXXXXXXXXXXXXXXN * -5 '

wherein "X" = RNA "Y" is an optional overhang domain composed of 0-10 RNA monomers that are optionally 2'-O-methyl RNA monomers - in certain embodiments "Y" is an overhang domain composed of 1-4 RNA monomers that are optionally 2'-O-methyl RNA monomers, "Z" = DNA, RNA, or modified nucleotide, and "N" = 1 to 50 or more, but is optionally 1-30 or optionally 1-15 or optionally 1 10. In one embodiment, N comprises at least 9 consecutive phosphorothioate linkages. "N *" = 0 to 15 or more, but is optionally 0, 1, 2, 3, 4, or 5. In one embodiment, the upper strand is the sense strand and the lower strand is the antisense strand. Alternatively, the lower strand is the sense strand and the upper strand is the antisense strand.

In a related embodiment, the dsNA comprises:

5'-XXXXXXXXXXXXXXXXXXXXXXXN * DDZN-3 '

3'-YXXXXXXXXXXXXXXXXXXXXXXXN * XX-5 '

wherein "X" = RNA "Y" is an optional overhang domain composed of 0-10 RNA monomers that are optionally 2'-O-methyl RNA monomers - in certain embodiments "Y" is an overhang domain composed of 1-4 RNA monomers that are optionally 2'-O-methyl RNA monomers, "D" = DNA, "Z" = DNA, RNA, or modified nucleotide, and "N" = 1 to 50 or more, but is optionally 1-30 or optionally 1-15 or optionally 1-10. In one embodiment, N comprises at least 9 consecutive phosphorothioate linkages. "N *" = 0 to 15 or more, but is optionally 0, 1, 2, 3, 4, or 5. In one embodiment, the upper strand is the sense strand and the lower strand is the antisense strand. Alternatively, the lower strand is the sense strand and the upper strand is the antisense strand.

In a further embodiment, the dsNA comprises:

5'-XXXXXXXXXXXXXXXXXXXXXXXN * DDZN-3 '

3'-YXXXXXXXXXXXXXXXXXXXXXXXN * XX-5 '

where "X" = RNA "X" = 2'-O-methyl RNA, "Y" is an optional overhang domain composed of 0-10 RNA monomers that are optionally 2'-O-methyl-en RNA monomers certain embodiments "Y" is an overhang domain composed of 1-4 RNA monomers that are optionally 2'-O-methyl RNA monomers, "D" = DNA, "Z" = DNA, RNA, or modified nucleotide, and "N" = 1 to 50 or more, but is optionally 1-30 or optionally 1-15 or optionally 1-10. In one embodiment, N comprises at least 9 consecutive phosphorothioate linkages. "N *" = 0 to 15 or more, but is optionally 0, 1, 2, 3, 4, or 5. In one embodiment, the upper strand is the sense strand and the lower strand is the antisense strand. Alternatively, the lower strand is the sense strand and the upper strand is the antisense strand.

In another such embodiment, the dsNA comprises:

5'-XXXXXXXXXXXXXXXXXXXXXXXXXN * -3 '

3'-YXXXXXXXXXXXXXXXXXXXXXXXXXN * ZN-5 '

where "X" = RNA "X" = 2'-O-methyl RNA, "Y" is an optional overhang domain composed of 0-10 RNA monomers that are optionally 2'-O-methyl-en RNA monomers certain embodiments "Y" is an overhang domain composed of 1-4 RNA monomers that are optionally 2'-O-methyl RNA monomers, "Z" = DNA, RNA, or modified nucleotide, and "N" = 1 a 50 or more, but is optionally 1-30 or optionally 1-15 or optionally 1-10. In one embodiment, N comprises at least 9 consecutive phosphorothioate linkages. "N *" = 0 to 15 or more, but is optionally 0, 1, 2, 3, 4, or 5. In one embodiment, the upper strand is the sense strand and the lower strand is the antisense strand. Alternatively, the lower strand is the sense strand and the upper strand is the antisense strand. In one embodiment, the upper strand is the sense strand and the lower strand is the antisense strand. Alternatively, the lower strand is the sense strand and the upper strand is the antisense strand, with 2'-O-methyl RNA monomers located at alternating residues along the upper strand, rather than the lower strand currently represented in the above scheme.

In another such embodiment, the dsNA comprises:

5'-XXXXXXXXXXXXXXXXXXXXXXXN * DD-3 '

3'-YXXXXXXXXXXXXXXXXXXXXXXXN * XXZN-5 '

where "X" = RNA "X" = 2'-O-methyl RNA, "Y" is an optional overhang domain composed of 0-10 RNA monomers that are optionally 2'-O-methyl-en RNA monomers certain embodiments "Y" is an overhang domain composed of 1-4 RNA monomers that are optionally 2'-O-methyl RNA monomers, "D" = DNA, "Z" = DNA, RNA, or modified nucleotide, and "N" = 1 to 50 or more, but is optionally 1-30 or optionally 1-15 or optionally 1-10. In one embodiment, N comprises at least 9 consecutive phosphorothioate linkages. "N *" = 0 to 15 or more, but is optionally 0, 1, 2, 3, 4, or 5. In one embodiment, the upper strand is the sense strand and the lower strand is the antisense strand. Alternatively, the lower strand is the sense strand and the upper strand is the antisense strand.

In one embodiment, the upper strand is the sense strand and the lower strand is the antisense strand. Alternatively, the lower strand is the sense strand and the upper strand is the antisense strand, with 2'-O-methyl RNA monomers located at alternating residues along the upper strand, rather than the lower strand currently represented in the above scheme.

In any of the structures described above, the 5 'end of either the sense strand or the antisense strand optionally comprises a phosphate group.

In another such embodiment, the DARNsi comprises:

5'-XXXXXXXXXXXXXXXXXXXXXXXXXN * | EN-3 '

3'-YXXXXXXXXXXXXXXXXXXXXXXXXXN * ZN-5 '

where "X" = RNA "X" = 2'-O-methyl RNA, "Y" is an optional overhang domain composed of 0-10 RNA monomers that are optionally 2'-O-methyl-en RNA monomers certain embodiments "Y" is an overhang domain composed of 1-4 RNA monomers that are optionally 2'-O-methyl RNA monomers, "Z" = DNA, RNA or modified nucleotide, and "N" = 1 to 50 or more, but is optionally 1-30 or optionally 1-15 or optionally 1-10. "E" = modified DNA, RNA or nucleotide, "|" = a discontinuity, and "N" = 1 to 50 or more, but is optionally 1-15 or optionally 1-10. "N *" = 0 to 15 or more, but is optionally 0, 1, 2, 3, 4, or 5. In one embodiment, the upper strand is the sense strand and the lower strand is the antisense strand. Alternatively, the lower strand is the sense strand and the upper strand is the antisense strand. In one embodiment, the upper strand is the sense strand and the lower strand is the antisense strand. Alternatively, the lower strand is the sense strand and the upper strand is the antisense strand, with 2'-O-methyl RNA monomers located at alternating residues along the upper strand, rather than the lower strand currently represented in the above scheme.

In a related embodiment, the DARNsi comprises:

5'-XXXXXXXXXXXXXXXXXXXXXXXN * DD | EN-3 '

3'-YXXXXXXXXXXXXXXXXXXXXXXXN * XXZN-5 '

wherein "X" = RNA, "X" = 2'-O-methyl RNA, "Y" is an optional overhang domain composed of 0-10 RNA monomers that are optionally 2'-O-methyl RNA monomers; In certain embodiments, "Y" is an overhang domain composed of 1-4 RNA monomers that are optionally 2'-O-methyl RNA monomers, "D" = DNA, "Z" = DNA, RNA, or modified nucleotide, and "N" = 1 to 50 or more, but is optionally 1-30 or optionally 1-15 or optionally 1-10. "N *" = 0 to 15 or more, but optionally 0, 1, 2, 3, 4, or 5. In one embodiment, the upper strand is the sense strand and the lower strand is the antisense strand. Alternatively, the lower strand is the sense strand and the upper strand is the antisense strand. In one embodiment, the upper strand is the sense strand, and the lower strand is the antisense strand. Alternatively, the lower strand is the sense strand and the upper strand is the antisense strand, with 2'-O-methyl RNA monomers located at alternating residues along the upper strand, rather than the lower strand currently represented in the above scheme.

In another such embodiment, the DARNsi comprises:

5'-XXXXXXXXXXXXXXXXXXXXXXXXXN * ZN-3 '

3'-YXXXXXXXXXXXXXXXXXXXXXXXXXN * -5

where "X" = RNA "X" = 2'-O-methyl RNA, "Y" is an optional overhang domain composed of 0-10 RNA monomers that are optionally 2'-O-methyl-en RNA monomers certain embodiments "Y" is an overhang domain composed of 1-4 RNA monomers that are optionally 2'-O-methyl RNA monomers, "Z" = DNA, RNA, or modified nucleotide, and "N" = 1 a 50 or more, but is optionally 1-30 or optionally 1-15 or optionally 1-10. "N *" = 0 to 15 or more, but is optionally 0, 1,2, 3, 4, or 5. In one embodiment, the upper strand is the sense strand and the lower strand is the antisense strand. Alternatively, the lower strand is the sense strand and the upper strand is the antisense strand. In one embodiment, the upper strand is the sense strand and the lower strand is the antisense strand. Alternatively, the lower strand is the sense strand and the upper strand is the antisense strand, with 2'-O-methyl RNA monomers located at alternating residues along the upper strand, rather than the lower strand currently represented in the above scheme.

In a related embodiment, the DARNsi comprises:

5'-XXXXXXXXXXXXXXXXXXXXXXXN * DDZN-3 '

3'-YXXXXXXXXXXXXXXXXXXXXXXXN * XX-5 '

where "X" = RNA "X" = 2'-O-methyl RNA, "Y" is an optional overhang domain composed of 0-10 RNA monomers that are optionally 2'-O-methyl-en RNA monomers certain embodiments "Y" is an overhang domain composed of 1-4 RNA monomers that are optionally 2'-O-methyl RNA monomers, "D" = DNA, "Z" = DNA, RNA, or modified nucleotide, and "N" = 1 to 50 or more, but is optionally 1-30 or optionally 1-15 or optionally 1-10. "N *" = 0 to 15 or more, but is optionally 0, 1, 2, 3, 4, or 5. In one embodiment, the upper strand is the sense strand and the lower strand is the antisense strand. Alternatively, the lower strand is the sense strand and the upper strand is the antisense strand. In one embodiment, the upper strand is the sense strand and the lower strand is the antisense strand. Alternatively, the lower strand is the sense strand and the upper strand is the antisense strand, with 2'-O-methyl RNA monomers located at alternating residues along the upper strand, rather than the lower strand currently represented in the above scheme.

In one embodiment, an extended dsNA agent is provided comprising deoxyribonucleotides positioned at patterned sites to function through the specific direction of Dicer cleavage. An example structure for that molecule is shown:

5'-XXXXXXXXXXXXXXXXXXXXXN * XXDD-3 '

3'-YXXXXXXXXXXXXXXXXXXXXXN * DDXXZN-5 '

wherein "X" = RNA, "Y" is an optional overhang domain composed of 0-10 RNA monomers that are optionally 2'-O-methyl RNA monomers in certain embodiments, "Y" is a compound overhang domain by 1-4 RNA monomers that are optionally 2'-O-methyl RNA monomers, "D" = DNA, "Z" = DNA, RNA or modified nucleotide and "N" = 1 to 50 or more, but is optionally 1-30, optionally 1-15 or optionally 1-10. "N *" = 0 to 15 or more, but optionally 0, 1, 2, 3, 4, or 5. In one embodiment, the upper strand is the sense strand and the lower strand is the antisense strand. Alternatively, the lower strand is the sense strand and the upper strand is the antisense strand.

The above structure is modeled to force Dicer to cut a maximum of a 21-mer double as its main form of post-processing. In embodiments where the lower strand of the above structure is the antisense strand, placing two deoxyribonucleotide residues in the last and penultimate residues of the 5 'end of the antisense strand is likely to reduce off-target effects (such as Previous studies have shown a 2'-O-methyl modification of at least the penultimate position of the 5 'end of the antisense strand to reduce off-target effects; see, for example, US 2007/0223427).

In a related embodiment, the dsNA comprises:

5'-XXXXXXXXXXXXXXXXXXXXXN * XXDD | EN-3 '

3'-YXXXXXXXXXXXXXXXXXXXXXN * DDXXZN-5 '

where "X" = RNA, "Y" is an optional overhang domain composed of 0-10 RNA monomers that are optionally 2'-O-methyl RNA monomers; In certain embodiments, "Y" is an overhang domain composed of 1-4 RNA monomers that are optionally 2'-O-methyl RNA monomers, "D" = DNA, "Z" = DNA, RNA, or modified nucleotide, and "N" = 1 to 50 or more, but is optionally 1-30 or optionally 1-15 or optionally 1-10. "N *" = 0 to 15 or more, but optionally 0, 1, 2, 3, 4, or 5. In one embodiment, the upper strand is the sense strand and the lower strand is the antisense strand. Alternatively, the lower strand is the sense strand and the upper strand is the antisense strand.

In a related embodiment, the dsNA comprises:

5'-XXXXXXXXXXXXXXXXXXXXXN * XXDDZN-3 '

3'-YXXXXXXXXXXXXXXXXXXXXXN * DDXX-5 '

wherein "X" = RNA, "Y" is an optional overhang domain composed of 0-10 RNA monomers that are optionally 2'-O-methyl RNA monomers in certain embodiments, "Y" is a compound overhang domain by 1-4 RNA monomers that are optionally 2'-O-methyl RNA monomers, "D" = DNA, "Z" = DNA, RNA or modified nucleotide and "N" = 1 to 50 or more, but is optionally 1-30, optionally 1-15 or optionally 1-10. "N *" = 0 to 15 or more, but optionally 0, 1, 2, 3, 4, or 5. In one embodiment, the upper strand is the sense strand and the lower strand is the antisense strand. Alternatively, the lower strand is the sense strand and the upper strand is the antisense strand.

In any of the structures depicted above, the 5 'end of the sense strand or the antisense strand optionally comprises a phosphate group.

In one embodiment, the present invention provides a double stranded nucleic acid having a substantially duplicated region between the first and second strands comprising a fully duplicated region having no unpaired bases between the 5 'terminal and 3' terminal nucleotides of the first. strand that are paired with the corresponding nucleotides of the second strand. In another embodiment, the present invention provides a double stranded nucleic acid having a substantially double region comprising, between the 5 'terminal and 3' terminal nucleotides of the first strand that pair with the corresponding nucleotides of the second strand, 1, 2, 3, or 5 unpaired bases. In some embodiments, the unpaired bases are consecutive. In other embodiments, the unpaired bases are not consecutive.

As used herein, "DARNsimm" refers to an si DARNA that has a "mismatch tolerant region" that contains one, two, three, or four mismatches or five or six or seven or eight or nine or ten. or eleven or twelve or thirteen or fourteen or fifteen or twenty or thirty mismatched base pairs of the double formed by the sense and antisense strands of the DRNAsi, where said mismatches are placed within the DRNAsi at a location (s) found between (and therefore does not include) the two terminal base pairs at either end of the double-stranded region of the siDNA. The mismatched base pairs fall within a "mismatch tolerant region" as defined herein with respect to the location of the projected Ago2 cleavage site of the corresponding target nucleic acid. The mismatch tolerant region is "upstream" of the projected Ago2 cleavage site of the target strand. "Upstream" in this context will be understood as the 5 'most portion of the DRNAsimm double, where 5' refers to the orientation of the strand in the sense of the siDNA double. Therefore, the mismatch tolerant region is upstream of the base in the sense (passenger) strand that corresponds to the projected Ago2 cleavage site of the target nucleic acid; alternatively, when referring to the antisense (leader) strand of the DRNAsimm, the mismatch tolerant region can also be described as positioned downstream of the base that is complementary to the projected Ago2 cleavage site of the target nucleic acid, i.e. the portion plus 3 'of the antisense strand of the DRNAsimm (where position 1 of the antisense strand is the 5' terminal nucleotide of the antisense strand).

In one embodiment, for example, the mismatch tolerant region is placed between the included 3-9 base pairs, when numbered from the nucleotide beginning at the 5 'end of the double-sense strand. Therefore, a DRNAsimm of the invention possesses a single mismatched base pair in any of the 3, 4, 5, 6, 7, 8 or 9 positions of the strand in the sense of a DRNA si extended to the right (where the position 1 is the 5 'terminal nucleotide of the sense strand and position 9 is the nucleotide residue of the sense strand that is immediately 5' of the projected Ago2 cleavage site of the target RNA sequence corresponding to the strand sequence meaning). In certain embodiments, for a DARNsimm that possesses a mismatched base pair nucleotide at any of positions 3, 4, 5, 6, 7, 8, or 9 of the sense strand, the corresponding mismatched base pair nucleotide of the antisense strand not only forms a base pair mismatch with the sense strand sequence DRNAsimm, but also forms a base pair mismatches with a target RNA sequence DRNAsimm (hence the complementarity between the strand sequence antisense and the sense strand sequence is interrupted at the mismatched base pair within the DRNAsimm, and complementarity is similarly altered between the antisense strand sequence of DRNAsimm and the target RNA sequence). In alternative embodiments, the antisense strand nucleotide base pair of a DRNAsimm only forms a base pair mismatched with a corresponding nucleotide of the sense strand sequence of the DRNAsimm, but base pairs with their corresponding sequence nucleotide. of target RNA (therefore, complementarity between the antisense strand sequence and the sense strand sequence is interrupted at the mismatched base pair within the DRNAsimm, although the complementarity between the antisense strand sequence of the DRNAsimm and the target RNA sequence).

A DRNAsimm of the invention that possesses a single mismatched base pair within the mismatch tolerant region (region of mismatch) as described above (e.g., a DRNAsimm harboring a mismatched nucleotide residue in either of positions 3, 4, 5, 6, 7, 8 or 9 of the sense strand) may further include one, two or even three additional mismatched base pairs. In preferred embodiments, these one, two, or three additional mismatched base pairs of the DRNAsimm occur at positions 3, 4, 5, 6, 7, 8, and / or 9 of the sense strand (and at the corresponding residues). antisense strand). In an embodiment where an additional mismatched base pair is present within a DARNsimm, the two mismatched base pairs of the sense strand can occur, for example, at nucleotides at position 4 and position 6 of the sense strand (with the mismatch also in the corresponding nucleotide residues of the antisense strand).

In DARNsimm agents that possess two mismatched base pairs, consecutive mismatches can occur (eg, at consecutive positions along the nucleotide sequence of the sense strand). Alternatively, nucleotides of the sense strand that form base pairs mismatched with the antisense strand sequence may be interspersed with nucleotides that match the antisense strand sequence (e.g., for a DRNAsimm that has mismatched nucleotides in the positions 3 and 6, but not at positions 4 and 5, the mismatched residues at positions 3 and 6 of the sense strand are interspersed by two nucleotides that form matching base pairs with the corresponding residues of the antisense strand). For example, two sense strand residues (located within the sense strand mismatch tolerant region) that form mismatched base pairs with the corresponding antisense strand sequence can occur with zero, one, two, three, four, or five matching base pairs located between these mismatched base pairs.

For certain DARNsimm agents that possess three mismatched base pairs, consecutive mismatches can occur (eg, in a triplet along the nucleotide sequence of the sense strand). Alternatively, nucleotides of the sense strand that form base pairs that do not match the antisense strand sequence may be interspersed with nucleotides that form base pairs that match the same. antisense strand sequence (for example, for a DRNAsimm that possesses mismatched nucleotides at positions 3, 4, and 8, but not at positions 5, 6, and 7, the mismatched residues at positions 3 and 4 of the strand in sense are adjacent to each other, whereas the mismatched residues at positions 4 and 8 of the sense strand are interspersed by three nucleotides that form matching base pairs with the corresponding residues of the antisense strand). For example, three sense strand residues (located within the sense strand mismatch tolerant region) that form mismatched base pairs with the corresponding antisense strand sequence can occur with zero, one, two, three or four matching base pairs located between any of these two mismatched base pairs.

For certain DARNsimm agents that possess four mismatched base pairs, consecutive mismatches can occur (eg, in a quadruplet along the nucleotide sequence of the sense strand). Alternatively, nucleotides of the sense strand that form base pairs that do not match the antisense strand sequence may be interspersed with nucleotides that form base pairs that match the antisense strand sequence (for example, for a DRNAsimm that possesses nonsense nucleotides). coincident at positions 3, 5, 7 and 8, but not at positions 4 and 6, the non-coincident residues at positions 7 and 8 of the sense strand are adjacent to each other, while the non-coincident residues at positions 3 and 5 of the sense strand are interspersed by a nucleotide that forms a matching base pair with the corresponding residue of the antisense strand in a similar way, the mismatched residues of positions 5 and 7 of the sense strand are also interspersed by a nucleotide that forms a base pair coincident with the corresponding residue on the antisense strand). For example, four sense strand residues (located within the sense strand mismatch tolerant region) that form mismatched base pairs with the corresponding antisense strand sequence can occur with zero, one, two, or three matching base pairs located between two of these mismatched base pairs.

In another embodiment, a DRNAsimm of the invention comprises a non-matching tolerant region possessing a single nucleotide of mismatched base pairs at any of positions 13, 14, 15, 16, 17, 18, 19, 20, or 21 of the antisense strand of a left-extended siDNA (where position 1 is the 5 'terminal nucleotide of the antisense strand and position 13 is the nucleotide residue of the antisense strand that is immediately 3' (downstream) on the antisense strand of the projected Ago2 cleavage site of the target RNA sequence sufficiently complementary to the antisense strand sequence). In certain embodiments, for a DRNAsimm that possesses a mismatched base pair nucleotide at any of positions 13, 14, 15, 16, 17, 18, 19, 20, or 21 of the antisense strand relative to the sense strand of the DRNAsimm, the nucleotide of mismatched base pairs of the antisense strand not only forms a base pair mismatch with the sequence of the sense strand DRNAsimm, but also forms a base pair mismatch with a target RNA sequence of DRNAsimm (thus, the complementarity between the antisense strand sequence and the sense strand sequence is interrupted at the mismatched base pair within the DRNAsimm, and the complementarity is similarly altered between the antisense strand sequence of the DARNsimm and the target RNA sequence). In alternative embodiments, the antisense strand nucleotide base pair of a DRNAsimm only forms a base pair mismatched with a corresponding nucleotide of the sense strand sequence of the DRNAsimm, but base pairs with their corresponding sequence nucleotide. of target RNA (therefore, complementarity between the antisense strand sequence and the sense strand sequence is interrupted at the mismatched base pair within the DRNAsimm, although the complementarity between the antisense strand sequence of the DRNAsimm and the target RNA sequence).

A DRNAsimm of the invention that possesses a single mismatched base pair within the mismatch tolerant region as described above (e.g., a DRNAsimm harboring a mismatched nucleotide residue at positions 13, 14, 15, 16, 17, 18, 19, 20, or 21 of the antisense strand) may further include one, two, or even three additional mismatched base pairs. In preferred embodiments, these one, two, or three additional mismatched base pairs of the DRNAsimm occur at positions 13, 14, 15, 16, 17, 18, 19, 20, and / or 21 of the antisense strand (and in the corresponding sense strand residue). In an embodiment where an additional mismatched base pair is present within a DARNsimm, the two mismatched base pairs of the antisense strand can occur, for example, at nucleotides at position 14 and position 18 of the strand. antisense (with the mismatch also in the corresponding nucleotide residues of the sense strand).

In DARNsimm agents that possess two mismatched base pairs, consecutive mismatches can occur (eg, at consecutive positions along the nucleotide sequence of the antisense strand). Alternatively, nucleotides of the antisense strand that form base pairs mismatched with the sense strand sequence can be interspersed by nucleotides that match the sense strand sequence (for example, for a DRNAsimm that possesses mismatched nucleotides in positions 13 and 16, but not positions 14 and 15, the mismatched residues of antisense strand positions 13 and 16 are interspersed by two nucleotides that form base pairs matching the corresponding residues of the sense strand). For example, two antisense strand residues (located within the sense strand mismatch tolerant region) that form base pairs incompatible with the corresponding sense strand sequence can occur with zero, one, two, three , four, five, six, or seven matching base pairs located between these mismatched base pairs.

For certain DARNsimm agents that possess three mismatched base pairs, consecutive mismatches can occur (eg, in a triplet along the nucleotide sequence of the antisense strand). Alternatively, nucleotides of the antisense strand that form base pairs that do not match the sequence of the sense strand can be interspersed with nucleotides that form base pairs that match the sequence of the sense strand (for example, for a DARNsimm that possesses mismatched nucleotides at positions 13, 14, and 18, but not at positions 15, 16, and 17, mismatched residues at antisense strand positions 13 and 14 are adjacent to each other, while mismatched residues at antisense strand positions 14 and 18 are interspersed by three nucleotides that form base pairs coincident with the corresponding residues of the sense strand). For example, three antisense strand residues (located within the antisense strand mismatch tolerant region) that form base pairs mismatched with the corresponding sense strand sequence can occur with zero, one, two, three. , four, five, or six matching base pairs located between two of these mismatched base pairs.

For certain DARNsimm agents that possess four mismatched base pairs, consecutive mismatches can occur (eg, in a quadruplet along the nucleotide sequence of the antisense strand). Alternatively, nucleotides of the antisense strand that form base pairs that do not match the sequence of the sense strand may be interspersed with nucleotides that form base pairs that match the sequence of the sense strand (for example, for a DARNsimm that has mismatched nucleotides at positions 13, 15, 17, and 18, but not at positions 14 and 16, mismatched residues at antisense strand positions 17 and 18 are adjacent to each other, while mismatched residues at antisense strand positions 13 and 15 are interspersed by a nucleotide that forms a base pair coincident with the corresponding residue on the sense strand similarly, non-coincident residues at antisense strand positions 15 and 17 are also interspersed by a nucleotide that forms a base pair coincident with the corresponding residue on the sense strand). For example, four antisense strand residues (located within the antisense strand mismatch tolerant region) that form base pairs mismatched with the corresponding sense strand sequence can occur with zero, one, two, three , four or five matching base pairs located between two of these mismatched base pairs.

In a further embodiment, a DRNAsimm of the invention possesses a single nucleotide of mismatched base pairs in any of positions 11, 12, 13, 14, 15, 16, 17, 18 or 19 of the antisense strand of an extended DRNA on the left (where position 1 is the 5 'terminal nucleotide of the antisense strand and position 11 is the nucleotide residue of the antisense strand that is immediately 3' (downstream) on the antisense strand of the projected Ago2 cleavage site of the target RNA sequence sufficiently complementary to the antisense strand sequence). In certain embodiments, for a DRNAsimm that possesses a mismatched base pair nucleotide at any of positions 11, 12, 13, 14, 15, 16, 17, 18, or 19 of the antisense strand relative to the sense strand of the DRNAsimm, the nucleotide of mismatched base pairs of the antisense strand not only forms a mismatched base pair with the sequence of the sense strand of DRNAsimm, but also forms a mismatched base pair of an RNA sequence target of DRNAsimm (therefore, the complementarity between the sequence of the antisense strand and the sequence of the sense strand is interrupted at the mismatched base pair within the DRNAsimm, and the complementarity is similarly altered between the sequence of antisense strand of the DARNsimm and the target RNA sequence). In alternate embodiments, the antisense strand mismatch nucleotide base pair of a DRNAsimm only forms a base pair mismatch with a corresponding nucleotide of the sense strand sequence of DRNAsimm, but this same base pair of antisense strand nucleotides with their corresponding target RNA sequence nucleotide (therefore, the complementarity between the antisense strand sequence and the sense strand sequence is interrupted at the mismatched base pair within the DRNAsimm, although the complementarity between the antisense strand sequence of the DRNAsimm and the target RNA sequence).

A DRNAsimm of the invention that possesses a single mismatched base pair within the mismatch tolerant region as described above (e.g., a DRNAsimm harboring a mismatched nucleotide residue at positions 11, 12, 13, 14, 15, 16, 17, 18 or 19 of the antisense strand) may further include one, two, or even three additional mismatched base pairs. In preferred embodiments, these one, two, or three additional mismatched base pairs of the DRNAsimm occur at positions 11, 12, 13, 14, 15, 16, 17, 18, and / or 19 of the antisense strand (and at the corresponding sense strand residue). In an embodiment where an additional mismatched base pair is present within a DARNsimm, the two mismatched base pairs of the antisense strand can occur, for example, at nucleotides at position 14 and position 18 of the strand. antisense (with the mismatch also in the corresponding nucleotide residues of the sense strand).

In DARNsimm agents that possess two mismatched base pairs, consecutive mismatches can occur (eg, at consecutive positions along the nucleotide sequence of the antisense strand). Alternatively, nucleotides of the antisense strand that form base pairs mismatched with the sense strand sequence can be interspersed by nucleotides that match the sense strand sequence (for example, for a DRNAsimm that possesses mismatched nucleotides in positions 12 and 15, but not positions 13 and 14, the mismatched residues of antisense strand positions 12 and 15 are interspersed by two nucleotides that form base pairs matching the corresponding residues of the sense strand). For example, two antisense strand residues (located within the sense strand mismatch tolerant region) that form base pairs incompatible with the sense strand sequence Corresponding can occur with zero, one, two, three, four, five, six, or seven matching base pairs located between these mismatched base pairs.

For certain DARNsimm agents that possess three mismatched base pairs, consecutive mismatches can occur (eg, in a triplet along the nucleotide sequence of the antisense strand). Alternatively, nucleotides of the antisense strand that form base pairs that do not match the sequence of the sense strand can be interspersed with nucleotides that form base pairs that match the sequence of the sense strand (for example, for a DARNsimm that possesses mismatched nucleotides at positions 13, 14, and 18, but not at positions 15, 16, and 17, mismatched residues at antisense strand positions 13 and 14 are adjacent to each other, while mismatched residues at antisense strand positions 14 and 18 are interspersed by three nucleotides that form base pairs coincident with the corresponding residues of the sense strand). For example, three antisense strand residues (located within the antisense strand mismatch tolerant region) that form base pairs mismatched with the corresponding sense strand sequence can occur with zero, one, two, three. , four, five, or six matching base pairs located between two of these mismatched base pairs.

For certain DARNsimm agents that possess four mismatched base pairs, consecutive mismatches can occur (eg, in a quadruplet along the nucleotide sequence of the antisense strand). Alternatively, nucleotides of the antisense strand that form base pairs that do not match the sequence of the sense strand may be interspersed with nucleotides that form base pairs that match the sequence of the sense strand (for example, for a DARNsimm that has mismatched nucleotides at positions 13, 15, 17, and 18, but not at positions 14 and 16, mismatched residues at antisense strand positions 17 and 18 are adjacent to each other, while mismatched residues at antisense strand positions 13 and 15 are interspersed by a nucleotide that forms a base pair coincident with the corresponding residue on the sense strand similarly, non-coincident residues at antisense strand positions 15 and 17 are also interspersed by a nucleotide that forms a base pair coincident with the corresponding residue on the sense strand). For example, four antisense strand residues (located within the antisense strand mismatch tolerant region) that form base pairs mismatched with the corresponding sense strand sequence can occur with zero, one, two, three , four or five matching base pairs located between two of these mismatched base pairs.

In a further embodiment, a DRNAsimm of the invention possesses a single nucleotide of mismatched base pairs in any of positions 15, 16, 17, 18, 19, 20, 21, 22 or 23 of the antisense strand of an extended DRNA on the left (where position 1 is the 5 'terminal nucleotide of the antisense strand and position 15 is the nucleotide residue of the antisense strand that is immediately 3' (downstream) on the antisense strand of the projected Ago2 cleavage site of the target RNA sequence sufficiently complementary to the antisense strand sequence). In certain embodiments, for a DRNAsimm that possesses a mismatched base pair nucleotide at any of positions 15, 16, 17, 18, 19, 20, 21, 22, or 23 of the antisense strand relative to the sense strand of the DRNAsimm, the nucleotide of mismatched base pairs of the antisense strand not only forms a base pair mismatch with the sequence of the sense strand DRNAsimm, but also forms a base pair mismatch with a target RNA sequence of DRNAsimm (thus, the complementarity between the antisense strand sequence and the sense strand sequence is interrupted at the mismatched base pair within the DRNAsimm, and the complementarity is similarly altered between the antisense strand sequence of the DARNsimm and the target RNA sequence). In alternate embodiments, the antisense strand mismatch nucleotide base pair of a DRNAsimm only forms a base pair mismatch with a corresponding nucleotide of the sense strand sequence of DRNAsimm, but this same base pair of antisense strand nucleotides with their corresponding target RNA sequence nucleotide (therefore, the complementarity between the antisense strand sequence and the sense strand sequence is interrupted at the mismatched base pair within the DRNAsimm, although the complementarity between the antisense strand sequence of the DRNAsimm and the target RNA sequence).

A DARNsimm of the invention possessing a single mismatched base pair within the mismatch tolerant region as described above (e.g., a DRNAsimm harboring a mismatched nucleotide residue at positions 15, 16, 17, 18, 19, 20, 21, 22 or 23 of the antisense strand) may further include one, two, or even three additional mismatched base pairs. In preferred examples, these one, two, or three additional mismatched base pairs of the DRNAsimm occur at positions 15, 16, 17, 18, 19, 20, 21, 22, and / or 23 of the antisense strand (and at the corresponding sense strand residue). In an embodiment where an additional mismatched base pair is present within a DARNsimm, the two mismatched base pairs of the antisense strand can occur, for example, at nucleotides at position 16 and position 20 of the strand. antisense (with the mismatch also in the corresponding nucleotide residues of the sense strand).

In DARNsimm agents that possess two mismatched base pairs, consecutive mismatches can occur (eg, at consecutive positions along the nucleotide sequence of the antisense strand). Alternatively, nucleotides of the antisense strand that form base pairs that do not match the sequence of the sense strand can be intercalated by nucleotides that match the sequence of the sense strand (for example, for a DRNAsimm that possesses nonsense nucleotides). coincident at positions 16 and 20, but not at positions 17, 18, and 19, the mismatched residues from antisense strand positions 16 and 20 are interspersed by three nucleotides that form base pairs coincident with the corresponding residues of the sense strand). For example, two antisense strand residues (located within the sense strand mismatch tolerant region) that form base pairs incompatible with the corresponding sense strand sequence can occur with zero, one, two, three , four, five, six, or seven matching base pairs located between these mismatched base pairs.

For certain DARNsimm agents that possess three mismatched base pairs, consecutive mismatches can occur (eg, in a triplet along the nucleotide sequence of the antisense strand). Alternatively, nucleotides of the antisense strand that form base pairs that do not match the sequence of the sense strand may be interspersed with nucleotides that form base pairs that match the sequence of the sense strand (for example, for a DARNsimm that possesses mismatched nucleotides at positions 16, 17, and 21, but not at positions 18, 19, and 20, mismatched residues at antisense strand positions 16 and 17 are adjacent to each other, while mismatched residues at positions 17 and 21 of the antisense strand are interspersed by three nucleotides that form base pairs coincident with corresponding residues of the sense strand). For example, three antisense strand residues (located within the antisense strand mismatch tolerant region) that form base pairs mismatched with the corresponding sense strand sequence can occur with zero, one, two, three. , four, five, or six matching base pairs located between two of these mismatched base pairs.

For certain DARNsimm agents that possess four mismatched base pairs, consecutive mismatches can occur (eg, in a quadruplet along the nucleotide sequence of the antisense strand). Alternatively, nucleotides of the antisense strand that form base pairs that do not match the sequence of the sense strand can be interspersed with nucleotides that form base pairs that match the sequence of the sense strand (for example, for a DARNsimm that possesses mismatched nucleotides at positions 17, 19, 21, and 22, but not at positions 18 and 20, mismatched residues at antisense strand positions 21 and 22 are adjacent to each other, while mismatched residues at antisense strand positions 17 and 19 are interspersed by a nucleotide that forms a base pair coincident with the corresponding residue on the sense strand similarly, the mismatched residues at antisense strand positions 19 and 21 are also interspersed by a nucleotide that forms a base pair coincident with the corresponding residue on the sense strand). For example, four antisense strand residues (located within the antisense strand mismatch tolerant region) that form base pairs mismatched with the corresponding sense strand sequence can occur with zero, one, two, three , four or five matching base pairs located between two of these mismatched base pairs.

For the sake of clarity, the location (s) of the mismatched nucleotide residues within the DRNAsimm agents above are numbered in reference to the 5 'terminal residue of the sense or antisense strands of DRNAsimm. The numbering of the positions within the mismatch tolerant region (mismatch region) of the antisense strand can change with variations in proximity of the 5 'end of the antisense strand to the projected Ago2 cleavage site. Therefore, the location (s) of the preferred mismatch sites within the antisense strand or sense strand can also be identified as the permissible proximity of such mismatches to the projected Ago2 cleavage site. Accordingly, in a preferred embodiment, the position of an upstream strand nucleotide mismatch of a DARNsimm is the nucleotide residue on the downstream strand immediately 5 '(upstream) of the projected Ago2 cleavage site. of the corresponding target RNA sequence. In other preferred embodiments, a non-matching nucleotide of the downstream strand of a DARNsimm is placed at the nucleotide residue of the downstream strand that lies two nucleotides 5 '(upstream) of the projected Ago2 cleavage site, three nucleotides 5 '(upstream) of the projected Ago2 cleavage site, four nucleotides 5' (upstream) of the projected Ago2 cleavage site, five nucleotides 5 '(upstream) of the projected Ago2 cleavage site, six 5' nucleotides ( upstream) from the projected Ago2 cleavage site, seven nucleotides 5 '(upstream) from the projected Ago2 cleavage site, eight nucleotides 5' (upstream) from the projected Ago2 cleavage site, or nine nucleotides 5 '(upstream) of the projected Ago2 cleavage site.

Examples of extended single-stranded 5'DRNAs containing individual incompatibilities (DRNAsimm) include the following structures (such structures containing incompatibilities can also be incorporated into other example DRNAs structures shown herein).

5'-XXMXXXXXXXXXXXXXXXXXXXXN * DD-3 '

3'-YXXMXXXXXXXXXXXXXXXXXXXXN * XXZN-5 '

5'-XXXMXXXXXXXXXXXXXXXXXXXN * DD-3 '

3'-YXXXMXXXXXXXXXXXXXXXXXXXN * XXZN-5 '

5'-XXXXMXXXXXXXXXXXXXXXXXXN * DD-3 '

3'-YXXXXMXXXXXXXXXXXXXXXXXXN * XXZN-5 '

5'-XXXXXMXXXXXXXXXXXXXXXXXN * DD-3 '

3'-YXXXXXMXXXXXXXXXXXXXXXXXN * XXZN-5 '

5'-XXXXXXMXXXXXXXXXXXXXXXXN * DD-3 '

3'-YXXXXXXMXXXXXXXXXXXXXXXXN * XXZN-5 '

5'-XXXXXXXMXXXXXXXXXXXXXXXN * DD-3 '

3'-YXXXXXXXMXXXXXXXXXXXXXXXN * XXZN-5 '

5'-XXXXXXXXMXXXXXXXXXXXXXXN * DD-3 '

3'-YXXXXXXXXMXXXXXXXXXXXXXXN * XXZN-5 '

Where "X" = RNA, "Y" is an optional overhang domain composed of 0-10 RNA monomers that are optionally 2'-O-methyl RNA monomers; In certain embodiments, "Y" is an overhang domain composed of 1-4 RNA monomers that are optionally 2'-O-methyl RNA monomers, "Z" = DNA, RNA, or modified nucleotide, "N" = 1 a 50 or more, but is optionally 1-30 or optionally 1-15 or optionally 1-10. "N *" = 0 to 15 or more, but optionally is 0, 1, 2, 3, 4 or 5, and "D" = DNA, "M" = nucleic acid residues (RNA, DNA or non-natural nucleic acids or modified) that do not form a base pair (hydrogen bonding) with the corresponding "M" residues of the complementary strand when the strands fuse. Any of the residues of said agents can optionally be 2'-O-methyl RNA monomers with alternate positioning of 2'-O-methyl RNA monomers starting from the 3'-terminal residue of the lower (second) strand, such as shown above, can also be used in older DARNsimm agents. For the mismatched structures above, the upper strand is the sense strand and the lower strand is the antisense strand.

In certain embodiments, a DRNA si of the invention may contain mismatches that exist in reference to the target RNA sequence, but do not necessarily exist as mismatched base pairs within the two strands of the DRNA si, therefore, a DRNA si may possess a perfect complementarity between the first and second strands of a DRNA si, still possessing mismatched residues in reference to a target RNA (which, in certain embodiments, may be advantageous to promote efficacy and / or potency and / or duration of effect ). In certain embodiments, where mismatches occur between the antisense strand and the target RNA sequence, the position of a mismatch is within the antisense strand at a position (s) corresponding to a sequence of the sense strand located at 5 'of the projected Ago2 cleavage site of the target region, eg, antisense strand residues placed within the antisense strand 3' of the antisense residue that is complementary to the projected Ago2 cleavage site of the target sequence.

Examples of 25/27-mer DRNAses harboring a single unpaired residue in reference to target sequences include the following preferred structures;

Target RNA Sequence: 5 '-. AXXXXXXXXXXXXXXXXXXXX.-3'

Thread in sense DARNsimm: 5'-XXXXXXXXXXXXXXXXXXXXXXXN * DD-3 '

DARNsimm antisense strand: 3'-EXXXXXXXXXXXXXXXXXXXXXXXXN * XXZN-5 '

Target RNA sequence: 5 '- ..XAXXXXXXXXXXXXXXXXXXX-3'

Thread in sense DARNsimm: 5'-XXXXXXXXXXXXXXXXXXXXXXN * DD-3 '

DARNsimm antisense strand: 3'-XEXXXXXXXXXXXXXXXXXXXXXXXN * XXZN-5 '

Target RNA Sequence: 5'- ... AXXXXXXXXXXXXXXXXXX-3 '

Thread in sense DARNsimm: 5'-BXXXXXXXXXXXXXXXXXXXXXXN * DD-3 '

DARNsimm antisense strand: 3'-XXEXXXXXXXXXXXXXXXXXXXXXXN * XXZN-5 '

Target RNA sequence: 5 '-... XAXXXXXXXXXXXXXXXXX.-3'

Thread in sense DARNsimm: 5'-XBXXXXXXXXXXXXXXXXXXXXXN * DD-3 '

DARNsimm antisense strand: 3'-XXXEXXXXXXXXXXXXXXXXXXXXXN * XXZN-5 '

Target RNA sequence: 5 '-... XXAXXXXXXXXXXXXXXXX.-3'

Thread in sense DARNsimm: 5'-XXBXXXXXXXXXXXXXXXXXXXXN * DD-3 '

DARNsimm antisense strand: 3'-XXXXEXXXXXXXXXXXXXXXXXXXXN * XXZN-5 '

Target RNA sequence: 5 '-... XXXAXXXXXXXXXXXXXXX.-3'

Thread in direction DARNsimm: 5'-XXXBXXXXXXXXXXXXXXXXXXXN * DD-3 '

DARNsimm antisense strand: 3'-XXXXXEXXXXXXXXXXXXXXXXXXXN * XXZN-5 '

Target RNA sequence: 5 '-... XXXXAXXXXXXXXXXXXXX.-3'

Thread in sense DARNsimm: 5'-XXXXBXXXXXXXXXXXXXXXXXXN * DD-3 '

DARNsimm antisense strand: 3'-XXXXXXEXXXXXXXXXXXXXXXXXXN * XXZN-5 '

Target RNA sequence: 5 '-... XXXXXAXXXXXXXXXXXXX.-3'

Thread in direction DARNsimm: 5'-XXXXXBXXXXXXXXXXXXXXXXXN * DD-3 '

DARNsimm antisense strand: 3'-XXXXXXXEXXXXXXXXXXXXXXXXXN * XXZN-5 '

Target RNA sequence: 5 '-... XXXXXXAXXXXXXXXXXXX.-3'

Thread in sense DARNsimm: 5'-XXXXXXBXXXXXXXXXXXXXXXXN * DD-3 '

DARNsimm antisense strand: 3'-XXXXXXXXEXXXXXXXXXXXXXXXXN * XXZN-5 '

Target RNA sequence: 5 '-... XXXXXXXAXXXXXXXXXXX.-3'

Thread in sense DARNsimm: 5'-XXXXXXXBXXXXXXXXXXXXXXXN * DD-3 '

DARNsimm antisense strand: 3'-XXXXXXXXXEXXXXXXXXXXXXXXXN * XXZN-5 '

Target RNA sequence: 5 '-... XXXXXXXXAXXXXXXXXXX.-3'

Thread in sense DARNsimm: 5'-XXXXXXXXBXXXXXXXXXXXXXXN * DD-3 '

DARNsimm antisense strand: 3'-XXXXXXXXXXEXXXXXXXXXXXXXXN * XXZN-5 '

Where "X" = RNA, "Y" is an optional overhang domain composed of 0-10 RNA monomers that are optionally 2'-O-methyl RNA monomers; In certain embodiments, "Y" is an overhang domain composed of 1-4 RNA monomers that are optionally 2'-O-methyl RNA monomers, "Z" = DNA, RNA, or modified nucleotide, "N" = 1 a 50 or more, but is optionally 1-30 or optionally 1-15 or optionally 1-10. "N *" = 0 to 15 or more, but optionally is 0, 1, 2, 3, 4 or 5, "D" = DNA, "p" = a phosphate group, "E" = nucleic acid residues (RNA , DNA, or unnatural or modified nucleic acids) that do not form a base pair (hydrogen bonding) with the corresponding RNA "A" residues of the complementary (target) strand when strands are collected, but optionally make a base pair with the corresponding "B" residues (The "B" residues are also non-natural or modified RNA, DNA or nucleic acids). Any of the residues of such agents may optionally be 2'-O-methyl RNA monomers, for example, with alternate positioning of 2'-O-methyl RNA monomers starting from the 3'-terminal residue of the lower strand ( second), as shown above, or other 2'-O-methyl standards and / or other modifications as described herein may also be used in the above siRNA agents.

In addition to the structures exemplified above, the siDNAs of the invention may also possess one, two, or three additional residues that form additional mismatches with the target RNA sequence. Such mismatches can be consecutive, or they can be interspersed by nucleotides that form base pairs matching the target RNA sequence. When interspersed with nucleotides that form matching base pairs, mismatched residues can be separated from each other within a single strand in a range of one, two, three, four, five, six, seven, or even eight base pair nucleotides forming residuals between such mismatches.

As for the DRNAsimm agents described above, a preferred location within the DRNAses for antisense strand nucleotides that form base pairs mismatched with the target RNA sequence (although it may or may not match the sense strand nucleotides Corresponding strands) is within the antisense strand region that lies 3 '(downstream) of the antisense strand sequence that is complementary to the projected Ago2 cleavage site of the siDNA. Therefore, in a preferred embodiment, the position of a mismatched nucleotide (relative to the target RNA sequence) of the antisense strand of a DRNAsimm is the nucleotide residue of the antisense strand immediately 3 '(current bottom) within the antisense strand sequence of the projected Ago2 cleavage site from the corresponding target RNA sequence. In other preferred embodiments, a mismatched nucleotide of the antisense strand of a DRNAsimm (relative to the target Rn sequence) is placed at the nucleotide residue of the antisense strand that is located two nucleotides 3 '(downstream) of the corresponding projected Ago2 cleavage site, three 3' nucleotides (downstream) of the corresponding projected Ago2 cleavage site, four 3 'nucleotides (downstream) of the corresponding projected Ago2 cleavage site, five 3 nucleotides '(downstream) from the corresponding projected Ago2 cleavage site, six nucleotides 3' (downstream) from the projected Ago2 cleavage site, seven 3 'nucleotides (downstream) from the projected Ago2 cleavage site, eight 3' nucleotides (downstream ) of the projected Ago2 cleavage site, or nine nucleotides 3 '(downstream) of the projected Ago2 cleavage site.

In siDNAs that possess two antisense strand mismatch nucleotides (where the mismatch nucleotides are forming mismatch relative to the target RNA sequence), mismatches may occur consecutively (e.g., in consecutive positions along the nucleotide sequence of the antisense strand). Alternatively, nucleotides of the antisense strand that form base pairs mismatched with the target RNA sequence can be interspersed with nucleotides that match the target RNA sequence (for example, for a siDNA that possesses mismatched nucleotides in positions 13 and 16 (starting from Terminal 5 '(position 1) of the antisense strand), but not at positions 14 and 15, the mismatched residues at positions 13 and 16 of the sense strand are interspersed by two nucleotides that form base pairs matching the corresponding residues of the target RNA sequence). For example, two antisense strand residues (located within the antisense strand mismatch tolerant region) that form base pairs mismatched with the corresponding target RNA sequence can occur with zero, one, two, three, four or five matching base pairs (relative to the target RNA sequence) located between these mismatched forming base pairs.

For certain siDNAs that possess three mismatched forming base pairs (mismatching with respect to the target RNA sequence), the mismatching nucleotides may occur consecutively (e.g., in a triplet along the sequence of nucleotides of the antisense strand). Alternatively, nucleotides of the antisense strand that form base pairs mismatched with the target RNA sequence can be interspersed with nucleotides that form base pairs match the target RNA sequence (for example, for a siDNA having mismatched nucleotides At positions 13, 14, and 18, but not at positions 15, 16, and 17, the mismatch-forming residues of antisense strand positions 13 and 14 are adjacent to each other, while the mismatch-forming residues of antisense strand positions 14 and 18 are interspersed by three nucleotides that form matching base pairs with the corresponding residues of the target RNA). For example, three antisense strand residues (located within the antisense strand mismatch tolerant region) that form base pairs mismatched with the corresponding target RNA sequence can occur with zero, one, two, three, or four matching base pairs located between either of these two mismatched forming base pairs.

For certain siRNAs that possess four mismatched forming base pairs (mismatching with respect to the target RNA sequence), the mismatching nucleotides may occur consecutively (e.g., in a quadruplet along the sequence of nucleotides of the sense strand). Alternatively, nucleotides of the antisense strand that form base pairs mismatched with the target RNA sequence may be interspersed with nucleotides that form base pairs match the target RNA sequence (for example, for a siDNA that possesses mismatch at positions 13, 15, 17, and 18, but not at positions 14 and 16, the mismatched-forming residues at positions 17 and 18 of the antisense strand are adjacent to each other, while the mismatched-forming residues of positions 13 and 15 of the antisense strand are interspersed by a nucleotide that forms a base pair paired with the corresponding residue of the target RNA sequence, similarly, the mismatch-forming residues of antisense strand positions 15 and 17 are also interspersed by a nucleotide that forms a paired base pair with the corresponding residue in the dian RNA sequence. to). For example, four antisense strand residues (located within the antisense strand mismatch tolerant region) that form base pairs mismatched with the corresponding target RNA sequence can occur with zero, one, two, or three pairs. matching base pairs located between two of these mismatch-forming base pairs.

The DARNsimm above and other DRNAsi structures are described in order to exemplify certain structures of DRNAsimm and DRNAsi agents. The design of the DARNsimm and DARNsi structures above can be adapted to generate, for example, DRNAsimm forms of an extended DRNAsi agent shown below (including, for example, design of mismatched DRNAsimm agents). As exemplified above, siRNAs can also be designed to possess unique mismatches (or two, three, or four mismatches) between the antisense strand of the siRNAs and a target sequence, although they can optionally retain perfect complementarity between the sequences of the sense and antisense strand of a DARNsi.

It is further noted that the siRNA agents exemplified infra may also possess insertion / deletion (en / del) structures within their double-stranded structures and / or aligned with target RNA. Accordingly, the siDNAs of the invention can be designed to possess variations in / del, for example, in the antisense strand sequence compared to the target RNA sequence and / or the antisense strand sequence compared to the strand sequence in sense, with preferred locations for the placement of such in / of the nucleotides corresponding to the locations described above for the positioning of malformed and / or malformed base pairs.

In certain embodiments, the "D" residues of any of the above structures include at least one PS-DNA or PS-RNA. Optionally, the "D" residues of any of the above structures include at least one modified nucleotide that inhibits Dicer cleavage.

In one embodiment, the DARNsi agent has an asymmetric structure, with the sense strand being 25 base pairs in length, the antisense strand being 42 nucleotides in length with a 3 'overhang of 2 bases (and therefore , the DRNA agent has a 5 'overhang of 15 nucleotides in length at the 3' end of the sense strand / 5 'of the antisense strand), and with deoxyribonucleotides located at positions 24 and 25 of the sense strand (numbering from position 1 in the 5 'of the sense strand) and each base paired with a cognate nucleotide of the antisense strand. The 5 'overhang comprises a modified nucleotide, preferably a 2'-O-methyl ribonucleotide, and / or a phosphate backbone modification, preferably phosphorothioate.

In another embodiment, the siDNA agent has a structure, with the sense strand being 40 nucleotides in length, the antisense strand being 27 nucleotides in length with a 2 base 3 'overhang (and therefore the DRNA agent has a 3 'overhang of 15 nucleotides in length at the 3' end of the sense strand / 5 'of the antisense strand), and with deoxyribonucleotides located at positions 24 and 25 of the sense strand (numbering from position 1 5 'of the sense strand) and each base paired with a cognate nucleotide of the antisense strand. The 3 'overhang comprises a deoxyribonucleotide and / or a modification of the phosphate backbone, preferably methylphosphonate.

Modification of dsNAs

A major factor that inhibits the effect of double-stranded RNAs ("dsRNAs") is the degradation of dsRNAs (eg, RNAsis and DRNAses) by nucleases. A 3'-exonuclease is the primary nuclease activity present in serum and modification of the 3 'ends of antisense DNA oligonucleotides is crucial to prevent degradation (Eder et al., 1991). A nuclease of the RNase-T family called ERI-1 has been identified that has a 3'-5 'exonuclease activity that is involved in the regulation and degradation of siRNAs (Kennedy et al., 2004; Hong et al. , 2005). This gene is also known as Thex1 (NM-02067) in mice or THEX1 (NM-153332) in humans and is involved in the degradation of histone mRNA; it also mediates the degradation of 3 'overhangs in siRNAs, but does not degrade double RNA (Yang et al., 2006). Therefore, it is reasonable to expect that stabilization of the 3 'end of dsRNAs, including the dsNAs of the present invention, will improve stability.

XRN1 (NM-019001) is a 5 'to 3' exonuclease that resides in P bodies and has been implicated in mRNA-driven degradation of mRNA (Rehwinkel et al., 2005) and may also be responsible for completing the degradation initiated by internal cleavage directed by an siRNA. XRN2 (NM-012255) is a distinct 5 'to 3' exonuclease that is involved in nuclear RNA processing. Although not currently involved in the degradation or processing of mRNAs and mRNAs, both are known nucleases that can degrade RNAs and may also be important to consider.

RNase A is a major mammalian endonuclease activity that degrades RNAs. It is specific for ssRNA and cleaves at the 3 'end of pyrimidine bases. SiRNA degradation products compatible with RNase A cleavage can be detected by mass spectrometry after incubation in serum (Turner et al., 2007). The 3 'overhangs increase the susceptibility of siRNAs to RNase degradation. Depletion of RNase A from serum reduces degradation of RNAses; this degradation shows some sequence preference and is worse for sequences that have poly A / U sequence at the ends (Haupenthal et al., 2006). This suggests the possibility that the regions of less stability of the double "breathe" and offer transient single-stranded species available for degradation by RNase A. Inhibitors of RNase A can be added to the serum and improve the longevity and potency of the siRNA (Haupenthal et al., 2007).

At 21-mer, phosphorothioate or boranophosphate modifications directly stabilize the internucleoside phosphate bond. Boranophosphate-modified RNAs are highly resistant to nucleases, potent as silencing agents, and are relatively non-toxic. Boranophosphate-modified RNAs cannot be manufactured using standard methods of chemical synthesis and are instead manufactured by in vitro transcription (IVT) (Hall et al., 2004 and Hall et al., 2006). Phosphorothioate (PS) modifications can easily be placed on a RNA double at any desired position and can be performed using standard chemical synthesis methods, although the ability to use such modifications within an RNA double that retain RNA silencing activity can be limited.

In certain embodiments, the 5 'single strand extended region of the guide strand or the 3' single strand extended region of the passenger strand has at least one phosphorothioate backbone modification. In some embodiments, each bond in the 5 'single strand extended region of the guide strand or 3' single strand extended region of the passenger strand has a phosphorothioate backbone modification. In some embodiments, each linkage of the 5 'single strand extended region of the leader strand has a modification of the phosphorothioate backbone, except for the 5' terminal nucleotide linkage of the leader strand. In certain embodiments, the 5 'single strand extended region of the guide strand or the 3' single strand extended region of the passenger strand has at least one methyl phosphonate backbone modification. In some embodiments, each link in the 5 'single strand extended region of the guide strand or 3' single strand extended region of the passing strand has a modification of the methylphosphonate backbone. In some embodiments, each linkage of the 3 'single stranded extended region of the passenger strand has a modification of the phosphorothioate backbone, except for the 5' terminal nucleotide of the guide strand.

However, it is observed that the modification of PS shows dose-dependent toxicity, which is why most researchers have recommended limited incorporation into siRNAs, historically favoring the 3 'ends where protection against nucleases is more important ( Harborth et al., 2003; Chiu and Rana, 2003; Braasch et al., 2003; Amarzguioui et al., 2003). A more extensive PS modification may be compatible with potent IRNA activity; however, the use of sugar modifications (such as 2'-O-methyl RNA) may be superior (Choung et al., 2006).

A variety of substitutions can be placed at the 2 'position of ribose which generally increases double stability (Tm) and can greatly improve nuclease resistance. 2'-O-methyl RNA is a natural modification found in mammalian ribosomal RNAs and transfer RNAs. The modification of 2'-O-methyl in RNAses is known, but the precise position of the modified bases within the double is important to retain potency and the complete substitution of RNA for 2'-O-methyl RNA will inactivate the siRNA. For example, a standard employing alternate 2'-O-methyl bases may have equivalent potency to unmodified RNA and is quite stable in serum (Choung et al., 2006; Czauderna et al., 2003).

The 2'-fluoro (2'-F) modification is also compatible with dsRNA function (eg, siRNA and dsNA); most commonly placed at pyrimidine sites (due to cost and reagent availability) and can be combined with the 2'-O-methyl modification at purine positions; 2'-F purines are available and can also be used. Highly modified doubles of this type can be potent in vitro IRNA triggers (Allerson et al., 2005; Prakash et al., 2005; Kraynack and Baker, 2006) and can improve performance and extend the duration of action when used. used in vivo (Morrissey et al., 2005a; Morrissey et al., 2005b). Allerson teaches a highly potent, stable, blunt 19-mer double containing alternate 2'-F and 2'-O-Me bases. In this design, the alternate residues are arranged in an identical pattern to that employed by Czauderna, however, the remaining RNA residues are converted to 2'-F modified bases. A highly potent, nuclease resistant siRNA employed by Morrissey employed a highly potent, nuclease resistant siRNA in vivo. In addition to RNA and 2'-F RNA, this double includes DNA, RNA, inverted abasic residues, and a 3'-terminal PS internucleoside linkage. While extensive modification has certain benefits, a more limited two-fold modification can also improve in vivo performance and is simpler and less expensive to manufacture. Soutschek et al. (2004) used an in vivo double and it was mainly RNA with two 2'-O-Me RNA bases and limited 3'-terminal PS internucleoside linkages.

Locked nucleic acids (LNA) and unblocked nucleic acids (UNA) are a different class of 2 'modification that can be used to stabilize dsRNAs (eg, siRNA and dsNA). LNA incorporation patterns that retain potency are more restricted than 2'-O-methyl or 2'-F bases, so limited modification is preferred (Braasch et al., 2003; Grunweller et al., 2003 ; Elmen et al., 2005) Even with limited incorporation, the use of LNA modifications can improve dsRNA performance in vivo and can also alter or enhance off-target effect profiles (Mook et al., 2007) .

Synthetic nucleic acids introduced into living cells or animals can be recognized as "foreign" and trigger an immune response. Immune stimulation constitutes a major class of off-target effects that can dramatically change experimental results and even lead to cell death. The innate immune system includes a collection of receptor molecules that specifically interact with the DNA and RNA that mediate these responses, some of which are found in the cytoplasm and some of which reside in the endosomes (Marques and Williams, 2005; Schlee et al. , 2006) Administration of RNAsis by cationic lipids or liposomes exposes siRNA to the cytoplasmic and endosomal compartments, maximizing the risk of eliciting an interferon type 1 (IFN) response both in vitro and in vivo (Morrissey et al., 2005b; Sioud and Sorensen, 2003; Sioud, 2005; Ma et al., 2005). RNAs transcribed within the cell are less immunogenic (Robbins et al., 2006) and synthetic RNAs that are immunogenic when administered using lipid-based methods can evade immune stimulation when introduced into cells by mechanical means, even inadvertent. alive (Heidel et al., 2004). However, lipid-based methods of administration are convenient, effective, and widely used. Some general strategy is needed to prevent immune responses, especially for in vivo application where all cell types are present and the risk of generating an immune response is higher. The use of chemically modified RNA can solve most or even all of these problems.

Although certain sequence motifs are clearly more immunogenic than others, it appears that receptors of the innate immune system in general distinguish the presence or absence of certain base modifications that are more commonly found in mammalian RNAs than in prokaryotic RNAs. For example, bases modified with pseudouridine, N6-methyl-A and 2'-O-methyl are recognized as "self" and the inclusion of these residues in a synthetic RNA can help evade immune detection (Kariko et al., 2005). The 2 'modification of a sequence that is strongly immunostimulatory since unmodified RNA can block an immune response when administered to mice intravenously (Morrissey et al., 2005b). However, extensive modification is not necessary to escape immune detection, and the substitution of as few as two 2'-O-methyl bases in a single strand of a siRNA double may be sufficient to block an IFN type 1 response both. in vitro as in vivo; modified U and G bases are more effective (Judge et al., 2006). As an added benefit, selective incorporation of 2'-O-methyl bases can reduce the magnitude of off-target effects (Jackson et al., 2006). Therefore, the use of 2'-O-methyl bases should be considered for all dsRNAs intended for in vivo applications as a means of blocking immune responses and has the additional benefit of improving nuclease stability and reducing the likelihood of off-target effects.

Although cell death can be the result of immune stimulation, assessing cell viability is not a suitable method to monitor the induction of IFN responses. IFN responses can be present without cell death, and cell death can be the result of target abrogation in the absence of IFN activation (eg, if the target gene is essential for cell viability). Relevant cytokines can be measured directly in culture medium and there are a variety of commercial kits that make such assays routine to perform. While a large number of different immune effector molecules can be measured, the test levels of IFN-a, TNF-a, and IL-6 at 4 and 24 hours after transfection are generally sufficient for detection purposes. It is important to include a "transfection reagent only control" as cationic lipids can elicit immune responses in certain cells in the absence of any nucleic acid load. The inclusion of controls for the induction of the IFN pathway should be considered for cell culture work. It is essential to assess immune stimulation when nucleic acids are administered in vivo, where the risk of eliciting IFN responses is greatest.

The dsNAs of the invention may have any of the modification patterns described hereinafter for DRNAs. Modifications can be included in the dsNA agents of the present invention as long as the modification does not prevent the dsNA agent from serving as a substrate for Dicer. Indeed, a surprising finding of the present invention is that a 5 'extended single strand nucleotide region of the antisense strand or the 3' extended single strand nucleotide region of the sense strand can bind to molecules of previously described dsNAs, resulting in improved IRNA efficiency and duration, provided such extension is performed in a region of the extended molecule that does not interfere with Dicer processing (e.g., 3 'of the Dicer cleavage site of the strand downstream / 5 'of the Dicer cleavage site of the antisense strand). In one embodiment, one or more modifications are made that improve Dicer processing of the dsiNA agent. In a second embodiment, one or more modifications are made that result in more effective IRNA generation. In a third embodiment, one or more modifications are made that support a greater RNAi effect. In a fourth embodiment, one or more modifications are made that result in increased potency for each molecule of dsNA agent that will be delivered to the cell. Modifications can be incorporated in the 3'-terminal region, the 5'-terminal region, in both the 3'-terminal region and the 5'-terminal region or, in some cases, at various positions within the sequence. Keeping in mind the restrictions mentioned above, any number and combination of modifications can be incorporated into the dsNA agent. When there are multiple modifications, they can be the same or different. Modifications to the bases, sugar structural units, the phosphate backbone, and their combinations are contemplated. Either of the 5 'ends can be phosphorylated.

Examples of contemplated modifications to the phosphate backbone include phosphonates, including methylphosphonate, phosphorothioate, and phosphotriester modifications such as alkyl phosphotriesters, blocked nucleic acids (LNAs), deblocked nucleic acid, morpholino, furanose bicyclic analogs, and the like. Examples of contemplated modifications for the sugar moiety include 2'-alkylpyrimidine, such as 2'-O-methyl, 2'-fluoro, amino and deoxy modifications and the like (see, eg, Amarzguioui et al., 2003). Examples of contemplated modifications for the base groups include abasic sugars, 2-O-alkyl modified pyrimidines, 4-thiouracil, 5-bromouracil, 5-iodouracil, and 5- (3-aminoallyl) -uracil, and the like. Blocked nucleic acids, or LNAs, unblocked nucleic acids or UNAs could also be incorporated. Many other modifications are known and can be used as long as the above criteria are met. Examples of modifications are also described in US Patent Nos. 5,684,143, 5,858,988 and 6,291,438 and in US Published Patent Application No. 2004/0203145 A1. Other modifications are described in Herdewijn (2000), Eckstein (2000), Rusckowski et al. (2000), Stein et al. (2001); Vorobjev et al. (2001).

One or more contemplated modifications can be incorporated into any of the strands. The placement of the modifications on the dsNA agent can greatly affect the characteristics of the dsNA agent, including conferring greater potency and stability, reducing toxicity, improving Dicer processing, and minimizing an immune response. In one embodiment, the antisense strand or the sense strand or both strands have one or more 2'-O-methyl modified nucleotides. In another embodiment, the antisense strand contains 2'-O-methyl modified nucleotides. In another embodiment, the antisense support contains a 3 'overhang comprising 2'-O-methyl modified nucleotides. The antisense strand could also include additional 2'-O-methyl modified nucleotides.

In certain embodiments, the 5 'single strand extended region of the guide strand, the 3' single strand extended region of the passenger strand, or the 5 'single strand extended region of the passenger strand has at least one modified nucleotide, optionally a 2'-O-methyl ribonucleotide. In some embodiments, each nucleotide in the 5 'single strand extended region of the guide strand or 3' single strand extended region of the passenger strand is a modified ribonucleotide, optionally a 2'-O-methyl ribonucleotide. In certain embodiments, an oligonucleotide complementary to the extended 5 'single strand region of the leader strand has at least one modified nucleotide, optionally a 2'-O-methyl ribonucleotide. In some embodiments, each nucleotide of a The oligonucleotide complementary to the extended 5 'single strand region of the guide strand is a modified nucleotide, optionally a 2'-O-methyl ribonucleotide.

In certain embodiments of the present invention, the dsiNA agent has one or more properties that enhance its dicer processing. According to these embodiments, the dsiNA agent is of sufficient length for Dicer to process it to produce an active siRNA and at least one of the following properties: (i) the dsiNA agent is asymmetric, for example, it has a 3 'overhang. on the antisense strand and (ii) the dsiNA agent has a modified 3 'end on the sense strand to direct dicer binding and processing of the dsRNA region to an active siRNA. In certain such embodiments, the presence of one or more base-paired deoxyribonucleotides in a region of the downstream strand that is 3 'of the projected site of Dicer enzyme cleavage and the corresponding region of the antisense strand that is 5 'of the projected site of Dicer enzyme cleavage may also serve to orient said molecule for the proper directionality of Dicer enzyme cleavage.

In certain embodiments, the length of the extended single chain antisense region is 1-30 nucleotides, 1-15 nucleotides, 10-15 nucleotides, 11-15 nucleotides. Therefore, a single-stranded extended dsNA of the present invention may possess a single-stranded extended region at the 5 'end of an antisense / guide strand or at the 3' end of a sense / transient strand that is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more (eg, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 or more) nucleotides in length.

In some embodiments, the longest strand in the double-stranded nucleic acid comprises 36-66 nucleotides. In one embodiment, the dsNA agent has a structure such that the 5 'end of the antisense strand protrudes from the 3' end of the sense strand, or the 3 'end of the antisense strand protrudes from the 5' end of the antisense strand. sense. In certain embodiments, the 5 'extension of the antisense strand is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 , 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more (for example, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 or more) nucleotides in length, and is optionally 10-30 nucleotides, for example 15 nucleotides. In another embodiment, the dsNA agent has a structure such that the 3 'end of the sense strand protrudes from the 5' end of the antisense strand, and the 3 'end of the antisense strand protrudes from the 5' end of the antisense strand. sense. In certain embodiments, the 3 'extension of the sense strand is 1-30 nucleotides, and optionally is 10-30 nucleotides, for example 15 nucleotides. In certain embodiments, the 3 'extension of the antisense strand is 1-10 nucleotides, and is optionally 1-6 nucleotides, preferably 1-4 nucleotides, for example 2 nucleotides. In another embodiment, the DsNA agent has a structure such that the 5 'end of the sense strand protrudes from the 3' end of the antisense strand. In certain embodiments, the 5 'overhang of the sense strand is 4-30 nucleotides, and optionally is 10-30 nucleotides, for example 15 nucleotides. Both the sense and antisense strands can also have a 5 'phosphate. An iterative combination of the extension characteristics at different 5 'and 3' terminals of sense and antisense strands as shown in Figures 34, 35 and 36 is also contemplated in the present invention.

In certain embodiments, the sense strand of a dsNA of the invention has a total length of at least 25 nucleotides (e.g., the sense strand is 25, 26, 27, 28, 29, 30 or more in length (for example For example, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 or more (nucleotides). In certain embodiments, the length of the sense strand is between 25 nucleotides and 30 nucleotides, for example, between 26 and 30 nucleotides, or between 27 and 30 nucleotides in length. In related embodiments, the antisense strand is at least 36 nucleotides in length (eg, the sense strand is 36, 37, 38, 39, 40 in length. , 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65 , 66 or more (eg, 67, 28, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80 or more (nucleotides). In certain such embodiments, the strand antisense is between 37 and 57 nucleotides in length, or between 37 and 52 nucleotides in length. tud, or between 37 and 47 nucleotides in length, or between 42 and 62 nucleotides in length, or between 42 and 57 nucleotides in length, or between 42 and 47 nucleotides in length.

In certain embodiments, the sense strand of a DsNA of the invention has a total length of 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 , 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60 or more (for example, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70 or more (nucleotides). In certain embodiments, the length of the sense strand is between 25 nucleotides and 30 nucleotides, optionally between 35 and 55 nucleotides, between 40 and 55 nucleotides in length, between 40 and 60 nucleotides in length, or between 45 and 60 nucleotides in length. In related embodiments, the antisense strand is 25, 27, 28, 29, 30, 31, 32, 33, 34 in length , 35, 36 or more (eg, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 nucleotides). In certain such embodiments, the antisense strand it is between 27 and 32 nucleotides long.

In certain embodiments, the presence of one or more base-paired deoxyribonucleotides in a region of the downstream strand that is 3 'of the projected site of Dicer enzyme cleavage and the corresponding region of the antisense strand that is 5' of the site The projected cleavage of the Dicer enzyme can serve to direct the cleavage of the Dicer enzyme from said molecule. While certain exemplified agents of the invention possess an downstream deoxyribonucleotide that is at position 24 or more 3 'when counted from position 1 at the 5' end of the sense strand, and having this position 24 or more deoxyribonucleotide 3 'of the sense base pairing of the strand with a cognate deoxyribonucleotide of the antisense strand, in some embodiments, it is also possible to instruct Dicer to cut a shorter product, for example, a 19-mer or a 20 -mer by including deoxyribonucleotide residues at, for example, position 20 of the strand sense.

Such a position 20 base pairs of deoxyribonucleotides with a corresponding deoxyribonucleotide of the antisense strand, thus directing the Dicer-mediated cleavage of a 19-mer as the most frequent Dicer product (it is noted that the antisense strand may also comprise one or two residues of deoxyribonucleotides immediately 3 'of the antisense residue that the base pairs with the deoxyribonucleotide residue at position 20 of the sense strand in such embodiments, to further direct Dicer cleavage of the antisense strand). In such embodiments, the region of double-stranded DNA (including modified nucleic acids that block Dicer cleavage) will generally be greater than 1 or 2 base pairs in length (eg, 3 to 5 base pairs or more), in command to direct Dicer cleavage to generate what is normally a non-preferred length of Dicer cleavage product. A parallel approach can also be taken to direct the Dicer cleavage of 20-mer siRNA, with the placement of the first deoxyribonucleotide residue of the sense strand (when the sense strand is examined from position 1 at the 5 'end of strand in sense) at position 21.

In certain embodiments, the DsNA agent of the invention may generally comprise modified nucleotides from about 5 to about 100% of the nucleotide positions (eg, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of the nucleotide positions). The actual percentage of modified nucleotides present in a given siNA molecule depends on the total number of nucleotides present in the siNA. If the siNA molecule is single-stranded, the percentage of modification can be based on the total number of nucleotides present in the single-stranded siNA molecules. Similarly, if the siNA molecule is double-stranded; the percent modification can be based on the total number of nucleotides present in the sense strand, the antisense strand, or the sense and antisense strands. Furthermore, the actual percentage of modified nucleotides present in a given siNA molecule may also depend on the total number of purine and pyrimidine nucleotides present in the siNA, for example, where all pyrimidine nucleotides and / or all purine nucleotides present in the siNA molecule are modified. In some cases, even 100% of the sense strand and / or the antisense strand can be completely modified.

In certain embodiments, the downstream strand of the DsiNA agent is modified for Dicer processing by suitable modifiers located at the 3 'end of the downstream strand, i.e., the DsiNA agent is designed to direct the orientation of the junction and Dicer processing via sense modification of the strand. Suitable modifiers include nucleotides such as deoxyribonucleotides, dideoxyribonucleotides, aciconucleotides, and the like, and hindered molecules, such as fluorescent molecules, and the like. Aciconucleotides substitute a 2-hydroxyethoxymethyl group for the 2'-deoxyribofuranosyl sugar normally present in dNMPs. Other nucleotide modifiers could include 3'-deoxyadenosine (cordycepin), 3'-azido-3'-deoxythymidine (AZT), 2 ', 3'-dideoxyinosine (ddl), 2', 3'-dideoxy-3'-thiacytidine (3TC), 2 ', 3'-didehydro-2', 3'-dideoxythymidine (d4T) and the nucleotides 3'-azido-3'-deoxythymidine monophosphate (AZT), 2 ', 3'-dideoxy-3' - thiacytidine (3TC) and 2 ', 3'-didehydro-2', 3'-dideoxythymidine (d4T). In one embodiment, deoxyribonucleotides are used as modifiers. When nucleotide modifiers are used, the 1-3 nucleotide modifiers, or 2 nucleotide modifiers are substituted for the ribonucleotides at the 3 'end of the sense strand. When sterically hindered molecules are used, they bind to the ribonucleotide at the 3 'end of the antisense strand. Therefore, the length of the strand does not change with the incorporation of the modifiers. In another embodiment, the invention contemplates substituting two DNA bases in the DsiNA agent to direct the orientation of Dicer processing of the antisense strand. In a further embodiment of the present invention, two terminal DNA bases are replaced by two ribonucleotides at the 3 'end of the sense strand forming a double blunt end at the 3' end of the sense strand and the 5 'end of the antisense strand, and a two-nucleotide RNA overhang is found at the 3 'end of the antisense strand. This is an asymmetric composition with DNA at the blunt end and RNA bases at the protruding end. In certain embodiments of the present invention, the modified nucleotides (eg, deoxyribonucleotides) of the penultimate and last positions of the 3 'end of the sense strand base pair with the corresponding modified nucleotides (eg, deoxyribonucleotides) of the strand antisense (optionally, the penultimate and last residues of the 5 'end of the antisense strand in those DsiNA agents of the present invention that possess a blunt end at the 3' end of the sense / 5 'end of the antisense strand).

The sense and antisense strands of a DsiNA agent of the present invention are collected under biological conditions, such as conditions found in the cytoplasm of a cell. Furthermore, a region of one of the sequences, particularly of the antisense strand, of the DsiNA agent has a sequence length of at least 19 nucleotides, wherein these nucleotides are in the region of 21 nucleotides adjacent to the 3 'end of the antisense strand and they are sufficiently complementary to a nucleotide sequence of the RNA produced from the target gene to anneal and / or decrease the levels of said target RNA.

The DsiNA agent of the present invention may possess one or more base pairs of deoxyribonucleotides located in any position of the sense and antisense strands that are 3 'of the projected Dicer cleavage site of the sense and 5' of Dicer cleavage site projected antisense strand. In certain embodiments, one, two, three, or all four positions 24-27 of the sense strand (starting from position 1 at the 5 'end of the sense strand) are deoxyribonucleotides, the base of which of each deoxyribonucleotide is paired with a Corresponding deoxyribonucleotide of the antisense strand. In certain embodiments, deoxyribonucleotides in the 5 'region of the antisense strand (e.g., the region of the antisense strand located 5' of the projected Dicer cleavage site for a given DsiNA molecule) are not complementary to the target RNA by which is addressed by the DsiNA agent. In related embodiments, the entire region of the antisense strand located 5 'of the projected Dicer cleavage site of a DsiNA agent is not complementary to the target RNA to which the DsiNA agent is directed. In certain embodiments, the deoxyribonucleotides of the antisense strand or the entire region of the antisense strand that lies 5 'of the projected Dicer cleavage site of the DsiNA agent is not sufficiently complementary to the target RNA to enhance fusion of the antisense strand of the DsiNA for target RNA when the antisense strand is annealed to the target RNA under conditions sufficient to allow fusion between the antisense strand and the target RNA (eg, a "core" antisense strand sequence lacking the extended region of DNA binds equally well to target RNA as the same "core" antisense strand sequence also extended with the DNA extended region sequence).

The DsNA agent may also have one or more of the following additional properties: (a) the antisense strand has a typical 21-mer shift to the right or left, (b) the strands may not be completely complementary, i.e., the strands can contain single mismatches and (c) base modifications such as blocked nucleic acid and unblocked nucleic acid (UNA) can be included at the 5 'end of the sense strand. A "typical" 21-mer siRNA is designed using standard techniques. In one technique, a variety of sites are commonly tested in parallel or clusters containing several different doubles of siRNAs specific for the same target in the hope that one of the reagents will be effective (Ji et al., 2003). Other techniques use design rules and algorithms to increase the probability of obtaining effector molecules of active RNAi (Schwarz et al., 2003; Khvorova et al., 2003; Ui-Tei et al., 2004; Reynolds et al., 2004; Krol et al., 2004; Yuan et al., 2004; Boese et al., 2005). A high-throughput screen for siRNA has also been developed (US Published Patent Application No. 2005/0042641 A1). Potential target sites can also be analyzed using secondary structure predictions (Heale et al., 2005). This 21-mer is used to design a right shift to include an additional 3-9 nucleotides at the 5 'end of the 21-mer. The sequence of these additional nucleotides can be any sequence. In one embodiment, the added ribonucleotides are based on the sequence of the target gene. Even in this embodiment, complete complementarity between the target sequence and the antisense siRNA is not required.

The first and second oligonucleotides of a DsNA agent of the present invention are not required to be completely complementary. They only need to be substantially complementary to the fusion under biological conditions and provide a substrate for Dicer that produces siRNA sufficiently complementary to the target sequence. Blocked nucleic acids, or LNAs, unblocked nucleic acids (UNA), are well known to one of skill in the art (Elman et al., 2005; Kurreck et al., 2002; Crinelli et al., 2002; Braasch and Corey , 2001; Bondensgaard et al., 2000; Wahlestedt et al., 2000). In one embodiment, an LNA is incorporated at the 5 'end of the sense strand. In another embodiment, an LNA is incorporated at the 5 'end of the double sense strand designed to include a 3' overhang on the antisense strand.

In certain embodiments, the DsNA agent of the present invention has an asymmetric structure, with the sense strand being 27 base pairs long, and the antisense strand being 29 base pairs long and 2 base overhang. 3'. Such agents may possess between one and four deoxyribonucleotides in the 3 'terminal region (specifically, the 3' region of the projected Dicer cleavage site) of the sense strand, in at least one of which the deoxyribonucleotide base pairs with a cognate deoxyribonucleotide of the 5 'terminal region (specifically, the 5' region of the projected Dicer cleavage site) of the antisense strand. In other embodiments, the sense strand is 28 base pairs long, and the antisense strand is 30 base pairs long and 2 base 3 'overhang. Such agents may possess between one and five deoxyribonucleotides in the 3 'terminal region (specifically, the 3' region of the projected Dicer cleavage site) of the sense strand, in at least one of which the deoxyribonucleotide base pairs with a cognate deoxyribonucleotide of the 5 'terminal region (specifically, the 5' region of the projected Dicer cleavage site) of the antisense strand. In additional embodiments, the sense strand is 29 base pairs long, and the antisense strand is 31 base pairs long with a 3 base overhang of 3 '. Such agents may possess between one and six deoxyribonucleotides in the 3 'terminal region (specifically, the 3' region of the projected Dicer cleavage site) of the sense strand, in at least one of which the deoxyribonucleotide base pairs with a cognate deoxyribonucleotide of the 5 'terminal region (specifically, the 5' region of the projected Dicer cleavage site) of the antisense strand. In additional embodiments, the sense strand is 30 base pairs long, and the antisense strand is 32 base pairs long and 2 base 3 'overhang. Such agents optionally possess between one and seven deoxyribonucleotides in the 3 'terminal region (specifically, the 3' region of the projected Dicer cleavage site) of the sense strand, in at least one of which the deoxyribonucleotide base pairs with a cognate deoxyribonucleotide of the 5 'terminal region (specifically, the 5' region of the projected Dicer cleavage site) of the antisense strand. In other embodiments, the sense strand is 31 base pairs long, and the antisense strand is 33 base pairs long with a 3 base overhang of 3 '. Such agents may possess between one and eight deoxyribonucleotides in the 3 'terminal region (specifically, the 3' region of the projected Dicer cleavage site) of the sense strand, in at least one of which the deoxyribonucleotide base pairs with a cognate deoxyribonucleotide of the 5 'terminal region (specifically, the 5' region of the projected Dicer cleavage site) of the antisense strand. In additional embodiments, the sense strand is 32 base pairs long, and the antisense strand is 34 base pairs long and 2 base 3 'overhang. Such agents optionally possess between one and nine deoxyribonucleotides in the 3 'terminal region (specifically, the 3 'region of the projected Dicer cleavage site) of the sense strand, in at least one of which the deoxyribonudeotide base pairs with a cognate deoxyribonucleotide of the 5' terminal region (specifically, the 5 'region of the projected dicer cleavage) of the antisense strand. In certain additional embodiments, the sense strand is 33 base pairs in length, and the antisense strand is 35 base pairs in length with a 2 base 3 'overhang. Such agents optionally possess between one and ten deoxyribonucleotides from the 3 'terminal region (specifically, the 3' region of the projected Dicer cleavage site) of the sense strand, in at least one of which the base pairs with a deoxyribonucleotide. cognate of the 5 'terminal region (specifically, the 5' region of the projected Dicer cleavage site) of the antisense strand. In still other embodiments, any of these DsNA agents have an asymmetric structure that further contains 2 deoxyribonucleotides at the 3 'end of the sense strand that can pair with cognate deoxyribonucleotides of the antisense strand.

Certain DsNA agent compositions containing two separate oligonucleotides can be joined by a third structure. The third structure will not block the activity of Dicer in the DsNA agent and will not interfere with the targeted destruction of the transcribed RNA from the target gene. In one embodiment, the third structure can be a chemical linking group. Many suitable chemical linking groups are known in the art and can be used. Alternatively, the third structure can be an oligonucleotide that joins the two oligonucleotides of the DsNA agent in such a way that a hairpin structure is produced by annealing the two oligonucleotides that make up the dsNA composition. The hairpin structure will not block the activity of Dicer in the DsNA agent and will not interfere with the targeted destruction of the target RNA.

In certain embodiments, the DsNA agent of the invention has various properties that enhance its dicer processing. According to such embodiments, the DsNA agent is of sufficient length for Dicer to process it to produce a siRNA and at least one of the following properties: (i) the DsNA agent is asymmetric, for example, it has a 3 'overhang in the sense strand and (ii) the DsNA agent has a modified 3 'end on the antisense strand to direct dicer binding and processing of the dsRNA region to an active siRNA. According to these embodiments, the longest strand in the DsNA agent comprises 25-43 nucleotides. In one embodiment, the sense strand comprises 25-39 nucleotides and the antisense strand comprises 26-43 nucleotides. The resulting dsNA may have an overhang at the 3 'end of the sense strand. The standout is 1-4 nucleotides, such as 2 nucleotides. The antisense or sense strand can also have a 5 'phosphate.

In certain embodiments, the DsNA agent of the invention has various properties that enhance its dicer processing. According to such embodiments, the DsNA agent is of sufficient length for Dicer to process it to produce a siRNA and at least one of the following properties: (i) the DsNA agent is asymmetric, for example, it has a 5 'overhang in the sense strand and (ii) the DsNA agent has a modified 3 'end on the antisense strand to direct dicer binding and processing of the dsRNA region to an active siRNA. According to these embodiments, the longest strand in the DsNA agent comprises 25-43 nucleotides. In one embodiment, the sense strand comprises 25-43 nucleotides and the antisense strand comprises 25-39 nucleotides. The resulting dsNA may have an overhang at the 3 'end of the sense strand. The standout is 1-4 nucleotides, such as 2 nucleotides. The antisense or sense strand can also have a 5 'phosphate.

In certain embodiments, the downstream strand of a DsiNA agent is modified for Dicer processing by suitable modifiers located at the 3 'end of the downstream strand, i.e., the DsiNA agent is designed to directly target binding and Dicer processing. Suitable modifiers include nucleotides such as deoxyribonucleotides, dideoxyribonucleotides, aciconucleotides, and the like, and hindered molecules, such as fluorescent molecules, and the like. Aciconucleotides substitute a 2-hydroxyethoxymethyl group for the 2'-deoxyribofuranosyl sugar normally present in dNMPs. Other nucleotide modifiers could include 3'-deoxyadenosine (cordycepin), 3'-azido-3'-deoxythymidine (AZT), 2 ', 3'-dideoxyinosine (ddI), 2', 3'-dideoxy-3'-thiacytidine (3TC), 2 ', 3'-didehydro-2', 3'-dideoxythymidine (d4T) and the nucleotides 3'-azido-3'-deoxythymidine monophosphate (AZT), 2 ', 3'-dideoxy-3' -thiacytidine (3TC) and 2 ', 3'-didehydro-2', 3'-dideoxythymidine (d4T). In one embodiment, deoxyribonucleotides are used as modifiers. When nucleotide modifiers are used, the 1-3 nucleotide modifiers, or 2 nucleotide modifiers are substituted for the ribonucleotides at the 3 'end of the sense strand. When sterically hindered molecules are used, they bind to the ribonucleotide at the 3 'end of the antisense strand. Therefore, the length of the strand does not change with the incorporation of the modifiers. In another embodiment, the invention contemplates substituting two DNA bases in the dsNA to direct the orientation of Dicer processing. In a further embodiment, two terminal DNA bases are located at the 3 'end of the sense strand instead of two ribonucleotides that form a double blunt end at the 5' end of the antisense strand and the 3 'end of the antisense strand. sense strand, and a two nucleotide RNA overhang is found at the 3 'end of the antisense strand. This is an asymmetric composition with DNA at the blunt end and RNA bases at the protruding end.

In certain other embodiments, the antisense strand of a DsiNA agent is modified for Dicer processing by suitable modifiers located at the 3 'end of the antisense strand, i.e., the DsiNA agent is designed to directly target the binding and processing of Dicer. Suitable modifiers include nucleotides such as deoxyribonucleotides, dideoxyribonucleotides, aciconucleotides, and the like, and hindered molecules, such as fluorescent molecules, and the like. Aciconucleotides substitute a 2-hydroxyethoxymethyl group for the 2'-deoxyribofuranosyl sugar normally present in dNMPs. Other modifiers nucleotides could include 3'-deoxyadenosine (cordycepin), 3'-azido-3'-deoxythymidine (AZT), 2 ', 3'-dideoxyinosine (ddl), 2', 3'-dideoxy-3'-thiacytidine (3TC) , 2 ', 3'-didehydro-2', 3'-dideoxythymidine (d4T) and the nucleotides 3'-azido-3'-deoxythymidine monophosphate (AZT), 2 ', 3'-dideoxy-3'-thiacytidine ( 3TC) and 2 ', 3'-didehydro-2', 3'-dideoxythymidine (d4T). In one embodiment, deoxyribonucleotides are used as modifiers. When nucleotide modifiers are used, 1 to 3 nucleotide modifiers, or 2 nucleotide modifiers are substituted for the ribonucleotides at the 3 'end of the antisense strand. When sterically hindered molecules are used, they bind to the ribonucleotide at the 3 'end of the antisense strand. Therefore, the length of the strand does not change with the incorporation of the modifiers. In another embodiment, the invention contemplates substituting two DNA bases in the dsNA to direct the orientation of Dicer processing. In another invention, two terminal DNA bases are located at the 3 'end of the antisense strand instead of two ribonucleotides that form a double blunt end at the 5' end of the sense strand and the 3 'end of the strand. antisense, and a two nucleotide RNA overhang is found at the 3 'end of the sense strand. This is also an asymmetric composition with DNA at the blunt end and RNA bases at the protruding end

The sense and antisense strands are collected under biological conditions, such as conditions found in the cytoplasm of a cell. Furthermore, a region of one of the sequences, particularly of the antisense strand, of the dsNA has a sequence length of at least 19 nucleotides, wherein these nucleotides are adjacent to the 3 'end of the antisense strand and are sufficiently complementary to a nucleotide target RNA sequence to direct RNA interference.

Furthermore, the structure of the DsiNA agent can be optimized to ensure that the oligonucleotide generated by Dicer cleavage is the most efficient in inhibiting gene expression. For example, in one embodiment of the invention, a 27-35 bp oligonucleotide is synthesized from the structure of the DsiNA agent where the anticipated 21 to 22 bp segment that will inhibit gene expression is at the 3 'end of the strand. antisense. Dicer will cleave the remaining bases located at the 5 'end of the antisense strand and they will be discarded. This cleaved portion can be homologous (ie, based on the sequence of the target sequence) or non-homologous and aggregate to extend the nucleic acid strand. As surprisingly identified in the present invention, such extension can be performed with base-paired DNA residues (double-stranded DNA: DNA extensions), resulting in extended DsiNA agents that have improved efficacy or duration of effect than corresponding DsiNA agents. double-stranded RNA: extended RNA.

US 2007/0265220 discloses that 27-mer DsNAs show improved stability in serum over comparable 21-mer siRNA compositions, even without chemical modification. Modifications of DsNA agents, such as the inclusion of 2'-O-methyl RNA in the antisense strand, in patterns as detailed in US 2007/0265220 and in the flash examples, when combined with the addition of a 5 'phosphate, can improve the stability of DsNA agents. The addition of 5'-phosphate to all synthetic RNA double strands can be an inexpensive and physiological method of conferring some limited degree of nuclease stability.

The chemical modification patterns of the DsNA agents of the present invention are designed to improve the efficacy of such agents. Consequently, such modifications are designed to avoid reducing the potency of DsNA agents; to avoid interfering with Dicer processing of DsNA agents; to improve the stability in biological fluids (reduce nuclease sensitivity) of DsNA agents; or to block or evade detection by the innate immune system. Such modifications are also designed to avoid being toxic and to avoid increasing the cost or affecting the ease of manufacture of the instant DsNA agents of the invention.

SiRNA processing RNA

The siRNA-mediated IRNA process is triggered by the presence of long dsRNA molecules in a cell. During the IRNA initiation step, Dicer, a conserved family of enzymes containing two RNase III-like domains (Bernstein et al. 2001; Elbashir et al. 2001). SiRNAs are characterized by a double region of 19-21 base pairs and 2 3 'nucleotide overhangs on each strand. During the IRNA effector step, the siRNAs are incorporated into a multimeric protein complex called the RNA-induced silencing complex (RISC), where they serve as guides to select fully complementary mRNA substrates for degradation. Degradation is initiated by endonucleolytic cleavage of mRNA within the region complementary to siRNA. More precisely, the mRNA is cleaved at a position 10 nucleotides from the 5 'end of the leader siRNA (Elbashir et al.

2001 Genes and Dev. 15: 188-200; Nykanen et al. 2001 Cell 107: 309-321; Martínez et al. 2002 Cell 110: 563-574). An endonuclease responsible for this cleavage was identified as Argonaute2 (Aug2; Liu et al. Science, 305: 143741).

MiRNA

Most human miRNAs (70%), and presumably most miRNAs from other mammals, are transcribed from introns and / or exons, and approximately 30% are found in intergenic regions (Rodriguez et al., Genome Res. 2004, 14 (10A), 1902-1910). In humans and animals, miRNAs are generally transcribed by RNA polymerase II (Farh et al. Science 2005, 310 (5755), 1817-1821), and in some cases by pol III (Borchert et al. Nat. Struct. Mol. Biol 2006, 13 (12), 1097-1101). Certain virus-encoded mRNAs are transcribed by RNA polymerase III (Pfeffer et al. Nat. Methods 2005, 2 (4), 269-276; Andersson et al. J. Virol. 2005, 79 (15), 9556-9565) , and some are in the open reading frame of the viral gene (Pfeffer et al. Nat. Methods 2005, 2 (4), 269-276; Samols et al. J. Virol. 2005, 79 (14), 9301-9305) . MiRNA transcription results in the production of large monocistronic, bicistronic, or polycistronic primary transcripts (mi-pri-mRNA). A single pri-miRNA can range from about 200 nucleotides (nt) to several kilobases (kb) in length and have 5'7-methylguanosine (m7) protectors and a poly (A) 3 'tail. Characteristically, mature miRNA sequences are located in regions of imperfect stem-loop sequences within pri-miRNAs (Cullen, Mol. Cell. 2004, 16 (6), 861 865).

The first step of miRNA maturation in the nucleus is the recognition and cleavage of pri-miRNAs by the RNase III Drosha-DGCR8 nuclear microprocessor complex, which releases a ~ 70 nt hairpin-containing precursor molecule called pre-miRNA. , with a monophosphate at the 5 'terminal and a 2 nt overhang with a hydroxyl group at the 3' terminal (Cai et al. RNA 2004, 10 (12), 1957-1966; Lee et al. Nature 2003, 425 ( 6956), 415-419; Kim Nat. Rev. Mol. Cell. Biol. 2005, 6 (5), 376-385). The next step is the nuclear transport of the pre-miRNAs out of the nucleus into the cytoplasm by Exportin-5, a carrier protein (Yi et al. Genes. Dev. 2003, 17 (24), 3011-3016, Bohnsack et al. RNA 2004, 10 (2), 185-191). Exportin-5 and the GTP-bound form of its Ran cofactor together recognize and bind the 2-nucleotide 3 'overhang and adjacent stem that are characteristic of pre-miRNA (Basyuk et al. Nucl. Acids Res. 2003, 31 (22 ), 6593-6597, Zamore Mol. Cell. 2001, 8 (6), 1158-1160). In the cytoplasm, GTP hydrolysis results in the release of pre-miRNA, which is then processed by a cellular endonuclease III enzyme Dicer (Bohnsack et al.). Dicer was first recognized for its role in the generation of siRNAs that mediate RNA interference (RNAi). Dicer acts in concert with its cofactors TRBP (Trans activation region-binding protein; Chendrimata et al. Nature 2005, 436 (7051), 740-744) and PACT (inducible double-stranded RNA-dependent protein kinase activator protein kinase activator; interferon; Lee et al. Em BÓ J. 2006, 25 (3), 522-532). These enzymes bind at the 3 '2 nucleotide overhang at the base of the pre-miRNA hairpin and remove the terminal loop, producing a miRNA double intermediate of approximately 21 nt with both ends with 5' monophosphates, 3 '2 overhangs of nucleotides and 3 'hydroxyl groups. The guide strand of miRNA, whose 5 'terminal is energetically less stable, is selected for incorporation into the RISC (RNA-induced silencing complex), while the' passenger 'strand is released and degraded (Maniataki et al. Genes. Dev 2005, 19 (24), 2979-2990; Hammond et al. Nature 2000, 404 (6775), 293-296). The composition of RISC remains incomplete, but a key component is a member of the Argonaute (Ago) family of proteins (Maniataki et al .; Meister et al. Mol. Cell. 2004, 15 (2), 185-197).

The mature miRNA then directs the RISC to complementary mRNA species. If the target mRNA has perfect complementarity with the miRNA-armed RISC, the mRNA will cleave and degrade (Zeng et al. Proc. Natl. Acad. Sci. USA 2003, 100 (17), 9779-9784; Hutvagner et al. Science 2002, 297 (55 89), 2056-2060). But as the most common situation in mammalian cells, miRNAs target mRNAs with imperfect complementarity and suppress their translation, resulting in reduced expression of the corresponding proteins (Yektaetal. Science 2004, 304 (5670), 594 -596; Olsen et al. Dev. Biol. 1999, 216 (2), 671-680). The 5 'region of miRNA, especially the match between miRNA and the target sequence at nucleotides 2-7 or 8 of miRNA (starting from position 1 at the 5' terminal), which is called the seed region, is essentially important for the selection for miRNA, and this seed matching has also become a widely used key principle in computer prediction of miRNA target (Lewis et al. Cell 2005, 120 (1), 15-20; Brennecke et al. PLoS Biol.

2005, 3 (3), e85). The miRNA regulation of miRNA-mRNA doubles is mediated primarily through multiple complementary sites in the 3 'UTRs, but there are many exceptions. MiRNAs can also bind to the 5 'UTR and / or the coding region of mRNAs, resulting in a similar result (Lytle et al. Proc. Natl. Acad. Sci. USA 2007, 104 (23), 9667-9672) .

RNase H

RNase H is a ribonuclease that cleaves the RNA 3'-O-P bond at a DNA / RNA double to produce 3'-hydroxyl and 5'-phosphate terminated products. RNase H is a non-specific endonuclease and catalyzes RNA cleavage through a hydrolytic mechanism, aided by a divalent metal ion bound to the enzyme. Members of the RNase H family are found in almost all organisms, from archaea and prokaryotes to eukaryotes. During DNA replication, RNase H is believed to cleave the RNA primers responsible for the generation of Okazaki fragment primers; however, the RNase H enzyme can be used more generally to cleave any hybrid DNA: RNA sequence of sufficient length (eg, typically hybrid DNA: RNA sequences of 4 or more base pairs in length in mammals).

MicroRNA and MicroRNA-like therapies

MicroRNAs (miRNAs) have been reported to act by binding to the 3 'UTR of a template transcript, thus inhibiting the expression of a protein encoded by template transcription by a related but distinct mechanism from classical RNA interference. Specifically, miRNAs are believed to work by reducing translation of the target transcript, rather than decreasing its stability. Naturally occurring miRNAs are typically about 22 nt in length. They are believed to be derived from larger precursors known as small temporary RNAs (tRNAs) of approximately 70 nt in length.

Interfering agents such as RNAsis, and more specifically such as mRNA, that bind within the 3 'UTR (or elsewhere in a target transcript, for example, in repeating elements of, for example, Notch and / or Notch family transcripts) and inhibit translation can tolerate a greater number of mismatches in the siRNA / template double (miRNA / template), and particularly can tolerate mismatches within the central region of the double. Indeed, there is evidence that some mismatches may be desirable or required, as naturally-occurring tRNAs frequently exhibit such mismatches, as do miRNAs that have been shown to inhibit translation in vitro (Zeng et al., Molecular Cell , 9: 1-20) For example, when hybridized to the target transcript, such mRNAs frequently include two stretches of perfect complementarity separated by a mismatched region. Such a hybridized complex commonly includes two regions of perfect complementarity (double portions) comprising nucleotide pairs, and at least a single mismatched base pair, which can be, for example, G: A, G: U, G: G, A: A, A: C, U: U, U: C, C: C, G: -, A: -, U: -, C: -, etc. Such mismatched nucleotides, especially if they are present in tandem (eg, a mismatched two, three, or four nucleotide area) can form a bulge that separates the double portions found on either flank of the bulge. A variety of structures is possible. For example, miRNA can include multiple areas of non-identity (mismatch). Areas of non-identity (mismatch) need not be symmetric in the sense that both the target and the miRNA include unpaired nucleotides. For example, structures in which only one strand includes unpaired nucleotides have been described (Zeng et al.). Typically, stretches of perfect complementarity within a miRNA agent are at least 5 nucleotides in length, eg, 6, 7 or more nucleotides in length, while regions of mismatch may be, eg, 1,2, 3 or 4 nucleotides in length.

In general, any particular siRNA could function to inhibit gene expression both through (i) the "classical" siRNA pathway, in which the stability of a target transcript is reduced and in which perfect complementarity between the siRNA and the target, and also by (ii) the "alternative" pathway (generally characterized as the miRNA pathway in animals), in which translation of a target transcript is inhibited. In general, transcripts driven by a particular siRNA through mechanism (i) would be distinct from transcription driven through mechanism (ii), although it is possible that a single transcript may contain regions that can serve as targets for classical pathways. and alternatives. (Note that the terms "classical" and "alternative" are used simply for convenience and are generally believed to reflect the historical moment of discovery of such mechanisms in animal cells, but do not reflect the importance, effectiveness, or other characteristics of any of the mechanisms). A common goal of siRNA design has been to target a single transcript with high specificity, via mechanism (i), while minimizing off-target effects, including potentially elicited effects via mechanism (ii). However, one of the objectives of the present invention is to provide RNA interference agents that possess mismatched residues by design, either in order to mimic the activities of natural miRNAs, or to create agents directed against target RNAs. for which there is no corresponding miRNA. currently known, with the inhibitory and / or therapeutic efficacy / potencies of such siDARN agents containing tolerant mismatches (eg, DRNAsimm agents) and, indeed, possibly potentiated portal mismatches.

The tolerance of miRNA agents for mismatched nucleotides (and indeed the existence and natural use of mechanism (ii) above in the cell) suggests the use of miRNA in ways that are advantageous and / or expand over the "classical" use of perfectly complementary siRNAs acting through mechanism (i). Because miRNAs are naturally occurring molecules, there are likely distinct advantages to applying miRNAs as therapeutic agents. MiRNAs benefit from hundreds of millions of years of evolutionary "tuning" of their function. Therefore, sequence-specific "off-target" effects should not be a problem with natural miRNAs, nor, by extension, with certain synthetic siRNAs of the invention (eg, simmDRNAs) designed to mimic miRNAs. natural. Furthermore, miRNAs have evolved to modulate the expression of clusters of genes, driving up and down regulation (in certain cases, performing both functions simultaneously within a cell with a single miRNA acting promiscuously on multiple target RNAs) , with the result that complex cell functions can be precisely modulated. Such replacement of natural mRNAs may involve the introduction of synthetic mRNAs or mRNA mimetics (e.g., certain DRNAsimms) into diseased tissues in an effort to restore normal proliferation, apoptosis, the cell cycle, and other cellular functions that have been affected by down-regulation of one or more mRNAs. In certain cases, reactivation of these miRNA-regulated pathways has produced a significant therapeutic response (for example, in a study on cardiac hypertrophy, overexpression of miR-133 by adenovirus-mediated administration of a miRNA expression cassette in hypertrophy-protected animals agonist-induced cardiac arrest, whereas reciprocal reduction of miR-133 in wild-type mice by antagonists caused an increase in hypertrophic markers (Care et al. Nat. Med. 13: 613-618)).

To date, more than 600 encoded miRNAs have been identified within the human genome, with such miRNAs expressed and processed by a combination of proteins in the nucleus and cytoplasm. MiRNAs are highly conserved among vertebrates and comprise approximately 2% of all mammalian genes. Since each miRNA appears to regulate the expression of multiple, for example, two, three, four, five, six, seven, eight, nine, or even tens to hundreds of different genes, miRNAs can function as "master switches", regulating and coordinating multiple cellular pathways and processes. By coordinating the expression of multiple genes, miRNAs play key roles in embryonic development, immunity, inflammation, as well as cell growth and proliferation.

Functional and expression studies suggest that altered expression of specific miRNAs is critical for a variety of human diseases. Increasing evidence indicates that the introduction of specific miRNAs into Disease cells and tissues can induce favorable therapeutic responses (Pappas et al., Expert Opin Ther Targets. 12: 115-27). The promise of miRNA therapy is perhaps greatest in cancer due to the apparent role of certain miRNAs as tumor suppressors. The rationale for miRNA-based therapeutics for, for example, cancer is supported, at least in part, by the following observations:

(1) miRNAs are frequently poorly regulated and expressed at altered levels in diseased tissues compared to normal tissues. Several studies have shown altered levels of miRNA in cancerous tissues relative to their corresponding normal tissues. Often times, altered expression is the consequence of genetic mutations that lead to increased or decreased expression of particular mRNAs. Diseases possessing unique miRNA expression signatures can be exploited as diagnostic and prognostic markers, and can be targeted with the DRNAs (eg, DRNAsimm) agents of the invention.

(2) Poorly regulated miRNAs contribute to cancer development by acting as oncogenes or tumor suppressors. Oncogenes are defined as genes whose overexpression or inappropriate activation leads to oncogenesis. Tumor suppressors are genes necessary to prevent cells from being cancerous; Down regulation or inactivation of tumor suppressors is a common inducer of cancer. Both types of genes represent preferred drug targets, since that target can act specifically on the molecular basis of a particular cancer. Examples of oncogenic mRNAs are miR-155 and miR-17-92; let-7 is an example of a tumor suppressor miRNA.

(3) Administration of miRNA induces a therapeutic response by blocking or reducing tumor growth in preclinical studies in animals. The scientific literature provides proof-of-concept studies showing that restoring miRNA function can prevent or reduce cancer cell growth in vitro and in animal models as well. A well characterized example is the antitumor activity of let-7 in models for breast and lung cancer. DRNAs (e.g., DRNAsimms) of the invention that are designed to mimic let-7 can be used to target such cancers, and it is also possible to use the DRNAs design parameters described herein to generate new DRNAs (e.g., DRNAsimm) directed against target RNAs for which counterpart natural miRNAs are not known (e.g., repeats within Notch or other transcripts), to detect therapeutic lead compounds, e.g., agents that are capable of reducing tumor burden in animal models preclinical.

(4) A given miRNA controls multiple cellular pathways and therefore may have superior therapeutic activity. Depending on their biology, miRNAs can function as genome "master switches", regulating multiple gene products and coordinating multiple pathways. Genes regulated by miRNA include genes encoding oncogenes and conventional tumor suppressors, many of which are individually targeted as drug targets by the pharmaceutical industry. Therefore, miRNA therapy could possess superior activity to siRNAs and other forms of major compounds by targeting multiple diseases and / or cancer-associated genes. Given the observation that miRNA misregulation is often an early event in the tumorigenesis process, miRNA therapy, which replaces missing miRNAs, may be the most appropriate therapy.

(5) miRNAs are natural molecules and therefore less likely to induce non-specific side effects. Millions of years of evolution helped develop the mRNA regulatory network, fine-tuning the interaction of miRNA with target messenger RNAs. Therefore, miRNAs and miRNA derivatives (eg, siRNAs designed to mimic natural miRNAs) will have little or no sequence-specific "off-target" effect when applied in the proper context.

The physical characteristics of mRNAs and mRNAs are similar. Accordingly, technologies that are effective in delivering RNAses (eg, DRNAses of the invention) are also effective in delivering synthetic mRNAs (eg, certain DRNAsimms of the invention).

Conjugation and delivery of dsNA agents

In certain examples, the present disclosure refers to a method of treating a subject who has or is at risk of developing a disease or disorder. In such examples, the dsNA can act as a new therapeutic agent to control the disease or disorder. The method comprises administering a pharmaceutical composition of the invention to the patient (eg, human), so as to reduce the expression, level and / or activity of a target RNA. The expression, level and / or activity of a polypeptide encoded by the target RNA could also be reduced by a DsNA of the present invention.

In treating a disease or disorder, siDNA may come into contact with cells or tissue that exhibit or are associated with a disease or disorder. For example, DsNA substantially identical to all or part of a target RNA sequence can contact or be introduced into a diseased, disease-associated, or infected cell, in vivo or in vitro. Similarly, DsNA substantially identical to all or part of a target RNA sequence can be administered directly to a subject who has or is at risk of developing a disease or disorder.

The therapeutic use of the DsNA agents of the present invention may involve the use of DsNA agent formulations comprising multiple different DsNA agent sequences. For example, two or more, three or more, four or more, five or more, etc. of the currently disclosed agents can be combined to produce a formulation that, for example, targets multiple different regions of one or more target RNA (s). A DsNA agent of the present invention can also be constructed such that any of the strands of the DsNA agent independently target two or more regions of a target RNA. The use of multifunctional DsNA molecules that target more than one region of a target nucleic acid molecule is expected to provide potent inhibition of RNA levels and expression. For example, a single multifunctional DsNA construct of the invention can target both conserved and variable regions of a target nucleic acid molecule, thus allowing downregulation or inhibition of, for example, different strain variants of a virus, or splice variants encoded by a single target gene.

A DsNA agent of the invention is conjugated to another structural unit, for example, a non-nucleic acid structural unit such as a peptide, or an organic compound, for example, a dye, cholesterol or the like. Modifying DsNA agents in this way can enhance cellular uptake or enhance cell targeting activities of the resulting DsNA agent derivative compared to the corresponding unconjugated DsNA agent, they are useful for screening the DsNA agent derivative. in the cell or improve the stability of the derived DsNA agent compared to the corresponding unconjugated DsNA agent. The dsNAs of the initiation are conjugated to GalNAc, folate, cholesterol, mannose-6-phosphate. In one embodiment, a single dsNA of the invention comprises more than one GalNAc molecule and more than one folate molecule and more than one cholesterol molecule and more than one mannose-6-phosphate molecule or any combination of all.

Not only can a GalNAc ligand bind to the nucleobase of a nucleoside monomer (i.e. the C5 position of thymidine as shown in Example 6), but it can also bind to the ribose sugar via 2'-OH ( or 3'-OH) with a linker. The 2'-OH as a conjugation site is particularly useful in the case of tetraloop siDNAs because the 2'-OH of the four nucleotides in the loop are exposed to the solvent and are not involved in hydrogen bonding and base stacking. which is necessary to form the stable loop based on its crystal structure.

Various linkers can be used to conjugate ligands with dsNA agents. Linkers commonly used in the art can be used to conjugate ligands to dsNA molecules. Some of those linkers are exemplified in Tables 4 and 5.

In particular, dsNA agents as now claimed using an acetal linker demonstrated in vitro and in vivo cell induction and killing potency comparable to a click linker. The acetal chemistry used to install the 2'-OH connector is much gentler compared to traditional alkylation conditions; therefore, allow selective conjugation to the 2 'position. This will avoid tedious separation of the mixture of 2 'and 3' isomers and will significantly improve performance.

In vitro IRNA assay to assess siDNA activity

An in vitro assay that recapitulates RNAi in a cell-free system can optionally be used to evaluate dsNA constructs. For example, such an assay comprises a system described by Tuschl et al., 1999, Genes and Development, 13, 3191-3197 and Zamore et al., 2000, Cell, 101, 25-33, adapted for use with dsNA agents directed against target RNAs and commercially available kits, including Turbo Dicer (Genlantis). A Drosophila extract derived from syncytial blastoderm is used to reconstitute RNAi activity in vitro. Target RNA is generated through in vitro transcription from an appropriate plasmid using T7 RNA polymerase or by chemical synthesis. Sense and antisense dsNA strands (eg, 20 pM each) are fused by incubation in buffer (such as 100 mM potassium acetate, 30 mM HEpES-KOH, pH 7.4, 2 mM magnesium acetate) for 1 minute at 90 ° C followed by 1 hour at 37 ° C, then diluted in lysis buffer (eg, 100mM potassium acetate, 30mM HEPES-KOH pH 7.4, 2mM magnesium acetate). Melting can be monitored by gel electrophoresis on an agarose gel in TBE buffer and stained with ethidium bromide. Drosophila lysate is prepared using zero to two hour old embryos of Oregon R flies collected on yeast molasses agar that are dechorionized and lysed. The lysate is centrifuged and the supernatant is isolated. The assay comprises a reaction mixture containing 50% lysate [vol / vol], RNA (final concentration 10-50 pM) and 10% [vol / vol] lysis buffer containing dsNA (final concentration 10 nM). The reaction mix also contains 10 mM creatine phosphate, 10 ug / ml creatine phosphokinase, 100 um GTP, 100 uM UTP, 100 uM CTP, 500 uM ATP, 5 mM DTT, 0.1 U / uL RNasin (Promega) and 100 uM of each amino acid. The final concentration of potassium acetate is adjusted to 100 mM. Reactions are pre-assembled on ice and pre-incubated at 25 ° C for 10 minutes before adding RNA, then incubated at 25 ° C for an additional 60 minutes. Reactions are quenched with 4 volumes of 1.25 * passive lysis regulator (Promega). Cleavage of the target RNA is analyzed by RT-PCR analysis or other methods known in the art and compared to control reactions in which DRNAs are omitted from the reaction.

Alternatively, internally labeled target RNA for the assay is prepared by in vitro transcription in the presence of [alpha-32P] CTP, passed over a Sephadex G50 column by spin chromatography, and used as target RNA without further purification. Optionally, the target RNA is labeled at the 5'-32P end using the T4 polynucleotide kinase enzyme. The assays are performed as described above and the target RNA and specific RNA cleavage products generated by RNAi are visualized on a gel autoradiograph. Percent cleavage is determined by PHOSPHOR IMAGER® quantification (autoradiography) of bands representing intact control RNA or RNA from control reactions without dsNA and the cleavage products generated by the assay.

The ability of a double-stranded nucleic acid (dsNA) molecule composition of the invention to inhibit protein synthesis can be measured using techniques that are known in the art, for example, by detecting an inhibition in gene transcription or protein synthesis. . The level or activity of a target RNA can be determined by any suitable method now known in the art or later developed. It can be appreciated that the method used to measure a target RNA and / or the expression of a target RNA may depend on the nature of the target RNA. For example, if the target RNA encodes a protein, the term "expression" can refer to a protein or to the RNA / transcript derived from the target RNA. In such cases, the expression of a target RNA can be determined by measuring the amount of RNA corresponding to the target RNA or by measuring the amount of that protein. Protein can be measured in protein assays, such as by staining or immunoblotting or, if the protein catalyzes a measurable reaction, by measuring reaction rates. All of these methods are known in the art and can be used. When target RNA levels are to be measured, any art recognized method for detecting RNA levels can be used (eg, RT-PCR, Northern blot, etc.). By targeting viral RNAs with the dsNA agents of the present invention, it is also anticipated that measuring the efficacy of a dsNA agent in reducing the levels of a target virus in a subject, tissue, cells, in vitro or in In vivo, or in cell extracts can also be used to determine the degree of reduction in target viral RNA levels. Any of the above measurements can be performed on cells, cell extracts, tissues, tissue extracts, or any other suitable source material.

Nuclease resistance test

The nuclease resistance of the dsNA molecules is analyzed to a 0.1 pM oligonucleotide using 5 x 10-3 units / ml snake venom phosphodiesterase (US Biochemical Corp.) in a 50 mM Tris-HCl buffer, pH 8.5 , 72 mM CaCl2, and 14 mM MgCh in a final volume of 50 µl. For the Bal31 nuclease assays, the nuclease stabilities of the dsNA molecules are analyzed at 0.1 pM oligonucleotide using 2 * 10-3 units / ml of Bal31 nuclease (Boehringer Mannheim) in a 20 mM Tris-HCl buffer, pH 7.5 , 10 mM NaCl, 5 mM CaCl2, 5 mM MgCh, 5 mM EDTA (final volume = 100 µl). For both nuclease assays, 5 µl reaction aliquots are removed at the indicated times, added to an equal volume of 80% formamide containing bromophenol blue and xylene cyanol gel screening dyes, and then heated for 2 minutes at 95 ° C. Aliquots are stored at -20 ° C until analysis by denaturing polyacrylamide electrophoresis. Quantification is performed on a Molecular Dynamics PhosphorImager (Molecular Dynamics, Sunnyvale, CA). The same protocol can be repeated with lysosomal extracts and endosomal extracts to mimic the nuclease resistance of dsNA molecules against lysosomal environments.

Cell uptake assay

Cell uptake experiments were carried out following the protocols described in Ts'o et al., Cell type-specific enhancement and cell-specific uptake ligand of oligodeoxynucleoside-methylphosphonates covalently linked with a neoglycopeptide, YEE (ah-GalNAc) s, Bioconjugate Chem. 1995, 6, 695-701.

Nucleic Acid, Vector, and Host Cell Introduction Methods

The DsNA agents of the invention can be introduced directly into a cell (ie, intracellularly); or it is introduced extracellularly into a cavity, interstitial space, in the circulation of an organism, it is introduced orally, or it can be introduced by bathing a cell or organism in a solution containing the nucleic acid. The vascular or extravascular circulation, the blood or lymphatic system, and the cerebrospinal fluid are sites where nucleic acid can be introduced.

The DsNA agents of the invention can be introduced using nucleic acid delivery methods known in the art, including injection of a solution containing the nucleic acid, bombardment by nucleic acid-coated particles, soaking the cell or organism in a nucleic acid solution or electroporation of cell membranes in the presence of nucleic acid. Other methods known in the art can be used to introduce nucleic acids into cells, such as lipid-mediated vehicle transport, chemical-mediated transport, and cationic transfection of liposomes such as calcium phosphate and the like. The nucleic acid can be introduced together with other components that perform one or more of the following activities: enhance the uptake of nucleic acid by the cell, or otherwise enhance the inhibition of target RNA.

A cell having a target RNA can be germ or somatic, totipotent or pluripotent, divided or non-dividing, parenchyma or epithelium, immortalized or transformed, or the like. The cell can be a stem cell or a differentiated cell. Cell types that differentiate include adipocytes, fibroblasts, myocytes, cardiomyocytes, endothelium, neurons, glia, blood cells, megakaryocytes, lymphocytes, macrophages, neutrophils, eosinophils, basophils, mast cells, leukocytes, granulocytes, keratinocytes, keratinocytes, chondrocytes, osteoblasts, osteoclasts, hepatocytes, and endocrine or exocrine gland cells.

Depending on the particular target RNA sequence and the dose of DsNA agent material delivered, this process can provide a partial or complete loss of function for the target RNA. An example is a reduction or loss of RNA levels or expression (either expression of RNA or expression of encoded polypeptides) by at least 50%, 60%, 70%, 80%, 90%, 95% or 99% or more than target cells. Inhibition of target RNA levels or expression refers to the absence (or observable decrease) in the level of protein encoded by RNA or RNA. Specificity refers to the ability to inhibit target RNA without overt effects on other genes in the cell. The consequences of inhibition can be confirmed by examining the external properties of the cell or organism (as presented below in the examples) or by biochemical techniques such as RNA solution hybridization, nuclease protection, hybridization Northern, reverse transcription, gene expression monitoring with a microarray, antibody binding, enzyme-linked immunosorbent assay (ELISA), Western blot, radioimmunoassay (RIA), other immunoassays, and fluorescence-activated cell analysis (FACS) . The inhibition of the target RNA sequence (s) by the DsNA agents of the invention can also be measured as a function of the effect of the administration of said DsNA agents on measurable phenotypes such as tumor size for treatment cancer, viral load / titer for viral infectious diseases, etc., in vivo or in vitro. For viral infectious diseases, reductions in viral load or titer can include reductions of, for example, 50%, 60%, 70%, 80%, 90%, 95%, or 99% or more, and are often measured in logarithmic terms, for example, a 10-fold, 100-fold, 1000-fold, 105-fold, 106-fold, 107-fold reduction in viral load or titer can be achieved by administering the DsNA agents of the invention to cells, a tissue or a subject.

For RNA-mediated inhibition in a whole cell or organism, the expression of a reporter or drug resistance gene whose protein product is easily analyzed can be measured. Such reporter genes include acetohydroxy acid synthase (AHAS), alkaline phosphatase (AP), beta galactosidase (LacZ), beta glucuronidase (GUS), chloramphenicol acetyltransferase (CAT), green fluorescent protein (GFP), horseradish peroxidase (HRP), luciferase (Luc), nopaline synthase (NOS), octopine synthase (OCS) and their derivatives. Multiple selectable markers are available that confer resistance to ampicillin, bleomycin, chloramphenicol, gentamicin, hygromycin, kanamycin, lincomycin, methotrexate, phosphinothricin, puromycin, and tetracycline. Depending on the assay, quantification of the amount of gene expression makes it possible to determine a degree of inhibition greater than 10%, 33%, 50%, 90%, 95% or 99% compared to a cell not treated according to the present invention.

Lower doses of injected material and longer times after administration of the RNA silencing agent can result in inhibition in a smaller fraction of cells (e.g., at least 10%, 20%, 50%, 75%, 90% or 95% specific cells). Quantification of gene expression in a cell can show similar amounts of inhibition at the level of target RNA accumulation or target protein translation. As an example, the efficiency of the inhibition can be determined by evaluating the amount of gene product in the cell; RNA can be detected with a hybridization probe having a nucleotide sequence outside of the region used for the inhibitory DsNA, or the translated polypeptide can be detected with an antibody raised against the polypeptide sequence of that region.

The DsNA agent can be entered in an amount that allows delivery of at least one copy per cell. Higher doses (eg, at least 5, 10, 100, 500, or 1000 copies per cell) of material can produce more effective inhibition; Lower doses can also be useful for specific applications.

RNA interference based therapy

As is known, RNAi methods are applicable to a wide variety of genes in a wide variety of organisms and the compositions and methods described can be used in each of these contexts. Examples of genes that can be targeted by the disclosed compositions and methods include endogenous genes that are native to the cell or genes that are not normally native to the cell. Without limitation, these genes include oncogenes, cytokine genes, idiotypic protein (Id) genes, prion genes, genes expressing molecules that induce angiogenesis, genes for adhesion molecules, cell surface receptors, proteins involved in metastasis, proteases, apoptosis genes, cell cycle control genes, genes expressing EGF and the EGF receptor, multidrug resistance genes, such as the MDR1 gene.

More specifically, a target mRNA of the invention can specify the amino acid sequence of a cellular protein (eg, a nuclear, cytoplasmic, transmembrane, or membrane-associated protein). In another embodiment, the target mRNA of the invention may specify the amino acid sequence of an extracellular protein (eg, an extracellular matrix protein or secreted protein). As used herein, the term "specifies the amino acid sequence" of a protein means that the mRNA sequence is translated into the amino acid sequence according to the rules of the genetic code. The following classes of proteins are listed for illustrative purposes: developmental proteins (e.g., adhesion molecules, cyclin kinase inhibitors, members of the Wnt family, members of the Pax family, members of the winged helix family, members from the Hox family, cytokines / lymphokines and their receptors, growth / differentiation factors and their receptors, neurotransmitters and their receptors); Oncogene-encoded proteins (e.g. ABLI, BCLI, BCL2, BCL6, CBFA2, CBL, CSFIR, ERBA, ERBB, EBRB2, ETSI, ETSI, ETV6, FGR, FOS, FYN, HCR, HRAS, JUN, KRAS, LCK, LYN, MDM2, MLL, MYB, MYC, MYCLI, MYCN, NRAS, PIM I, PML, RET, SRC, TALI, TCL3 and YES); tumor suppressor proteins (eg, APC, BRCA1, BRCA2, MADH4, MCC, NF I, NF2, RB I, TP53, and WTI); and enzymes (e.g., ACC synthases and oxidases, ACP desaturases and hydroxylases, ADP-glucose pyrophorlases, ATPases, alcohol dehydrogenases, amylases, amyloglucosidases, catalases, cellulases, chalcone synthases, chitinases, cyclooxygenases, decarboxylases, dextriinases, and RNA polyserases Galactosidases, glucanases, glucose oxidases, granule-bound starch synthases, GTPases, helicases, hernicellulases, integrases, inulinases, invertases, isomerases, kinases, lactases, lipases, lipoxygenases, lysozymes, nopaline synthases, octopininases, peroctinases synthases, octopininases, peroctinases sintastas, octopininastasas, octopinastasas, octopininasas, octopinastasas, octopinastasas, octopininasas phospholipases, phosphorylases, phytases, plant growth regulatory synthases, polygalacturonases, proteinases and peptidases, pullanases, recombinases, reverse transcriptases, RUBISCO, topoisomerases and xylanases).

In one aspect, the target mRNA molecule of the invention specifies the amino acid sequence of a protein associated with a pathological condition. For example, the protein may be a pathogen-associated protein (e.g., a viral protein involved in host immunosuppression, pathogen replication, pathogen transmission, or maintenance of infection), or a host protein that facilitates entry of the pathogen into the host, metabolism of the drug by the pathogen or host, replication or integration of the pathogen genome, establishment or spread of infection in the host, or assembly of the next generation of pathogens. Pathogens include RNA viruses such as flaviviruses, picornaviruses, rhabdoviruses, filoviruses, retroviruses, including lentiviruses, or DNA viruses such as adenovirus, smallpox virus, herpes virus, cytomegalovirus, hepadnavirus, or others. Additional pathogens include bacteria, fungi, helminths, schistosomes, and trypanosomes. Other types of pathogens can include transposable elements from mammals. Alternatively, the protein can be a tumor associated protein or an autoimmune disease associated protein.

The target gene can be derived from or contained in any organism. The organism can be a plant, animal, protozoan, bacterium, virus or fungus. See, for example, US Patent No. 6,506.55.

The stability profile, pharamacokinetics, cell targeting ability, and biodistribution characteristics of the dsNA molecules are evaluated by suitable methods known in the art including, but not limited to, methods based on the protocols taught by Rice et al. to the. (In vivo targeting function of N-linked oligosaccharides with terminating galactose and N-acetylgalactosamine residues, Chiu MH, Tamura T, Wadhwa MS, Rice KG, J Biol Chem. 1994 Jun 10; 269 (23): 16195-202). 125I (sodium iodide), Sephadex G-10, chloramine T, sodium metabisulfite, heparin, BSA, HEPES, collagenase, ketamine hydrochloride, xylazine hydrochloride, and ICR mice are all obtained from commercial suppliers.

Radiolabeling of dsNA molecules

The dsNA molecules of the invention conjugated to ligands such as GalNac, cholesterol, folate or mannose-6-phosphate are labeled with 125I using the procedures described by Rice et al. Radioiodinated dsNAs are chromatographed on a SephadexG-10 column (0.8 x 25 cm) and eluted with 0.15 M sodium chloride (pH 7.0) and collected in 0.5 ml fractions. The purity of each iodinated dsNA comprising, for example, a GalNac ligand is analyzed by detecting 1 pl (2 nCi) at the origin of a thin layer chromatography (TLC) plate developed with ethyl acetate: acetic acid: pyridine: water. in a ratio optimized for each dsNA. Quantitative densitometry is performed on a Phosphor Imager (Molecular Dynamics, Sunnyvale, CA) after a 12 hour automated radiographic exposure at room temperature. ImageQuant software (Molecular Dynamics, Sunnyvale, CA) is used to integrate the densitometry trace and establish> 95% purity for each iodinated oligonucleotide.

In vitro stability test for dsNA molecules

Each radioiodinated oligosaccharide (1.5 µl, 75 nCi) is added to 100 µl of heparinized whole mouse blood and incubated at 37 ° C. Time points (10 µl) are removed at 10, 20 and 30 min and 1, 2, 3, 4, 5 and 6 hr, and analyzed using TLC and quantitative autoradiography as described above.

Pharmacokinetic analysis

The pharmacokinetics of the dsNAs are performed in three to four mice. Mice are anesthetized and double cannulation of the jugular vein is performed. GalNAc ligand dsNAs are dosed into the left vein while blood time points are taken at 1, 3, 6, 10, 15, 20, 30, 40 and 60 min from the right vein. Serial blood time points are analyzed by direct counting of and, after which the dsNA is extracted from the blood by adding 60 µl of water and 200 µl of acetonitrile. Proteins are precipitated by centrifugation for 10 min (13,000 x g)

Eq. 1 C'b = Ae-at Be- | M

and the pellet is washed twice with 50 µl of 80% v / v acetonitrile, resulting in the recovery of 80% of the radioactivity. The extracts are combined and evaporated to dryness in a Centra-Vap at reduced pressure. and they are reconstituted in 3 | jl of water. Each time point is analyzed by placing 1 µl on a TLC plate which is then developed and automatically radiographed as described above. Pharmacokinetic parameters are derived from direct blood counts versus time for triplicate data sets for each oligosaccharide and then averaged to obtain mean and standard deviation. Nonlinear iterative least squares fits for individual data sets are obtained with PCNONLIN (SCI Software, Lexington, KY) using a two-compartment open model described by integrated equation 1:

Cb is the concentration of oligosaccharide in the blood. A and B are constants, and a and p are first-order hybrid constants that characterize the slopes of the fast and slow decay phases in a plasma concentration versus time profile. The mean residence time (MRT) is calculated according to equation 2:

Median residence time (MRT) is the average time that the oligosaccharide was in the mouse (Riegelman and Collier, J. Pharmacokinet. BioPharm. 8.509-534.1980). Total body clearance (Cltb) is calculated using equation 3 and volume of distribution at steady state (Vdss) is calculated according to equation 4 (Benet and Galeazzi, J.Pharm Sci, 68, 1071-1074, 1979 ).

Whole body autoradiography

The orientation and / or biodistribution of a dsNA of the invention is determined by suitable methods known in the art, including the methods described below.

Mice are anesthetized intraperitoneally. Ketamine hydrochloride (100 mg / kg) and xylazine hydrochloride (10 mg / kg) injection. A single silastic catheter is inserted into the right jugular vein and a bolus intravenous dose of dsNA radiolabeled with GalNAc ligand (0 µl, 7 µC i, in saline) is administered after which the catheter is removed and the vein is ligated. . After 30 minutes, the mice are sacrificed by lethal injection of phenobarbital (100 mg / kg). Immediately after sacrifice, mice are immersed in a dry ice bath with hexane (-70 ° C) for 5 minutes and mounted on a 4% (w / v) carboxymethylcellulose block which is then cooled to -20 ° C. Longitudinal 25 µm sections are cut near the midline of the mice at a temperature of -15 ° C in a cryomicrotome (LKB 2250, Sweden). Sections are collected on tape (Scotch 810, 3M Co., Minneapolis, MN), dehydrated at -15 ° C for 24 h, and then autoradiographed for 48 h using a Phosphor Imager.

DsNA biodistribution assay

Mice are anesthetized, as described above, followed by insertion of a single cannula into the right jugular vein. The dsNA (15 µl, 2 µC i, in saline) is dosed intravenously and biodistribution allowed 30 minutes after which the mice are sacrificed by cervical dislocation. Major organs (liver, lungs, spleen, stomach, kidneys, heart, large intestine, and small intestine) were harvested, rinsed with saline, and measured by direct counting for total radioactivity. The level of radioactivity indicates the areas of distribution and allows one to determine which tissues are being enriched for the dsNA molecule.

Cell targeting and administration

An optimal biodistribution time is selected based on the assay described above to analyze injection of dsNA molecules. Automatic whole body radiographic analysis allows detection of all ^{tissues to identify major biodistribution sites. Direct counting} and ^{desiccated tissue is} used to confirm the results observed by the whole body autoradiography. Quantitative biodistribution analysis is used to determine the efficiencies of dsNA molecules with GalNac ligands. The cellular target of dsNAs is established from the ratio of the radioactive dose in non-parenchymal and parenchymal liver cells.

Binding Affinity Assays:

Binding affinity is measured by various methods well established in the art. One of the methods to measure binding affinity is by fluorescence polarization as shown in Example 20. Seth et al teach another method that is also used (Targeted delivery of antisense oligonucleotides to hepatocytes using triantennary N-acetyl galactosamine improves potency 10-fold in mice, Nucleic Acids Res. 2014 Jul; 42 (13): 8796 807).

Desialylation and 125 I labeling of acid glycoprotein (AGP) for the competition assay in primary mouse hepatocytes (100 nmol AGP) are incubated in 50 mM sodium acetate buffer (pH 5) with 1 U of neuraminidase- agarose for 16 h at 37 ° C. Desialylation is confirmed by sialic acid assay or by size exclusion chromatography (SEC). Iodine monochloride iodination is achieved as described by Atsma et al (Atsma DE, Kempen HJ, Nieuwenhuizen W., van 't Hooft, FM, Pauwels EK, Partial characterization of low density lipoprotein preparations isolated from fresh and frozen plasma after radiolabeling by seven different methods, J. Lipid Res. 1991; 32: 173-181). One milliliter of desialylated acid glycoprotein a1 (de-AGP, 1 mg / ml) and 0.2 ml of 1-M glycine in 0.25 M NaOH (pH 10) are added to a mixture of 10-MM iodine chloride solution (7 pl / mg protein), Na125I (2.5 µl / mg protein) and 1 M glycine in 0.25 M NaOH (25 µl / mg protein). After incubation for 10 minutes at room temperature, the 1251-labeled de-AGP is separated from the free 1251 by concentrating the mixture twice using a 3 kDa MWCO spin column. The efficiency and purity of protein labeling is tested on an HPLC system equipped with an Agilent SEC-3 column (7.8 * 300mm) and a p-RAM counter.

Competition experiments using 125I-labeled de-AGP and dsNA with GalNAc ligands are performed as follows: Freshly isolated mouse hepatocytes (106 cells / ml) are plated in six-well plates in 2 ml of appropriate growth medium. . Primary hepatocytes are cultured in William's media containing 10% fetal calf serum (FBS), 1 * non-essential amino acids, and 1 * sodium pyruvate. The cells are incubated 16-20 h at 37 ° C with 5 and 10% CO2, respectively. The cells are then washed with media without FBS before the experiment. Cells are incubated for 30 minutes at 37 ° C with a 1 ml competition mix containing appropriate growth media with 1251 de-AGP-labeled, 10-8 M 2% FBS and dsNA containing GalNAc at varying concentrations. 10-11 to 10-5 M. Non-specific binding is determined in the presence of 10-2 M GalNAc sugar. Cells are washed twice with media without FBS to remove unbound de-AGP with 1251 tag and GalNAc competitor -dsNA. Cells are lysed using Qiagen's RLT regulator containing 1% pmercaptoethanol. Lysates are transferred to round bottom test tubes after a short 10 minute freeze / thaw cycle and analyzed in a y-counter. Non-specific binding is subtracted before dividing 1251 protein counts by the value of the lowest concentration counts of GalNAc-dsNA. The inhibition curves are fit according to a single-site competition binding equation using a non-linear regression algorithm.

Immunogenicity assay

Synthetic siRNA doubles can induce high levels of inflammatory cytokines and type I interferons, particularly interferon-α, after systemic administration in mammals and in primary cultures of human blood cells. Immunogenicity levels are determined by measuring the amount of interferon-a before and after the dsNA molecules of interest at varying concentrations are administered as described above. Synthetic Poly (I: C) (Sigma-Aldrich) is used to induce an immune response in PBMC as a positive control. After 24 hours of incubation, the culture supernatants are collected and analyzed for INF-a by a sandwich ELISA (Invitrogen) according to the supplier's instructions.

Pharmaceutical Compositions

In certain embodiments, the present invention provides a pharmaceutical composition comprising the DsNA agent of the present invention. The sample of the dsNA agent can be appropriately formulated and introduced into the cell environment by any means that allows a sufficient portion of the sample to enter the cell to induce gene silencing, if at all. Many formulations for dsNA are known in the art and can be used as long as the dsNA enters the target cells so that it can act. See, for example, US Published Patent Application Nos. 2004/0203145 A1 and 2005/0054598 A1. For example, the DsNA agent of the present invention can be formulated in buffer solutions such as phosphate-buffered saline, liposomes, micellar structures, and capsids. Formulations of the DsNA agent with cationic lipids can be used to facilitate transfection of the DsNA agent into cells. For example, cationic lipids, such as lipofectin (US Patent No. 5,705,188), cationic glycerol derivatives, and polycationic molecules, such as polylysine (published PCT international application WO 97/30731) can be used. Suitable lipids include Oligofectamine, Lipofectamine (Life Technologies), NC388 (Ribozyme Pharmaceuticals, Inc., Boulder, Colo.), Or FuGene 6 (Roche), all of which can be used according to the manufacturer's instructions.

Such compositions typically include the nucleic acid molecule and a pharmaceutically acceptable carrier. As used herein, the term "pharmaceutically acceptable carrier" includes saline, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic agents, and absorption retarders, and the like, compatible with pharmaceutical administration. Supplemental active compounds can also be incorporated into the compositions.

A pharmaceutical composition is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, eg, intravenous, intradermal, subcutaneous, oral (eg, inhalation), transdermal (topical), transmucosal, and rectal administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application may include the following components: a sterile diluent such as water for injection, saline, fixed oils, polyethylene glycols, glycerin, propylene glycol, or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates, or phosphates; and tonicity-adjusting agents such as sodium chloride or dextrose. The pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes, or multi-dose glass or plastic vials.

Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where they are soluble in water) or sterile dispersions and powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL ™ (BASF, Parsippany, N.J.), or phosphate-regulated saline (PBS). In all cases, the composition must be sterile and must be fluid to the extent that there is easy syringing. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (eg, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. Adequate fluidity can be maintained, for example, by using a coating such as lecithin, by maintaining the required particle size in the case of dispersion, and by using surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride in the composition. Prolonged absorption of injectable compositions can be achieved by including in the composition an agent that delays absorption, for example, aluminum monostearate and gelatin.

Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients listed above, as necessary, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle, which contains a basic dispersion medium and the required other ingredients from those listed above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and lyophilization which produces a powder of the active ingredient plus any additional desired ingredients from a previously sterile filtered solution thereof.

Oral compositions generally include an inert diluent or an edible carrier. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, lozenges, or capsules, eg, gelatin capsules. Oral compositions can also be prepared using a flowable vehicle for use as a mouthwash. Pharmaceutically compatible binding agents and / or adjunct materials can be included as part of the composition. Tablets, pills, capsules, lozenges, and the like may contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth, or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, primogel or cornstarch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.

For administration by inhalation, the compounds are administered as an aerosol from a pressurized container or dispenser containing a suitable propellant (eg, a gas such as carbon dioxide or a nebulizer). Such methods include those described in US Patent No. 6,468,798.

Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrating agents appropriate to the barrier to be crossed are used in the formulation. Such penetrating agents are generally known in the art and include, for example, for transmucosal administration, detergents, bile salts, and derivatives of fusidic acid. Transmucosal administration can be accomplished through the use of nasal sprays or suppositories. For transdermal administration, the active compounds are formulated into ointments, salves, gels, or creams as is generally known in the art.

The compounds can also be prepared in the form of suppositories (eg, with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.

The compounds can also be administered by transfection or infection using methods known in the art, including, but not limited to, the methods described in McCaffrey et al. (2002), Nature, 418 (6893), 38-9 (hydrodynamic transfection); Xia et al. (2002), Nature Biotechnol., 20 (10), 1006-10 (virus-mediated delivery); or Putnam (1996), Am. J. Health Syst. Pharm 53 (2), 151-160, erratum at Am. J. Health Syst. Pharm 53 (3), 325 (1996).

The compounds can also be administered by any method suitable for the administration of nucleic acid agents, such as a DNA vaccine. These methods include gene guns, bioinjectors, and skin patches, as well as needle-free methods, such as the DNA microparticle vaccine technology described in US Patent No. 6,194,389, and the transdermal needle-free vaccine for mammals with vaccine in powder form as described in US Patent No. 6,168,587. Furthermore, intranasal administration is possible, as described, among others, in Hamajima et al. (1998), Clin. Immunol Immunopathol., 88 (2), 205-10. Liposomes can also be used (for example, as described in U.S. Patent No.

6,472,375) and microencapsulation. Biodegradable steerable microparticle delivery systems can also be used (eg, as described in US Patent No. 6,471,996).

In one embodiment, the active compounds are prepared with vehicles that will protect the compound against rapid clearance from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable and biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Such formulations can be prepared using standard techniques. The materials are also commercially available from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies against viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in US Patent No. 4,522,811.

The toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, for example, to determine the LD50 (the lethal dose for 50% of the population) and the ED50 (the therapeutically effective dose in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and can be expressed as the LD50 / ED50 ratio. Compounds exhibiting high therapeutic indices are preferred. While compounds that exhibit toxic side effects can be used, care must be taken when designing a delivery system that targets such compounds to the affected tissue site to minimize potential damage to uninfected cells and therefore reduce the effects. secondary.

Data obtained from cell culture assays and animal studies can be used to formulate a range of dosage for use in humans. The dosage of such compounds is preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage can vary within this range depending on the dosage form used and the route of administration used. For any compound used, the therapeutically effective dose can be estimated initially from cell culture assays. A dose can be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (ie, the concentration of the test compound that achieves maximum mean symptom inhibition) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma can be measured, for example, by high performance liquid chromatography.

As defined herein, a therapeutically effective amount of a nucleic acid molecule (ie, an effective dosage) depends on the nucleic acid selected. For example, if a plasmid encoding a DsNA agent is selected, single dose amounts can be administered in the range of about 1 pg to 1000 mg; In some embodiments, 10, 30, 100, or 1000 pg, or 10, 30, 100, or 1000 ng, or 10, 30, 100, or 1000 pg, or 10, 30, 100, or 1000 mg can be administered. In some embodiments, 1-5 g of the compositions can be administered. The compositions can be administered from one or more times per day to one or more times per week; including once every two days. The person skilled in the art will appreciate that certain factors may influence the dose and time required to effectively treat a subject, including, but not limited to, the severity of the disease or disorder, previous treatments, general health, and / or age. of the subject, and other diseases present. In addition, treating a subject with a therapeutically effective amount of a protein, polypeptide, or antibody may include a single treatment or, preferably, it may include a series of treatments.

It can be appreciated that the method of introduction of DsNA agents into the cell environment will depend on the type of cell and the composition of its environment. For example, when cells are within a liquid, a preferable formulation is with a lipid formulation as in lipofectamine and the DsNA agents can be added directly to the liquid environment of the cells. The lipid formulations can also be administered to animals such as by intravenous, intramuscular or intraperitoneal injection, or orally or by inhalation or other methods as are known in the art. When the formulation is suitable for administration to animals such as mammals and more specifically humans, the formulation is also pharmaceutically acceptable. Pharmaceutically acceptable formulations for administering oligonucleotides are known and can be used. In some cases, it may be preferable to formulate DsNA agents in a buffer or saline and directly inject the formulated DsNA agents into cells, as in oocyte studies. Direct injection of double DsNA agents can also be done. For suitable methods of introducing dsNAs (eg, DsNA agents), refer to US Published Patent Application 2004/0203145 A1.

Adequate amounts of a DsNA agent must be introduced and these amounts can be determined empirically using standard methods. Typically, effective concentrations of individual DsNA agent species in the environment of a cell will be about 50 nanomolar or less, 10 nanomolar or less, or compositions in which concentrations of about 1 nanomolar or less can be used. In another embodiment, methods using a concentration of about 200 picomolar or less, and even a concentration of about 50 picomolar or less, about 20 picomolar or less, about 10 picomolar or less, or about 5 picomolar or less can be used in many circumstances.

The method can be carried out by adding the DsNA agent compositions to any extracellular matrix in which the cells can live, provided that the DsNA agent composition is formulated so that a sufficient amount of the DsNA agent can enter in the cell to exert its effect. For example, the method can be used with cells present in a liquid, such as a liquid culture or cell growth medium, in tissue explants or in whole organisms, including animals, such as mammals and especially humans.

The level or activity of a target RNA can be determined by any suitable method now known in the art or later developed. It can be appreciated that the method used to measure a target RNA and / or the expression of a target RNA may depend on the nature of the target RNA. For example, if the target RNA encodes a protein, the term "expression" can refer to a protein or to the RNA / transcript derived from the target RNA. In such cases, the expression of a target RNA can be determined by measuring the amount of RNA corresponding to the target RNA or by measuring the amount of that protein. Protein can be measured in protein assays, such as by staining or immunoblotting or, if the protein catalyzes a measurable reaction, by measuring reaction rates. All of these methods are known in the art and can be used. When target RNA levels are to be measured, any art recognized method for detecting RNA levels can be used (eg, RT-PCR, Northern blot, etc.). By targeting viral RNAs with the DsNA agents of the present invention, it is also anticipated that measuring the efficacy of a DsNA agent in reducing the levels of a target virus in a subject, tissue, cells, in vitro or in vivo, or in cell extracts, it can also be used to determine the degree of reduction in target viral RNA levels. Any of the above measurements can be performed on cells, cell extracts, tissues, tissue extracts, or any other suitable source material.

Determination of whether the expression of a target RNA has been reduced can be made by any suitable method that can reliably detect changes in RNA levels. Typically, the determination is made by introducing an undigested cellular DsNA into the environment such that at least a part of that DsNA agent enters the cytoplasm and then measures the level of the target RNA. The same measurement is performed on identical untreated cells and the results obtained from each measurement are compared.

The DsNA agent can be formulated as a pharmaceutical composition comprising a pharmacologically effective amount of a DsNA agent and a pharmaceutically acceptable carrier. A pharmacologically or therapeutically effective amount refers to the amount of a DsNA agent effective to produce the desired pharmacological, therapeutic, or preventive result. The terms "pharmacologically effective amount" and "therapeutically effective amount" or simply "effective amount" refer to that amount of RNA effective to produce the desired pharmacological, therapeutic or preventive result. For example, if a given clinical treatment is considered effective when there is at least a 20% reduction in a measurable parameter associated with a disease or disorder, a therapeutically effective amount of a drug for the treatment of that disease or disorder is the amount necessary. to effect at least a 20% reduction in that parameter.

The suitably formulated pharmaceutical compositions of this invention may be administered by any means known in the art, such as parenteral routes, including intravenous, intramuscular, intraperitoneal, subcutaneous, transdermal, airway (aerosol), rectal, vaginal, and topical (including buccal and sublingual). In some embodiments, the pharmaceutical compositions are administered by intravenous or intraparenteral infusion or injection.

In general, a suitable dosage unit for dsNA will be in the range of 0.001 to 0.25 milligrams per kilogram of recipient body weight per day, or in the range of 0.01 to 20 micrograms per kilogram of body weight per day, or in the range 0.01 to 10 micrograms per kilogram of body weight per day, or in the range of 0.10 to 5 micrograms per kilogram of body weight per day, or in the range of 0.1 to 2.5 micrograms per kilogram of body weight per day. The pharmaceutical composition comprising the dsNA can be administered once a day. However, the therapeutic agent can also be dosed in dosage units containing two, three, four, five, six or more subdoses administered at appropriate intervals throughout the day. In that case, the dsNA contained in each sub-dose must be correspondingly smaller to achieve the total daily dosage unit. The dosage unit can also be combined for a single dose over several days, for example, using a conventional sustained release formulation that provides a sustained and consistent release of the dsNA over a period of several days. Sustained release formulations are well known in the art. In this embodiment, the dosage unit contains a corresponding multiple of the daily dose. Regardless of the formulation, the pharmaceutical composition must contain dsNA in an amount sufficient to inhibit expression of the target gene in the treated animal or human. The composition can be combined in such a way that the sums of the multiple dsNA units together contain a sufficient dose.

Data from cell culture assays and animal studies can be obtained to formulate a suitable dosage range for humans. The dosage of the compositions of the invention is within a range of circulating concentrations that include the ED50 (as determined by known methods) with little or no toxicity. The dosage can vary within this range depending on the dosage form used and the route of administration used. For any compound used, the therapeutically effective dose can be estimated initially from cell culture assays. A dose can be formulated in animal models to achieve a circulating plasma concentration range of the compound that includes the IC50 (ie, the concentration of the test compound that achieves maximum mean symptom inhibition) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Plasma dsNA levels can be measured by standard methods, for example, by high performance liquid chromatography.

The pharmaceutical compositions can be included in a kit, container, pack or dispenser together with instructions for administration.

Treatment methods

The present disclosure provides both prophylactic and therapeutic methods for treating a subject at risk of (or susceptible to) a disease or disorder caused, in whole or in part, by the expression of a target RNA and / or the presence of said target RNA. (eg, in the context of a viral infection, the presence of a target RNA from the viral genome, capsid, host cell component, etc.).

"Treatment", or "treat" as used herein, is defined as the application or administration of a therapeutic agent (eg, a DsNA agent or vector or transgene encoding it) to a patient, or the application or administration of a therapeutic agent to an isolated tissue or cell line of a patient, having the disease or disorder, a symptom of disease or disorder, or a predisposition to a disease or disorder, for the purpose of curing, healing, alleviating, attenuating , alter, remedy, recover, ameliorate or affect the disease or disorder, the symptoms of the disease or disorder, or the predisposition to the disease.

In one aspect, the disclosure provides a method of preventing, in a subject, a disease or disorder as described above, by administering to the subject a therapeutic agent (eg, a DsNA agent or vector or transgene encoding it). Subjects at risk of contracting the disease can be identified by, for example, any or a combination of diagnostic or prognostic tests as described herein. Administration of a prophylactic agent may occur prior to the detection of, for example, viral particles in a subject, or the manifestation of symptoms characteristic of the disease or disorder, so that the disease or disorder is prevented or, alternatively, delayed. its progression.

Another aspect of the disclosure relates to methods of therapeutic treatment of subjects, ie, altering the appearance of symptoms of the disease or disorder. These methods can be performed in vitro (eg, by culturing the cell with the DsNA agent) or, alternatively, in vivo (eg, by administering the DsNA agent to a subject).

With regard to both prophylactic and therapeutic treatment methods, such treatments can be specifically adapted or modified, based on knowledge obtained in the field of pharmacogenomics. "Pharmacogenomics", as used herein, refers to the application of genomic technologies such as gene sequencing, statistical genetics, and gene expression analysis to drugs in clinical development and on the market. More specifically, the term refers to the study of how a patient's genes determine their response to a drug (eg, the "drug response phenotype" or "drug response genotype"). Therefore, another aspect of the disclosure provides methods for tailoring prophylactic or therapeutic treatment of an individual with the target RNA molecules of the present invention or with target RNA modulators according to that individual's drug response genotype. Pharmacogenomics allows a doctor or physician to direct prophylactic or therapeutic treatments to patients who will benefit the most from treatment and to avoid treating patients who will experience toxic drug-related side effects.

Therapeutic agents can be tested in an appropriate animal model. For example, a DsNA agent (or expression vector or transgene encoding it) as described herein can be used in an animal model to determine the efficacy, toxicity, or side effects of treatment with said agent. Alternatively, a therapeutic agent can be used in an animal model to determine the mechanism of action of said agent. For example, an agent can be used in an animal model to determine the efficacy, toxicity, or side effects of treatment with that agent. Alternatively, an agent can be used in an animal model to determine the mechanism of action of that agent.

The practice of the present invention employs, unless otherwise indicated, conventional techniques of chemistry, molecular biology, microbiology, recombinant DNA, genetics, immunology, cell biology, cell culture, and transgenic biology, which are within the skill of the technique. See, for example, Maniatis et al., 1982, Molecular Cloning (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY); Sambrook et al., 1989, Molecular Cloning, 2nd Ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY); Sambrook and Russell, 2001, Molecular Cloning, 3rd Ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY); Ausubel et al., 1992), Current Protocols in Molecular Biology (John Wiley and Sons, including periodic updates); Glover, 1985, DNA Cloning (IRL Press, Oxford); Anand, 1992; Guthrie and Fink, 1991; Harlow and Lane, 1988, Antibodies (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY); Jakoby and Pastan, 1979; Nucleic Acid Hybridization (BD Hames and SJ Higgins eds. 1984); Transcription and Translation (BD Hames and SJ Higgins eds. 1984); Culture Of Animal Cells (RI Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal, A Practical Guide To Molecular Cloning (1984); the treatise, Methods In Enzymology (Academic Press, Inc., NY); Gene Transfer Vectors For Mammalian Cells (JH Miller and MP Calos eds., 1987, Cold Spring Harbor Laboratory); Methods In Enzymology, Vols. 154 and 155 (Wu et al. Eds.), Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook Of Experimental Immunology, Volumes I-IV (DM Weir and CC Blackwell, eds., 1986); Riott, Essential Immunology, 6th Edition, Blackwell Scientific Publications, Oxford, 1988; Hogan et al., Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1986); Westerfield, M., The zebrafish book. A guide for the laboratory use of zebrafish (Danio rerio), (4th Ed., Univ. Of Oregon Press, Eugene, 2000).

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

The present invention is illustrated with reference to the following examples, which provide information both on the constructs of the invention as now claimed and on the comparative constructs.

Examples

Example 1 Synthesis methods

Oligonucleotide synthesis, in vitro and in vivo use

Individual RNA strands were synthesized and purified by HPLC according to standard methods (Integrated DNA Technologies, Coralville, Iowa). All oligonucleotides were released by quality control based on chemical purity by HPLC analysis and whole strand purity by mass spectrometry analysis. Double RNA DsNAs were prepared prior to use by mixing equal amounts of each strand, heating briefly to 100 ° C in RNA buffer (IDT), and then allowing the mixtures to cool to room temperature.

Cell culture and RNA transfection

HeLa cells were obtained from ATCC and maintained in Dulbecco's modified Eagle's medium (HyClone) supplemented with 10% fetal calf serum (HyClone) at 37 ° C under 5% CO2. For the RNA transfections of Figures 7, 9, 12 and 13, HeLa cells were transfected with DsNA as indicated at a final concentration of 0.1 nM using Lipofectamine ™ IRNAMAX (Invitrogen) and following the manufacturer's instructions. Briefly, 2.54 of a 0.0204 stock solution of each DsNA were mixed with 46.54 of Opti-MEM I (Invitrogen) and 14 of Lipofectamine ™ IARNMAX. The resulting 504 mixture was added to individual wells of 12-well plates and incubated for 20 minutes at room temperature to allow RNAMAX DsNA: Lipofectamine ™ complexes to form. Meanwhile, HeLa cells were trypsinized and resuspended in medium at a final concentration of 367 cells / pL. Finally, 4504 of the cell suspension was added to each well (final volume 500 µl) and the plates were placed in the incubator for 24 hours.

RNA isolation and analysis, in vitro

Cells were washed once with 2 ml of PBS, and total RNA was extracted using RNeasy Mini Kit ™ (Qiagen) and eluted in a final volume of 30 pL. Reverse transcription was performed at 1 pg of total RNA using Transcriptor 1st Strand cDNA Kit ™ (Roche) and random hexamers following the manufacturer's instructions. One thirtieth (0.66 pL) of the resulting cDNA was mixed with 54, of iQ ™ Multiplex Powermix (Bio-Rad) together with 3,334, of H2O and 14, of a 304 mixture containing 2 sets of primers and specific probes for human genes Genes HPRT-1 (accession number NM-000194) and s Fr S9 (accession number NM-003769):

(SEQ ID NO: 1) Hu HPRT forward primer F517 GACTTTGCTTTCCTTGGTCAG

(SEQ ID NO: 2) Hu HPRT reverse primer R591 GGCTTATATCCAACACTTCGTGGG

(SEQ ID NO: 3) Hu HPRT probe P554 Cy5-ATGGTCAAGGTCGCAAGCTTGCTGGT-IBFQ

(SEQ ID NO: 4) Hu SFRS9 forward primer F569 TGTGCAGAAGGATGGAGT

(SEQ ID NO: 5) Hu SFRS9 reverse primer R712 CTGGTGCTTCTCTCAGGATA

(SEQ ID NO: 6) Hu SFRS9 probe P644 HEX-TGGAATATGCCCTGCGTAAACTGGA-IBFQ

In vivo sample preparation and injection

The DsNA was formulated in Invivofectamine ™ according to the manufacturer's protocol (Invitrogen, Carlsbad, CA). In summary, the N / mouse group and the body weight of the mice used were determined, then the amount of DsNA required for each group of treated mice was calculated. One ml of FIV-oligo was sufficient for 4 mice of 25 g / mouse with a dose of 10 mg / kg. One mg of DsNA was added to one ml of Invivofectamine ™, and mixed at room temperature for 30 minutes on a rotator. 14 ml of 5% glucose was used to dilute formulated IVF-DsNA and applied to 50 kDa molecular weight cut-off spin concentrators (Amicon). The spin concentrators were centrifuged at 4000 rpm for ~ 2 hours at 4 ° C until the IVF-DsNA volume was reduced to less than 1 ml. The recovered IVF-DsNA was diluted to one ml with 5% glucose and prepared for injection into animals.

Animal injection and tissue collection

The animals were subjected to surgical anesthesia by i.p. injection. with ketamine / xylazine. Each mouse was weighed before injection. IVF-DsNA formulated i.v. at 100 ul / 10 g of body weight. After 24 hours, the mice were euthanized by CO2 inhalation. Tissues for analysis were harvested and placed in tubes containing 2 ml of RNAlater ™ (Qiagen) and rotated at room temperature for 30 minutes before incubation at 4 ° C overnight. The tissues were subsequently stored at -80 ° C until use.

Preparation and quantification of tissue RNA

Approximately 50-100 mg of tissue pieces were homogenized in 1 ml of QIAzol ™ (Qiagen) in Tissue Lyser ™ (Qiagen). Then, total RNA was isolated according to the manufacturer's protocol. Briefly, 0.2 ml of chloroform (Sigma-Aldrich) was added to the QIAzol ™ lysates and mixed vigorously by vortexing. After rotating at 14,000 rpm for 15 minutes at 4 ° C, the aqueous phase was collected and mixed with 0.5 ml of isopropanol. After another centrifugation at 14,000 rpm for 10 minutes, the RNA pellet was washed once with 75% ethanol and briefly dried. The isolated RNA was resuspended in 100 µl of RNase-free water and cleaned with the RNeasy ™ Total RNA Preparation Kit (Qiagen) or the SV 96 Total RNA Isolation System (Promega) according to the protocol of the maker.

Synthesis of first-strand cDNA, in vivo

1 pg of total RNA was reverse transcribed using Transcriptor 1st Strand cDNA Kit ™ (Roche) and oligo-dT following the manufacturer's instructions. One-fortieth (0.66 pL) of the resulting cDNA was mixed with 54, IQ Multiplex Powermix (Bio-Rad) along with 3.33 pL H2O and 1 pL of a 3 pM mix containing 2 sets of primers and gene-specific probes. mouse. HPRT-1 (accession number NM-013556) and KRAS (accession number NM-021284) genes:

(SEQ ID NO: 7) Mm HPRT forward primer F576 CAAACTTTGCTTTCCCTGGT

(SEQ ID NO: 8) Mm HPRT reverse primer R664 CAACAAAGTCTGGCCTGTATC

(SEQ ID NO: 9) Mm HPRT probe P616 Cy5-TGGTTAAGGTTGCAAGCTTGCTGGTG-IBFQ

(SEQ ID NO: 10) Mm KRAS forward primer F275 CTTTGTGGATGAGTACGACC

(SEQ ID NO: 11) Mm KRAS reverse primer R390 CACTGTACTCCTCTTGACCT

(SEQ ID NO: 12) Mm KRAS probe P297 FAM-CGATAGAGGACTCCTACAGGAAACAAGT - IBFQ

Quantitative RT-PCR

A CFX96 real time system with a C1000 thermal cycler (Bio-Rad) was used for the amplification reactions. The PCR conditions were: 95 ° C for 3 min; and then cyclize at 95 ° C, 10 seconds; 55 ° C, 1 min for 40 cycles. Each sample was analyzed in triplicate. For the HPRT experiment, the relative levels of HPRT mRNA were normalized to the SFRS9 mRNA levels and compared with the mRNA levels obtained in control samples treated with the transfection reagent plus a double of control mismatch, or No treatment. For the KRAS examples, relative KRAS mRNA levels were normalized to HPRT-1 mRNA levels and compared to mRNA levels obtained in control samples from mice treated with 5% glucose. Data were analyzed using Bio-Rad CFX Manager software version 1.0 (in vitro examples) or 1.5 (in vivo example).

Example 2 Efficacy of siDARN Agents Possessing Single Strand Extensions

SiDARN agents possessing single-stranded extensions were examined for efficiency of sequence-specific target mRNA inhibition. Specifically, DRNAs doubles targeting KRAS-249M and HPRT that possess 5 'single-stranded guide extensions were transfected into HeLa cells at a fixed concentration of 20 nM and HPRT expression levels were measured 24 hours later (Figures 7 and 9). Transfections were performed in duplicate, and each duplicate was analyzed in triplicate for the expression of KRAS-249M and HPRT, respectively, by qPCR.

Under these conditions (double 0.1 nM, Lipofectamine ™ IRNAMAX transfection), the expression of the KRAS-249 gene was reduced by approximately 60-85% by double DNA10PS, RNA10PS, RNA10PS-2'-OME, DNA15PS, RNA15PS and RNA15PS-2 'OME (figure 7). In comparison, a double without single-stranded guide extensions reduced KRAS-249 gene expression by approximately 90%. Therefore, the doubles with single-stranded guide extensions were as effective in silencing the KRAS-249 as a double without the single-chain guide extensions. All single-stranded extended doubles contained phosphorothioate backbone modifications in the single-stranded extension region. For the DNA10PS, RNA10PS, RNA10PS-2'-OME doubles, which have 10 nucleotide single-stranded leader extensions, the expression of the KRAS-249 gene was reduced by approximately 75-85%. For the double DNA10PS, RNA10PS, RNA10PS-2'-OME, which have 15 nucleotide single-stranded leader extensions, the expression of the KRAS-249 gene was reduced by 60-70%. In general, the doubles having the 10 nucleotide leader extensions reduce KRAS target gene expression more than the doubles having the 15 nucleotide leader extensions, regardless of the nucleotides present in the 5 'leader extensions. In particular, the silencing activity of the doubles having guide extensions containing deoxyribonucleotides was more sensitive to the increased length of 15 nucleotides, compared to the doubles containing ribonucleotides and 2'-O-methyl ribonucleotides. The 5 'guide strand spreading processing by Dicer, which is used in experiments targeting KRAS-249 gene expression, was also shown by in vitro assay (Figure 10).

Similarly, under the same conditions (double 0.1 nM, Lipofectamine ™ IRNAMAX transfection), the expression of the HPRT1 gene was reduced by approximately 65-85% by double DNA10PS, RNA10PS, RNa 10PS-2'-OME, DNA15PS, RNA15PS and RNA15PS-2'OME (Figure 9). In comparison, a double without single-stranded guide extensions reduced the expression of the HPRT1 gene by approximately 90%. Therefore, the doubles having single-stranded guide extensions were as effective at silencing HPRT1 as a double without the single-stranded guide extensions. All single-stranded extended doubles contained phosphorothioate backbone modifications in the single-stranded extension region. For the double DNA10PS, RNA10PS, RNA10PS-2'-OME, which have 10 nucleotide single-stranded leader extensions, the expression of the KRAS-249 gene was reduced by approximately 80-85%. For the double DNA10PS, RNA10PS, RNA10PS-2'-OME, which have 15 nucleotide single-stranded leader extensions, the expression of the KRAS-249 gene was reduced by 60-80%. In general, the doubles having the 10 nucleotide leader extensions reduce KRAS target gene expression more than the doubles having the 15 nucleotide leader extensions, regardless of the nucleotides present in the 5 'leader extensions. In particular, the silencing activity of the doubles having guide extensions containing deoxyribonucleotides or 2'-O-methyl ribonucleotides, was more sensitive to the increased length of 15 nucleotides, compared to the doubles containing ribonucleotides. The 5 'guide-strand double-spread processing by Dicer, which was used in the experiments targeting HPRT1 gene expression, was also shown by in vitro assay (Figure 10).

Because the double having the single-stranded guide extensions was as effective in silencing KRAS-249 and HPRT1, respectively, as a double without the single-stranded guide extensions, this discovery allows modification of DARNsi agents with single-stranded guide extensions without loss. efficiency.

Example 3. Efficacy of siDNA agents possessing single-stranded extensions in combination with a short oligonucleotide complementary to the single-stranded extension

SiDNA agents possessing single-stranded extensions were examined for the efficacy of sequence-specific target mRNA inhibition in combination with a short oligo complementary to the single-stranded extension. Specifically, double DRNAs targeting KRAS-249M and HPRT possessing 15 nucleotide long 5 'single-stranded guide extensions including a discontinuous 15 nucleotide complement were transfected into HeLa cells at a fixed concentration of 20 nM and the expression levels HPRT were measured 24 hours later (Figures 12 and 13). Transfections were performed in duplicate, and each duplicate was analyzed in triplicate for the expression of KRAS-249M and HPRT, respectively, by qPCR.

Under these conditions (double 0.1 nM, Lipofectamine ™ IRNAMAX transfection), the expression of the KRAS-249 gene was reduced by approximately 15-60% by double DNA15PS (1301 1340), RNA15PS (1301 + 1341), RNA15PS-2'- OME (1301 1342) in the presence of discontinuous complements RNA15, PS-RNA15, PS-DNA15, PS-2'OMe-RNA15 and 2'OMe-RNA15 (Figure 12). A double without the single-stranded guide extensions reduced the expression of the KRAS-249 gene by approximately 85%. All single-stranded extended doubles contained phosphorothioate backbone modifications in the single-stranded extension region. Generally, doubles having ribonucleotide guide extensions or 2'-O-methyl ribonucleotides reduce KRAS target gene expression more than doubles having deoxyribonucleotide guide extensions, regardless of the discontinuous complement present. For doubles DNA15PS (1301 1340), RNA15PS (1301 + 1341), RNA15PS-2'-OME (1301 1342), reductions in gene expression were comparable with or without the discontinuous complement 2'OMe-RNA15.

Similarly, under the same conditions (double 0.1 nM, Lipofectamine ™ IRNAMAX transfection), the expression of the HPRT1 gene was reduced by approximately 30-85% by double DNA15PS (1001 1353), RNA15PS (1001 1354) and RNA15PS-2 ' OME (1001 1355) in the presence of discontinuous complements RNA15, PS-RNA15, PS-DNA15, PS-2'OMe-RNA15 and 2'OMe-RNA15 (Figure 13). A double without the single-stranded guide extensions reduced the expression of the HPRT1 gene by approximately 90%. All single-stranded extended doubles contained modifications of the phosphorothioate backbone in the single-chain extension region. Generally, doubles having ribonucleotide guide extensions or 2'-O-methyl ribonucleotides reduce KRAS target gene expression more than doubles having deoxyribonucleotide guide extensions, regardless of the discontinuous complement present. The double RNA15PS (1301 1341) and RNA15PS-2'-OME (1301 1342) showed an improved reduction in gene expression in the presence of discontinuous complements RNA15, PS-RNA15, PS-2'OMe-RNA15, 2'OMe-RNA15 , compared to the same double RNA15PS (1301 1341) and RNA15PS-2'-OME (1301 1342) without any discontinuous complement.

Example 4 In Vivo Efficacy of SiDARN Agents

SiDNA agents possessing double DNA strands were examined for in vivo efficacy of sequence-specific target mRNA inhibition in a single dose protocol or in a repeat dose protocol (e.g., single injection of 10 mg / kg in vivo Fectamine). KRAS expression in liver, kidney, spleen and lymph node tissues was measured 24 hours after injection, with real-time PCR (RT-PCR) performed in triplicate to assess KRAS expression. Under these conditions, single-stranded guide extended siRNAs exhibited statistically significant levels of inhibition of the KRAS target gene in all tissues examined. The percentage inhibition levels of KRAS in said tissues treated with single-stranded guide extension siRNAs were: liver (10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95 %, 96%, 97%, 98%, 99% or 100%), spleen (10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100%),), kidney (10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) and lymph nodes (10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96 %, 97%, 98%, 99% or 100%)). Therefore, the in vivo efficacy of extended siRNAs was demonstrated in many types of tissues.

Further demonstration of the ability of extended Dicer substrate agents to reduce gene expression of specific target genes in vivo was made by administering the siDNAs to mice or other mammalian subjects, either systemically (for example, by intravenous injection or ip) or by direct injection of a tissue (eg injection of the eye, spinal cord / brain / CNS, etc.). Measurement of additional target RNA levels was performed in target cells (for example, RNA levels in liver and / or kidney cells were analyzed after injection of mice; eye cells were analyzed after ophthalmic injection of subjects; or spinal cord / brain / CNS cells were analyzed after direct injection from the same subjects) by standard methods (e.g. Trizol® preparation (guanidinophenol thiocyanate-chloroform) followed by qRT-PCR ).

In any of these additional in vivo experiments, an extended Dicer substrate agent (eg, a 5 'extended or 3' extended guideline siDNA) can be considered an effective in vivo agent if a statistically significant reduction in levels RNA was observed when an extended Dicer substrate agent was administered, compared to an appropriate control (eg, a vehicle-only control, a double randomized control, a double directed to a different target RNA control, etc.) . In general, if the p-value (for example, generated through a 1-tailed, no-tailed T-test) assigned to such a comparison was less than 0.05, an extended Dicer substrate agent (for example, extended DARNsi 5 'agent or 3 'extended passenger) is considered an effective RNA interference agent. Alternatively, the p-value threshold can be set below which to classify an extended Dicer substrate agent as an effective RNA interference agent, for example, at 0.01, 0.001, etc., to provide more stringent filtering, identify more robust differences and / or adjust for multiple hypothesis tests, etc. Absolute activity level limits can also be set to distinguish between effective and ineffective Extended Dicer Substrate agents. For example, an effective extended Dicer substrate agent was one that not only shows a statistically significant reduction in target RNA levels in vivo but also exerts, for example, at least about a 10% reduction, about a 15% reduction , at least about 20% reduction, about 25% reduction, about 30% reduction, etc., in the target RNA levels in the tissue or cell being examined, compared to an appropriate control. Thus, in vivo efficacy tests of the extended Dicer substrate agents (eg, 5 'extended and 3' guide extended siRNA agents) were performed.

SiDNA agents possessing single-stranded extensions (Figures 14 and 15) effectively inhibited the mRNA expression of sequence-specific target KRAs in vivo in liver, spleen, and kidney. In the liver, the transient 5 'siRNA agents 1371 (PS 3M) and 1339 (PS10M) showed inhibition of KRAS mRNA expression compared to siDNA agents without the 5' transient extensions K249M and 1370 (3M), when normalized to control only glucose (Figures 16-18). Inhibition of KRAS mRNA expression by DRNA si agents was at least 75-90% in the liver of animals injected with the extended passenger 5 'DRNA si agents 1371 (PS 3M) and 1339 (PS10M). . The amount of inhibition of the DARNsi agents extended for 5 'transients 1371 (PS 3M) and 1339 (PS10M) in the liver was comparable to that of the DRNAs without the transient extensions 5' K249M and 1370 (3M), which was significant compared to negative glucose control.

In the spleen, DRNAs extended 5 'transients 1371 (PS 3M) and 1339 (PS 10M) also showed inhibition of KRAS mRNA expression compared to DRNAs without the 5' transient extensions K249M and 1370 (3M ), when normalized to glucose-only control (Figures 19-21). Inhibition of KRAS mRNA expression by siDNA agents was at least 90-95% in the spleen of animals injected with the 5 'passenger extended DARNsi agents 1371 (PS 3M) and 1339 (PS10M). The amount of inhibition of the DARNsi agents extended for 5 'transients 1371 (PS 3M) and 1339 (PS10M) in the spleen was comparable to that of the DRNAs without the transient extensions 5' K249M and 1370 (3M), which was significant compared to negative glucose control.

In the kidney, the extended 5 'DRNA si agents 1371 (PS 3M) and 1339 (PS 10M) showed inhibition of KRAS mRNA expression compared to DRNA si agents without the 5' transient extensions K249M and 1370 (3M) , when normalized to glucose-only control (Figures 22-24). Inhibition of KRAS mRNA expression by DRNA si agents was at least 20-40% in kidneys of animals injected with the transient extended DRNA si agents 5 '1371 (PS 3M) and 1339 (PS10M). However, the amount of inhibition of the DRNA si agents extended for 5 'transients 1371 (p S 3M) and 1339 (p S 10M) was comparable to that of DRNAs without the 5' transient extensions K249M and 1370 (3M). . In these experiments, a DARNsi agent without the 5 'M97M transient extension and without a specific sequence for KRAS was used as a positive control.

Because DARNsi agents having a single-stranded guide extension were as effective at silencing KRAS in vivo as DRNA agents without the single-chain guide extension, this discovery allows modification of DRNAs agents with single-chain guide extensions without loss of efficacy in vivo.

Example 5. In vitro cell culture assay to evaluate nucleic acid inhibition of target RNA

The dsRNAs are administered to human hepatoma cells (Huh7) and subsequently the levels of targeted mRNA in human hepatoma cells (Huh7) are measured, to evaluate the in vitro efficacy for reducing the target expression of dsRNAs against transcripts. specific.

Double-stranded RNAs specific for the human hypoxanthine-guanine phosphoribosyl transferase (HPRT1; GenBank Accession No. NM-000194 and GI: 164518913) target gene are tested for their efficacy in human hepatoma cells (Huh7). The above target gene is an art recognized "housekeeping" gene. Housekeeping genes are selected as target genes for the dual purpose of ensuring that the target genes have strong and homogeneous expression in human liver cells and minimizing the variability of the expression level between species. Few examples of the disclosure are shown in Figures 37, 38, 39 and 41, including control dsRNAs to be used as a reference for comparison. Specific dsRNAs to target HPRT1 are shown, for example, in Figures 37, 38, 39 and 41. Specific dsRNA sequences that target GAPDH, LMNA, Hn RpA 1, and ATP1B3 can be similarly constructed to target their respective transcript in human liver cells.

RNA-targeted dsNA molecules are designed and synthesized as described herein. These nucleic acid molecules can be analyzed in vivo for the ability to reduce gene expression and Dicer cleavage activity, for example, using the following procedure. Two formats are used to test the effectiveness of dsNA. The reagents are tested in cell culture using, for example, human hepatoma cells (Huh7), to determine the degree of RNA and protein inhibition. The dsNA reagents are targeted to a specific target as described herein. RNA inhibition is measured after delivery of these reagents by a suitable transfection agent to, for example, cultured epidermal keratinocytes. Relative amounts of target RNA are measured and compared to actin using real-time PCR monitoring of amplification (eg, ABI 7700 TAQMAN). A comparison is made with a mixture of oligonucleotide sequences made with unrelated targets or with a randomized dsNA control with the same length and general chemistry, but randomly substituted at each position. Target-directed primary and secondary lead reagents are optimized. After choosing an optimal concentration of transfection agent, an RNA inhibition cycle is performed with the major dsNA molecule. In addition, a cell coat format can be used to determine RNA inhibition.

The dsNA constructs are tested for their efficacy in reducing target RNA expression, for example, using the following protocol. Cells are plated approximately 24 hours prior to transfection in 96-well plates at 5,000-7,500 cells / well, 100ul / well, so that at the time of transfection the cells are 70-90% confluent. . For transfection, the fused dsNA is mixed with the transfection reagent (Lipofectamine 2000, Invitrogen) in a volume of 50 µl / well and incubated for 20 minutes at room temperature. The dsNA transfection mixtures are added to the cells to give a final dsNA concentration of 50 pM, 200 pM or 1 nM in a volume of 150 ul. Each dsNA transfection mix is tested in triplicate. Cells are incubated at 37 ° C for 24 hours in the continuous presence of the siDNA transfection mix. At 24 hours, RNA is prepared from each well of treated cells. After centrifugation of the cell samples, the supernatants with the transfection mixtures are removed and discarded, the cells are lysed, and RNA is prepared from each well. The level or expression of target RNA after treatment is assessed by a quantitative method (eg, RT-PCR, Northern blot) for the target gene and for a control gene (eg, actin or 36B4, a subunit of RNA polymerase ) for normalization. Alternatively, cells are lysed and total protein is prepared from each well. The level of target protein or expression after treatment is assessed by Western blotting and the signal is quantified. The data are averaged in triplicate and standard deviations are determined for each treatment. The normalized data is plotted and the percent reduction in target mRNA by the dsRNAs is determined compared to the appropriate control dsRNAs (eg, inverted control dsRNAs).

Therefore, notched dsRNAs, eg, notched tetraloop structures, can be shown to reduce specific target gene expression in cells, compared to a reference dsRNA. Tetraloop cut dsRNAs are expected to have enhanced Dicer cleavage. Thus, dsRNAs having a notched tetraloop structure reduce the expression of a target gene and improve dicer cleavage compared to a reference dsRNA. DsNAs possessing structures encompassed by the notched tetraloop structure are robustly effective sequence-specific inhibitors of in vitro expression of target genes in human hepatoma cells (Huh7).

Example 6. In vitro test to evaluate the stability of serum

Serum stability of dsNA agents is assessed by incubating dsNA agents in 50% fetal bovine serum for various periods of time (up to 24 h) at 37 ° C. Serum is extracted and nucleic acids separated on a 20% non-denaturing gel using PAGE and visualized with Gelstar stain. Relative levels of protection against nuclease degradation are evaluated for dsNA (optionally with and without modifications).

Example 7. In Vivo Assay of Tetraloop Notched dsRNA

The disclosure provides compositions for reducing the expression of a target gene in a cell, which involves contacting a cell with notched dsRNA having a tetraloop in an amount effective to reduce the expression of a target gene in a subject in need thereof. The dsRNAs are administered systemically to mice and the levels of targeted mRNA are subsequently measured in liver samples from treated mice. The study evaluates the in vivo efficacy of dsRNAs against targeted transcripts.

Double-stranded RNA agents specific for the following mouse housekeeping target genes are tested for efficacy in mouse liver: Hypoxanthine-Guanine Phosphoribosyl Transferase (HPRT1; GenBank Accession No. NM-013556); Glyceraldehyde 3-phosphate dehydrogenase (GAPDH; GenBank accession number NM-008084); Lamin A (LMnA; GenBank Accession No. NM-019390); Heterogeneous nuclear ribonucleoprotein A1 (HNRpAl; GenBank Accession No. NM-010447) and ATPase, Na + / K + transporter, Beta 3 polypeptide (ATP1B3; GenBank Accession No. NM-007502; two different locations were attacked within the ATP1B3 mRNA) .

Specific dsRNA sequences targeting HPRT1, GAPDH, LMNA, HNRPA1, and ATP1B3 are constructed having a dsRNA structure, for example, a notched tetraloop structure containing any of the following sequences on the antisense strand to target their respective transcripts :

HPRT1 antisense sequence: 3'-UUCGGUCUGAAACAACCUAAACUUUAA-5 '

GAPDH antisense sequence: 3'-ACUCGUAGAGGGAGUGUUAAAGGUAGG-5 '

LMNA antisense sequence: 3'-CUCGAACUGAAGGUCUUCUUGUAAAUG-5 '

HNRPA1 antisense sequence: 3'-GUCCUGACAUAAACACUGAUU AACAUA-5 '

ATP1B3 antisense sequence: 3'-AUCCCUAUGUUACCAUGGAACGGUUGU-5 '

ATP1B3 antisense sequence: 3'-GGUCUGCCUAUAGGUGUUUAUAGCACA-5 '

Legend: uppercase = RNA residues

Mice (CD-1 females) weighing approximately 25 grams are purchased, housed, treated and euthanized.

An initial dose interval and time point selection study was conducted to establish the in vivo efficacy of notched dsRNAs in reducing the expression of targeted transcripts while establishing the optimal notched dsRNA dose and collection time. of samples. This is done, for example, for two independent and active targeting sequences (HPRT1). The different doses (50 and 200 µg) of the dsRNAs to be analyzed are dissolved in phosphate-regulated saline (PBS; 2.5 ml of total volume per dose) and administered to mice as individual hydrodynamic injections through the vein of the line. Liver samples are collected from dosed mice at the following time points: 24, 48 and 72 hours, and 7 days after administration. A total of four animals per group are treated with the dsRNAs to ensure that at least 3 animals can be evaluated at each dose / time.

The study is also conducted using the following conditions. One dose (200 µg) of the dsRNA to be tested is dissolved in phosphate-regulated saline (PBS; 2.5 ml total volume per dose) and administered to mice as single hydrodynamic injections via the tail vein. Liver samples are collected from dosed mice 24 hours after administration. A total of seven animals per group are treated with each dsRNA agent.

Target mRNA levels are assessed using a quantitative reverse transcriptase-polymerase strand reaction ("qRT-PCR"). CDNAs are synthesized using a mixture of oligo-dT and hexamer random priming. QPCR reactions are run in triplicate. Absolute quantification is performed by extrapolation against a standard curve derived from a cloned linearized amplicon target. The data is normalized using the control as 100%. The data is normalized by setting the expression level of the control gene to be the target mRNA expression value measured for all mice that were not administered target mRNA-specific siDNA agents, which were averaged to obtain a control value of 100. % (for example, for Ga PDH si DARNA injected mice, the HPRT1, LMNA, HNRPA1, ATP1B3-1, and ATP1B3-3 mouse pool are used as negative controls to produce normalized baseline GAPDH levels. Therefore, there are seven study mice and 35 control mice for each study arm). In assessing the significance of the results, P values are calculated using a 1-tailed no-tailed T-test. Values below 0.05 are considered statistically significant.

Reduced levels of targeted mRNA are observed in liver samples from treated mice due to treatment with the tetra-notched dsRNAs. Study results show that dsRNA agents directed against HPRT1 target sequences reduce target mRNA levels in vivo when administered at 50 micrograms and 200 micrograms or other concentrations, for example between 1 µg and 500 µg, for example 1,2, 3, 4, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500 jg with reductions in target gene transcript expression levels of at least 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100% observed at 24 hours after administration compared to a control that is not expected to reduce gene transcription levels.

Example 8 Synthesis of Ligand Derivatives

Derivatives of the ligand N-acetyl galactosamine, called GalNac in this example, were synthesized according to scheme I: (Refer to page 193)

A flask was charged with a stir bar, benzyl alcohol (90 ml, 94 g, 0.87 mol, 8.0 equivalents, anhydrous Aldrich), delta-valerolactone (10.0 ml, 10.8 g, 0.108 mol, 1.0 equivalents, Alpha, used as received) and Dowex 50W8X-100 resin (207 mg, Aldrich). The flask was fitted with a rubber septum with an N2 (nitrogen) inlet needle, and the flask was placed in a preheated 75 ° C oil bath. The mixture was vigorously stirred for 4 h, and then the oil bath power was turned off, and the solution was allowed to stir overnight, cooling to room temperature under N2 (nitrogen). The clear, colorless solution was filtered to remove the DOWEX beads, and the beads and filter were rinsed with DCM. The filtrate was concentrated on a rotary evaporator to remove the (dichloromethane) DCM. The mixture was purified by silica gel flash chromatography (FC) (ISCO) in 3 batches, each on a 330 g silica gel column (the same column was reused for all 3 batches). 330 g column, equilibrated with 5% ethyl acetate (EtOAc) / hexanes. 33-35 ml of the reaction solution was injected onto the column for each run and eluted with EtOAc / Hexanes 5% -100%. UV 254 nm, 280 nm. All the desired fractions from the 3 columns were combined and evaporated to give D2 as a colorless liquid: 15.82 g (0.076 mol, 70%). This was repurified by FC on silica gel: 220 g column, eluted with EtOAc / Hexanes 5% -70%, 254 nm, 280 nm. The desired fractions were combined and evaporated to give a colorless liquid which was dried under complete vacuum for 24 hours to give D2 12.60 g (56%) as a colorless liquid sufficiently pure to use in the next step.

b. G1 'synthesis

4 g scale:

An oven-dried flask was loaded with the GalNAc (G1) (4,360 g, 11.20 mmol, 1.00 equivalents) and a stir bar. 1,2-Dichloroethane (Aldrich. Anhydrous, 26 ml) was added to give a milky suspension. To this mixture was added trimethylsilyl trifluoromethanesulfonate (TMSOTf) (Alpha, 2.8 ml over 1 minute) via syringe at room temperature under N2. This mixture was stirred at room temperature for 30 minutes, but remained heterogeneous. The flask was placed in an oil bath preheated to 50 ° C. Within a few minutes, the reaction mixture became homogeneous. After heating for 95 minutes, the oil bath feed was turned off and the flask was allowed to cool to room temperature overnight. After 21 hours, an aliquot was removed, diluted with CH3CN and verified by mass spectroscopy (MS) CIPOS: 362.1 (10), 330.1 (100), 210.1 (20), 168.1 (12), 150.1 (28) .

The reaction solution (amber color) was poured into a 500 ml separatory funnel containing 130 ml of ice cold saturated aqueous NaHCO3, and the reaction flask was rinsed with DCM (100 ml). After the gas evolution had subsided, the phases separated (the lower organic phase was cloudy yellow in color and the upper aqueous phase was milky with a little color). The aqueous phase was extracted with DCM (1 x 50 ml). The combined DCM phases were washed with H2O (120 ml) and saturated aqueous NaCl (120 ml). The DCM phase (clear, light yellow) was dried over Na2SO4, filtered (Na2SO4 rinsed with approximately 100 mL DCM), and concentrated by rotary evaporator to give an amber oil. This was dried at room temperature under full vacuum overnight (approximately 3.7 g), and then stored in the freezer. This material was used without further purification in the next step.

20g scale:

To a mixture of galactosamine pentaacetate (G1) (20.0 g, 51.0 mmol, 1.0 equivalents, LC Scientific) in dichloromethane (120 ml) was added TMSOTf (14.0 ml, 77.0 mmol, 1.5 equivalents, Alpha) at room temperature, and the The reaction was heated to reflux and stirred for 90 minutes under reflux. Subsequently, the mixture was stirred at room temperature overnight. The reaction mixture was poured into ice cold sodium bicarbonate solution, extracted with dichloromethane, washed with water, dried over sodium sulfate, and filtered. After concentrating on a rotary evaporator, the expected product G1 'was obtained as dark orange gum (about 16 g). The crude product was used without further purification.

c. G2 synthesis

5-Hydroxpentanoic acid benzyl ester D2 (12.44 g, 59.73 mmol, 1.75 equivalents) was dissolved in 1,2-dichloroethane (80 ml, anhydrous Aldrich), and this solution was added to the crude derivative of GalNAc (G1 ') ( 11.24 g, 34.13 mmol, 1.00 equivalents). Once this solution was homogeneous, dry 3A molecular sieves (10.5 g, beads) were added to it. The mixture was stirred at room temperature under N2 for 30 minutes. TMSOTf (3.2 ml, 18 mmol, 0.52 equivalents) was added via syringe. The mixture was stirred at room temperature under N2 overnight. The reaction was monitored by MS (CI POS) and TLC (silica gel, 100% EtOAc, stained with PMAo H2SO4 / MeOH). MS POS: 638.3 (15), 538.2 (100), 438.2 (10), 330.1 (40). After 24 hours at room temperature, the reaction was worked up. The amber solution was poured into a separatory funnel containing 100 ml of saturated aqueous NaHCO3, and the flask and sieves were rinsed with 80 ml of DCM, which was also added to the separatory funnel. The phases were separated and the aqueous phase was extracted with 1 x 80 ml of DCM. The combined organic phases were washed with H2O (100 ml) and saturated aqueous NaCl (100 ml). The amber organic phase was dried (Na2SO4), filtered (paper) and evaporated to give a viscous amber liquid: 26.54 g (145%). The crude sample was purified directly by FC on silica gel (ISCO): 330 g column, compound injected into the equilibrated column and rinsed with 8 ml DCM; eluted with 0% -100% EtOAc / Hexanes, UV 254 nm, 280 nm. The desired fractions were combined and evaporated to give an almost colorless viscous liquid: 13.52 g (74%). This material was contaminated by a small amount of GalNAc-OBn (M + 1 = 438) and small amounts of "dimer" and "trimer" derivatives (pentanoic acid homologues) (M + 1 = 738 and 638).

d. G2 'synthesis

The G2 starting material (2.42 g, 4.50 mmol, 1.0 equivalents) was dissolved in MeOH (60 ml) and the solution was placed in a Parr jar. 5% Pd / C (592 mg, Aldrich, Degussa E1002 U / W, wet) was added. The jar was placed in the Parr hydrogenator, and the jar was evacuated and refilled with H2 four times. The jar was pressurized to 48 psi (hydrogen) H2 and stirred at room temperature overnight. After 18 hours, the reaction was stopped. The jar was evacuated and refilled with N2 four times. An aliquot of the reaction mixture was removed, filtered, diluted with MeOH, and verified by MS. MS POS: 448.2 (100), 330.1 (65), 210.1 (7), 150.1 (8); MS NEG: 560.2 (5), 446.2 (100). The reaction was complete and clean. The reaction mixture was filtered through Celite and rinsed with MeOH (100 ml). The clear, colorless filtrate was evaporated and dried in vacuo at room temperature to give a colorless foam / glass solid: 1.70 g (84%) of G2 '.

and. G3 synthesis

To a mixture of G2 '(2 g, 4.47 mmol) in dichloromethane (100 ml) was added EDC (3.08 g, 16.06 mmol) and NHS (0.77 g, 6.71 mmol), and the reaction mixture was stirred at room temperature for the night. The reaction mixture was concentrated on a rotary evaporator (40 ° C), and the residue was washed with saturated water. Aqueous sodium bicarbonate (200 ml) and extracted with EtOAc (2 X 500 ml). The combined organic solution was dried over anhydrous Na2SO4 and evaporated. The crude G3 was used in the next step without purification (1.4 g, 57%).

1H NMR (300 MHz, DMSO-de)) 87.83 (d, J = 9.36 Hz, 1H), 5.21 (d, J = 3.27 Hz, 1H), 4.95 (dd, J = 11.28, 3.3 Hz, 1H), 4.5 (d, J = 8.49 Hz, 1H), 3.99-4.06 (m, 3H), 3.84-3.94 (m, 1H), 3.70-3.77 (m, 1H), 3.43-3.49 (m, 1H), 2.80 (s , 4H), 2.67 (t, J = 7.41 Hz, 2H), 2.1 (s, 3H), 1.99 (s, 3H), 1.89 (s, 3H), 1.76 (s, 3H), 1.57-1.62 (m, 4H).

13C NMR (75 MHz, DMSO-d6)

8 170.81, 170.58, 170.50, 170.21, 169.86, 169.49, 101.41, 71.04, 70.41, 68.54, 67.26, 62.01, 49.8 1, 30.31, 28.34, 25.99, 25.78, 23.28, 21.44, 21.08, 21.02, 21.01

MS: (APCI +) M 1 = 545.2

Example 9. Synthesis of Multivalent Ligand Derivatives

An example of this is tri-stranded GalNac and the synthesis of these branched GalNac derivatives is shown in Scheme II. (Refer to pages 194-196).

to. Synthesis of T5 (3- [2- (benzyloxycarbonylamino) -3- (2-carboxyethoxy) -2- (2-carboxyethoxymethyl) -propoxy] propanoic acid)

A flask was charged with 3,3 '- ((2 - (((benzyloxy) carbonyl) amino) -2 - ((2-carboxyethoxy) methyl) propane-1,3-diyl) bis (oxy)) dipropionic acid ( T4) (4.39 g, 9.31 mmol, 1.0 equivalent) (CAS registry number: 200133-16-0) and DMF (44 ml) to give a homogeneous solution. HOBtH2O (1.59 g, 9.30 mmol, 1.0 equivalents) was added at room temperature under N2, and the mixture was stirred for about 1 minute until homogeneous. DIEA (9.5 ml, 54.5 mmol, 5.9 equivalents) was added via syringe. HBTU (11.70 g, 30.9 mmol, 3.3 equivalents) was added all at once. The reaction mixture was stirred for 1-2 minutes until homogeneous. The flask was immersed in an ice water bath and BOC-1,3-diaminopropane (5.80 mL, 33.2 mmol, 3.6 equivalents) was added slowly with a syringe over approximately 5 minutes. The bath was left in place, and the reaction solution (clear, slightly yellow-amber) was stirred under N2 for 24 h, the reaction solution was diluted with CH2Cl2 (350 ml) and washed with H2O (150 ml) , Saturated aqueous NaHcO3 (2 x 150 mL), H2O (150 mL), and saturated aqueous NaCl (150 mL), dried over Na2SO4, filtered and evaporated to give a viscous amber liquid. The crude material was purified by FC in SO2 (ISCO). Eluted with 0% to 20% MeOH / EtOAc, then 10% MeOH / CH2Cl2 to give a sticky, almost colorless foam / oil: 7.17 g (82%) T5.

1H NMR (300 MHz, CDCla): 87.34-7.28 (m, 5H), 6.85 (m, 3H), 5.55 (s, 1H), 5.18 (m, 3H), 5.01 (s, 2H), 3.68-3.63 ( m, 12H), 3.28-3.21 (m, 6H), 3.13-3.07 (m, 6H), 2.39 (t, J = 5.5 Hz, 6H), 1.58 (br q, J = 6.0 Hz, 6H), 1.41 ( s, 27H) MS (APCI +) M 1 = 940.5

CAS Registry Number: 1162069-31-9

b. Synthesis of T8 (10-amino-10- (13,13-dimethyl-5,11-dioxo-2,12-dioxa-6,10-diazatetradecyl) -5,15-dioxo-8,12-dioxa-4, Di-tert-butyl 16-diazanonadecane-1,19-diyl) dicarbamate

T5 (2.84 g, 3.02 mmol) was dissolved in MeOH (50 ml) at room temperature, and the solution was placed in a Parr jar. 5% Pd / C (0.6670 g, Degussa E1002 U / W, wet, Aldrich) was added. The jar was placed in a Parr hydrogenator, evacuated, and refilled with H2 four times. The jar was pressurized to 47 psi H2 and stirred at room temperature for 6 h. The jar was evacuated and refilled with N2 four times. The reaction mixture was filtered through Celite, and the Celite was rinsed with approximately 200 ml of MeOH. The slightly cloudy filtrate was filtered through filter paper with some CH2Cl2 to rinse, and the resulting clear filtrate was evaporated and dried under complete vacuum to give a foamy solid: 2.38 g (98%) of T8.

1H NMR (300 MHz, DMSO-d6): 87.85 (t, J = 5.5 Hz, 3H), 6.76 (t, J = 5.7 Hz, 3H), 3.55 (t, J = 6.4 Hz, 6H), 3.16 (s , 6H), 3.02 (dt, J = 6.5 Hz, 6H), 2.90 (q, J = 6.5 Hz, 6H), 2.26 (t, J = 6.1 Hz, 6H), 1.48 (quint, J = 6.9 Hz, 6H ), 1.36 (s, 27H).

MS (APCI +) M 1 = 806.5

c. Synthesis of T9 15,15-bis (13,13-dimethyl-5,11-dioxo-2,12-dioxa-6,10-diazatetradecyl) -2,2-dimethyl-4,10,17-trioxo-3, Methyl 13,20,23,26,29,32-heptaoxa-5,9,16-triazapentatriacontan-35-oate (T9):

A flask was charged with 3-oxo-2,6,9,12,15,18-hexaoxahenicosan-21-oic acid (532.0 mg, 4.06 mmol, 1.0 equivalents, BroadPharm), T8 (3.385 g, 4.12 mmol 1.0 equivalents), HBTU (1.888 g, 4.98 mmol, 1.2 equivalents), HOBt H2O (710.3 mg, 4.15 mmol, 1.0 equivalents) and DMF (15 mL). The mixture was stirred for a few minutes under N2 until it was clear and homogeneous. To this was added DIEA (1.6 ml, 9.19 mmol, 2.3 equivalents) via syringe over 1 minute. The reaction solution was stirred under N2 at room temperature for 41 h. The solution was diluted with CH2O2 (180 mL) and washed with 1: 1 saturated aqueous H2O / NaHCO3 (2 x 70 mL), saturated aqueous NaHCO3 (70 ml) and saturated aqueous NaCl (80 ml). The combined aqueous phases were extracted with CH2Cl2 (80 ml), and this CH2Cl2 phase was washed with H2O (50 ml) and saturated aqueous NaCl (50 ml). The combined CH2Cl2 phases were dried over Na2SO4, filtered and evaporated to give an oil. The crude oil was purified by FC over SO2 (ISCO), eluting with (NH30.7M in MeOH) / CH2Cl2, 0% -10%, to give 1604 g (35%) of T9 as an oil.

1H NMR (300 MHz, DMSO-d6): 87.81 (brt, J = 5.7 Hz, 3H), 7.11 (s, 1H), 6.76 (brt, J = 5.5 Hz, 3H), 3.61 (t, J = 6.4 Hz , 2H), 3.59 (s, 3H), 3.56-3.47 (m, 32H), 3.02 (br q, J = 6.5 Hz, 6H), 2.90 (br q, J = 6.5 Hz, 6H), 2.53 (t, J = 6.3 Hz, 2H), 2.26 (brt, J = 6.3 Hz, 6H), 1.48 (br quint, J = 6.9 Hz, 6H), 1.36 (s, 27 H).

MS (APCI +) M 1 = 1140.7

d. Synthesis of T10 tris (2,2,2-trifluoroacetic acid) (30-amino-21,21-bis ((3 - ((3-aminopropyl) amino) -3-oxopropoxy) methyl) -19,26- methyl dioxo-4,7,10,13,16,23-hexaoxa-20,27-diazatriacontanoate) (T10):

In a 100 ml round bottom flask, a mixture of T9 (1.5 g, 1315 mmol), TFA (6 ml) and dichloromethane (24 ml) was stirred at room temperature for 1 h. The reaction mixture was concentrated by rotary evaporator, and the crude product was dried under vacuum overnight. No purification was needed, and crude T10 (1.55 g, yield: quant) was used in the next step directly.

1H NMR (300 MHz, DMSO-d6) 88.08 (t, J = 5.79 Hz, 3H), 7.72 (br, 9H), 7.14 (s, 1H), 3.61 (t, J = 6.03 Hz, 2H), 3.58 ( m, 3H), 3.46-3.56 (m, 30H), 3.07-3.15 (m, 6H), 2.74-2.80 (m, 6H), 2.53 (t, J = 6.33 Hz, 2H), 2.28-2.34 (m, 8H), 1.62-1.71 (m, 6H).

13C NMR (75 MHz, DMSO-d6)

8 172.15, 171.31, 171.00, 70.28, 70.19, 70.01, 68.8, 67.84, 67.37, 66.49, 60.19, 51.83, 37.26, 37.1 1, 36.46, 36.09, 34.95, 27.95

MS: (APCI +) M 1 = 840.5

and. Synthesis of 3GT2 methyl ester:

DIPEA (2.29 ml, 13.15 mmol) was added to a solution of T10 (1.55 g, 1.315 mmol) in dichloromethane (45 ml) at 0 ° C (ice-water bath) and the mixture was stirred for 5 minutes. G3 was added and the reaction mixture was stirred at room temperature overnight. The reaction mixture was washed with saturated aqueous sodium bicarbonate (200 ml), and the aqueous phase was extracted with dichloromethane (500 ml). The combined organic phases were washed with brine, dried over anhydrous Na2SO4, and evaporated. The residue was purified by silica gel column chromatography (gradient elution from 0% to 40% MeOH / CH2Cl2). 3GT2 methyl ester was obtained as white foam (1.4 g, 51%).

1H NMR (300 MHz, DMSO-d6) 87.81 - 7.85 (m, 6H), 7.74 (t, J = 5.19 Hz, 3H), 7.13 (s, 1H), 5.21 (d, J = 3.3 Hz, 3H), 4.95 (dd, J = 11.25, 3.57 Hz, 3H), 4.47 (d, J = 8.25 Hz, 3H), 4.02-4.05 (m, 12H), 3.81- 3.91 (m, 6H), 3.38 - 3.73 (m, 83H), 2.53 (t, J = 6.33 Hz, 2H), 2.32 (t, J = 6.87 Hz, 2H), 2.27 (t, J = 6.33 Hz, 6H), 2.1 (s, 9H), 2.04 (t, J = 7.17 Hz, 6H), 1.99 (s, 9H), 1.88 (s, 9H), 1.76 (s, 9H), 1.45-1.54 (m, 18H).

13C NMR (75 MHz, DMSO-d6)

8 172.51, 170.65, 170.58, 170.5, 170.21, 169.94, 101.53, 71.02, 70.32, 70.21,70.03, 69.22, 68.78, 67.90, 67.24, 66.52, 61.98, 51.87, 49.90, 36.92, 36.83, 36.57, 35.59, 34.98, 29.89 , 29.13, 23.31, 22.39,21.01

F. Synthesis of 3GT3:

3GT2 methyl ester (1.4 g, 0.66 mmol) was dissolved in a solution of MeOH (30 ml) and H2O (10 ml), LiOH monohydrate (1.1 g, 26.22 mmol) was added and the reaction mixture was stirred at room temperature for 4 h. The reaction mixture was concentrated on a rotary evaporator, then diluted with H2O (10 mL). The mixture was acidified with 1N HCl, until pH = 3-4. The mixture was loaded onto a C18 column (80 g) and purified by reverse phase chromatography (ISCO) (gradient elution from 0% to 60% CH3CN / H2O). After lyophilization, 3GT3 was obtained as a colorless solid (634 mg, 55%).

1H NMR (300 MHz, DMSO-d6) 87.86 (t, J = 5.76 Hz, 3H), 7.74 (t, J = 5.76 Hz, 3H), 7.62 (d, J = 8.79 Hz, 3H), 7.15 (s, 1H), 4.48-4.63 (m, 9H, OH), 4.20 (d, J = 8.25 Hz, 3H), 3.47-3.73 (m, 52H), 3.26-3.37 (m, 4H), 2.95-3.10 (m, 12H), 2.42 (t, J = 6.33 Hz, 2H), 2.32 (t, J = 6.33 Hz, 2H), 2.27 (t, J = 6.33 Hz, 6H), 2.04 (t, J = 6.87 Hz, 6H) , 1.79 (s, 9H), 1.40-1.51 (m, 18H).

13C NMR (75 MHz, DMSO-d6)

8 173.33, 172.62, 170.91, 170.67, 170.09, 101.94, 75.82, 72.08, 70.31,70.03, 68.77, 68.45, 68.08, 67.90, 67.41,66.93, 61.03, 60.17, 52.61, 37.11, 36.93, 36.83, 36.57, 35.65, 35.52 , 29.88, 29.19, 23.60, 22.52

g. Synthesis of the GalNActricatenary Ligand (3GT5S):

EDC (5.96 mg, 0.031 mmol) and NHS (6.99 mg, 0.061 mmol) were added to a mixture of 3GT3 (36 mg, 0.021 mmol) in DMF (3 ml), and the reaction mixture was stirred at room temperature for evening. The reaction mixture was concentrated on a rotary evaporator (40 ° C), and the residue was loaded onto a C18 column (13 g) and purified by reverse phase chromatography (ISCO) (H2O gradient elution (0.1 TFA %) to 60% CH3CN / H2O (0.1% TfA)). After lyophilization, 3GT5S was obtained as an off-white solid (21 mg, 55%).

1H NMR (300 MHz, DMSO-d6) 87.85 (t, J = 5.76 Hz, 3H), 7.74 (t, J = 5.76 Hz, 3H), 7.62 (d, J = 8.79 Hz, 3H), 7.14 (s, 1H), 4.55 - 4.63 (m, 6H, OH), 4.48 (d, J = 3.84 Hz, 3H, OH), 4.20 (d, J = 7.95 Hz, 3H), 3.47 - 3.73 (m, 52H), 3.26 - 3.37 (m, 4H), 2.95 - 3.10 (m, 12H), 2.91 (t, J = 6.03 Hz, 2H), 2.80 (s, 4H), 2.32 (t, J = 6.33 Hz, 2H), 2.27 ( t, J = 6.57 Hz, 6H), 2.03 (t, J = 7.29 Hz, 6H), 1.78 (s, 9H), 1.40-1.51 (m, 18H).

Example 10. Synthesis of phosphoamidite monomer conjugated to N-acetyl galactosamine (GalNAc) with the GalNAc bound through the nucleobase

Scheme III below shows the steps involved in the synthesis of GalNac (D6) -conjugated monomers. D3 was obtained commercially and is a modified thymidine having the linker attached to the methyl group at C5.

Scheme

to. Synthesis of D4

To a solution of (E) -3- (1 - ((2R, 4S, 5R) -5 - ((bis (4-methoxyphenyl) (phenyl) methoxy) methyl) -4-hydroxytetrahydrofuran-2-yl) -2 , 4-dioxo-1,2,3,4-tetrahydropyrimidin-5-yl) -N- (6- (2,2,2-trifluoroacetamido) hexyl) acrylamide (D3) (4.55 g, 5.73 mmol, 1 equivalent, Glen Research) in methanol (24 ml) 36 ml of concentrated ammonium hydroxide solution (Fisher) were added over 5-10 minutes. The solution was stirred at room temperature and monitored by MS and TLC (silica gel, elution with 100% or 10% EtOAc (7M NH3 in MeOH) / DCM, and visualizing with UV or staining with phosphomolybodic acid (PMA) or H2SO4 / MeOH). After 24 hours, a small amount of SM still remained. K2CO3 (222 mg, 1.61 mmol, 0.28 equivalents) was added. The reaction mixture was stirred another 15 hours, at which time more K2CO3 (103 mg, 0.748 mmol, 0.13 equivalents) was added. The solution was stirred for 3 hours at room temperature. The volatiles were evaporated on a rotary evaporator (bath temperature <33 ° C). MS CI POS: 795 (1), 753.3 (5), 699.3 (100), 303.1 (20). The residue was dissolved in approximately 10% MeOH / DCM (approximately 7 ml) with sonication, and this solution was deposited on a balanced ISCO column: 80 g column (ISCO Gold), eluted with (NH37M in MeOH) / DCM 0.75% to 15%. UV 280 nm, 254 nm. The desired fractions were combined and evaporated to give a foamy solid which was triturated to an off-white powder which was dried in vacuo at room temperature for several days to give D4: 4.17 g (quantitative).

b. Synthesis of D5

5 - (((2R, 3R, 4R, 5R, 6R) -3-acetamido-4,5-diacetoxy-6- (acetoxymethyl) tetrahydro-2H-pyran-2-yl) oxy) pentanoic acid (G2 ') ( 1.60 g, 3.58 mmol, 1.20 equivalents) was dissolved in 12 ml of dry DMF at room temperature (with brief sonication). To this solution was added, in this order: triethylamine (0.60 ml, 1.44 equivalents, anhydrous Aldrich), hydroxybenzotriazole hydrate (HOBt hydrate), (0.459 g, 1.00 equivalents, CHEM-IMPEX), CMC (1.65 g, 1.30 equivalents, Aldrich), and the amine SM (D4) (2.09 g, 2.99 mmol, 1.0 equivalents). 12 ml of dry DMF was added to rinse the flask. The solution was briefly sonicated to dissolve the last bit of amine SM (D4). The clear solution was stirred under N2 at room temperature overnight, and monitored by TLC (silica gel, elute with 100% or 10% EtOAc (7M NH3 in MeOH) / DCM, and visualize with UV or stain with PmA or H2SO4 / MeOH). After 19 hours, the reaction solution was concentrated on the rotary evaporator to remove almost all of the DMF (water bath temperature <39 ° C) to give a suspension. This was dissolved in MeOH (few ml) and DCM (6 ml) and deposited on an equilibrated ISCO column and purified by flash chromatography: 120 g of silica gel, 0.5% -14% (2.3M NH3 in MeOH) in DCM. UV 214 nm, 254 nm. The desired fractions were combined and evaporated to give D5: 2.36 g (70%).

c. Synthesis of D6

D5 (2.24 g, 1.99 mmol, 1 equivalents) was dissolved in dichloromethane (30 ml, Aldrich. Anhydrous) at room temperature under N2. Diisopropylethylamine (1.40 mL, 8.18 mmol, 4.12 equivalents, Aldrich. Anhydrous) was added. The solution was stirred for a few minutes, then 2-cyanoethyl N, N-diisopropylchlorophosphoramidite (0.90 ml, 4.0 mmol, 2.0 equivalents, Toronto Research) was added via syringe, dropwise over about 1 minute. The resulting clear, nearly colorless solution was stirred at room temperature and monitored by TLC: 10% (7M NH3 in MeOH) / DCM or 10% MeOH / DCM; UV, PMA or H2SO4 / MeOH. There was very little D5 left after 3 hours. (D6 has a Rf greater than D5). After 4.5 hours, the reaction solution was quenched with 1 ml of MeOH and stirred for 5 minutes. It was then concentrated to a volume of approximately 5 ml and deposited on an equilibrated column, and purified by FC on silica gel (ISCO): 120 g column, eluting with 2% to 60% [20% (NH32.33 M in MeOH)] / DCM. The desired fractions were combined and evaporated to give a nearly colorless glassy foam solid which was dried in vacuo at room temperature to give 1.56 g (59%) of D6.

Example 11 Synthesis of dsNA comprising a stem-loop with four N-acetyl-galactosamine (GalNac) ligands in the loop

Stem-loop oligomers were produced in which the GalNac ligand is conjugated to a monomer in the loop were produced according to scheme A. (Refer to pages 208-209)

to. Synthesis of the A2 sense strand

In a 15 ml Falcon tube, compound A1 (30 mg, 0.00252 mmol) was dissolved in degassed 3: 1 dimethylacetamide / deionized water (750 µl). In a 2 ml scintillation vial, azido-Pegl 1-amine (Quanta BioDesign, order # 10524, 46 mg, (0.00806 mmol) was dissolved in degassed dimethylacetamide / deionized water 3: 1 (150 µl). scintillation of 2 ml, copper (I) bromide dimethyl sulfide complex 16.6 mg, 0.0806 mmol) was dissolved in degassed acetonitrile (300 µl).

The peg-azide solution was added to the RNA solution followed by the addition of CuBr as solution / suspension. The reaction solution turned blue-green in color upon addition of the CuBr reagent. The reaction mixture was heated to 40 ° C for 1 hour on a shaker and the reaction was monitored by LC-MS (2-40% water / ACN with 100 mM HFIP and 8.3 mM triethylamine gradient over 2 minutes, BEH C182 , 1x50 mm).

The desired product was observed by LC-MS. The reaction was quenched with 0.5M ethylenediaminetetraacetic acid, pH 8 (5 ml). This reaction was placed on the shaker for 15 minutes and then dialyzed against water (1x) using a 15 ml Millipore 10K membrane (4200 rpm, 15 minutes, 4 ° C).

The reaction mixture was purified by ion-pairing chromatography (5-25% water / acetonitrile containing 100mM triethylammonium acetate for 35 minutes, XBridge C18 19x150mm). The product fractions were pooled and dialyzed against water 3x using a 15 ml Millipore 10K membrane (4200 rpm, 15 minutes, 4 ° C) and lyophilized in a 15 ml Falcon tube to provide a white amorphous solid, Compound A2 (18 mg).

b. Synthesis of the strand in sense A3

In a 1.5 ml Eppendorf vial, Organix Compound 1 (27.6 mg, 0.066 mmol) was dissolved in anhydrous DMSO (200 µl). In a separate 15 ml falcon tube, Compound A2 (50 mg, 0.005 mmol) was dissolved in water (2000 ul) and diluted with DMSO (200 ul). The solution containing G3 was added to the solution containing Compound A2 followed by the addition of triethylamine (30.67ul).

The resulting solution was placed on a shaker and monitored by UPLC-MS for the formation of the desired product. The reaction mixture was purified by ion pairing chromatography (5-40% water / acetonitrile containing 100mM triethylammonium acetate for 35 minutes, XBridge C18 19x150mm). The product fractions were pooled and dialyzed against water 3x using a 15 ml Millipore 10K membrane (4200 rpm, 15 minutes and 4 ° C) and lyophilized in a 15 ml Falcon tube to provide a solid, amorphous, A3 strand. White.

c. Synthesis of Double A5

The A3 sense strand (13.08 mg) was dissolved in DI water (5 ml) and added to a vial containing the A4 antisense strand (complementary to A3, commercially obtained) (0.812 mg) in water (0.812 ml). The resulting solution was mixed and heated at 90 ° C for 3 minutes and allowed to cool to room temperature for 5 minutes. The solution was lyophilized to provide double as a white amorphous solid, double A5.

Example 12. Synthesis of stem-loop dsNA with three GalNac ligands in the loop

A stem-loop oligomer was produced with the GalNac conjugated monomers in the loop. The following scheme illustrates the synthesis of the conjugated stem-loop oligomer of GalNac where the GalNac monomers are confined to the loop and are three in number (Scheme B) as shown on pages 216-217.

The B1 sense strand and the B3 sense strand complementary strand (designated B4 antisense) were obtained by synthesis from commercial manufacturers using standard solid phase nucleic acid synthesis procedures. The B2 sense strand was synthesized in a similar manner to the A2 sense strand synthesis as described above. The sense strand B3 was synthesized in a similar manner to the synthesis of the sense strand A3 as described above. Double B5 was synthesized in a similar manner to the synthesis of compound A5 as described above.

Example 13. Synthesis of stem-loop dsNA with branched GalNac ligands in the loop

A stem-loop oligomer was produced with the GalNac conjugated monomers in the loop. Scheme C illustrates the synthesis of the conjugated stem-loop oligomer of GalNac where the GalNac monomer is confined to the loop and contains a tri-stranded GalNac ligand as shown in Scheme C (Refer to pages 218-219) as 3GT3.

The C1 sense strand and the C3 complementary strand (referred to as the C4 antisense strand) were obtained by synthesis from commercial manufacturers using standard solid phase nucleic acid synthesis procedures. The C2 sense strand was synthesized in a similar manner to the synthesis of compound A2 as described above.

In a 15 ml falcon tube, the detection strand C2 (24 mg, 0.002 mmol) was dissolved in water (400 µl) and then diluted with DMSO (1000 µl). In a separate 1.5 ml Eppendorf vial, the 3GTS compound (40.79 mg, 0.023 mmol) was dissolved in anhydrous DMSO (150 µl). To the solution containing 3GTS, HATU ((1- [Bis (dimethylamino) methylene] -1H-1,2,3-triazolo [4,5-b] pyridinium 3-oxydi hexafluorophosphate, 8.93 mg, 0.023 mmol) in DMSO (50 ul) and N, N-diisopropylethylamine (8.2 ul, 0.047 mmol) was added After 5 minutes, the solution containing the C2 strand was added to the reaction mixture.

The reaction mixture was placed on a shaker and monitored by UPLC-MS for the desired product formation. The reaction mixture was purified by ion pairing chromatography (5-40% water / acetonitrile containing 100mM triethylammonium acetate for 35 minutes, XBridge C18 19x150mm). Product fractions were pooled and dialyzed against water 3x using a 15 ml Millipore 10K membrane (4200 rpm, 15 minutes, 4 ° C) and lyophilized in a 15 ml Falcon tube to provide a C3 white stranded amorphous solid . The double C5 was synthesized in a similar manner to the synthesis of the double A5 as described above.

Example 14. Synthesis of stem-loop dsNA with four GalNac ligands on the stem

A stem-loop oligomer was produced with the GalNac conjugated monomers on the stem. The following scheme illustrates the synthesis of the GalNac conjugated stem-loop oligomer where the GalNac monomers are confined to the stem and are four in number (Scheme D) as shown on pages 220-221.

The D1 sense strand and the D3 complementary strand (referred to as the D4 antisense strand) were obtained by synthesis from commercial manufacturers using standard solid phase nucleic acid synthesis procedures. The D2 sense strand was synthesized in a similar manner to the A2 sense strand synthesis as described above. The D3 sense strand was synthesized in a similar manner to the A3 sense strand synthesis as described above. Double D5 was synthesized in a manner similar to the synthesis of compound A5 as described above.

Example 15 Synthesis of dsNA oligomers with multiple GalNac ligands in the 5 'extension of the antisense strand

A dsNA oligomer was produced with GalNac-conjugated monomers in the 5 'extension region of the antisense strand. The following scheme illustrates the synthesis of a dsNA oligomer comprising GalNac ligands where the ligands are confined to extension in the 5 'region of the antisense strand and are four in number (Scheme E, refer to pages 222-233) . However, the number of GalNac-conjugated monomers could vary and the position of the GalNac ligands can also vary anywhere along the antisense strand.

The E1 antisense strand and the E2 complementary strand (referred to as the E3 sense strand) were obtained by synthesis from commercial manufacturers using standard solid phase nucleic acid synthesis procedures. The strand E2 antisense was synthesized similarly to the schemes described above. The double E4 was synthesized in a similar manner to the synthesis of the double A5 as described above.

Example 16. Synthesis of dsNA with Multiple GalNac Ligands in the 5 'Extension of the Downstream Strand

A dsNA oligomer was produced with GalNac-conjugated monomers in the 5 'extension region of the sense strand. The following scheme illustrates the synthesis of a dsNA oligomer comprising GalNac ligands where the ligands are confined to extension in the 5 'region of the sense strand and are four in number (Scheme F, refer to pages 224- 225). However, the number of GalNac-conjugated monomers could vary and the position of the GalNac ligands can also vary anywhere along the sense strand.

The F1 sense strand and the F2 complementary strand (referred to as the F3 antisense strand) were obtained by synthesis from commercial manufacturers using standard solid phase nucleic acid synthesis procedures. The F2 sense strand was synthesized in a similar manner to the A3 sense strand synthesis as described above. The double F4 was synthesized in a similar manner to the synthesis of the double A5 as described above.

Example 17. Synthesis of dsNAs with multiple N-acetyl-galactosamine ligands separated by a spacer in the 5 'extension of the downstream strand separated by a spacer

A dsNA oligomer with GalNac-conjugated monomers was produced in the 5 'extension region of the sense strand separated by a spacer. The following scheme illustrates the synthesis of a dsNA oligomer comprising GalNac ligands where the ligands are confined to extension in the 5 'region of the sense strand and are four in number (Scheme G, refer to pages 226-227 ). However, the number of GalNac-conjugated monomers could vary and the position of the GalNac ligands can also vary anywhere along the sense strand. The extension comprising GalNac ligands separated by a spacer can also be placed in the 5 'region of the antisense strand.

The G1 sense strand and the G2 complementary strand (referred to as the G3 antisense strand) were obtained by synthesis from commercial manufacturers using standard solid phase nucleic acid synthesis procedures. The G2 sense strand was synthesized in a similar manner to the A3 sense strand synthesis as described above. The double G4 was synthesized in a similar manner to the synthesis of the double A5 as described above.

Example 18. Synthesis of dsNAs with multiple N-acetyl-galactosamine ligands separated by two spacers in the 5 'extension of the downstream strand

A dsNA oligomer with GalNac-conjugated monomers was produced in the 5 'extension region of the sense strand separated by two spacers. The following scheme illustrates the synthesis of a dsNA oligomer comprising GalNac ligands where the ligands are confined to extension in the 5 'region of the sense strand and are four in number (Scheme H, refer to pages 228-229 ). However, the number of GalNac-conjugated monomers, the number of spacers could vary and the position of the GalNac ligands can also vary anywhere along the sense strand. The stretch comprising spacer-separated GalNac ligands can also be placed in the 5 'region of the antisense strand.

The H1 sense strand and the H2 complementary strand (referred to as the H3 antisense strand) were obtained by synthesis from commercial manufacturers using standard solid phase nucleic acid synthesis procedures. The H2 sense strand was synthesized in a similar manner to the A3 sense strand synthesis as described above. The double H4 was synthesized in a similar manner to the synthesis of the double A5 as described above.

Example 19. Synthesis of dsNA oligomers with multiple GalNac ligands in the 5 'extension of the downstream strand double separated by multiple spacers

A dsNA oligomer with GalNac-conjugated monomers was produced in the 5 'extension region of the downstream strand separated from the double region by multiple spacers. The following scheme illustrates the synthesis of a dsNA oligomer comprising GalNac ligands where the ligands are confined to extension in the 5 'region of the sense strand and are four in number and twice separated by multiple spacers. (Scheme I, refer to pages 230-231). However, the number of GalNac-conjugated monomers, the number of spacers could vary and the position of the GalNac ligands can also vary anywhere along the sense strand. The extension comprising GalNac ligands separated by double spacers can also be placed in the 5 'region of the antisense strand.

The I1 sense strand and the I2 complementary strand (designated antisense strand 13) were obtained by synthesis from commercial manufacturers using standard solid phase nucleic acid synthesis procedures. The sense I2 strand was synthesized in a similar manner to the synthesis of the sense A3 strand as described above. Double I4 was synthesized in a similar manner to the synthesis of double A5 as described above.

Example 20. Synthesis of dsNA oligomers with multiple GalNac ligands in the 5 'extension of the antisense strand separated by two spacers

A dsNA oligomer with GalNac-conjugated monomers was produced in the 5 'extension region of the antisense strand separated by two spacers. The following scheme illustrates the synthesis of a dsNA oligomer comprising GalNac ligands where the ligands are confined to extension in the 5 'region of the antisense strand and are four in number (Scheme J, refer to pages 232-233) . However, the number of conjugated GalNac monomers, the number of spacers could vary and the position of the GalNac ligands can also vary anywhere along the antisense strand. The extension comprising GalNac ligands separated by spacers can also be placed in the 5 'region of the sense strand.

The J1 antisense strand and the J2 complementary strand (referred to as the J3 antisense strand) were obtained by synthesis from commercial manufacturers using standard solid phase nucleic acid synthesis procedures. The antisense strand J1, J2 was synthesized similarly to the synthesis of the sense strand A3 as described above. The double J4 was synthesized in a similar manner to the synthesis of the double A5 as described above.

Example 21 Synthesis of dsNA oligomers with multiple GalNac ligands in the 5 'extension of the antisense strand double separated by multiple spacers

A dsNA oligomer with GalNac-conjugated monomers was produced in the 5 'extension region of the antisense strand separated from the double region by multiple spacers. The following scheme illustrates the synthesis of a dsNA oligomer comprising GalNac ligands where the ligands are confined to extension in the 5 'region of the antisense strand and are four in number and doubled by multiple spacers. (Scheme K1, refer to pages 235-236). However, the number of conjugated GalNac monomers, the number of spacers could vary and the position of the GalNac ligands can also vary anywhere along the antisense strand. The stretch comprising GalNac ligands separated by double spacers can also be placed in the 5 'region of the sense strand.

The K1 antisense strand and the K2 complementary strand (referred to as the K3 antisense strand) were obtained by synthesis from commercial manufacturers using standard solid phase nucleic acid synthesis procedures. The antisense strand K1 and K2 were synthesized in a similar manner to the synthesis of the A3 sense strand as described above. The double K4 was synthesized in a similar manner to the synthesis of the double A5 as described above.

Example 22. In Vitro Self-Administration of GalNAc-Conjugated SiRNAs to Cultured Mouse Hepatocytes

8-10 week old female CD-1 or C57-BL / 6 mice were used for primary hepatocyte preparation. The mice were anesthetized with isoflurane. Once anesthetized, the abdominal cavity was opened and the vena cava was cannulated with an 18-gauge catheter and the portal vein was cut to drain the blood from the liver. The liver was perfused with perfusion regulator [HBSS, 1 mM EDTA (Boston Bioproducts)] for 5-10 minutes, at a flow rate of 5 ml / min until the perfusate was clear. The liver was then perfused with collagenase II regulator [DMEM (Gibco), 1% b Sa (Fisher), 0.8 mg / ml collagenase I (Worthington laboratories)] at 37 ° C for 5-10 minutes. The digested liver was transferred to cold solution III [DMEM (Gibco), 1% BSA (Fisher)] and triturated. The cell suspension was passed through a 70 µm mesh (Corning) and centrifuged at 50 x g for 3 minutes. The supernatant was discarded and the pellet was washed in cold Solution III two more times, followed by a William buffer wash with thaw and coat supplements (Life Technologies). The viability and concentration of the hepatocytes were estimated by exclusion of Trypan blue and counting on a hemocytometer. Cells were seeded in collagen I coated 96-well plates (Corning) at a concentration of 5x104 cells per well and incubated at 37 ° C, 5% CO2 in a humidified atmosphere for 4-5 hours. The medium was changed to William's medium with maintenance supplements (Life Technologies) and varying concentrations of GalNAc-conjugated oligonucleotides were added to the medium and the cells were incubated for 24 hours, after which the medium was renewed and the cells grew for another 24 hours. Cells were then lysed and RNA was purified using SV96 kit (Promega), RNA was reverse transcribed using Transcriptor First Strand Synthesis Kit (Roche).

The relative amount of the target gene was measured by multiplexed qPCR on a Bio-Rad CFX96 system, normalized to a multiplexed housekeeping gene. The remaining percentage of a selected transcript relative to an untreated control was calculated and IC50 values were estimated by non-linear regression. Examples of in vitro self-administration data (without the use of transfectants) of selected compounds / conjugates are shown in Figure 25 A and B. Figure 25A shows the activity of dsNA molecules with extension and Figure 25B shows the activity of dsNA molecules with tetraloop. Extension molecules differ from each other in the pattern and nature of the modifications, as illustrated by the digramatic keys in the figure. Also, the tetraloop molecules in Figure 25B differ from each other in the pattern and nature of the modifications. The sequence information for the dsNA molecules is shown in Table 3. These data demonstrated that GalNAc dsNA conjugates, including the 5 'stretch and the notched tetraloop, are self-administered to primary hepatocytes in culture with IC50 nM low.

Example 23. In vitro cell free binding to CD301

The binding of monovalent and triple-stranded N-acetyl-galactosamine constructs was estimated using a fluorescence polarization competition binding assay. The tracer ligand was an N-acetyl-galactosamine construct synthesized custom tri-stranded FITC - 3GT1'-FITC. A constant concentration of 4 µg / ml of macrophage asialoglycoprotein receptor - CD301 (R&D systems) and 50 nM 3GT1 '-FITC were incubated at 25 ° C in binding buffer (20 mM HEPES pH 7.4, 150 NaCl mM, 21 mM CaCl, 0.5 mM MgCh) along with varying concentrations of dsNAs. Fluorescence polarization measurements were performed after 30 minutes on a Spectramax M5 microplate reader (Molecular Devices). Binding of dsNA conjugates was estimated as a decrease in polarization units through the shift of 3GT1'-FITC from CD301. The relative binding of each dsNA conjugate is estimated through nonlinear regression and calculation of IC50 values. Examples of in vitro binding data for selected compounds / conjugates are shown in Figure 13. These data demonstrated that dsNA conjugates based on the 5 'extension and the notched tetra-loop binding ASLOpr effectively and in many cases showed better binding affinity compared to the tris-based GalNAc Tris linker (DP2465P: DP2382G). .

Cell-free binding to CD301 of a dsNA conjugate linked to GalNAc ligands through an acetal linker (see Example 25 for synthesis) and a dsNA conjugate linked to GalNAc ligands through a 2'-triazole linker was comparable (Figure 48). These two dsNA agents contained the same nucleic acid sequence and the GalNAc ligand so that only the linker differed between the two agents. The cell-free binding of the dsNA conjugate to the 2'-triazole linker of Figure 48 and a dsNA conjugate to the same triazole linker, but with the same length of the PEG linker as the acetal linker of Figure 48 also were comparable (Refer to Figure 49). This shows that the use of an acetal linker in place of the 2'-triazole linker did not damage the binding of the dsNA conjugate. It is interesting to note that the activity of the dsNA molecules in terms of abrogation of the target or binding to the receptor was not greatly affected due to the increase or decrease in the length of the linker. It was surprising to learn that the acetal linker was able to survive the rigors of nucleic acid synthesis and was still functional under in vivo / in vitro conditions to deliver the conjugate to the receptor. (Refer to Figures 48-50).

The in vitro removal potency of the two GalNAc dsNAs described above was tested with triazole linkers, but with PEG segments of different length from the linker. Figure 50 shows that the two dsNA conjugates had comparable intrinsic knockout potency in mice, demonstrating that changing the length of PEG in the linker did not change the in vivo function of the dsNA agent.

GalNAc ligand preparations, GalNAc-containing monomers, and GalNAc oligonucleotide conjugates are described below in the examples and synthetic schemes. The specific oligonucleotide sequences used for the compounds and / or conjugates described below are shown in Table 3.

Example 24. In vivo evaluation of IRNA stability, immunogenicity and activity

Diseased or wild-type engineered mice were dosed by subcutaneous or intravenous injection in less than 200 ul volume. The animals were observed for behavioral or physiological changes. For pharmacokinetic and pharmacodynamic analysis, animals were sacrificed 24 to 168 hours after the last dose, as indicated by CO2 asphyxia. Blood and tissue samples were collected following standard procedures. For mRNA analysis, tissues were stored in the freezer later until RT-qPCR was performed following standard protocols. Frozen tissues were also collected for western and immunohistochemical analysis. Urine samples were collected and metabolites were analyzed during the course of the study using the enzymatic or LC / MS method. Cytokine, blood cell count, and blood chemistry analysis was performed following standard procedures. Examples of in vivo data of selected compounds / conjugates are shown in Figures 27, 28, 29 and 30. These data demonstrated that GalNAc dsNA conjugates that include the 5 'extension on the sense strand and tetraloop constructs with Notch are active in knocking down target mRNA in vivo in mice when dosed subcutaneously and intravenously.

Example 25. Synthesis of the phosphoamidite monomer conjugated to N-acetyl galactosamine (GalNAc) with the GalNAc attached through the 2'-acetal linker

Not only can the GalNAc ligand bind to the nucleoside monomer nucleobase (i.e. the C5 position of thymidine as shown in example 8, 9), but it can also bind to the ribose sugar via 2'-OH (or 3'-OH) with a linker. The 2'-OH as a conjugation site is particularly useful in the case of tetraloop siDNAs because the 2'-OH of the four nucleotides in the loop are exposed to the solvent and are not involved in hydrogen bonding and base stacking. which is necessary to form the stable loop based on its crystal structure. The acetal chemistry used to install the linker in 2'-OH (shown in Schemes IV-VI below, refer to pages 198-200) is much gentler compared to traditional alkylation conditions; therefore, allow selective conjugation to the 2 'position. This will avoid tedious separation of the mixture of 2 'and 3' isomers and will significantly improve performance. The synthesis of compounds 2-4 is depicted in Scheme IV, the synthesis of compounds 5-9 is depicted in Scheme V, and the synthesis of compounds 10 and 11 is depicted in Scheme VI. (Refer to page 198-200).

to. Synthesis of Compound 2

2- (2-aminoethoxy) ethanol (105.0 g), triethylamine (101.0 g) and ethyl trifluoroacetate were added to a flask and the mixture was stirred for 24 h. Dichloromethane (1 L) was added and the solution was washed with water (500 ml). The organic layer was dried (MgSO4) and evaporated to give a liquid (161.0 g).

b. Synthesis of Compound 3

The mixture of compound 2 (161.0 g) and paraformaldehyde (24.0) in methylene chloride (200 ml) was cooled in an ice bath with stirring. Anhydrous hydrogen chloride was bubbled through the mixture for 3 h. The reaction mixture was allowed to room temperature and two clear homogeneous layers separated. The organic layer was dried over anhydrous calcium chloride and concentrated on a rotary evaporator to liquid (201 g).

c. Synthesis of Compound 4

The obtained compound 3 was dissolved in acetonitrile (200 ml) and sodium acetate (100 g) was added. The mixture was stirred at room temperature for 14 h. The precipitate was filtered; the filtrate was concentrated on a rotary evaporator to liquid. The residue was dissolved in ethyl acetate (100 ml) and washed with a 10% aqueous sodium hydrogen carbonate solution (50 ml) and water (2x50 ml). The organic layer was dried over anhydrous sodium sulfate and concentrated on a rotary evaporator to liquid (176.0 g) (MS M-1: 272.0).

d. Synthesis of Compound 69

To a cold solution (-15 ° C) under nitrogen of nucleoside 5 (61.3 g) and compound 4 (55 g) in 1,2-dichloromethane (500 ml), tin tetrachloride (18 ml) was added and the solution it was kept at -12 ° C for 20 min. A saturated aqueous sodium hydrogen carbonate solution (500 ml) and methylene chloride (1 L) were added and the suspension was stirred at 0 ° C for 20 min. The suspension was filtered, the organic layer was separated, washed with water (200 ml), dried over anhydrous sodium sulfate and evaporated to dryness. The residue was purified by silica gel column chromatography. The column was eluted with methylene chloride-methanol (100: 0-95: 5), and then evaporation of the appropriate fractions to give compound 6 as a foam (55.2 g) (MS M-1: 825.4).

and. Synthesis of Compound 7

Nucleoside 6 (55 g) was dissolved in 0.5 M tetrabutylammonium fluoride trihydrate in tetrahydrofuran (1 L), kept for 10 minutes at 20 ° C, evaporated to dryness, evaporated with chloroform (10 ml) and applied on a silica gel column. The column was eluted with methylene chloride-methanol (100: 0-90: 10), and then evaporation of the appropriate fractions to give compound 7 as a foam (30.5 g) (MS M-1: 583.2).

F. Synthesis of Compound 8

Nucleoside 7 (30.0 g) was dried by evaporation with pyridine (2x20 ml). The residue was dissolved in dry pyridine (300 ml), dimethoxytrityl chloride (18.2 g) was added and the resulting solution was kept for 16 h at 20 ° C. MeOH (10 ml) was added and after 30 minutes the mixture was concentrated in vacuo to near dryness. The residue was dissolved in methylene chloride (500 ml) and washed with a 10% aqueous solution of sodium bicarbonate (200 ml) and water (2x200 ml). The organic layer was dried over anhydrous sodium sulfate, evaporated in vacuo, evaporated with toluene (2x100 ml) and purified by column chromatography on silica gel. The column was eluted with methylenemethanol chloride (100: 0-90: 5), and then evaporation of the appropriate fractions to give compound 8 as a foam (40.5 g) (MS M-1: 885.3).

g. Phosphoramidite synthesis [Compound 9]

The dimethoxytritylated derivative 8 (40.0 g) was dissolved in 600 ml of dichloromethane under argon and ethyl- (diisopropyl) amine (10 ml) and 2-cyanoethyl diisopropylphosphoramidochloridite (16.0 g) were added. After stirring the solution for 3 h, TLC indicated complete reaction. A 10% aqueous sodium hydrogen carbonate solution (2 ml) was added, the solution was stirred for 10 minutes and partitioned between methylene chloride (500 ml) and aqueous sodium carbonate (300 ml). The organic phase was washed with aqueous sodium chloride (2x300 ml) and the aqueous phases were re-extracted with methylene chloride (200 ml). Evaporation of the organics left an oil, which was rapidly purified on silica gel (hexane-ethyl acetate, 20:80) to provide the product as a foam after co-evaporation (36.5 g) (MS M-1: 1085.4). Compound 11 was made from nucleoside 10 in the same manner as described above. Similarly, Schemes VII (Refer to pages 201-202) and VlII (Refer to page 203) represent the production of compound 17, the procedures described above can be adopted to make compound 17.

Example 26. Synthesis of Cholesterol Conjugated Tetraloop Notched dsNA with Cholesterol Ligands in the Loop

Cholesterol-conjugated dsNA molecules can be produced following established protocols for the synthesis of GalNAc-conjugated dsNA molecules. Cholesterol-conjugated dsNA molecules are synthesized using post conjugation to the solid phase via standard click chemistry methods. or amide. In one example, cholesterol-conjugated dsNA molecules are made by solid phase synthesis using cholesterol phosphoramidites.

A stem-loop dsNA having cholesterol-conjugated nucleotides in the loop is produced using click chemistry, for example, as shown in Scheme L (Refer to page 239-240). Compound K2 required for synthesis is produced following the protocol illustrated in Scheme Kb (Refer to pages 237-238). In one example, a stem-loop dsNA is produced having cholesterol-conjugated nucleotides in the loop using amide chemistry, eg, as shown in Scheme L1 (Refer to page 241-242). Schemes L and L1 illustrate the synthesis of cholesterol-conjugated stem-loop dsNA where cholesterol monomers are confined to the loop and have a unique number. Similarly, Scheme M (Refer to pages 243-244) illustrates the synthesis of cholesterol-conjugated stem-loop dsNA molecules in which the cholesterol monomers are confined to the loop, but are multiple in number.

The sense strand and its complementary antisense strand, as shown in the schemes mentioned above, are obtained by synthesis from commercial manufacturers using standard solid phase nucleic acid synthesis procedures. The sense strand is synthesized in a similar manner to the synthesis of the A3 sense strand as described above. The double shown in the schemes mentioned above is synthesized in a similar manner to the synthesis of the A5 double as described above.

Example 27. Synthesis of Cholesterol-Conjugated Tetraloop Notched dsNA with Stem Cholesterol Ligands

A stem-loop dsNA having cholesterol-conjugated nucleotides in the stem is produced using click chemistry, eg, as shown in Scheme N (Refer to pages 245-246).

Compound K2 required for synthesis is produced following the protocol illustrated in Scheme Kb. Scheme N (Refer to pages 245-246) illustrates the synthesis of cholesterol-conjugated stem-loop dsNA in which cholesterol monomers they are confined to the root and have a singular number. Similarly, Scheme O (Refer to pages 247-248) illustrates the synthesis of cholesterol-conjugated stem-loop dsNA molecules in which the cholesterol monomers are confined to the stem, but are multiple in number.

The sense strand and the complementary antisense strand, as shown in the schemes mentioned above, are obtained by synthesis, from commercial manufacturers, using standard solid phase nucleic acid synthesis procedures. The sense strand is synthesized in a similar manner to the synthesis of the A3 sense strand as described above. The double shown in the schemes mentioned above is synthesized in a similar manner to the synthesis of the A5 double as described above.

Example 28. Synthesis of dsNAs with cholesterol ligands in the 5 'extension of the antisense strand

A dsNA molecule having cholesterol-conjugated nucleotides in the 5 'extension of the antisense strand is produced using post-solid phase conjugation via click chemistry, for example, as shown in Scheme P (Refer to pages 249 -250). Compound K2 required for synthesis can be produced following the protocol illustrated in Scheme Kb. (Refer to pages 237-238).

Scheme P1 (Refer to pages 251-252) illustrates the solid phase synthesis of cholesterol-conjugated dsNA molecules using cholesterol phosphoramidites, where the cholesterol monomers are confined to the 5 'extension of the antisense strand, and they are singular in number. However, the number of cholesterol-conjugated monomers can vary, for example, a ligand can be conjugated at the first, second, third, fourth, fifth position from the 5 'end or the 3' end of the antisense strand or at a position beyond fifth position. Scheme Q (Refer to pages 253-254) illustrates subsequent solid phase conjugation of cholesterol to dsNA molecules using click chemistry in which cholesterol monomers are confined to the 5 'extension of the antisense strand, but they are multiple in numbers. Scheme Q1 (Refer to page 255-256) illustrates the solid phase synthesis of cholesterol-conjugated dsNA molecules using cholesterol phosphoramidites, where the cholesterol monomers are confined to the 5 'extension on the antisense strand, but they are multiple in numbers.

The sense strand and its complementary antisense strand, as shown in the schemes mentioned above, are obtained by synthesis, from commercial manufacturers, using standard solid phase nucleic acid synthesis procedures. The sense strand is synthesized in a similar manner to the synthesis of the A3 sense strand as described above. The double shown in the schemes mentioned above will be synthesized similarly to the synthesis of double A5 as described above.

Example 29 Synthesis of dsNAs with cholesterol ligands in the 5 'extension of the sense strand

A dsNA molecule having cholesterol-conjugated nucleotides in the 5 'extension of the sense strand is produced using post-solid phase conjugation via click chemistry, for example, as shown in Scheme R (Refer to pages 257-258). Compound K2 required for synthesis is produced following the protocol illustrated in Scheme Kb.

Scheme R1 (Refer to pages 259-260) illustrates the solid phase synthesis of the cholesterol-conjugated dsNA molecule using cholesterol phosphoramidites, where the cholesterol monomers are confined to the 5 'extension of the downstream strand. , and have a singular number. However, the number of cholesterol-conjugated monomers can vary, for example, a ligand is conjugated at the first, second, third, fourth, fifth position from the 5 'end or the 3' end of the sense strand or at a position beyond fifth position. Using the synthetic schemes previously discussed, the number of cholesterol-conjugated nucleotides is varied, as well as the position of the cholesterol ligands, for example, a ligand can also be anywhere along the sense strand.

The sense strand and its complementary antisense strand, as shown in the schemes mentioned above, are obtained by synthesis from commercial manufacturers using standard solid phase nucleic acid synthesis procedures. The sense strand is synthesized in a similar manner to the synthesis of the A3 sense strand as described above. The double shown in the schemes mentioned above is synthesized in a similar manner to the synthesis of the A5 double as described above.

Example 30. Synthesis of dsNAs with multiple cholesterol ligands in the 5 'extension of the forward strand separated by one or more spacers

A dsNA with cholesterol-conjugated nucleotides in the extended 5 'region of the sense strand, the nucleotides separated by a spacer are produced following protocols developed for the synthesis of similar dsNA molecules comprising a GalNAc ligand. Schemes G, H, I, J, and K (Refer to pages 226-237) describe the synthesis of GalNAc-conjugated dsNA molecules where the ligand-conjugated nucleotides are separated by one or more spacers. Cholesterol-conjugated nucleotides can be in the stem region or in the loop region, in the 5 'extension of the sense strand, or the 5' extension of the antisense strand, the 3 'extension of the sense strand or the 3 'extension of the antisense strand or a combination of any of the options mentioned above. Schemes G, H, I, J and K produce specific products for GalNAc ligand conjugation, they are easily adapted and modified to produce with cholesterol ligand conjugates. The mode of conjugation of ligand to nucleotide is similar and can occur by postsynthetic conjugation by click chemistry or amide chemistry or solid phase synthesis using ligand phosphoramidites.

Example 31. Synthesis of Loop-Conjugated Folate-Conjugated Notched Tetraloop dsNA

Folate-conjugated dsNA molecules are produced following established protocols for the synthesis of GalNAc-conjugated dsNA molecules. Folate-conjugated dsNA molecules are synthesized using post-solid phase conjugation, via standard click or amide chemistry methods. In one example, folate-conjugated dsNA molecules are made by solid phase synthesis using folate phosphoramidites.

A stem-loop dsNA having folate-conjugated nucleotides in the loop is produced using click chemistry, eg, as shown in Scheme U (Refer to pages 264-265). Compound S6 (click chemistry) or S13 (amide chemistry) required for synthesis is produced following the protocol illustrated in Schemes S (Refer to pages 264-265) and T (Refer to page 263) respectively . The production of compounds T7 and S13 is depicted in Schemes T and S, respectively, following the same protocols used to prepare GalNAc conjugates as described above. In one example, a stem-loop dsNA having folate-conjugated nucleotides in the loop is produced using amide chemistry, for example, as shown in scheme U1. Schemes U (Refer to pages 264-265) and U1 (Refer to page 266) illustrate the synthesis of loop folate conjugated dsNA where the folate monomers are confined to the loop and have a unique number. Similarly, Schemes V (Refer to pages 267-268) and VI (Refer to pages 269-270) illustrate the synthesis of folate loop and stem conjugated dsNA molecules in which the folate monomers are confined to the loop, but multiple in number.

The sense strand and its complementary antisense strand, as shown in the schemes mentioned above, are obtained by synthesis from commercial manufacturers using standard solid phase nucleic acid synthesis procedures. The sense strand is synthesized in a similar manner to the synthesis of the A3 sense strand as described above. The double shown in the schemes mentioned above is synthesized in a similar manner to the synthesis of the A5 double as described above.

Example 32. Synthesis of Stem-Conjugated Folate-Conjugated Notched Tetraloop dsNA

A stem-loop dsNA having folate-conjugated nucleotides in the stem is produced using click chemistry, eg, as shown in Scheme W (Refer to pages 271-272). Compound S6 (click chemistry) or S13 (amide chemistry) required for synthesis is produced following the protocol illustrated in Schemes S (Refer to pages 261-262) and T (Refer to page 263) respectively . Scheme W1 (Refer to pages 273-274) illustrates the synthesis of folate stem and loop conjugated dsNA using amide chemistry, where the folate monomers are confined to the stem and have a unique number. Similarly, Schemes X (Refer to pages 275-276) and XI (Refer to pages 277-278) illustrate the synthesis of folate-conjugated dsNA molecules where the folate monomers are confined to the stem, but are multiple in number.

The sense strand and its complementary antisense strand, as shown in the schemes mentioned above, are obtained by synthesis from commercial manufacturers using standard solid phase nucleic acid synthesis procedures. The sense strand is synthesized in a similar manner to the synthesis of the A3 sense strand as described above. The double shown in the schemes mentioned above is synthesized in a similar manner to the synthesis of the A5 double as described above.

Example 33 Synthesis of dsNAs with folate ligands in the 5 'extension of the antisense strand

A dsNA molecule having folate-conjugated nucleotides in the 5 'extension of the antisense strand can be produced using solid post-phase conjugation via click chemistry, for example, as shown in Scheme Y (Refer to pages 279- 280). Compound S6 (click chemistry) or S13 (amide chemistry) required for synthesis can be produced following the protocol illustrated in Schemes S (Refer to pages 261-262) and T (Refer to page 263) respectively.

Scheme Y1 (Refer to pages 281-282) illustrates the solid phase synthesis of the folate-conjugated dsNA molecule using folate phosphoramidites, where the folate monomers are confined to the 5 'extension of the antisense strand, and they have a singular number. However, the number of folate-conjugated monomers can vary, for example, a ligand can be conjugated at the first, second, third, fourth or fifth position from the 5 'end or the 3' end of the antisense strand or at a position beyond fifth position. Scheme Z (Refer to pages 283-284) illustrates subsequent solid phase conjugation of folate to dsNA molecules using click chemistry in which the folate monomers are confined to the 5 'extension of the antisense strand, but they are multiple in numbers. Scheme Z1 (Refer to pages 285-286) illustrates the solid phase synthesis of folate-conjugated dsNA molecules using folate phosphoramidites, where the folate monomers are confined to the 5 'extension on the antisense strand, but they are multiple in numbers.

The sense strand and its complementary antisense strand, as shown in the schemes mentioned above, are obtained by synthesis from commercial manufacturers using standard solid phase nucleic acid synthesis procedures. The sense strand is synthesized in a similar manner to the synthesis of the A3 sense strand as described above. The double shown in the schemes mentioned above is synthesized in a similar manner to the synthesis of the A5 double as described above.

Example 34 Synthesis of dsNAs with folate ligands in the 5 'extension of the sense strand

Folate-conjugated dsNA molecules are produced following established protocols for the synthesis of GalNAc-conjugated dsNA molecules. Folate-conjugated dsNA molecules are synthesized using post-solid phase conjugation via standard click or amide chemistry methods. In one example, folate-conjugated dsNA molecules are made by solid phase synthesis using folate phosphoramidites.

A dsNA molecule having folate-conjugated nucleotides in the 5 'extension of the sense strand is produced using post-solid-phase conjugation via click chemistry, for example, as shown in scheme AA (Refer to pages 287-288). Compound S6 (click chemistry) or S13 (amide chemistry) for synthesis is produced following the protocol illustrated in Schemes S (Refer to pages 261-262) and T (Refer to page 263) respectively.

Scheme AA1 (Refer to pages 289-290) illustrates the solid phase synthesis of the folate-conjugated dsNA molecule using folate phosphoramidites, where the folate monomers are confined to the 5 'extension of the upstream strand. , and are singular in number. However, the number of folate-conjugated monomers can vary, for example, a ligand can be conjugated at the first, second, third, fourth or fifth position from the 5 'end or the 3' end of the sense strand or one position beyond fifth position. Using the synthetic schemes previously discussed, the number of folate-conjugated nucleotides can be varied, as well as the position of the folate ligands, for example, a ligand can also be anywhere along the sense strand.

The sense strand and its complementary antisense strand, as shown in the schemes mentioned above, are obtained by synthesis from commercial manufacturers using standard solid phase nucleic acid synthesis procedures. The sense strand is synthesized in a similar manner to the synthesis of the A3 sense strand as described above. The double shown in the schemes mentioned above is synthesized in a similar manner to the synthesis of the A5 double as described above.

Example 35. Synthesis of dsNAs with multiple folate ligands in the 5 'extension of the downstream strand separated by one or more spacers

A dsNA with nucleotides conjugated with folate in the extended region 5 'of the sense strand, the nucleotides being separated by a spacer, is produced following the protocols developed for the synthesis of similar dsNA molecules in which the ligand is GalNAc. Schemes G, H, I, J, and K (Refer to pages 226-237) describe the synthesis of GalNAc-conjugated dsNA molecules where the ligand-conjugated nucleotides are separated by one or more spacers. Folate-conjugated nucleotides can be in the 5 'extension of the sense strand, the 5' extension of the antisense strand, the 3 'extension of the sense strand, or the 3' extension of the antisense strand, or a combination of any. of the above options. Schemes G, H, I, J and K specific for GalNAc ligand conjugation are easily adapted and modified to produce folate ligand conjugates. The mode of ligand to nucleotide conjugation is similar and often occurs via postsynthetic conjugation via click chemistry or amide chemistry or solid phase synthesis using ligand phosphoramidites. Scheme V (Refer to pages 267-268) and V1 (Refer to pages 269-270) shows the synthesis of folate tetraloop dsNA conjugates with sample with multiple folates in the loop using the conjugation method of Subsequent solid phase using click chemistry as described above for GalNAc conjugates.

Example 36. Synthesis of mannose-6-phosphate conjugated tetraloop notched dsNA with mannose-6-phosphate ligand in the loop

Mannose-6-phosphate conjugated dsNA molecules are produced following established protocols for the synthesis of GalNAc-conjugated dsNA molecules. Mannose-6-phosphate conjugated dsNA molecules can be synthesized using post-solid phase conjugation via standard click or amide chemistry methods.

A stem-loop dsNA having mannose-6-phosphate conjugated nucleotides in the loop is produced using click chemistry, for example, as shown in Scheme AB (Refer to pages 291-292). Compound 114 (click chemistry) or compound 108 (amide chemistry) required for synthesis are produced following the protocol illustrated in Schemes IX (Refer to page 204) and X (Refer to pages 205 206) respectively. In one example, a stem-loop dsNA is produced having mannose-6-phosphate conjugated nucleotides in the loop using amide chemistry, for example, as shown in Scheme AC (Refer to pages 293-294) . Schemes AB (Refer to pages 291-292) and AC (Refer to pages 293-294) illustrate the synthesis of stem-loop conjugated dsNA molecules with mannose-6-phosphate in which the mannose monomers- 6-phosphate are confined to the loop and are produced by post-synthetic methods. Similarly, Schemes AD (Refer to pages 295-296) and AE (Refer to pages 297-298) illustrate the solid phase synthesis of mannose-6-phosphate loop conjugated dsNA molecules using mannose-6-phosphate nucleoside phosphoamidites, where the mannose-6-phosphate monomers are confined to the loop. In scheme AD (Refer to pages 295-296), the mannose-6-phosphate ligand is attached to the nucleotide using 2'-triazole linkages and in scheme AE the mannose-6-phosphate ligand is attached to the nucleotide using linkages. 2'-acetal.

The sense strand and its complementary antisense strand, as shown in the schemes mentioned above, are obtained by synthesis, from commercial manufacturers, using standard solid phase nucleic acid synthesis procedures. The sense strand is synthesized in a similar manner to the synthesis of the A3 sense strand as described above. The double shown in the schemes mentioned above is synthesized in a similar manner to the synthesis of the A5 double as described above.

Example 37. Synthesis of mannose-6-phosphate conjugated tetraloop notched dsNA with stem mannose-6-phosphate ligand

A stem-loop dsNA having mannose-6-phosphate conjugated nucleotides in the stem is produced using click chemistry, eg, as shown in scheme AF (Refer to pages 299-300). Compound 114 (click chemistry) or compound 108 (amide chemistry) required for synthesis is produced following the protocol illustrated in Schemes IX (Refer to page 204) and X (Refer to pages 205-206) respectively. Scheme AF (Refer to pages 299-300) illustrates the synthesis of mannose-6-phosphate loop conjugated dsNA using click chemistry, where the mannose-6-phosphate monomers are confined to the stem and are in multiples .

The sense strand and its complementary antisense strand, as shown in the schemes mentioned above, are obtained by synthesis from commercial manufacturers using standard solid phase nucleic acid synthesis procedures. The sense strand is synthesized in a similar manner to the synthesis of the A3 sense strand as described above. The double shown in the schemes mentioned above is synthesized in a similar manner to the synthesis of the A5 double as described above.

Example 38. Synthesis of dsNAs with mannose-6-phosphate ligands in the 5 'extension of the antisense strand

A dsNA molecule having mannose-6-phosphate conjugated nucleotides in the 5 'extension of the antisense strand is produced using subsequent solid phase conjugation via click chemistry, for example, as shown in scheme AG (Do reference to pages 301-302). Compound 114 (click chemistry) or compound 108 (amide chemistry) required for synthesis is produced following the protocol illustrated in Schemes IX (Refer to page 204) and X (Refer to pages 205-206 ) respectively.

Scheme AG (Refer to pages 301-302) illustrates the synthesis of the mannose-6-phosphate conjugated dsNA molecule using postsynthetic conjugation, in which the mannose-6-phosphate monomers are confined to the 5 'extension. of the antisense strand. However, the number of monomers conjugated to mannose-6-phosphate can vary, for example, a ligand can be conjugated at the first, second, third, fourth or fifth position from the 5 'or 3' end of the antisense strand or at one position beyond fifth position.

The sense strand and its complementary antisense strand, as shown in the schemes mentioned above, are obtained by synthesis, from commercial manufacturers, using standard solid phase nucleic acid synthesis procedures. The sense strand is synthesized in a similar manner to the synthesis of the A3 sense strand as described above. The double shown in the schemes mentioned above is synthesized in a similar manner to the synthesis of the A5 double as described above. Similar variations of dsNA molecules containing mannose-6-phosphate conjugates are shown in schemes AI, AJ, AK, AL and AM (Refer to pages 305-306). These are synthesized following the same protocols designed for GalNac and cholesterol conjugates as described above.

Example 39. Synthesis of dsNAs with mannose-6-phosphate ligands in the 5 'extension of the sense strand

A dsNA molecule having mannose-6-phosphate conjugated nucleotides in the 5 'extension of the sense strand can be produced using subsequent solid phase conjugation via amide chemistry, for example, as shown in Scheme AH. Compound 114 (click chemistry) or compound 108 (amide chemistry) for synthesis can be produced following the protocol illustrated in Schemes IX and X, respectively.

Scheme AH (Refer to pages 304-305) illustrates the synthesis of the mannose-6-phosphate conjugated dsNA molecule using amide chemistry, where the mannose-6-phosphate monomers are confined to the 5 'extension of the strand in sense. Scheme AN (Refer to page 315) illustrates the solid phase synthesis of the mannose-6-phosphate conjugated dsNA molecule using mannose-6-phosphate-amidite, where the mannose-6-phosphate monomers are confined to the 5 'extension of the strand in the sense. However, the number of monomers conjugated to mannose-6-phosphate can vary, for example, a ligand can be conjugated in the first, second, third, fourth, fifth position or further away from the 5 'end or the 3' end of the strand in the direction or in a position beyond the fifth position. Using the synthetic schemes previously discussed, the number of nucleotides conjugated to mannose-6-phosphate can be varied, as well as the position of the mannose-6-phosphate ligands, for example, a ligand can also be anywhere along the strand in sense.

The sense strand and its complementary antisense strand, as shown in the schemes mentioned above, are obtained by synthesis from commercial manufacturers using standard solid phase nucleic acid synthesis procedures. The sense strand is synthesized in a similar manner to the synthesis of the A3 sense strand as described above. The double shown in the schemes mentioned above is synthesized in a similar manner to the synthesis of the A5 double as described above.

Example 40. Synthesis of dsNAs with multiple mannose-6-phosphate ligands in the 5 'extension of the downstream strand separated by one or more spacers

A dsNA with nucleotides conjugated to mannose-6-phosphate in the extended region 5 'of the sense strand, the nucleotides separated by spacers are produced following the protocols developed for the synthesis of similar dsNA molecules in which the ligand is GalNAc. Schemes G, H, I, J, and K (Refer to pages 226-237) describe the synthesis of GalNAc-conjugated dsNA molecules where the ligand-conjugated nucleotides are separated by one or more spacers.

Nucleotides conjugated to mannose-6-phosphate can be in the 5 'extension of the sense strand, or in the 5' extension of the antisense strand, or in the 3 'extension of the sense strand, or in the 3' extension. 'of the antisense strand or a combination of any of the options mentioned above. Schemes G, H, I, J and K produce specific products for GalNAc ligand conjugation, they are easily adapted and modified to produce with cholesterol ligand conjugates. The mode of conjugation of ligand to nucleotide is similar and can occur by postsynthetic conjugation by click chemistry or amide chemistry or solid phase synthesis using ligand phosphoramidites.

For example, Schemes AI, AJ, and AK (Refer to pages 305-310) illustrate the synthesis of a dsNA comprising mannose-6 phosphate ligands where the ligands are confined to the extended 5 'region of the strand. in sense and are separated by one or two or more separators respectively. However, the number of nucleotides conjugated to mannose-6-phosphate can vary and the position of the mannose-6-phosphate ligands can also vary, for example, a ligand can be anywhere along the sense strand . Conjugated mannose 6-phosphate ligand nucleotides separated by one or more spacers can also be located in the 5 'region of the antisense strand and / or the sense strand. Schemes AL and AM (Refer to pages 311-314) illustrate the synthesis of a dsNA comprising mannose-6-phosphate ligands, where the ligands are confined in the 5 'extended region of the antisense strand and are separated by two or more spacers respectively.

The sense strand and its complementary antisense strand, as shown in the schemes mentioned above, can be obtained by synthesis from commercial manufacturers using standard solid phase nucleic acid synthesis procedures. The sense strand is synthesized in a similar manner to the synthesis of the A3 sense strand as described above. The double shown in the schemes mentioned above will be synthesized similarly to the synthesis of double A5 as described above.

Example 41. GalNAc amidite tune synthesis

2- (2-chloroethoxy) ethanol (124.6 g) and sodium azide (130 g) in 5 L of H2O were heated under reflux overnight. On cooling, the reaction mixture was extracted with CH2O2 (3 x 2000 mL), the organic layers were combined, washed with brine, anhydrous Na2SO4, filtered, and concentrated under reduced pressure to give 2- (2-azidoethoxy) ethanol in a liquid 105 g. Yield: 80%. (Refer to Scheme XI, page 207). A solution of 105 g of 2- (2-azidoethoxy) ethanol and 200 ml of Et3N in 2 L of dry CH2Cl2 was cooled to 0 ° C under a nitrogen atmosphere. A solution of methanesulfonyl chloride (116 g) in CH2Ch (500 ml) was added dropwise to this mixture over a period of 30 minutes, and the solution was warmed to room temperature and stirred for 1.5 h. After the precipitate was filtered off, the solvent was evaporated and the crude product was purified by column chromatography eluting with a 2: 1 mixture of n-hexane and ethyl acetate to give 2- (2-azidoethoxy) ethyl methanesulfonate as a pale yellow oil (126 g). (Refer to Scheme XI, page 207).

A solution of 126 g of compound 3 and 116.5 g of potassium phthalimide in 4 L of dry DME was refluxed for 18 h under a nitrogen atmosphere. After cooling to room temperature and concentrating in vacuo, the resulting residue was diluted with ethyl acetate (10 L) and the solids were filtered. Concentration of the filtrate in vacuo followed by purification of the crude product by column chromatography eluting with a 4: 1 mixture of n-hexane and ethyl acetate to give 4 as a colorless solid (103 g). (Refer to Scheme XI, page 207).

A solution of 100 g of compound 4 and 40 ml of 80% hydrazine hydrate in 2000 ml of absolute ethanol was heated at 55 ° C for 2 h, during which time a white precipitate formed. The mixture was cooled to room temperature and concentrated in vacuo, after which the crude residue was diluted with 2000 mL of dry CH2Cl2. After the precipitate was filtered off, the solvent was dried and concentrated in vacuo to provide a pale yellow oil, which was used in the next step without further purification (45.7 g). MS M + 1: 131.0.

Compound 6 (157 g) was dissolved in dry dichloromethane (2 L). Triethylamine (100 ml) and dic (75.7 g) were added and the mixture was stirred for 4 h at room temperature. Compound 5 (45.7) in dichloromethane (500 ml) was added and the reaction mixture was stirred for 2 h. The mixture was washed with water (1 L) and concentrated. The residue was purified by column chromatography. The desired product was eluted with MeOH-CH2Cl2 (0: 100-10: 90). Evaporation of the appropriate fractions gave compound 7 as a solid (138.0 g) .MS M-1: 558.2.

A mixture of 5'-DMT-N6-bz-adenosine (551.7 g; 80 mmol), tetrabutylammonium bromide (283.2 g), dibutyltin oxide (DBTO) (238.4 g) and propargyl bromide (338 ml) and dry DMF (2.5) was stirred for 24 hours at 50 ° C. The mixture was then poured onto crushed ice. The liquid decanted. The gummy mass was dissolved in dichloromethane (5 L) and the organic layer was washed three times with distilled water. The organic layer was dried over sodium sulfate and then concentrated. The crude reaction mixture was purified on a silica gel column using a chloroform: hexane: acetone gradient system (50:40:10 to 50:30:20). The yield of pure 5'-DM T-2'-0-propargyl-N-bzA was 60.5 g as a solid MS M-1 710.2.

Compound 7 (71 g) and compound 8 (60.5 g) were dissolved in THF (1 L). CuSO4.5H2O (2.1) and sodium ascorbate (2.0) were added under nitrogen. The mixture was stirred overnight. EDTA (5 g) in water (1 L) was added and stirred for 30 minutes. Toluene (1 L) was added and the two layers were separated. The organic layer was evaporated and the residue was purified by silica gel chromatography. The desired product was eluted with MeOH-CH2Cl2 (0: 100-10: 90). Evaporation of the appropriate fractions gave compound 9 as a solid (91.0 g) .MS M-1: 1269.6.

The dimethoxytritylated derivative 9 (40.0 g) was dissolved in 600 ml of dichloromethane under argon and ethyl (diisopropyl) amine (10 ml) and 2-cyanoethyl diisopropylphosphoramidochloridite (15.0 g) were added. After stirring the solution for 3 h, TLC indicated a complete reaction. A 10% aqueous solution of sodium hydrogen carbonate (2 ml), the solution was stirred for 10 minutes and partitioned between methylene chloride (500 ml) and aqueous sodium carbonate (300 ml). The organic phase was washed with aqueous sodium chloride (2x300 ml) and the aqueous phases were re-extracted with methylene chloride (200 ml). Evaporation of the organics left an oil, which was rapidly purified on silica gel (ethyl acetate) to provide the product as a foam (34.5 g) (MS M-1: 1469.6).

A mixture of 5'-DMT-N2-ibuG (328 g), tetrabutylammonium bromide (177 g), DBTO (150 g), propargyl bromide (420 ml) and dry DMF (1.3 L) was stirred for 24 hours at 50 ° C. The mixture was poured onto crushed ice. The liquid decanted. The gummy mass was dissolved in dichloromethane (5 L) and the organic layer was washed three times with distilled water. The organic layer was dried over sodium sulfate and then concentrated. The residue was purified on a silica gel column using a chloroform: hexane: acetone: methanol gradient system (50: 30: 20: 0 to 50: 30: 20: 2). The yield of pure 5'-DMT-2'-0-propargyl-N2-ibu-G was 45.0 g as a solid MS M-1 692.2.

Compound 7 (18.0 g) and compound 11 (15.0 g) were dissolved in THF (300 ml). CuSO4.5H2O (0.6 g) and sodium ascorbate (0.5 g) were added under nitrogen. The mixture was stirred overnight. EDTA (2.0 g) in water (0.5 L) was added and stirred for 30 minutes. Toluene (0.5 L) was added and the two layers were separated. The organic layer was evaporated and the residue was purified by silica gel chromatography. The desired product was eluted with MeOH-CH2Cl2 (0: 100-10: 90). Evaporation of the appropriate fractions gave compound 9 as a solid (24.0 g) .MS M-1: 1251.6.

Compound 12 (24 g) was dissolved in 500 ml of dichloromethane under argon and ethyl- (diisopropyl) amine (8 ml) and 2-cyanoethyl diisopropylphosphoramidochloridite (10.0 g) were added. After stirring the solution for 3 h, TLC indicated a complete reaction. A 10% aqueous sodium hydrogen carbonate solution (2 ml) was added, the solution was stirred for 10 minutes and partitioned between methylene chloride (500 ml) and aqueous sodium carbonate (300 ml). The phase The organic was washed with aqueous sodium chloride (2x300 ml) and the aqueous phases were re-extracted with methylene chloride (200 ml). Evaporation of the organics left an oil, which was rapidly purified on silica gel (ethyl acetate) to provide the product as a foam (19.5 g) (MS M-1: 1451.6).

The following compounds are made using the same protocols for the synthesis of compound 13 with slight variations.

Scheme X (continued)

103

Ċ

Ċ

Ċ



Preparations of N-acetylgalactosamine ligands, nucleotides containing N-acetylgalactosamine and conjugates of N-acetylgalactosamine oligonucleotides are described above in the examples and synthetic schemes. The specific oligonucleotide sequences used for the compounds and / or conjugates described below are shown in Table 2.

Table 4.

Linkers useful for conjugating ligands to dsNAs are not limited to the linkers presented in Table 3. A dsNA conjugated to a single ligand may comprise more than one type of linker.

Table 5.

Linkers useful for conjugating ligands with dsNA.

As used herein, m = 2'-O-methyl; f = 2'-fluoro; r = 2'-ribo; d = 2'-deoxy; Subscribed "s" = phosphorothioate; iB = inverted abasic; prg = 2'-propargyl.

Table 5-Linker groups ab

Table 4 represents potential linker group combinations of various components shown in the formula below

Ċ

Table 4 represents the possible combinations of linking groups of various components

Claims (15)

1. A double stranded nucleic acid (dsNA) comprising: an upstream strand comprising 21 to 83 nucleotides; an antisense strand comprising 15 to 39 nucleotides; a double formed by said sense and antisense strand, having a length of 15 to 35 base pairs; wherein the dsNA comprises a discontinuity between the 5 'terminus of the sense strand and the 3' terminus of the antisense strand or between the 3 'terminus of the sense strand and the 5' terminus of the antisense strand; wherein the sense strand comprises a tetraloop and the tetraloop comprises at least one nucleotide conjugated to the ligand; wherein each ligand is conjugated to a nucleotide of the tetraloop through an acetal linker and wherein said antisense strand is complementary to a target mRNA over at least 15 nucleotides of said antisense strand and said dsNA reduces expression of the target gene when introduced into a mammalian or mammalian cell. 2. A dsNA as claimed in claim 1, wherein the tetraloop comprises three ligand-conjugated nucleotides. 3. A dsNA as claimed in claim 1, wherein the tetraloop comprises four ligand-conjugated nucleotides. 4. A dsNA as claimed in claim 1, wherein at least one ligand is conjugated to a nucleotide of the tetraloop through the 2'-hydroxyl on the ribose of the nucleotide; preferably wherein each ligand is conjugated to a nucleotide of the tetraloop through the 2'-hydroxyl on the ribose of the nucleotide. 5. A dsNA as claimed in any one of the preceding claims wherein the tetraloop is the loop of a stem and loop structure of the sense strand and there is a discontinuity between the 3 'terminal of the sense strand and the terminal 5 'of the antisense strand. 6. A dsNA as claimed in any of the preceding claims, wherein said antisense strand has a length range of: 15-30 nucleotides, 18-25 nucleotides or 19-24 nucleotides. 7. A dsNA as claimed in any preceding claim, wherein said sense strand has a length range of 35-55 nucleotides. 8. A dsNA as claimed in any one of the preceding claims, wherein said double has a length range of 15-22 base pairs or 15-30 base pairs. 9. A dsNA as claimed in any of the foregoing, wherein said ligand is selected from the group consisting of: a lipophilic, a steroid, a protein, a vitamin, a carbohydrate, and a terpene. 10. A dsNA as claimed in any one of claims 1 to 8, wherein said ligand is selected from the group consisting of: cholesterol, cholic acid, adamantine acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3- Bis-O (hexadecyl) glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, 03- (oleoyl) lithocholic acid, 03- (oleoyl) cholenic acid, dimethoxytrityl or phenoxazine, bile acid, PEG, folate, vitamin A, vitamin E, biotin, pyridoxal, a peptide, mimic peptide, mannose-6-phosphate, galactose, fructose, ribose, xylose, arabinose, lixose, allose, altrose, gulose, iodose , glucose, talose, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, polysaccharide, an endosomolytic component, uvaol, hecigenin, diosgenin, triterpenosarsasapogenin, friedelin, epifriedelanol-derived lithocholic acid, a cationic lipid and an antibody. 11. A dsNA as claimed in any one of the preceding claims, wherein said dsNA comprises at least one modified nucleotide; preferably wherein the at least one modified nucleotide comprises a sugar and / or a backbone modification; preferably wherein the sugar modification is selected from the group consisting of: 2'-O-methyl, 2'-methoxyethoxy, 2'-fluoro, 2'-allyl, 2'-O- [2- (methylamino) modification -2-oxoethyl], 4'-thio, 4'-CH2-0-2'-bridge, 4 '- (CH2) 2-0-2'-bridge, 2'-amino and 2'-O- (N -methylcarbamate) and the backbone modification is selected from the group consisting of: phosphonate, phosphorothioate, phosphotriester, methylphosphonate, morpholino, SATE modified phosphate (S-acyl-2-thioethyl) and BMEG modified phosphate (isobutyryl mercapto ethyl glycol) . 12. A dsNA as claimed in claim 1, comprising a region containing at least one phosphorothioate bond and / or wherein both the sense and antisense strands consist of up to 100% chemically modified nucleotides. 13. A dsNA as claimed in any of the preceding claims, wherein the 3 'end of the antisense strand has a 3' single-stranded extension protruding from the 5 'end of the sense strand, wherein said 3' extension is 1 -4 nucleotides, optionally 2 nucleotides. 14. A dsNA as claimed in any of the preceding claims, wherein each ligand is conjugated to the sugar of a nucleotide of the tetraloop through a linker as set forth in Formula VI:

Z is O, S, N (Ri), or CH2; V and W are each O; Ri and R2 are each H; m and n are each independently 1-20; X is a ligand selected from the group consisting of: GalNAc, folate, mannose-6-phosphate, and cholesterol; or wherein each ligand is conjugated to a nucleotide of the tetraloop through a linker selected from the group consisting of: to)

and b)

where n = 0-20 wherein said ligand is conjugated to the sugar or base of said nucleotide; and wherein said ligand-conjugated nucleotide is suitable for synthesizing the dsNA of any preceding claim. 15. A pharmaceutical composition comprising the dsNA of any of the preceding claims and a pharmaceutically acceptable carrier.