JPWO2008108466A1 - Improved halohydrin epoxidase - Google Patents

Abstract

Provided are an industrially useful improved halohydrin epoxidase, a method for producing the same, and a method for producing epihalohydrin or 4-halo-3-hydroxybutyronitrile using the same. The improved halohydrin epoxidase of the present invention comprises an amino acid sequence in which a specific amino acid substitution mutation is introduced into the amino acid sequence of a wild-type halohydrin epoxidase containing a predetermined amino acid sequence I and amino acid sequence II. It is.

Description

  The present invention relates to an improved halohydrin epoxidase and a method for producing the same.

Halohydrin epoxidase, also called halohydrin hydrogen halide lyase, halohydrin dehalogenase or haloalcohol dehalogenase, catalyzes the activity of converting 1,3-dihalo-2-propanol to epihalohydrin and its reverse reaction (EC number: 4.5.1.-). It is known that halohydrin epoxidases are roughly classified into three groups (group A, group B, group C) based on amino acid sequence homology (Non-patent Document 1: J. Bacteriology, 183). (17), 5058-5066, 2001). As halohydrin epoxidases classified into Group A, HheA derived from Corynebacterium sp. N-1074 (Non-patent Document 2: Biosci. Biotechnol. Biochem., 58 (8), 1451- 1457, 1994), HheA _AD2 derived from Arthrobacter sp. AD2 strain (Non-patent document 1), Deh-PY1 derived from Arthrobacter sp. Strain PY1 (Non-patent document 3: J Health. Sci., 50 (6), 605-612, 2004). The halohydrin epoxidases classified into group B include HheB (Non-patent Document 2) derived from Corynebacterium sp. N-1074 strain, and Mycobacterium sp. GP1 strain. HheB _GP1 (Non-patent Document 1), DehA derived from Arthrobacter erithii H10a strain (Non-patent Document 4: Enz. Microbiol. Technol., 22, 568-574, 1998) and the like. Examples of halohydrin epoxidases classified into group C include HheC derived from Agrobacterium radiobacter DH094 strain (Patent Document 1: JP-A-10-210981), Agrobacterium radiobacter (Agrobacterium radiobacter). ) HheC derived from AD1 strain (non-patent literature), HalB derived from Agrobacterium tumefaciens (http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=protein&val = 4960076 # feature 4960076) (Non-Patent Document 5: Thesis (1996) University of Wales, Cardiff, United Kingdom).

  Epihalohydrin is a useful substance as a raw material for synthesizing various pharmaceuticals and physiologically active substances. For example, (R)-(−)-4-halo-3-hydroxybutyronitrile obtained by ring-opening cyanation of (R) -epihalohydrin is known to be useful as a raw material for the synthesis of L-carnitine. (Patent Document 2: JP 57-165352 A). For at least some of the halohydrin epoxidases, in addition to the activity of converting 1,3-dihalo-2-propanol to epihalohydrin and the activity of catalyzing the reverse reaction, the epihalohydrin can be opened in the presence of a cyanide compound. It has been clarified to catalyze the reaction of cyanation to form 4-halo-3-hydroxybutyronitrile. As an example using this reaction, 1,3-dihalo-2-propanol is optically active 4- Process for producing halo-3-hydroxybutyronitrile (Patent Document 3: Japanese Patent Laid-Open No. 3-053889, Patent Document 4: Japanese Patent Laid-Open No. 2001-25397) and optically active 4-halo-3-hydroxybutyrate from epihalohydrin A method for producing ronitrile (Patent Document 5: Japanese Patent Laid-Open No. 3-053890) is known.

  By the way, the halohydrin epoxidase activity per cell of microorganisms isolated from the natural world is not always sufficiently high from the viewpoint of industrial use. In order to solve this problem, attempts have been made to improve halohydrin epoxidase activity per transformant using genetic recombination technology. For example, using various transformants obtained by introducing various expression plasmids obtained by cloning a gene encoding halohydrin epoxidase HheB from Corynebacterium sp. N-1074 strain, It has been shown that optically active 4-halo-3-hydroxybutyronitrile can be produced efficiently (Patent Document 6: JP-A-4-78089, Patent Document 7: JP-A-5-317066, and Patent Documents). 8: JP 2007-049932 A). In these transformants, the halohydrin epoxidase activity per transformant has been greatly improved by retaining multiple copies of the halohydrin epoxidase gene in the cells.

  On the other hand, recent advances in genetic engineering technology have made it possible to intentionally create mutants in which one or more of the constituent amino acids of the enzyme protein are deleted, added, inserted, or substituted with other amino acids. . Depending on the type of mutation, these mutants have improved performance, such as activity, stability, organic solvent resistance, heat resistance, acid resistance, alkali resistance, and substrate specificity, compared to an enzyme into which no mutation has been introduced. It is known to do. These performance improvements can significantly reduce production costs in industrial production using enzyme reactions by reducing enzyme catalyst production costs per activity, stabilizing enzyme catalysts, simplifying reaction processes, and improving reaction yields. May bring. Therefore, creation of useful improved enzymes having various performances improved in many enzymes. In halohydrin epoxidase, a mutant in which one or more constituent amino acids are deleted, added, inserted, or substituted with another amino acid has been reported. For example, Patent Document 9 (International Publication No. 2005/017141 pamphlet) includes 369 HheC variants derived from Agrobacterium radiobacter AD1 strain and Corynebacterium sp. N-1074. One type of HheB variant from the strain is described. Patent Document 10 (US Patent Application Publication No. 2005/0272064) includes 570 types of HheC variants derived from Agrobacterium radiobacter AD1 strain and Corynebacterium sp. One variant of HheB from the N-1074 strain is described. Further, Patent Document 11 (US Patent Application Publication No. 2006/0099700) discloses 1422 types of mutants of HheC derived from Agrobacterium radiobacter AD1 strain and Corynebacterium sp. One variant of HheB from the N-1074 strain is described. Some of these mutants have improved activity in the conversion reaction of ethyl (R) -4-chloro-3-hydroxybutyrate to ethyl (S) -4-cyano-3-hydroxybutyrate. It has been shown. Further, Non-Patent Document 6 (J. Bacteriol., 183 (17), 5058-5066, 2001) includes mutants of HheC derived from Agrobacterium radiobacter AD1 strain Ser132Ala, Ser132Cys, Tyr145Phe, Arg149Lys. Arg149Glu and Arg149Gln are described. Non-patent document 7 (Enz. Microbiol. Technol., 30, 251-258, 2002) includes mutants C30A, C153S, C229A and C153S / C229A of HheC derived from Agrobacterium radiobacter AD1 strain. It has been described that mutants C30A and C153S have improved stability over wild type halohydrin epoxidase. Non-Patent Document 8 (EMBO J., 22 (19), 4933-4944, 2003) describes mutants Asp80Asn and Asp80Ala of HheC derived from Agrobacterium radiobacter AD1 strain. Non-patent document 9 (Biochemistry, 42 (47), 14057-14065, 2003) describes mutants W139F, W192F, W238F and W249F of HheC derived from Agrobacterium radiobacter AD1 strain. . Non-Patent Document 10 (Biochemistry, 44 (17), 6609-6618, 2005) describes HheC mutants N176A, N176D and Y187F derived from Agrobacterium radiobacter AD1 strain. These all relate to mutants of halohydrin epoxidase HheC derived from Agrobacterium radiobacter AD1 strain.

Japanese Patent Laid-Open No. 10-210981 JP 57-165352 A Japanese Patent Laid-Open No. 3-053889 JP 2001-25397 Japanese Patent Laid-Open No. 3-053890 JP-A-4-78089 JP-A-5-317066 JP 2007-049932 A International Publication No. 2005/017141 Pamphlet US Patent Application Publication No. 2005/0272064 US Patent Application Publication No. 2006/0099700 J. Bacteriol., 183 (17), 5058-5066, 2001 Biosci. Biotechnol. Biochem., 58 (8), 1451-1457, 1994 J. Health. Sci., 50 (6), 605-612, 2004 Enz. Microbiol. Technol., 22, 568-574, 1998 Thesis (1996) University of Wales, Cardiff, United Kingdom J. Bacteriol., 183 (17), 5058-5066, 2001 Enz. Microbiol., Technol. 30, 251-258, 2002 EMBO J., 22 (19), 4933-4944, 2003 Biochemistry, 42 (47), 14057-14065, 2003 Biochemistry, 44 (17), 6609-6618, 2005

  When halohydrin epoxidase is used industrially, further advancement as an enzyme catalyst is desired. For example, as described above, the halohydrin epoxidase gene per transformant can be increased to a certain degree by increasing the copy of the halohydrin epoxidase gene in the transformant, but from the viewpoint of economy and practicality. Further improvement in activity is desired. Accordingly, a halohydrin epoxidase is desired that results in improved halohydrin epoxidase activity per transformant. In addition, when the purpose is to produce optically active 4-halo-3-hydroxybutyronitrile, the optical purity of 4-halo-3-hydroxybutyronitrile produced by a known halohydrin epoxidase is not always sufficient. It is not expensive. Therefore, a halohydrin epoxidase with improved stereoselectivity that produces 4-halo-3-hydroxybutyronitrile with higher optical purity is desired. When 4-halo-3-hydroxybutyronitrile is produced by halohydrin epoxidase using 1,3-dihalo-2-propanol as a starting material, the product (chloride ion and 4-halo-3- The reaction rate may decrease due to inhibition of (hydroxybutyronitrile). Accordingly, halohydrin epoxidases that are less susceptible to product inhibition are desired. In order to produce 4-halo-3-hydroxybutyronitrile at a low cost, the concentration of the substrate and / or product (4-halo-3-hydroxybutyronitrile) in the reaction system is usually increased. While it is desirable to improve per-product productivity, the product accumulation concentration with known halohydrin epoxidases is not necessarily high enough. Accordingly, halohydrin epoxidases that can accumulate high concentrations of product are desired.

  Accordingly, an object of the present invention is to provide a halohydrin epoxidase that can solve these problems, a method for producing the same, and a method for producing epihalohydrin or 4-halo-3-hydroxybutyronitrile using the same. is there.

  The present inventors conducted sincere research to solve the above problems. As a result, in the amino acid sequence of the wild-type halohydrin epoxidase, particularly in the amino acid sequence of the wild-type halohydrin epoxidase classified in group B, transformation is performed by substituting a specific amino acid residue with another amino acid. The inventors found that an improved halohydrin epoxidase having improved attributes such as halohydrin epoxidase activity per body, stereoselectivity, product inhibition resistance, and product accumulation ability, and completed the present invention. .

That is, the present invention is as follows.
(1) The following amino acid sequence I:
S-α1-α2-α3-α4-α5-α6-α7-α8-α9-α10-α11-α12-Y-α13-α14-AR-α15 (SEQ ID NO: 74)
(S represents a serine residue, Y represents a tyrosine residue, A represents an alanine residue, R represents an arginine residue, and α1 to α15 each independently represent an identical or different arbitrary amino acid residue.)
And the following amino acid sequence II:
L-β16-RL-β17-β18-β19-β20-E-β21 (SEQ ID NO: 75)
(L represents a leucine residue, R represents an arginine residue, E represents a glutamic acid residue, and β16 to β21 each independently represent the same or different arbitrary amino acid residues.)
An improved halohydrin epoxy comprising an amino acid sequence in which any one or a plurality of amino acid mutations selected from the following (A) to (D) are introduced into the amino acid sequence of a wild-type halohydrin epoxidase containing Dase.
(A) Amino acid mutation in which one amino acid residue on the C-terminal side of the starting amino acid residue (usually methionine residue) is replaced with another amino acid (B) Amino acid in which α14 residue is replaced with another amino acid Mutation (C) Amino acid mutation in which α15 residue is replaced with another amino acid (D) Amino acid mutation in which β21 residue is replaced with another amino acid

(2) The following amino acid sequence I:
S-α1-α2-α3-α4-α5-α6-α7-α8-α9-α10-α11-α12-Y-α13-α14-AR-α15 (SEQ ID NO: 74)
(S represents a serine residue, Y represents a tyrosine residue, A represents an alanine residue, R represents an arginine residue, and α1 to α15 each independently represent an identical or different arbitrary amino acid residue.)
And the following amino acid sequence II:
L-β16-RL-β17-β18-β19-β20-E-β21 (SEQ ID NO: 75)
(L represents a leucine residue, R represents an arginine residue, E represents a glutamic acid residue, and β16 to β21 each independently represent the same or different arbitrary amino acid residues.)
An improved halohydrin epoxy comprising an amino acid sequence into which any one or a plurality of amino acid mutations selected from the following (E) to (H) is introduced into the amino acid sequence of a wild-type halohydrin epoxidase containing Dase.
(E) Amino acid mutation in which one residue C-terminal amino acid residue is replaced with lysine or asparagine from the starting amino acid residue (usually methionine residue) (F) α14 residue is replaced with alanine, cysteine or serine (G) Amino acid mutation in which α15 residue is substituted with alanine, serine or tryptophan (H) Amino acid in which β21 residue is substituted with glutamine, glutamic acid, histidine, serine, threonine, tyrosine, leucine, isoleucine or methionine Mutation

In the improved halohydrin epoxidase described in (1) and (2) above, examples of the wild-type halohydrin epoxidase include those classified into Group B.
In the improved halohydrin epoxidase described in (1) and (2) above, examples of the wild-type halohydrin epoxidase include those derived from bacteria belonging to the genus Corynebacterium or Mycobacterium. And the like.

In the improved halohydrin epoxidase described in (1) and (2) above, examples of the amino acid sequence of the wild-type halohydrin epoxidase include the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2, and the like. It is done.
Examples of the improved halohydrin epoxidase described in (1) and (2) above include any one selected from the following (i) to (iii) with respect to the amino acid sequence of wild-type halohydrin epoxidase: Or an amino acid sequence having a plurality of amino acid mutations introduced therein.
(I) One or several amino acid residues selected from amino acid residues other than the amino acid residue at the C-terminal side, α14 residue, α15 residue and β21 residue from the starting amino acid residue (Ii) Amino acid residues one residue C-terminal from the starting amino acid residue, amino acid residues included in amino acid sequence I, and amino acid residues other than amino acid residues included in amino acid sequence II Amino acid mutation in which one or several amino acid residues selected from the group are deleted (iii) Amino acid sequence I and amino acid sequence in a region consisting of two or more residues from the starting amino acid residue and C-terminal amino acid residues Amino acid mutation in which one or several arbitrary amino acid residues are inserted in a region other than the region consisting of II

(3) A gene encoding the improved halohydrin epoxidase according to (1) or (2) above.
(4) A recombinant vector comprising the gene according to (3) above.
(5) A transformant or transductant obtained by introducing the recombinant vector according to (4) above into a host.
(6) A culture obtained by culturing the transformant or transductant described in (5) above.

(7) An improved halohydrin epoxidase collected from the culture according to (6) above.
(8) An improved halohydrin epoxidase characterized by culturing the transformant or transductant described in (5) above and collecting the improved halohydrin epoxidase from the resulting culture. Production method.
(9) The improved halohydrin epoxidase according to (1), (2) or (7) above and / or the culture according to (6) above, and 1,3-dihalo-2-propanol A method for producing epihalohydrin, characterized in that epihalohydrin is produced by contact.

(10) The improved halohydrin epoxidase according to (1), (2) or (7) above and / or the culture according to (6) above, in the presence of a cyanide compound, 1,3-dihalo A process for producing 4-halo-3-hydroxybutyronitrile, wherein 4-halo-3-hydroxybutyronitrile is produced by contacting with 2-propanol or epihalohydrin.

  According to the present invention, an improved halohydrin epoxidase having improved halohydrin epoxidase activity, stereoselectivity, product inhibition resistance, product accumulation ability and the like per transformant can be obtained. Utilizing this, epihalohydrin or 4-halo-3-hydroxybutyronitrile can be efficiently produced.

Wild type halohydrin epoxidase expression transformants (JM109 / pST111, JM109 / pSTK001 and JM109 / pSTT001) and improved halohydrin epoxidase expression transformants (JM109 / pSTK002, JM109 / pSTK003, JM109 / pSTT002 and JM109) FIG. 4 is a diagram showing the result of analyzing a crude enzyme solution derived from / pSTT003) by SDS-PSGE.

Embodiments of the present invention will be described below. However, the present embodiments are examples for explaining the present invention, and the present invention is not intended to be limited to these embodiments. The present invention can be implemented in various forms without departing from the gist thereof.
This specification includes the entire specification of Japanese Patent Application No. 2007-057854, which is the basis for claiming priority of the present application. In addition, all publications cited in the present specification, for example, prior art documents, and publications, patent publications and other patent documents are incorporated herein by reference.

(I) Halohydrin epoxidase activity In the present invention, "halohydrin epoxidase activity" means an activity of converting 1,3-dihalo-2-propanol to epihalohydrin and an activity of catalyzing the reverse reaction. . 1,3-dihalo-2-propanol is a compound represented by the following general formula (1).
(In the formula, X ₁ and X ₂ each independently represent the same or different halogen atom.)
As the halogen atom, fluorine, chlorine, bromine and iodine are preferable, and chlorine and bromine are particularly preferable. Specifically, 1,3-difluoro-2-propanol, 1,3-dichloro-2-propanol (hereinafter sometimes referred to as “DCP”), 1,3-dibromo-2-propanol, 1,3- Examples include diiodo-2-propanol, and 1,3-dichloro-2-propanol and 1,3-dibromo-2-propanol are preferable.

Epihalohydrin is a compound represented by the following general formula (2).
(In the formula, X represents a halogen atom.)
As the halogen atom, fluorine, chlorine, bromine and iodine are preferable, and chlorine and bromine are particularly preferable. Specific examples include epifluorohydrin, epichlorohydrin (hereinafter sometimes referred to as “ECH”), epibromohydrin, epiiodohydrin, and the like, and epichlorohydrin, epibromo are particularly preferred. It is a hydrin.

  In the present invention, “halohydrin epoxidase activity” can be determined by measuring the amount of epihalohydrin produced from 1,3-dihalo-2-propanol or the amount of chloride ions produced per hour. The amount of epihalohydrin produced can be quantified by, for example, liquid chromatography or gas chromatography. In addition, the amount of chloride ions generated is, for example, by adding an alkaline solution continuously or intermittently so as to keep the pH that decreases with the generation of chloride ions at a certain value, For convenience. The halohydrin epoxidase activity calculated by this method may be particularly referred to as “dechlorination activity”. In addition, antibodies against improved halohydrin epoxidase can be prepared and calculated by immunological techniques such as Western blot or ELISA. In addition, if it is assumed that the halohydrin epoxidase activity is proportional to the expression level in the transformant, it can also be analyzed by SDS-PAGE or other analytical means, for example, by comparing with a sample with known halohydrin epoxidase activity. It can be obtained indirectly. SDS-PAGE can be performed by those skilled in the art using a known method.

For at least some halohydrin epoxidases, 4-halo-3-hydroxybutyronitrile is obtained by ring-opening cyanation of epihalohydrin in the presence of a cyanide compound in addition to the above-mentioned “halohydrin epoxidase activity”. Has the activity of catalyzing the reaction to produce In this case, the cyanide compound includes cyanide ion (CN−) when added to a reaction solution such as hydrogen cyanide, potassium cyanide (hereinafter sometimes referred to as “KCN”), sodium cyanide, cyanic acid, or acetone cyanohydrin. ) Or a compound that generates hydrogen cyanide or a solution thereof. Further, 4-halo-3-hydroxybutyronitrile is a compound represented by the following general formula (3).
(In the formula, X represents a halogen atom.)

  As the halogen atom, fluorine, chlorine, bromine and iodine are preferable, and chlorine and bromine are particularly preferable. Specifically, 4-fluoro-3-hydroxybutyronitrile, 4-chloro-3-hydroxybutyronitrile (hereinafter sometimes referred to as “CHBN”), 4-bromo-3-hydroxybutyronitrile, 4 -Iodo-3-hydroxybutyronitrile and the like can be mentioned, and 4-chloro-3-hydroxybutyronitrile and 4-bromo-3-hydroxybutyronitrile are preferable.

(II) Halohydrin epoxidase (II-1) Wild-type halohydrin epoxidase The improved halohydrin epoxidase in the present invention is a wild-type halohydrin epoxidase (particularly preferably classified into group B). There is a thing improved by introducing a mutation (amino acid mutation) into the thing), and its origin is not particularly limited. As used herein, “wild-type halohydrin epoxidase” refers to a halohydrin epoxidase that can be isolated from a natural organism, and an intentional or unintentional deletion of an amino acid in the amino acid sequence constituting the enzyme. Alternatively, it means a halohydrin epoxidase that has no substitutions or insertions with other amino acids and retains its naturally derived attributes.

Furthermore, the wild-type halohydrin epoxidase used in the present invention has the following amino acid sequence I (19 amino acid residues):
S-α1-α2-α3-α4-α5-α6-α7-α8-α9-α10-α11-α12-Y-α13-α14-AR-α15 (SEQ ID NO: 74)
(S represents a serine residue, Y represents a tyrosine residue, A represents an alanine residue, R represents an arginine residue, and α1 to α15 each independently represent an identical or different arbitrary amino acid residue.)
And the following amino acid sequence II (10 amino acid residues):
L-β16-RL-β17-β18-β19-β20-E-β21 (SEQ ID NO: 75)
(L represents a leucine residue, R represents an arginine residue, E represents a glutamic acid residue, and β16 to β21 each independently represent the same or different arbitrary amino acid residues.)
It consists of an amino acid sequence containing Whether or not the wild-type halohydrin epoxidase consists of an amino acid sequence including amino acid sequence I and amino acid sequence II is determined according to public sequence databases such as the National Center for Biotechnology Information (NCBI; National Center for Biotechnology Information). ) Search for those registered as halohydrin epoxidases in the GenBank database (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?CMD=search&DB=protein) provided by What is necessary is just to investigate whether the said amino acid sequence I and amino acid sequence II are contained in the amino acid sequence of applicable thing. If necessary, it can be performed using gene information analysis software. In addition, if there is a known literature describing the amino acid sequence of the wild-type halohydrin epoxidase, it may be referred to. For example, amino acid sequence I and amino acid sequence II are included by referring to the alignment information of various wild-type halohydrin epoxidase amino acid sequences described in J. Bacteriology, 183 (17), 5058-5066, 2001. It is possible to know whether or not it is included and at which position in the entire amino acid sequence. The serine residue, tyrosine residue, arginine residue and alanine residue in amino acid sequence I, and leucine residue, arginine residue and glutamic acid residue in amino acid sequence II are known wild-type halohydrin epoxidases. Are highly conserved in the amino acid sequence.

Wild-type halohydrin epoxidases are known to be roughly divided into three groups (group A, group B, group C) based on amino acid sequence homology (J. Bacteriology, 18 3 (17 ), 5058-5066, 2001). Among these, as the wild-type halohydrin epoxidase used in the present invention, those belonging to Group B are particularly preferable.
As halohydrin epoxidases classified into group A, HheA (Biosci. Biotechnol. Biochem., 58 (8), 1451-1457, 1994) derived from Corynebacterium sp. N-1074 strain, HheA _AD2 derived from Arthrobacter sp. AD2 strain (J. Bacteriology, 183 (17), 5058-5066, 2001) and Deh-PY1 derived from Arthrobacter sp. PY1 strain (J Health. Sci., 50 (6), 605-612, 2004).
The halohydrin epoxidases classified into Group B include HheB (Biosci. Biotechnol. Biochem., 58 (8), 1451, 1994) derived from Corynebacterium sp. N-1074 strain, mycobacteria HheB _GP1 (J. Bacteriology, 183 (17), 5058-5066, 2001) derived from Mycobacterium sp. GP1 strain, DehA (Enz. Microbiol. Technol.) Derived from Arthrobacter erithii H10a strain , 22, 568-574, 1998). The halohydrin epoxidases classified into group C include HheC derived from Agrobacterium radiobacter DH094 strain (Japanese Patent Application Laid-Open No. 10-210981), and Agrobacterium radiobacter AD1 strain. HheC (J. Bacteriology, 183 (17), 5058-5066, 2001), HalB derived from Agrobacterium tumefaciens (Thesis (1996) University of Wales, Cardiff, United Kingdom) It is done.
Among these halohydrin epoxidases, those whose amino acid sequences have been clarified are included in the GenBank database (http: //www.National Center for Biotechnology Information) provided by the National Center for Biotechnology Information (NCBI). In ncbi.nlm.nih.gov/entrez/query.fcgi?CMD=search&DB=protein), it is registered with the following Accession No.

"Accession No. BAA14361": Amino acid sequence of HheA derived from Corynebacterium sp. N-1074 strain "Accession No. AAK92100": Amino acid of HheA _AD2 derived from Arthrobacter sp. Strain _AD2 Sequence “Accession No. BAA14362”: Amino acid sequence of HheB derived from Corynebacterium sp. N-1074 strain “Accession No. AAK73175”: HheB _GP1 derived from Mycobacterium sp. Strain _GP1 Amino acid sequence “Accession No. AAK92099”: Agrobacterium radiobacter AD1 strain HheC amino acid sequence “Accession No. AAD34609”: Agrobacterium tumefaciens derived amino acid sequence of HalB

In addition, about the halohydrin epoxidase HheB derived from the Corynebacterium sp. Strain N-1074 mainly exemplified in the present invention, since the gene (HheB) has two initiation codons, It has been reported that there are two types of halohydrin epoxidases that differ only in the presence or absence of 8 amino acid residues near the N-terminus (Biosci. Biotechnol. Biochem., 58 (8), 1451-1457, 1994). In the present invention, when both (the above two halohydrin epoxidases) are referred to separately, HheB consisting of an amino acid sequence (SEQ ID NO: 1) translated from the first initiation codon is referred to as “HheB (1 ^st )”. HheB consisting of the amino acid sequence (SEQ ID NO: 2) translated from the second start codon is referred to as “HheB (2 ^nd )”, and these are all wild-type halohydrin epoxidases .

Here, in HheB (1 ^st ) consisting of the amino acid sequence shown in SEQ ID NO: 1, amino acid sequence I corresponds to a sequence consisting of the 126th to 144th amino acid residues, and amino acid sequence II is the 198th amino acid sequence. This corresponds to a sequence consisting of the amino acid residues from the 207 th to the 207 th amino acid residues. Similarly, in HHEB (2 ^nd) comprising the amino acid sequence shown in SEQ ID NO: 2, amino acid sequence I corresponds to a sequence consisting the 118th ~ 136 th amino acid residue, the amino acid sequence II is a 190 This corresponds to the sequence consisting of the amino acid residues from the 199th amino acid to the 199th amino acid. The amino acid sequence of HHEB (2 ^nd) is, by the influence of the two start codons mentioned above, the 8 amino acid residues (specifically near the N terminus in the amino acid sequence of HHEB (1 ^st), shown in SEQ ID NO: 1 The first to eighth amino acid residues in the amino acid sequence to be deleted).

  In the present specification, the wild-type halohydrin epoxidase HheB derived mainly from the Corynebacterium sp. Strain N-1074 will be described as an example, but as described above, the halohydrin epoxidase is described. The origin of is not limited, and the same explanation can be applied to halohydrin epoxidases other than HheB as long as they are composed of amino acid sequences including the amino acid sequence I and the amino acid sequence II. In addition, any improved halohydrin epoxidase can be obtained by manipulating the position of the mutation or the amino acid species or base sequence to be mutated in the present invention. In the present invention, “high homology” refers to, for example, 60% or more homology, preferably 75% or more, particularly preferably 90% or more.

(II-2) Improved halohydrin epoxidase The “improved halohydrin epoxidase” in the present invention is at least for the amino acid sequence of the wild-type halohydrin epoxidase mainly using genetic recombination technology. A halohydrin epoxy having an amino acid sequence into which one amino acid substitution mutation has been introduced and having improved halohydrin epoxidase activity, stereoselectivity, product inhibition resistance, and product accumulation ability per transformant. It is a dase.
The improved halohydrin epoxidase in the present invention includes those having a higher halohydrin epoxidase activity per transformant than the wild-type halohydrin epoxidase. As an essential cause of the improvement of the halohydrin epoxidase activity per transformant referred to here, any factor may be used as long as it is caused by an amino acid substitution mutation. For example, the specific activity per enzyme protein is improved, Examples include an improved ability to form an active conformation, an increased expression level in the transformant, an improved enzyme stability in the transformant, an improved resistance to substrates, and a reduced product inhibition sensitivity.

  The “halohydrin epoxidase activity per transformant” means “halohydrin epoxidase activity per unit weight of dried transformant cells” and is also referred to as “cell specific activity”. (In the present specification, dry cells may be referred to as “DC”). The “halohydrin epoxidase activity per soluble protein” means “halohydrin epoxidase activity per unit weight of soluble protein” and is also referred to as “protein specific activity”. Further, in the present invention, for convenience, it is assumed that a certain amount of soluble protein can be obtained from a certain amount of transformant, and the “halohydrin epoxidase activity per transformant” (“bacterial cell ratio”). Activity ") shall be proportional to" halohydrin epoxidase activity per soluble protein "(" protein specific activity "). That is, if “halohydrin epoxidase activity per soluble protein” (“protein specific activity”) is high (“low”), “halohydrin epoxidase activity per transformant” (“cell specific activity”) Is high (low). In the present invention, “liquid activity” means halohydrin epoxidase activity per unit solution amount. Examples of the solution include a solution containing what can be obtained from a “culture” obtained by culturing a transformant producing halohydrin epoxidase. Specific examples include a culture solution, a culture solution supernatant, a cell or cell suspension, a cell or cell disruption solution, a crude enzyme solution, and a processed product thereof. By dividing the “liquid activity” by the bacterial concentration or soluble protein concentration of the solution, the “halohydrin epoxidase activity per transformant” (“cell specific activity”) or “halohydride per soluble protein” Phosphoepoxidase activity "(" protein specific activity ") can be calculated. In the present invention, the “activity recovery rate” means a relative ratio (%) of activities recovered after the operation, assuming that the activity before a certain operation is 100%.

  Further, the improved halohydrin epoxidase in the present invention includes the product obtained when epihalohydrin or 4-halo-3-hydroxybutyronitrile is produced from the substrate 1,3-dihalo-2-propanol or epihalohydrin. In which the optical purity of the product is higher than the optical purity of the product when the product is produced from the substrate by the wild-type halohydrin epoxidase. That is, the thing which the stereoselectivity with respect to 1, 3- dihalo- 2-propanol and / or epihalohydrin which are substrates is improved rather than wild-type halohydrin epoxidase is contained. As an essential cause of the improvement in stereoselectivity, any cause may be used as long as it is caused by amino acid substitution mutation.

In the present invention, “optical activity” means a state of a substance in which one enantiomer is contained more than the other enantiomer, or a substance consisting of only one of the enantiomers. Say state. In addition, “optical purity” is approximately equal to “enantiomeric excess (% ee)” and is defined by the following equation.
Optical purity ≒ Enantiomeric excess = 100 x (| [R]-[S] |) / ([R] + [S]) (% ee)
Here, [R] and [S] indicate the respective concentrations of the enantiomers in the sample. In the present invention, the term “stereoselectivity” refers to the property that halohydrin epoxidase preferentially catalyzes the reaction of either enantiomer when a product is produced from a substrate. To tell.

In addition, the improved halohydrin epoxidase in the present invention includes a reaction from inhibition of reaction by chloride ion or 4-halo-3-hydroxybutyronitrile, which is a product from 1,3-dihalo-2-propanol or epihalohydrin. Those having improved resistance over wild-type halohydrin epoxidase, i.e., improved product inhibition resistance. As an essential cause of the improvement in product inhibition resistance, any cause may be used as long as it is caused by amino acid substitution mutation.
In the improved halohydrin epoxidase of the present invention, the product is used when epihalohydrin or 4-halo-3-hydroxybutyronitrile is produced from the substrate 1,3-dihalo-2-propanol or epihalohydrin. Those having the attribute of being able to generate and accumulate at high concentrations, that is, those having improved product accumulation ability are included. As an essential cause of the improvement of the product accumulation ability, any cause may be used as long as it is caused by amino acid substitution mutation.

The “improved halohydrin epoxidase” in the present invention specifically includes the following (A) to (A) to the amino acid sequence of the wild-type halohydrin epoxidase including the amino acid sequence I and the amino acid sequence II described above. It consists of an amino acid sequence into which one or a plurality of amino acid mutations selected from D) are introduced.
(A) Amino acid mutation in which one amino acid residue on the C-terminal side from the starting amino acid residue is substituted with another amino acid (B) Amino acid in which α14 residue in amino acid sequence I is substituted with another amino acid Mutation (C) Amino acid mutation in which α15 residue in amino acid sequence I is replaced with another amino acid (D) Amino acid mutation in which β21 residue in amino acid sequence II is replaced with another amino acid

  In the above (A), the “starting amino acid residue” means an amino acid residue corresponding to the amino acid encoded by the translation initiation codon in the gene (DNA or mRNA) of the wild-type halohydrin epoxidase, Means the N-terminal amino acid residue (usually a methionine residue) in the amino acid sequence of the wild-type halohydrin epoxidase after translation.

The amino acid mutations (A) to (D) above are defined when the first amino acid residue (usually methionine residue) located at the most N-terminal side in the amino acid sequence of wild-type halohydrin epoxidase is defined as the first amino acid. The amino acid mutation in the amino acid residue from the starting amino acid residue toward the C-terminal side can also be specified. For example, when the wild-type halohydrin epoxidase is HheB (1 ^st ) derived from the Corynebacterium sp. N-1074 strain consisting of the amino acid sequence shown in SEQ ID NO: 1, “Amino acid residue 1 C-terminal side from the starting amino acid residue”, “α14 residue” in (B), “α15 residue” in (C) and “β21 residue” in (D) are respectively (A) the second amino acid residue (alanine residue), (B) the 141st amino acid residue (threonine residue), (C) the 144th amino acid residue (phenylalanine residue) and (D) 207 Corresponds to the second amino acid residue (aspartic acid residue). When the wild-type halohydrin epoxidase is HheB (2 ^nd ) derived from the Corynebacterium sp. N-1074 strain consisting of the amino acid sequence shown in SEQ ID NO: 2, “Amino acid residue 1 C-terminal side from the starting amino acid residue”, “α14 residue” in (B), “α15 residue” in (C) and “β21 residue” in (D) are respectively (A) the second amino acid residue (alanine residue), (B) the 133rd amino acid residue (threonine residue), (C) the 136th amino acid residue (phenylalanine residue) and (D) 199 Corresponds to the second amino acid residue (aspartic acid residue). However, as described above, HheB (2 ^nd ) is only a protein consisting of an amino acid sequence in which 8 amino acid residues near the N-terminal in the amino acid sequence of HheB (1 ^st ) are deleted. HheB (1 ^st ) and HheB The absolute role of each amino acid residue in both (2 ^nd ) amino acid sequences is substantially the same.

As a preferable embodiment of the “improved halohydrin epoxidase” in the present invention, for example, one comprising an amino acid sequence into which any one or a plurality of amino acid mutations selected from the following (E) to (H) is introduced: Can be mentioned.
(E) Amino acid mutation in which one amino acid residue on the C-terminal side of the starting amino acid residue (usually methionine residue) is substituted with lysine or asparagine as another amino acid (F) α14 residue in amino acid sequence I Amino acid mutation in which the group is substituted with alanine, cysteine or serine as another amino acid (G) Amino acid mutation (H) amino acid in which α15 residue in amino acid sequence I is substituted with alanine, serine or tryptophan as another amino acid Amino acid mutation in which β21 residue in sequence II is substituted with glutamine, glutamic acid, histidine, serine, threonine, tyrosine, leucine, isoleucine or methionine as other amino acids. Here, amino acid mutations (E) to (H) above Are respectively examples of specific embodiments of the amino acid mutations (A) to (D) described above (for details, refer to “Other A Examples of Amino Acids "which is the one shown).

Therefore, as in the case of (A) to (D) described above, the “amino acid residue on the C-terminal side from the starting amino acid residue” in (E) above, the “α14 residue” in (F), The “α15 residue” in (G) and the “β21 residue” in (H) are respectively the starting amino acid residues (usually methionine residues) located most N-terminally in the wild-type halohydrin epoxidase amino acid sequence. ) Is defined as the first, it can be specified by the amino acid number from the starting amino acid residue toward the C-terminal side. That is, for example, when the wild-type halohydrin epoxidase is HheB (1 ^st ) derived from the Corynebacterium sp. N-1074 strain consisting of the amino acid sequence represented by SEQ ID NO: 1, Embodiments of amino acid mutations E) to (H) can be specified as follows.

(E) Amino acid mutation in which the second amino acid residue (alanine residue) is substituted with lysine or asparagine (F) Amino acid mutation in which the 141st amino acid residue (threonine residue) is substituted with alanine, cysteine or serine (G) Amino acid mutation in which the 144th amino acid residue (phenylalanine residue) is substituted with alanine, serine or tryptophan (H) The 207th amino acid residue (aspartic acid residue) is glutamine, glutamic acid, histidine, serine, Amino acid mutations substituted by threonine, tyrosine, leucine, isoleucine or methionine

Further, if a wild-type halohydrin epoxidase is SEQ ID NO: 2 Corynebacterium comprising the amino acid sequence shown in (Corynebacterium sp.) N-1074 strain derived HHEB (2 ^nd), the above (E) The mode of amino group mutation in (H) can be specified as follows.
(E) Amino acid mutation in which the second amino acid residue (alanine residue) is substituted with lysine or asparagine (F) Amino acid mutation in which the 133rd amino acid residue (threonine residue) is substituted with alanine, cysteine or serine (G) Amino acid mutation in which the 136th amino acid residue (phenylalanine residue) is substituted with alanine or serine (H) The 199th amino acid residue (aspartic acid residue) is glutamine, glutamic acid, histidine, serine, threonine, Amino acid mutations substituted with isoleucine or tyrosine

As a more specific and preferred embodiment of the “improved halohydrin epoxidase” in the present invention, the wild-type halohydrin epoxidase has the amino acid sequence shown in SEQ ID NO: 1 (Corynebacterium sp.). In the case of HheB (1 ^st ) derived from the N-1074 strain, improved halohydrin epoxidases having the amino acid sequences shown in SEQ ID NOs: 3 to 15 and 76 to 79 can be mentioned. Further, if a wild-type halohydrin epoxidase is a genus Corynebacterium having the amino acid sequence shown in SEQ ID NO: 2 (Corynebacterium sp.) N- 1074 strain derived HheB (2 ^nd) is SEQ ID NO: 16 And an improved halohydrin epoxidase having the amino acid sequences shown in 28 and 80-83.

  Hereinafter, embodiments of amino acid mutations (amino acid substitutions) in the amino acid sequences shown in SEQ ID NOs: 3-15 and 76-79 are shown in Table A, and amino acid mutations (amino acids in the amino acid sequences shown in SEQ ID NOs: 16-28 and 80-83) The mode of substitution is shown in Table B. Here, in Table A, “Ala2,” “Thr141,” “Phe144,” and “Asp207” are the positions and types of amino acid residues to be subjected to amino acid substitution in the amino acid sequence of SEQ ID NO: 1 (three letters). For example, “Thr141” means the 141st threonine residue. The notation in the lower column of these “Ala2” and the like represents the amino acid residue after amino acid substitution in each of the amino acid sequences of SEQ ID NOs: 3 to 15 and 76 to 79, for example, the amino acid sequence of SEQ ID NO: 3 If there is, “Lys” is written in the lower column of “Ala2,” which means that the second alanine residue is an amino acid sequence substituted with a lysine residue. The notation “−” means that there was no amino acid substitution. Furthermore, the sequence number of the base sequence (described later) encoding each amino acid sequence after amino acid substitution is also shown in the rightmost column of the table. The above description of the notation in Table A is similarly applied to Table B.

  The improved halohydrin epoxidase in the present invention only needs to have an amino acid sequence having one or more amino acid mutations selected from the above (A) to (D), preferably (E) to (H). . Therefore, the improved halohydrin epoxidase in the present invention includes those comprising an amino acid sequence having a combination of the above characteristics (A) to (H) (that is, amino acid mutations (A) to (H)). It is. In addition, while maintaining the amino acid mutation modes (A) to (H) above, the following (i) is used for the amino acid sequence of the wild-type halohydrin epoxidase that is the base of the improved halohydrin epoxidase: The improved halohydrin epoxidase having an amino acid sequence into which any one or a plurality of amino acid mutations selected from (i) to (iii) is introduced is also included in the scope of the improved halohydrin epoxidase in the present invention.

(I) Amino acid residue other than the amino acid residue C-terminal one residue from the starting amino acid residue, α14 residue in amino acid sequence I, α15 residue in amino acid sequence I, and β21 residue in amino acid sequence II An amino acid mutation in which one or several amino acid residues selected from the above are substituted with other amino acids (ii) an amino acid residue that is one residue C-terminal from the starting amino acid residue, an amino acid residue contained in amino acid sequence I Amino acid mutation in which one or several amino acid residues selected from amino acid residues other than the amino acid residues contained in the group and amino acid sequence II are deleted (iii) two or more residues from the starting amino acid residue on the C-terminal side Amino acid mutation in which one or several arbitrary amino acid residues are inserted into a region other than the region consisting of amino acid sequence I and amino acid sequence II in the region consisting of amino acid residues

In the above embodiments (i) to (iii), “one or several” refers to, for example, about 1 to 10, preferably about 1 to 5.
In the present invention, the type of amino acid may be represented by a three-letter or one-letter alphabet. Furthermore, it may be described by placing a three-letter or one-letter alphabet before or before the number, and in this case, represents the position of the amino acid residue and the type of amino acid before and after substitution. In other words, unless otherwise specified, as described above, when the amino acid residue (usually methionine) encoded by the translation initiation codon is defined as the first, the number indicates the number of the amino acid residue. It is shown. In addition, the three-letter or one-letter alphabet displayed before the number represents the three-letter or one-letter code of the amino acid before the amino acid substitution, and the three-letter or one-letter alphabet displayed after the number causes an amino acid substitution. In this case, the three-letter or one-letter code of the amino acid after substitution is to be expressed. For example, the 207th aspartic acid residue may be expressed as “Asp207” or “D207”, and when the 207th aspartic acid residue is substituted with histidine, it may be expressed as “Asp207His” or “D207H”.

(III) Halohydrin epoxidase gene (III-1) Wild-type halohydrin epoxidase gene Among wild-type halohydrin epoxidases, the gene sequence (base sequence) of which has been clarified In the GenBank database (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=Nucleotide) provided by the National Center for Biotechnology Information (NCBI), the following Accession No. Registered by.

“Accession No. D90349”: the nucleotide sequence of the gene encoding HheA derived from Corynebacterium sp. N-1074 “Accession No. AF397297”: derived from Arthrobacter sp. AD2 Base sequence of the gene encoding HheA _AD2 “Accession No. D90350”: Base sequence of the gene encoding HheB derived from Corynebacterium sp. N-1074 strain “Accession No. AY044094”: Genus Mycobacterium (Mycobacterium sp.) GP1 derived gene sequence encoding HheB _GP1 “Accession No. AF397296”: Agrobacterium radiobacter AD1 strain encoding HheC derived gene base sequence “Accession No. AF149769 ”: Nucleotide sequence of the gene encoding HalB derived from Agrobacterium tumefaciens

In the present invention, these are referred to as “wild-type halohydrin epoxidase genes”. Here, the term “wild type” in the “wild type halohydrin epoxidase gene” refers to “halohydrin epoxidase”, and the amino acid sequence of halohydrin epoxidase is “wild type”. It means that there is. The base sequence constituting the “wild-type halohydrin epoxidase gene” in the present invention is not limited as long as it encodes a codon that can be used in the transformant host. The base sequence of the type halohydrin epoxidase gene is not limited. The wild type halohydrin epoxidase gene encoding HheB (1 ^st ) described in (II-1) wild type halohydrin epoxidase is referred to as HheB (1 ^st ) and encodes HheB (2 ^nd ). We shall refer to a gene and HheB (2 ^nd). The base sequence of HheB (1 ^st ) is shown in SEQ ID NO: 29, and the base sequence of HheB (2 ^nd ) is shown in SEQ ID NO: 30.

  To obtain a wild-type halohydrin epoxidase gene whose base sequence has been clarified, genomic DNA is prepared from the source organism, and based on the information on the sequence of the wild-type halohydrin epoxidase gene that has been clarified. And a method of amplifying a gene encoding a halohydrin epoxidase by PCR using the primer. Examples of the derived organism include N-1074 strain, and this strain has the accession number “FERM BP-2643” and the National Institute of Advanced Industrial Science and Technology Patent Biological Deposit Center (1-1-1 Tsukuba City East, Ibaraki Prefecture). No. 6 (hereinafter the same as in the present specification) has been deposited on November 10, 1988. It is also possible to chemically synthesize the full length of the wild-type halohydrin epoxidase gene using a PCR method (assembly PCR) combining synthetic oligo DNA based on known gene sequence information. . For example, the wild-type halohydrin epoxidase gene is divided into several regions (for example, about 50 bases), and multiple oligonucleotides that overlap with adjacent regions (for example, about 20 bases) at both ends are designed. And synthesize. The wild type halohydrin epoxidase gene can be amplified by annealing the oligonucleotides to each other by PCR.

Moreover, you may change the codon of a wild-type halohydrin epoxidase gene as needed. As a means for changing the codon, for example, site-specificity described in Molecular Cloning, A Laboratory Manual 2nd ed., Cold Spring Harbor Laboratory Press (1989), Current Protocols in Molecular Biology, John Wiley & Sons (1987-1997), etc. For mutagenesis using the dynamic displacement induction method and site-directed mutagenesis method (for example, QuickChange ^TM Site-Directed Mutagenesis Kit (Stratagene), GeneTailor ^TM Site-Directed Mutagenesis System (Invitrogen), TaKaRa) Site-Directed Mutagenesis System (Mutan-K, Mutan-Super Express Km, etc .: manufactured by Takara Bio Inc.)) and the like can be used. In addition, as described above, the codon can be changed by using a primer whose codon has been changed when performing a PCR method (assembly PCR) using a synthetic oligo DNA.

(III-2) Improved halohydrin epoxidase gene The improved halohydrin epoxidase gene in the present invention means a gene encoding the improved halohydrin epoxidase enzyme protein described in (II-2). To do. The improved halohydrin epoxidase gene of the present invention is, for example, (A) of (II-2) above for the wild-type halohydrin epoxidase consisting of the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2. A gene encoding an improved halohydrin epoxidase having an amino acid sequence into which any one or a plurality of amino acid mutations selected from (D) are introduced, and more preferably (E-2) in (E-2) A gene encoding an improved halohydrin epoxidase having an amino acid sequence into which any one or a plurality of amino acid mutations selected from (H) to (H) are introduced. The nucleotide sequence constituting the wild-type halohydrin epoxidase gene and the amino acid residue after introduction of the above-described amino acid mutation may be any sequence as long as it encodes a codon that can be used in the transformant host, and is not necessarily present on the genomic DNA of the organism. The nucleotide sequence of the encoded wild-type halohydrin epoxidase gene is not limited. In addition, HheB (1 ^st ) and HheB (2 ^nd ), which are the wild-type halohydrin epoxidase genes encoding HheB (1 ^st ) described in the wild type halohydrin epoxidase of (II-1) above, HheB (2 ^nd ), which encodes a wild-type halohydrin epoxidase gene, can be used as a base-type wild-type halohydrin epoxidase gene for obtaining an improved halohydrin epoxidase gene. it can. As a more specific and preferred embodiment of the “improved halohydrin epoxidase gene” in the present invention, the wild-type halohydrin epoxidase has the amino acid sequence shown in SEQ ID NO: 1 (Corynebacterium sp. ) In the case of HheB (1 ^st ) derived from the N-1074 strain, improved halohydrin epoxidase genes having the base sequences shown in SEQ ID NOs: 31 to 43 and 84 to 87 can be mentioned. Further, if a wild-type halohydrin epoxidase is a genus Corynebacterium having the amino acid sequence shown in SEQ ID NO: 2 (Corynebacterium sp.) N- 1074 strain derived HheB (2 ^nd) is SEQ ID NO: 44 to And an improved halohydrin epoxidase gene having base sequences shown in 56 and 88-91.

  The improved halohydrin epoxidase gene in the present invention is an amino acid sequence of an improved halohydrin epoxidase into which one or more amino acid mutations selected from (A) to (H) of (II-2) are introduced. Therefore, an improved halohydrin having a combination of features (A) to (H) of (II-2) above (ie, amino acid mutations (A) to (H)). Also included is a gene encoding the amino acid sequence of epoxidase. In addition, while maintaining the amino acid substitution mode of (A) to (H) in (II-2) above, in the amino acid sequence of the wild-type halohydrin epoxidase that is the base of the improved halohydrin epoxidase The gene encoding the amino acid sequence of the improved halohydrin epoxidase into which any one of the amino acid mutations selected from (i) to (iii) of (II-2) is introduced is also the improved halohydride in the present invention. Included within the scope of the phosphoepoxidase gene.

  Furthermore, as the improved halohydrin epoxidase gene of the present invention, an improved halohydrin into which any one or a plurality of amino acid mutations selected from (A) to (H) of (II-2) is introduced. A DNA comprising a base sequence complementary to the base sequence encoding the amino acid sequence of epoxidase and a DNA that hybridizes under stringent conditions are also included. Such DNA is, for example, an improved halohydrin epoxidase gene DNA consisting of a base sequence encoding an amino acid sequence into which any one or a plurality of amino acid mutations selected from the above (A) to (H) is introduced, or It can be obtained from a cDNA library and a genomic library by a known hybridization method such as colony hybridization, plaque hybridization, Southern blotting using the complementary sequence or a fragment thereof as a probe. A library prepared by a known method can be used, and a commercially available cDNA library and genomic library can also be used.

“Stringent conditions” are conditions at the time of washing after hybridization, in which the salt concentration is 300 to 2000 mM, the temperature is 40 to 75 ° C., preferably the salt concentration is 600 to 900 mM, and the temperature is 65 ° C. means. For example, 2 × SSC and conditions such as 50 ° C. can be mentioned. Those skilled in the art will consider other conditions such as probe concentration, probe length, reaction time, etc. in addition to the conditions such as salt concentration and temperature of the buffer. A DNA comprising a nucleotide sequence complementary to the nucleotide sequence encoding the amino acid sequence of the improved halohydrin epoxidase introduced with any or a plurality of amino acid mutations selected from A) to (H), and a stringent Conditions for obtaining DNA that hybridizes under conditions can be set.
For detailed procedures of the hybridization method, Molecular Cloning, A Laboratory Manual 2nd ed. (Cold Spring Harbor Laboratory Press (1989)) can be referred to. Examples of the hybridizing DNA include, for example, at least a base sequence encoding an amino acid sequence into which any one or a plurality of amino acid mutations selected from (A) to (H) of (II-2) is introduced. Examples thereof include DNA containing a base sequence having 40% or more, preferably 60%, more preferably 90% or more identity, or a partial fragment thereof.

In the present invention, the method for preparing the improved halohydrin epoxidase gene may be any known method for introducing a mutation, and can generally be performed by a known method. For example, using a commercially available kit based on the wild-type halohydrin epoxidase gene, site-specific substitution can be performed, or gene DNA can be selectively cleaved and then the selected oligonucleotide removed. The method of adding and connecting is mentioned. These site-directed mutagenesis methods are described in `` Molecular Cloning, A Laboratory Manual 2nd ed. '' (Cold Spring Harbor Press (1989)), `` Current Protocols in Molecular Biology '' (John Wiley & Sons (1987-1997)), Kunkel. , Proc. Natl. Acad. Sci. USA, 82: 488-492 (1985), Kramer and Fritz Method. Enzymol., 154: 350-367 (1987), Kunkel, Method. Enzymol., 85: 2763-2766 ( 1988). In recent years, mutagenesis kits using site-directed mutagenesis based on the Kunkel method or the Gapped duplex method, such as QuikChange ^TM Site-Directed Mutagenesis Kit (Stratagene), GeneTailor ^TM Site-Directed Mutagenesis System (Manufactured by Invitrogen), TaKaRa Site-Directed Mutagenesis System (Mutan-K, Mutan-Super Express Km etc .: manufactured by Takara Bio Inc.) and the like. In addition, when the target mutation introduction site exists in the vicinity of a restriction enzyme site that can be easily digested and linked in the target gene sequence, PCR is performed using a primer (synthetic oligo DNA) into which the target mutation has been introduced, A gene DNA fragment into which the target mutation has been introduced can be easily obtained. Furthermore, it can be extended by a PCR method (assembly PCR) combining synthetic oligo DNAs to obtain a synthetic gene. In addition, random methods such as methods that contact and act drugs such as hydroxylamine and nitrous acid, methods that induce mutations by UV irradiation, and methods that randomly introduce mutations using PCR (polymerase chain reaction) An improved halohydrin epoxidase gene can be obtained from a wild-type halohydrin epoxidase gene also by a mutation introduction method.

(IV) Recombinant vector, transformant (IV-1) recombinant vector In order to express the improved halohydrin epoxidase gene of the present invention obtained by the above method in a host, a transcription promoter is placed upstream of the gene. An expression cassette can be constructed by inserting a terminator downstream, and this cassette can be inserted into an expression vector. Alternatively, if a transcription promoter and terminator already exist in the expression vector into which the improved halohydrin epoxidase gene is introduced, the promoter and terminator in the vector are used in the meantime without constructing an expression cassette. A mutant gene may be inserted. In order to insert the improved halohydrin epoxidase gene into a vector, a method using a restriction enzyme, a method using topoisomerase, or the like can be used. Further, if necessary at the time of insertion, an appropriate linker may be added. In the present invention, such an integration operation can also be performed in combination with an operation for preparing an improved halohydrin epoxidase gene. That is, PCR is performed using a primer having a base sequence substituted with a base sequence encoding another amino acid, a recombinant vector in which a wild-type halohydrin epoxidase gene is cloned as a template, and the resulting amplified product is used as a vector. Can be incorporated into.

  The type of promoter is not particularly limited as long as it allows appropriate expression in the host.For example, those that can be used in E. coli hosts include the trp promoter of tryptophan operon, the lac promoter of lactose operon, Examples include PL promoters and PR promoters derived from lambda phage, and modified and designed sequences such as tac promoter and trc promoter can also be used. Examples that can be used in a Bacillus subtilis host include gluconate synthase promoter (gnt), alkaline protease promoter (apr), neutral protease promoter (npr), α-amylase promoter (amy), and the like. Examples that can be used in a Rhodococcus genus bacterial host include a promoter related to a nitrilase expression regulatory gene derived from Rhodococcus erythropolis SK92-B1 strain contained in an expression vector pSJ034. pSJ034 is a plasmid that expresses nitrile hydratase in bacteria belonging to the genus Rhodococcus, and can be prepared from pSJ023 by the method described in JP-A-10-337185. In addition, pSJ023 was transformed into ATCC12674 / pSJ023 (accession number “FERM BP-6232”) by the National Institute of Advanced Industrial Science and Technology, Patent Biological Depositary Center (1-1-1 Higashi 1-1-1, Tsukuba City, Ibaraki Prefecture). Deposited on March 4, 1997.

The terminator is not necessarily required, and the type of the terminator is not particularly limited, and examples thereof include ρ-factor-independent ones such as lipoprotein terminator, trp operon terminator, rrnB terminator and the like.
Further, ribosome binding sequences such as an SD sequence and a Kozak sequence are known as base sequences important for amino acid translation, and these sequences can be inserted upstream of a mutated gene. An SD sequence may be added by PCR or the like when a prokaryote is used as a host, and a Kozak sequence may be added when a eukaryotic cell is used as a host. Examples of the SD sequence include sequences derived from E. coli or Bacillus subtilis, but are not particularly limited as long as the sequence functions in a desired host such as Escherichia coli or Bacillus subtilis. For example, a consensus sequence in which a sequence complementary to the 3 ′ end region of 16S ribosomal RNA is continuous for 4 or more bases may be prepared by DNA synthesis and used.
In general, a vector contains a factor (selection marker) for selecting a target transformant. Examples of selectable markers include drug resistance genes, auxotrophic complementary genes, and assimilative genes, and can be selected according to the purpose and host. For example, drug resistance genes used as selection markers in E. coli include ampicillin resistance gene, kanamycin gene, dihydrofolate reductase gene, neomycin resistance gene and the like.

  The vector used in the present invention is not particularly limited as long as it retains the above mutant gene, and a vector suitable for each host can be used. Examples of the vector include plasmid DNA, bacteriophage DNA, retrotransposon DNA, artificial chromosome DNA and the like. For example, when E. coli is used as a host, pTrc99A (Centraalbureau voor Schimmelcultures (CBS), the Netherlands; http://www.cbs.knaw.nl/), pUC19 (Takara) having a region capable of autonomous replication in E. coli Bio, Japan), pKK233-2 (Centraalbureau voor Schimmelcultures (CBS), Netherlands; http://www.cbs.knaw.nl/), pET-12 (Novagen, Germany), pET-26b (Novagen, Germany) ) Etc. can be used. Moreover, what modified these vectors as needed can also be used. An expression vector having high expression efficiency, such as an expression vector pTrc99A or pKK233-2 having a trc promoter or a lac operator, can also be used.

  Recombinant vectors containing the improved halohydrin epoxidase gene are within the scope of the present invention. Specific examples of the recombinant vector containing the improved halohydrin epoxidase gene include, for example, pSTK002, pSTK003, pSTT002, pSTT003, pSTT002-T133A, pSTT002-T136C, pSTT002-T133S, pSTT002- exemplified in the present invention. F136A, pSTT002-F136S, pSTT002-F136W, pSTT002-D199Q, pSTT002-D199E, pSTT002-D199H, pSTT002-D199S, pSTT002-D199T, pSTT002-D199Y, pSTT002-D199L, pSTT002-D199M, pSTT002-D199T, etc.

(IV-1) Transformant A transformant or transductant (hereinafter collectively referred to as “transformant”) is produced by transforming or transducing the recombinant vector of the present invention into a host. . Such transformants are also included in the scope of the present invention.
The host used in the present invention is not particularly limited as long as the desired improved halohydrin epoxidase can be expressed after the introduction of the above recombinant vector. Examples of the host include bacteria such as Escherichia coli, Bacillus subtilis, Rhodococcus bacteria, yeast (Pichia, Saccharomyces), mold (Aspergillus), animal cells, insect cells, plant cells and the like.

  When bacteria are used as hosts, Escherichia coli and Rhodococcus bacteria can be used as preferred hosts in the present invention. Examples of Escherichia coli include Escherichia coli K12 strain and B strain, and JM109 strain, XL1-Blue strain, and C600 strain, which are derived from these wild strains. In particular, when the lac promoter of the lactose operon as described above and its derived promoter are used as expression promoters, expression becomes inducible if a host having the lacI repressor gene is used (induced by IPTG or the like), and the lacI repressor gene is present. If a non-host is used, the expression becomes a constitutive type, so that a host as required can be used. These strains are easily available from, for example, the American Type Culture Collection (ATCC). Examples of Bacillus subtilis include Bacillus subtilis. Examples of Rhodococcus bacteria include, for example, Rhodococcus rhodochrous ATCC999, ATCC12674, ATCC17895, ATCC15998, ATCC33275, ATCC184, ATCC4001, ATCC4273, ATCC4276, ATCC9356, ATCC9356, ATCC14341, ATCC14347, ATCC14350, ATCC15905, ATCC15998, ATCC15998, ATCC17041, ATCC19149, ATCC19150, ATCC21243, ATCC29670, ATCC29672, ATCC29675, ATCC33258, ATCC13808, ATCC17043, ATCC19067, AT2 , ATCC21291, ATCC21785, ATCC21924, IFO14894, IFO3338, NCIMB11215, NCIMB11216, JCM3202, Rhodococcus rhodochrous J1 (accession number "FERM BP-1478"), ococcus R globerulus) IFO14531, Rhodococcus luteus JCM6162, JCM6164, Rhodococcus erythropolis (Rhodococcus) erythropolis) IFO12538 strain, IFO12320 strain, Rhodococcus equi IFO3730 strain, and JCM1313 strain. Preferably, Rhodococcus rhodochrous J1 strain (Accession number “FERM BP-1478”) is used. The ATCC strain is from the American Type Culture Collection, the IFO strain is from the National Institute of Product Evaluation Technology Biotechnology Headquarters, Biogenetic Resource Division (NBRC), and the JCM strain is the RIKEN BioResource Center, Microbial Materials Development. From the laboratory, FERM strains can be obtained from the National Institute of Advanced Industrial Science and Technology Patent Biological Depositary.

  The method for introducing a recombinant vector into bacteria is not particularly limited as long as it is a method for introducing DNA into bacteria. Examples thereof include a method using calcium ions and an electroporation method. When yeast is used as a host, for example, Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pichia pastoris, etc. are used. The method for introducing a recombinant vector into yeast is not particularly limited as long as it is a method for introducing DNA into yeast, and examples thereof include an electroporation method, a spheroplast method, and a lithium acetate method. When animal cells are used as hosts, monkey cells COS-7, Vero, CHO cells, mouse L cells, rat GH3, human FL cells and the like are used. Examples of methods for introducing a recombinant vector into animal cells include an electroporation method, a calcium phosphate method, and a lipofection method. When insect cells are used as hosts, Sf9 cells, Sf21 cells and the like are used. As a method for introducing a recombinant vector into insect cells, for example, calcium phosphate method, lipofection method, electroporation method and the like are used. When plant cells are used as hosts, tobacco BY-2 cells and the like can be mentioned, but are not limited thereto. As a method for introducing a recombinant vector into a plant cell, for example, an Agrobacterium method, a particle gun method, a PEG method, an electroporation method, or the like is used.

  A transformant obtained by the recombinant vector containing the improved halohydrin epoxidase gene is included in the scope of the present invention. Specific examples of the transformant using the recombinant vector containing the improved halohydrin epoxidase gene include, for example, JM109 / pSTK002, JM109 / pSTK003, JM109 / pSTT002, JM109 / pSTT003, JM109 / pSTT002-T133A, JM109 / pSTT002-T133C, JM109 / pSTT002-T133S, JM109 / pSTT002-F136A, JM109 / pSTT002-F136S, JM109 / pSTT002-F136W, JM109 / pSTT002-D199Q, JM109 / pSTT002-199 D199H, JM109 / pSTT002-D199S, JM109 / pSTT002-D199T, JM109 / pSTT002-D199Y, JM109 / pSTT002-D199L, JM109 / pSTT002-D199M, JM109 / pSTT002-D199I, and the like.

(V) Method for producing improved halohydrin epoxidase In the present invention, the improved halohydrin epoxidase is produced as a culture itself obtained by culturing the above transformant or by harvesting from the culture. can do. In the present invention, the “culture” refers to a culture solution, a culture solution supernatant, a cell or fungus body, a cell or fungus suspension, a cell or fungus disruption solution, a crude enzyme solution, and a processed product thereof. It means to include both those obtained by culturing transformants producing type halohydrin epoxidase and those resulting therefrom. A culture obtained by culturing the transformant of the present invention is included in the scope of the present invention. The method for culturing the transformant of the present invention can be carried out according to a usual method used for culturing a host. The desired improved halohydrin epoxidase accumulates in any of the cultures.

  The medium for culturing the transformant of the present invention contains a carbon source, a nitrogen source, inorganic salts and the like that can be assimilated by the host, and can be a natural medium as long as the transformant can be cultured efficiently. Any of synthetic media may be used. Examples of the carbon source include carbohydrates such as glucose, galactose, fructose, sucrose, raffinose and starch, organic acids such as acetic acid and propionic acid, and alcohols such as ethanol and propanol. Examples of the nitrogen source include ammonium salts of inorganic acids or organic acids such as ammonia, ammonium chloride, ammonium sulfate, ammonium acetate, and ammonium phosphate, and other nitrogen-containing compounds. In addition, peptone, yeast extract, meat extract, corn steep liquor, various amino acids, and the like may be used. Examples of inorganic substances include monopotassium phosphate, dipotassium phosphate, magnesium phosphate, magnesium sulfate, sodium chloride, ferrous sulfate, manganese sulfate, zinc sulfate, copper sulfate, and calcium carbonate. Moreover, you may add an antifoamer in order to prevent foaming during culture | cultivation as needed. Moreover, you may add a vitamin etc. suitably as needed. During culture, an antibiotic such as ampicillin or tetracycline may be added to the medium as necessary.

During the culture, the vector and the target gene may be cultured under selective pressure in order to prevent the loss of the vector and the target gene. That is, a drug corresponding to the case where the selection marker is a drug resistance gene may be added to the medium, and a nutrient factor corresponding to the case where the selection marker is an auxotrophic complementary gene may be removed from the medium. When the selectable marker is an assimilation gene, a corresponding assimilation factor can be added as a sole factor as necessary. For example, when culturing E. coli transformed with a vector containing an ampicillin resistance gene, ampicillin may be added to the medium as needed during the culture.
When cultivating a transformant transformed with an expression vector using an inducible promoter as a promoter, an inducer may be added to the medium as necessary. For example, when cultivating a transformant transformed with an expression vector having a promoter inducible with isopropyl-β-D-thiogalactoside (IPTG), IPTG or the like can be added to the medium. In addition, when cultivating a transformant transformed with an expression vector using a trp promoter inducible with indoleacetic acid (IAA), IAA or the like can be added to the medium.

  The culture conditions for the transformant are not particularly limited as long as the desired improved halohydrin epoxidase productivity and the growth of the host are not hindered. Usually, the culture temperature is 10 ° C to 45 ° C. C., preferably 10 ° C. to 40 ° C., more preferably 15 ° C. to 40 ° C., and even more preferably 20 ° C. to 37 ° C., and the temperature may be changed during the cultivation as necessary. The culture time is 5 to 120 hours, preferably 5 to 100 hours, more preferably 10 to 100 hours, and even more preferably about 15 to 80 hours. The pH is adjusted using an inorganic or organic acid, an alkaline solution, or the like. Examples of the culture method include solid culture, stationary culture, shaking culture, and aeration and agitation culture.

  In particular, when culturing Escherichia coli transformants, it is preferable to culture under aerobic conditions by shaking culture or aeration and agitation culture (jar fermenter). In this case, the culture may be performed by a normal solid culture method. However, it is preferable to employ the liquid culture method as much as possible. Examples of the medium used for the culture include one or more nitrogen sources such as yeast extract, tryptone, polypeptone, corn steep liquor, soybean or wheat bran leachate, sodium chloride, monopotassium phosphate, dipotassium phosphate. In addition, one or more inorganic salts such as magnesium sulfate, magnesium chloride, ferric chloride, ferric sulfate or manganese sulfate are added, and if necessary, saccharide raw materials, vitamins and the like are appropriately added. The initial pH of the medium is suitably adjusted to 7-9. The culture is performed at 5 ° C to 40 ° C, preferably 10 ° C to 37 ° C for 5 to 100 hours. It is preferably carried out by aeration and agitation deep culture, shaking culture, static culture, fed-batch culture or the like. In particular, when producing improved halohydrin epoxidase on an industrial scale, aeration and agitation culture can be used. Furthermore, the operation method of the aeration and agitation culture is not limited, and it can be performed in any of a batch culture, a fed-batch culture, a semi-batch culture, and a continuous culture. Good. In particular, when it is desired to increase productivity per apparatus, per hour, per cost, or per operation by high concentration culture, semi-batch culture can be performed. The fed medium component used in the semi-batch method may have the same composition as the batch medium component or the composition may be changed, but the concentration of the medium component compared to the initial medium Is preferably at a higher concentration. The volume of the fed-batch medium is not particularly limited, but usually a volume of 1/2 or less of the initial medium can be added. The feeding mode is, for example, constant flow, constant, exponential, stepwise increase, or specific growth rate. Controlled flow method (specific growth-rate control), pH stat flow method (pH-stat), DO stat flow method (DO-stat), glucose concentration control flow method (glucose concentration control), acetic acid concentration monitoring flow Methods (acetate concentration monitoring), fuzzy neural network (Trends in Biotechnology (1996), 14, 98-105), but the desired halohydrin epoxidase activity can be obtained. There is no particular limitation. In addition, the culture end time at the time of semi-batch culture does not need to be limited after the end of the flow medium, and the culture is continued as necessary, and the halohydrin epoxidase activity per transformant is the highest. The culture can be terminated at a high point.

Examples of a medium for culturing a transformant obtained using animal cells as a host include generally used RPMI1640 medium, DMEM medium, or a medium obtained by adding fetal calf serum or the like to these mediums. The culture is usually performed at 37 ° C. for 1 to 30 days in the presence of 5% CO ₂ . During culture, antibiotics such as kanamycin and penicillin may be added to the medium as necessary. When the transformed (introduced) body is a plant cell or plant tissue, culturing can be performed by using a normal plant culture medium such as an MS basic medium or an LS basic medium. As a culture method, any of a normal solid culture method and a liquid culture method can be employed.
When the transformant is a plant cell or plant tissue, the culture can be performed by using a normal plant culture medium such as an MS basic medium or an LS basic medium. As a culture method, any of a normal solid culture method and a liquid culture method can be employed.
When cultured under the above culture conditions, the improved halohydrin epoxidase of the present invention is added to the culture, that is, at least one of a culture solution, a culture supernatant, cells, fungus bodies, or cells or fungus disruptions. Can be accumulated.

  When improved halohydrin epoxidase is produced in cells or cells after culturing, the cells or cells can be used as a catalyst in substance production, or the cells or cells can be disrupted. Thus, the desired improved halohydrin epoxidase can be collected. In either case, if necessary, the medium can be removed and washed by solid-liquid separation operations such as centrifugation and membrane filtration. Centrifugation is not particularly limited as long as it can supply centrifugal force for sedimenting cells or cells, and a cylindrical shape, a separation plate shape, or the like can be used. As a centrifugal force, it can carry out at about 500G-20,000G, for example. The membrane filtration that can be used in this step may be either a microfiltration (MF) membrane or an ultrafiltration (UF) membrane as long as the desired solid-liquid separation can be achieved. It is preferable to use it. For example, microfiltration can be classified into dead-end and crossflow (tangential flow) methods based on the flow direction, and gravity, pressure, vacuum, centrifugal force based on how pressure is applied. It can be classified into formulas, etc., and based on the operation mode, it can be classified into batch type and continuous type, but any one that can perform solid-liquid separation operation can be used. it can. Materials for MF membranes can be broadly classified into polymer membranes, ceramic membranes, metal membranes, and composites thereof, which can reduce the improved halohydrin epoxidase activity and the activity recovery rate during solid-liquid separation operations. Unless otherwise specified, polymer membranes such as polysulfone, polyethersulfone, polytetrafluoroethylene, polyvinylidene fluoride, polyvinyl chloride, polypropylene, polyolefin, polyethylene, polycarbonate, polyacrylonitrile, mixed cellulose ester, Copper ammonia method regenerated cellulose ester, polyimide, nylon, Teflon (registered trademark) and the like are preferable. The pore diameter of the membrane is not particularly limited as long as it can capture bacterial cells or cells and can be concentrated, and usually about 0.1 to 0.5 μm can be used.

  At the time of the solid-liquid separation operation by the above centrifugal separation and membrane filtration, dilution washing can be performed by adding water or, if necessary, a buffer solution or an isotonic solution. The buffer used is not particularly limited as long as it does not reduce the improved halohydrin epoxidase activity and the activity recovery rate during solid-liquid separation. For example, the salt concentration is 5 to 500 mM, preferably 5 It is about -150 mM and pH should just be about 5-9. Examples of the buffer component include tris (hydroxymethyl) aminomethane (Tris), sodium or potassium phosphate, citrate, acetate, and the like. Specific examples include 20 mM Tris-sulfate buffer (pH 8), 20 mM sodium phosphate buffer (pH 7), and the like. Examples of the isotonic solution include 0.7 to 0.9% sodium chloride solution. In addition, if there are substances that can stabilize the improved halohydrin epoxidase, they may be added.

  After performing the above-mentioned medium removal and washing operations, the cells or cells can be suspended again in water or, if necessary, in a buffer solution or an isotonic solution to prepare a cell or cell suspension. The bacterial cell or cell suspension can be used as a catalyst in substance production as it is, but can be used after treatment as necessary. As a treatment method, for example, the surfactant may be added to the culture obtained from the above-mentioned culture so that the final concentration becomes 0.01% to 10% and stirred at a temperature at which the halohydrin epoxidase is not inactivated. The final concentration of the surfactant is preferably 0.05% to 1%, particularly preferably 0.1% to 0.5%. The treatment temperature is preferably 0 ° C to 40 ° C, particularly preferably 4 ° C to 20 ° C. The treatment time may be within the time in which the effect of the bacterial cell treatment is recognized, preferably 15 minutes to 24 hours, particularly preferably 30 minutes to 2 hours. As the surfactant, an anionic surfactant, a cationic surfactant, or a nonionic surfactant can be used. As an anionic surfactant, sodium dodecyl sulfate can be used. As the cationic surfactant, benzethonium chloride or the like can be used. As the nonionic surfactant, Triton X100 or the like can be used. Bacteria treated with a surfactant may be used after washing with a buffer, or may be used without washing. Moreover, it is also possible to directly perform a treatment with a fungus body or cell surfactant or the like without performing the above-described medium removal and washing operations. In addition, bacterial cells or cells can be immobilized and used. Specific examples include those in which cells or cells after culturing are included in a gel such as acrylamide, or those supported on an inorganic carrier such as alumina, silica, zeolite, or diatomaceous earth.

  On the other hand, the desired improved halohydrin epoxidase can also be collected by disrupting the cells or cells. As a method for disrupting cells or cells, ultrasonic treatment, high-pressure treatment with a French press or a homogenizer, grinding treatment with a bead mill, collision treatment with an impact crushing device, enzyme treatment using lysozyme, cellulase, pectinase, etc., freeze-thaw treatment, Examples include hypotonic solution treatment, lysis induction treatment with phage, and the like, and any of these methods can be used alone or in combination as necessary. When crushing bacterial cells or cells on an industrial scale, it is preferable to use mainly high-pressure treatment, grinding treatment, and collision treatment in consideration of operability, recovery rate, cost, etc. Enzymatic treatment or the like may be combined with the mechanical crushing operation. In each crushing method, the operation conditions are not particularly limited as long as the improved halohydrin epoxidase recovery rate from the cells or cells is sufficiently high. The sufficiently high improved halohydrin epoxidase recovery rate is, for example, preferably 85% or more, more preferably 90% or more, still more preferably 95%, and most preferably 99% or more.

When grinding by a bead mill, the beads used can be crushed by, for example, filling about 80 to 85% of a density of 2.5 to 6.0 g / cm ³ and a size of 0.1 to 1.0 mm, Either a batch system or a continuous system can be adopted as the operation system. The bacterial cell or cell concentration is not particularly limited, but may be, for example, about 6 to 12% for bacteria and about 14 to 18% for yeasts.
When high-pressure treatment is performed, the treatment pressure is not particularly limited as long as the recovery rate of improved halohydrin epoxidase from cells or cells is sufficiently high. For example, crushing is performed at a pressure of about 40 to 150 MPa. Can do. The bacterial cell or cell concentration is not particularly limited, and may be, for example, about 20% or less. If necessary, it is possible to perform multistage processing by arranging the devices in series or using a device having a multi-stage structure to improve crushing and operation efficiency. Usually, since a temperature rise of 2 to 3 ° C. per 10 MPa of processing pressure occurs, it is preferable to perform a cooling process as necessary.
In the case of the collision treatment, for example, the cells to be crushed or the cell slurry are preliminarily sprayed into a frozen fine particle (eg, 50 μm or less) by rapid freezing treatment (freezing speed: for example, several thousand degrees C per minute), and this is performed at high speed ( For example, the cells or cells can be crushed by colliding against the collision plate with a carrier gas of about 300 m / s).

  As a result of bacterial cell or cell disruption treatment as described above, when the intracellular nucleic acid flows out, the viscosity of the treatment liquid increases and handling becomes difficult, or the activity recovery rate in the subsequent residue separation step If there is an effect on the improvement, it is possible to expect a reduction in the viscosity of the treatment liquid and an improvement in the activity recovery rate in the residue separation step by removing the nucleic acid or decomposing the nucleic acid as necessary. Any method can be used for removing or degrading nucleic acids in the cell lysate so long as the method can remove or degrade nucleic acids without reducing the improved halohydrin epoxidase activity or the activity recovery rate. However, for example, as described in Biochemistry Laboratory, Vol. 5, pages 200-201, nucleic acid is degraded by adding protamine sulfate or streptomycin to the cell lysate, or nucleolytic enzyme. And a method of liquid-liquid separation using dextran-polyethylene glycol. It may also be useful to add further physical crushing treatments. Among these methods, in particular, when it is desired to rapidly degrade nucleic acids while avoiding complicated processes, a method of degrading nucleic acids with a nucleolytic enzyme can be employed. The nucleolytic enzyme used in the nucleolytic enzyme treatment may be any nucleolytic enzyme as long as it acts on at least deoxyribonucleic acid (DNA), has a nucleolytic reaction catalytic ability, and lowers the degree of DNA polymerization. However, an exogenous nucleolytic enzyme may be added separately. Examples of the nucleolytic enzyme added separately include bovine spleen-derived DNase I (Takara Bio, Japan), porcine spleen-derived DNase II (Wako Pure Chemicals, Japan), Serratia marcescens-derived nucleolytic enzyme Benzonase (registered trademark) Nuclease (Takara Bio, Japan), Nuclease from Staphylococcus aureus (Wako Pure Chemicals, Japan). The amount of enzyme to be added varies depending on the type of enzyme and the definition of the number of units (U), but can be appropriately set by those skilled in the art. If necessary, a cofactor such as magnesium required for a nucleolytic enzyme may be added to the enzyme solution. The treatment temperature varies depending on the nucleolytic enzyme to be used, but a normal temperature species-derived nucleolytic enzyme may be usually set at a temperature of 20 to 40 ° C.

When it is necessary to remove bacterial cells or cell disruption residues from the obtained disrupted solution, it can be removed by, for example, centrifugation or filtration (dead end method or crossflow method).
Centrifugation can be performed as described above. If the bacterial cell or cell disruption residue is fine and difficult to settle easily, a flocculant can be used as necessary to increase the residue precipitation efficiency. Organic polymer flocculants can include cationic flocculants, anionic flocculants, amphoteric flocculants and nonionic flocculants based on ionic properties, and acrylic, polyethyleneimine, condensation based on ingredients. A polycation (polyamine), dimethyldiallylammonium chloride, chitosan, etc., and the flocculant used in the present invention does not decrease the improved halohydrin epoxidase activity or the activity recovery rate, and Any flocculant may be used as long as the residue separation efficiency can be improved. Examples of the acrylic water-soluble monomer that is a component of the acrylic flocculant include acrylamide, sodium acrylate, sodium acrylamide 2-methyl-propanesulfonate, dimethylaminoethyl methacrylate, methacryloyloxyethyl-trimethylammonium chloride, methacrylate. Monomers such as leuoxyethyl-benzyldimethyl-ammonium chloride, dimethylaminoethyl-acrylate, acryloyloxyethyl-trimethylammonium chloride, dimethylaminopropyl-acrylamide, acrylamidopropyl-trimethylammonium chloride, and polyamidine-chloride. Examples of acrylic flocculants include single polymers, copolymers with various compositions, and polymer-modified products. . Representative cationic polymer flocculants include polyaminoalkyl methacrylates, copolymers of polyamnoalkyl methacrylate and acrylamide, Mannich modified polyacrylamide, polydimethyldiallylammonium salts, polyvinyl imidazolines. , Polyacrylamides, amine-based polycondensates and the like, and many products are already on the market. The main ones are, for example, Sanpoly-K-601, K-602 (main component polyamine, Sankyo Kasei), Cliflock LC-599 (main component: polyamine and polyamide, Kurita Industries), Hymorlock M-166, M- 566, M-966, (Main component: acrylamide modified, Kyoritsu Organic Industries), Unifroca-UF-301, UF-304, UF-305, (Main component: Polyacrylamide, Unitika), UF-330, UF- 340, (main component: aminomethacrylic acid ester, Unitika), UF-505 (main component: dicyanamine, Unitika), Liufloc C-110 (main component: polyamine, Dainippon Ink Chemical), Piurifloc C-31 (principal component) : Polyamine, Dow Chemical). Also, K-400 series, KM-200 series, KM-1200 series, KAM-200 series, KD-200 series, KP-000 series, KP-100 series, KP-200 series, KP- from Daianitrix (Japan) 300 series, KP-500 series, KP-1200 series, KA-000 series, KA-200 series, KA-300 series, KA-400 series, KA-600 series, KA-700 series, KA-800 series etc. It is done. These flocculants can be used alone or in combination of two or more. The flocculant used in the present invention may be any of the flocculants described above as long as it does not decrease the improved halohydrin epoxidase activity or the activity recovery rate and can improve the residue separation efficiency. However, specific examples include K-403B, K-408, K-415, etc., manufactured by Dianitics (Japan). The amount of the flocculant added varies depending on the type of flocculant and the liquid form of the microbial cells or the crushing liquid.For example, the concentration is 1/200 to 1/5 of the crushed microorganism dry weight concentration, preferably 1/100. ~ 1/10 concentration. As an addition method, for example, after the flocculant is dissolved in water in advance, it is added to the bacterial cells or cell disruption solution, and is allowed to stand or stir for at least 5 minutes to 24 hours, preferably about 30 minutes to 10 hours. . As temperature at that time, for example, 0 ° C. to 60 ° C., particularly 0 ° C. to 50 ° C., and more preferably 0 ° C. to 40 ° C. are preferable. When pH adjustment is required, it can be added to make a buffer solution with an inorganic salt final concentration of 5 to 200 mM as appropriate, and if necessary, improved halohydrin epoxidase can be stabilized. Substances to be converted may be added.

  When performing residue separation by filtration, either a microfiltration (MF) membrane or an ultrafiltration (UF) membrane may be used as long as the desired residue separation can be achieved, but usually a microfiltration (MF) membrane. Is preferably used. As described above, any microfiltration membrane can be used as long as it can perform a residue separation operation. The pore size of the membrane is not particularly limited as long as it captures bacterial cells or cell debris and can recover the improved halohydrin epoxidase activity on the filtrate side, for example, about 0.1 to 0.5 μm. Can do. Furthermore, if a filter aid and, if necessary, a flocculant are used, a membrane or filter paper having a pore size of 0.5 μm or more can be used. Examples of the filter aid include diatomaceous earth, cellulose powder, and activated carbon. The flocculant is as described above.

  The supernatant obtained after removing the residue is a cell extract soluble fraction and can be a crude enzyme solution containing an improved halohydrin epoxidase. Thereafter, if necessary, general biochemical methods used for protein isolation and purification, such as ammonium sulfate precipitation, various chromatographies (eg gel filtration chromatography (eg Sephadex column)), ion exchange chromatography (eg DEAE- Toyopearl), affinity chromatography, hydrophobic chromatography (for example, butyl Toyopearl), anion chromatography (for example, MonoQ column)), SDS polyacrylamide gel electrophoresis, etc., alone or in combination as appropriate, From inside, halohydrin epoxidase can be isolated and purified.

  The transformant of the present invention is a gene recombinant, and causes microbial contamination secondarily due to leakage of the transformant into the environment in the production process, mixing into a product, or handling after use. In case of fear of possibility, inactivation processing can be performed as necessary. The inactivation method may be any method as long as it does not reduce the improved halohydrin epoxidase activity or the activity recovery rate and can inactivate the transformant. For example, heat treatment, cell disruption treatment, etc. A method such as drug treatment can be used alone or in combination. For example, inactivation can be performed by performing a chemical treatment before or after the cell disruption treatment. The agent to be used varies depending on the host type of the transformant. For example, a cationic surfactant such as benzethonium chloride, cetylpyridinium chloride, methylstearoyl chloride, cetyltrimethylammonium bromide, alkyldiaminoethylglycine hydrochloride, etc. Examples include zwitterionic surfactants. Also included are alcohols such as ethanol, thiols such as 2-mercaptoethanol, amines such as ethylenediamine, and amino acids such as cysteine, ornithine and citrulline. The concentration of the drug may be any concentration that does not decrease the improved halohydrin epoxidase activity or the activity recovery rate and can be inactivated. For example, the concentration is 1/100 to 1/2 of the microbial dry weight% concentration. The concentration is preferably about 1/10 to 1/5. The treatment temperature is 0 to 50 ° C, preferably 0 to 40 ° C. The pH is about 5 to 9, preferably about 6 to 8.

On the other hand, when the improved halohydrin epoxidase is produced outside the cells or cells, the culture solution is used as it is, or the cells or cells are removed by centrifugation or filtration as described above. Thereafter, if necessary, improved halohydrin epoxidase is collected from the culture by extraction with ammonium sulfate precipitation or the like, and if necessary, dialysis, various chromatography (gel filtration, ion exchange chromatography, affinity chromatography). Etc.) can be used alone or in appropriate combination.
When the transformant is a plant cell or plant tissue, the cell is destroyed by cell lysis treatment using an enzyme such as cellulase or pectinase, ultrasonic disruption treatment, grinding treatment, or the like. Thereafter, if necessary, general biochemical methods used for protein isolation and purification, such as ammonium sulfate precipitation, various chromatographies (eg gel filtration chromatography (eg Sephadex column)), ion exchange chromatography (eg DEAE- Toyopearl), affinity chromatography, hydrophobic chromatography (for example, butyl Toyopearl), anion chromatography (for example, MonoQ column), SDS polyacrylamide gel electrophoresis, etc., alone or in combination as appropriate, From inside, halohydrin epoxidase can be isolated and purified. The isolated halohydrin epoxidase can be retained on a suitable carrier and used as an immobilized enzyme in the same manner as the above-described cells or cells.

The culture and improved halohydrin epoxidase obtained as described above are included in the scope of the present invention. The production yield of the obtained culture and the improved halohydrin epoxidase was determined by measuring the halohydrin epoxidase activity described in (I), and the wet weight of the cells (transformants) per culture apparatus, per culture solution. Or it can obtain | require by calculating activities, such as per dry weight and per protein weight in an enzyme solution.
In the present invention, it is also possible to collect an improved halohydrin epoxidase from a recombinant vector containing the improved halohydrin epoxidase gene or the improved halohydrin epoxidase gene. That is, in the present invention, it is possible to produce an improved halohydrin epoxidase by employing a cell-free protein synthesis system without using any living cells. The cell-free protein synthesis system is a system that synthesizes a protein in an artificial container such as a test tube using a cell extract. The cell-free protein synthesis system used in the present invention includes a cell-free transcription system that synthesizes RNA using DNA as a template. In this case, the organism corresponding to the host corresponds to the organism from which the following cell extract is derived. Here, eukaryotic cell-derived or prokaryotic cell-derived extracts such as wheat germ, Escherichia coli and the like can be used as the cell extract. Note that these cell extracts may be concentrated or not concentrated. The cell extract can be obtained, for example, by ultrafiltration, dialysis, polyethylene glycol (PEG) precipitation or the like. Furthermore, in the present invention, cell-free protein synthesis can also be performed using a commercially available kit. Examples of such kits include reagent kits PROTEIOS ^™ (Toyobo), TNT ^™ System (Promega), synthesizer PG-Mate ^™ (Toyobo), RTS (Roche Diagnostics) and the like.
The improved halohydrin epoxidase obtained by cell-free protein synthesis as described above can be purified, for example, by appropriately selecting chromatography as described above.

(VI) Method for producing epihalohydrin and 4-halo-3-hydroxybutyronitrile The improved halohydrin epoxidase produced as described above can be used as an enzyme catalyst for substance production. That is, it can use for reaction shown to the following (VI-1)-(VI-3).

(VI-1) Conversion of 1,3-dihalo-2-propanol to epihalohydrin In this conversion reaction, 1,3-dihalo-2-propanol was converted into the above-described improved halohydrin epoxidase and / or the above-mentioned culture. It can carry out by making it contact with the culture obtained by.
1,3-Dihalo-2-propanol as a substrate is a compound represented by the general formula (1) described above. As the halogen atom, fluorine, chlorine, bromine and iodine are preferable, and chlorine and bromine are particularly preferable. Specific examples include 1,3-difluoro-2-propanol, 1,3-dichloro-2-propanol, 1,3-dibromo-2-propanol, 1,3-diiodo-2-propanol, and preferably 1,3-dichloro-2-propanol and 1,3-dibromo-2-propanol.
The substrate concentration in the conversion reaction solution is preferably 0.01 to 15 (W / V)%. Within this range, it is preferable from the viewpoint of enzyme stability, and 0.01 to 10% is particularly preferable. The substrate can be added to the reaction solution all at once or in divided portions. It is desirable from the viewpoint of accumulation to make the substrate concentration constant by divided addition.

As a solvent for the reaction solution, water or a buffer solution having an enzyme activity at an optimum pH of around 4 to 10 is preferable. As the buffer solution, for example, a buffer solution composed of a salt such as phosphoric acid, boric acid, citric acid, glutaric acid, malic acid, malonic acid, o-phthalic acid, succinic acid or acetic acid, Tris buffer or Good A buffer solution or the like is preferable.
The reaction temperature is preferably 5 to 50 ° C. and the reaction pH is preferably 4 to 10.
The reaction temperature is more preferably 10 to 40 ° C. The reaction pH is more preferably pH 6-9. The reaction time is selected as appropriate depending on the concentration of the substrate, etc., the bacterial cell concentration or other reaction conditions, but it is preferable to set the conditions so that the reaction is completed in 1 to 120 hours. In this reaction, the optical purity can be further improved by removing chlorine ions produced as the reaction proceeds from the reaction system. This removal of chlorine ions is preferably carried out by adding silver nitrate or the like.
Epihalohydrin produced and accumulated in the reaction solution can be collected and purified using a known method. For example, an epihalohydrin syrup can be obtained by performing extraction with a solvent such as ethyl acetate and removing the solvent under reduced pressure. Further, these syrups can be further purified by distillation under reduced pressure.

(VI-2) Conversion of 1,3-dihalo-2-propanol to 4-halo-3-hydroxybutyronitrile In this conversion reaction, 1,3-dihalo-2-propanol was converted into the above-mentioned improved halohydride. It can be performed by bringing into contact with a phosphoepoxidase and / or a culture obtained by the culture described above.
1,3-Dihalo-2-propanol as a substrate is a compound represented by the above general formula (1), preferably 1,3-dichloro-2-propanol, 1,3-dibromo-2-propanol, etc. It is.
Further, as the cyanide compound, it is possible to use a compound that generates cyanide ion (CN-) or hydrogen cyanide or a solution thereof when added to a reaction solution such as hydrogen cyanide, potassium cyanide, sodium cyanide, cyanic acid or acetone cyanohydrin. it can. The substrate concentration in the reaction solution is preferably 0.01 to 15 (W / V)%, particularly preferably 0.01 to 10% from the viewpoint of enzyme stability.

Moreover, the usage-amount of a cyanide compound has the preferable 1-3 times amount (mol) of a substrate from a viewpoint of enzyme stability.
The reaction conditions can be the same as in the above (VI-1).
The 4-halo-3-hydroxybutyronitrile produced and accumulated in the reaction solution can be collected and purified using a known method. For example, after removing bacterial cells from the reaction solution using a method such as centrifugation, extraction with a solvent such as ethyl acetate is performed, and the solvent is removed under reduced pressure to remove 4-halo-3-hydroxybutyronitrile. You can get syrup. Further, these syrups can be further purified by distillation under reduced pressure.

(VI-3) Conversion of epihalohydrin to 4-halo-3-hydroxybutyronitrile The conversion reaction involves contacting the epihalohydrin with the improved halohydrin epoxidase described above and / or the culture obtained by the culture described above. To do.
Epihalohydrin as a substrate is a compound represented by the above general formula (2). As the halogen atom, fluorine, chlorine, bromine and iodine are preferable, and chlorine and bromine are particularly preferable. Specific examples include epifluorohydrin, epichlorohydrin, epibromohydrin, epiiodohydrin, and the like, with epichlorohydrin and epibromohydrin being particularly preferred.
In addition, as the cyanide compound, a compound that generates cyanide ion (CN-) or hydrogen cyanide or a solution thereof when added to a reaction solution such as hydrogen cyanide, potassium cyanide, sodium cyanide, cyanic acid, or acetone cyanohydrin can be used.
Reaction conditions, collection and purification methods can be carried out in the same manner as in the above (VI-2).

  Hereinafter, the present invention will be described more specifically with reference to examples. However, the present invention is not limited to these examples.

Acquisition and evaluation of an improved halohydrin epoxidase in which one amino acid residue at the C-terminal side of the starting amino acid residue is substituted with another amino acid

(1) Preparation of improved halohydrin epoxidase expression transformant (expression vector pKK233-2)
An amino acid residue 1 residue downstream of the amino acid residue encoded by the translation initiation codon in HheB (2 ^nd ), a wild-type halohydrin epoxidase derived from Corynebacterium sp. N-1074 Expression plasmid (expression vector pKK233-2) that expresses an improved halohydrin epoxidase in which (the second amino acid residue) is substituted with lysine and asparagine, respectively, and an improved halohydrin epoxidase expression containing the expression plasmid A transformant was prepared as follows.
First, halohydrin epoxidase gene HheB the (2 ^nd) was amplified by PCR. The composition of the PCR reaction solution (total amount 50 μl) was as shown in the following table, and three series were prepared (the difference between the three series is that each sense primer is different).

The sequence of the oligonucleotide used as a primer is as follows.
DH-08: GGCCATGGCTAACGGAAGACTGGCAGGC (SEQ ID NO: 57: 28 nucleotides, including the restriction enzyme NcoI recognition site (CCATGG) and the halohydrin epoxidase gene HheB (2 ^nd ) after the translation start codon The codon corresponding to the amino acid of GCT encodes alanine by GCT)
DH-09: GATCATGAAAAACGGAAGACTGGCAGGCAAGCG (consists SEQ ID NO: 58:33 nucleotides have a translation initiation after codon restriction enzyme BspHI recognition site in its sequence (TCATGA) and halohydrin epoxidase gene HheB (2 ^nd), 2 th The codon corresponding to the amino acid of AAA encodes lysine with AAA)

DH-10: GATCATGAACAACGGAAGACTGGCAGGCAAGCG (consists SEQ ID NO: 59:33 nucleotides have a translation initiation after codon restriction enzyme BspHI recognition site in its sequence (TCATGA) and halohydrin epoxidase gene HheB (2 ^nd), 2 th The codon corresponding to the amino acid of AAC encodes asparagine)
DH-07: CGCCTGCAGGCTACAACGACGACGAGCGCCTG (SEQ ID NO: 60: consisting of 32 nucleotides, having a restriction enzyme Sse8387I and PstI recognition site (CCTGCAGG) and a halohydrin epoxidase gene HheB (2 ^nd ) stop codon downstream region in the sequence)

Moreover, pST111 used as a template is described in Japanese Patent Publication No. 5-317066, and an E. coli transformant JM109 / pST111 using a recombinant vector containing pST111 is designated as an accession number “FERM BP-10922”. It is deposited on March 1, 1991 at the Research Center for Biological Biology.
Each 50 μl of the prepared PCR reaction solution was subjected to the following thermal cycle treatment.

  After purifying the three PCR reaction solutions that had been subjected to thermal cycling using the GFX PCR DNA band and GelBand Purification kit (GE Healthcare Bioscience), the PCR amplification products of the series 1 were restricted with the restriction enzymes NcoI and PstI. The PCR amplification products of 2 and 3 were double digested with restriction enzymes BspHI and PstI, respectively. Each digestion product was separated by agarose gel electrophoresis, and then a band (about 0.8 kb) containing the full length of the halohydrin epoxidase gene was purified by QIAquick Gel Extraction Kit (QIAGEN). On the other hand, it is a derivative of pKK233-2 (Centraalbureau voor Schimmelcultures (CBS), the Netherlands; http://www.cbs.knaw.nl/) and can be prepared by the method described in WO 2006/41226 After digesting the vector pKK233-2 (+ Sse) with restriction enzymes NcoI and PstI, phenol extraction, chloroform extraction, ethanol precipitation (Molecular Cloning, A Laboratory Manual, 2nd ed. (Cold Spring Harbor Laboratory Press (1989))) Purified. This was mixed with each of the three PCR amplification products containing the full-length halohydrin epoxidase gene described above, and then Solution I (DNA Ligation Kit ver. 2 (Takara Bio) was added to the mixture to obtain the ligation mixture. This mixture was incubated for 12 hours at 16 ° C. to bind the PCR amplification product and the expression vector pKK233-2 (+ Sse).

  E. coli JM109 strain competent cell prepared in advance (E. coli JM109 strain was inoculated into 1 ml of LB medium (1% bactotryptone, 0.5% bacto yeast extract, 0.5% NaCl) and aerobically treated at 37 ° C for 5 hours. After culturing, add 0.4 ml of the preculture to 40 ml of SOB medium (2% bactotryptone, 0.5% bacto yeast extract, 10 mM NaCl, 2.5 mM KCl, 1 mM MgSO4, 1 mM MgCl2), and incubate at 18 ° C. for 20 hours. The obtained culture was collected by centrifugation (3,700 × g, 10 minutes, 4 ° C.), and then cooled TF solution (20 mM PIPES-KOH (pH 6.0), 200 mM KCl, 10 mM CaCl2, 40 mM MnCl2). 13 ml, left at 0 ° C. for 10 minutes, centrifuged again (3,700 × g, 10 minutes, 4 ° C.) to remove the supernatant, and the resulting E. coli cells were suspended in 3.2 ml of cold TF solution. 200 μl was added to 10 μl of the above ligation product. 0.22 ml of dimethyl sulfoxide was added and the mixture was allowed to stand at 0 ° C. for 10 minutes and then stored at −80 ° C. using liquid nitrogen. For example, it was allowed to stand for 30 minutes at 0 ℃. Subsequently, the competent cell was subjected to heat shock at 42 ° C. for 30 seconds and cooled at 0 ° C. for 2 minutes. After that, 1 ml of SOC medium (20 mM glucose, 2% bactotryptone, 0.5% bacto yeast extract, 10 mM NaCl, 2.5 mM KCl, 1 mM MgSO4, 1 mM MgCl2) was added and cultured with shaking at 37 ° C. for 1 hour. . Each 200 μl of the culture solution after culturing was applied to an LB Amp agar medium (LB medium containing ampicillin 100 mg / L, 1.5% agar) and cultured at 37 ° C. overnight. A plurality of transformant colonies grown on an agar medium were cultured overnight at 37 ° C. in 1.5 ml of LB Amp medium (LB medium containing ampicillin 100 mg / L). After collecting each of the obtained culture broths, the recombinant plasmid was recovered using Flexi Prep (GE Healthcare Bioscience). Using the capillary DNA sequencer CEQ2000 (Beckman Coulter), analyze the nucleotide sequences of the PCR amplification products cloned in the three plasmids according to the attached manual, and confirm that no error mutation has occurred in the PCR reaction. did. A plasmid in which a DNA fragment derived from a series 1 PCR amplification product is cloned, pSTK001, a plasmid in which a DNA fragment derived from a series 2 PCR amplification is cloned, and a plasmid in which a DNA fragment derived from a series 3 PCR amplification product is cloned. pSTK003 was named, and E. coli JM109 strain transformants containing these plasmids were named JM109 / pSTK001, JM109 / pSTK002 and JM109 / pSTK003, respectively.

The characteristics of each of the above plasmids are as follows.
pSTK001: 2 amino acid residue is cloned into a wild-type halohydrin epoxidase gene on the expression vector pKK233-2 encoding wild-type halohydrin epoxidase HheB (2 ^nd) is an alanine residue
pSTK002: An improved halohydrin epoxidase gene encoding an improved halohydrin epoxidase HheB (2 ^nd ) in which the second amino acid residue (alanine residue) is replaced by lysine is expressed on the expression vector pKK233-2. Has been cloned into
pSTK003: An improved halohydrin epoxidase gene encoding the improved halohydrin epoxidase HheB (2 ^nd ) in which the second amino acid residue (alanine residue) is replaced by asparagine is expressed on the expression vector pKK233-2. Has been cloned into

(2) Preparation of improved halohydrin epoxidase expression transformant (expression vector pTrc99A)
In HheB (2 ^nd ), a wild-type halohydrin epoxidase derived from the Corynebacterium sp. Strain N-1074, one residue C-terminal amino acid residue (second amino acid residue) An expression plasmid (expression vector pTrc99A) expressing an improved halohydrin epoxidase in which amino acid residues are substituted with lysine and asparagine, respectively, and an improved halohydrin epoxidase expression transformant containing the expression plasmid were prepared. . The production was performed in the same manner as in Example 1 (1) except that pTrc99A was used instead of the expression vector pkk233-2 used in Example 1 (1). PSTT001 is a plasmid in which a DNA fragment derived from a series 1 PCR amplification product is cloned, pSTT002 is a plasmid in which a DNA fragment derived from a PCR amplification in series 2 is cloned, and a plasmid in which a DNA fragment from a PCR amplification product in series 3 is cloned. It was named pSTT003, and E. coli JM109 strain transformants containing these plasmids were named JM109 / pSTT001, JM109 / pSTT002 and JM109 / pSTT003, respectively.

The characteristics of each of the above plasmids are as follows.
pSTT001: 2 amino acid residue has been cloned wild-type halohydrin epoxidase gene on the expression vector pTrc99A encoding wild-type halohydrin epoxidase HheB (2 ^nd) is an alanine residue
pSTT002: An improved halohydrin epoxidase gene encoding an improved halohydrin epoxidase HheB (2 ^nd ) in which the second amino acid residue (alanine residue) is replaced by lysine is cloned into the expression vector pTrc99A Has been
pSTT003: 2 amino acid residue (alanine residue) is cloned onto substituted improved halohydrin epoxidase gene encoding the improved halohydrin epoxidase HHEB (2 ^nd) is an expression vector pTrc99A to asparagine Has been

(3) Evaluation of improved halohydrin epoxidase-expressing transformants Six strains (JM109 / pSTK001, JM109 / pSTK002, JM109 / pSTK003, JM109 / pSTT001) prepared in Example 1 (1) and (2) , JM109 / pSTT002, JM109 / pSTT003) and JM109 / pST111 described in JP-B-5-317066, a total of 7 strains were evaluated for IPTG (isopropyl-1-thio-D-β-D-galactoside) as follows: Went to. One ml of LBAmp medium was dispensed into a Wasselman test tube, and each of the test tubes was inoculated with 6 strains selected for secondary evaluation and JM109 / pST111 colonies. After culturing at 37 ° C. and 210 rpm for about 8 hours, 100 μl of each culture solution obtained was inoculated into LBAmp medium (100 ml in a 500 ml Erlenmeyer flask) containing 1 mM of IPTG as the final concentration, and then 24 hours at 37 ° C. and 210 rpm. Incubate for hours. Each bacterial cell is recovered from the obtained culture broth by centrifugation (3,700 × g, 10 minutes, 4 ° C.), washed with 20 mM Tris-sulfate buffer (pH 8.0), and then the bacterial concentration is 12.5 g DC / L. So that it was suspended in the same buffer. 1 ml of the obtained cell suspension is ice-cooled using an ultrasonic crusher VP-15S (Tytec, Japan) under conditions of output control 4, DUTY CYCLE 40%, PULS, TIMER = B mode 10s. While crushed for 3 minutes. The disrupted cell suspension was subjected to centrifugation (23,000 × g, 5 minutes, 4 ° C.), and the supernatant was collected as a crude enzyme solution. The obtained crude enzyme solution was diluted with 20 mM Tris-sulfate buffer (pH 8.0) so that the concentration of the bacteria before disruption (at the time of cell suspension) was 6.25 g DC / L. The diluted crude enzyme solution derived from each transformant is mixed with an equal amount of sample buffer for polyacrylamide gel electrophoresis (0.1 M Tris-HCl (pH 6.8), 4% w / v SDS, 12% v / v β mercaptoethanol, 20% v / v glycerol and a trace amount of bromophenol blue) and boiled for 5 minutes for modification. A 10% polyacrylamide gel was prepared, and 5 μl of the denatured sample was applied per lane and subjected to electrophoretic analysis (FIG. 1). Each halohydrin epoxidase was observed as a band of more than 30 kDa (arrow in FIG. 1). Compared to JM109 / pST111 from crude enzyme solution expressing wild-type halohydrin epoxidase HheB (1 ^st), the wild-type halohydrin epoxidase expressing peptidase HHEB the (2 ^nd) JM109 / pSTK001 from crude enzyme solution In addition, it was confirmed that the expression level of the crude enzyme solution derived from JM109 / pSTT001 increased (this is considered to be due to the difference in the expression vector). On the other hand, compared with the crude enzyme solution derived from JM109 / pSTK001 and the crude enzyme solution derived from JM109 / pSTT001, JM109 that expresses improved halohydrin epoxidase HheB (2 ^nd ) in which the second amino acid residue is substituted with asparagine. / pSTK003-derived crude enzyme solution and JM109 / pSTT003-derived crude enzyme solution each have an increased expression level, and an improved halohydrin epoxidase in which the second amino acid residue is substituted with lysine. It was confirmed that the expression levels of the crude enzyme solution derived from JM109 / pSTK002 and the crude enzyme solution derived from JM109 / pSTT002 that express HheB (2 ^nd ) were significantly increased.

Subsequently, halohydrin epoxidase activity (dechlorination activity) was measured by the following method using the above crude enzyme solution. 100 ml of a reaction solution for measuring activity (50 mM DCP, 50 mM Tris-sulfuric acid (pH 8)) was prepared, and the temperature was adjusted to 20 ° C. The diluted crude enzyme solution derived from each transformant was added to the reaction solution to start the reaction. The decrease in pH accompanying the release of chloride ions due to the halohydrin epoxidase activity was continuously adjusted to maintain the pH at 8 using a 0.01 N aqueous sodium hydroxide solution using an automatic pH controller. From the amount of 0.01N aqueous sodium hydroxide solution added to maintain the pH at 8 during the 10-minute reaction, the amount of chloride ion produced was calculated, and the halohydrin epoxidase activity (dechlorination activity) ( U) was calculated. 1 U is defined as the amount of enzyme desorbing 1 μmol chloride ion per minute from DCP under the above conditions, and the activity of each crude enzyme solution used for activity measurement and the activity was used for activity measurement. The liquid activity of each crude enzyme solution was calculated by dividing by the amount of each crude enzyme solution. Furthermore, assuming that the cells are completely crushed by the ultrasonic treatment, the specific activity of the cells is obtained by dividing the liquid activity by the concentration of the cells (at the time of the cell suspension) before crushing. Calculated. The results of the specific cell activity for each transformant are shown in Table 1. Compared to JM109 / pSTK001 and JM109 / pSTT001 expressing the wild-type halohydrin epoxidase HheB (2 ^nd), 2 th amino acid residue is replaced with asparagine of the improved halohydrin epoxidase HHEB (2 ^nd ) Expressing JM109 / pSTK003 and JM109 / pSTT003 have an improved specific cell activity of about 12 times and about 5 times, respectively, and an improved halohydride in which the second amino acid residue is substituted with lysine. JM109 / pSTK002 and JM109 / pSTT002 expressing phosphoepoxidase HheB (2 ^nd ) were confirmed to have improved specific cell activity by about 25-fold and about 17-fold, respectively. That is, expression of an improved halohydrin epoxidase in which one amino acid residue (second amino acid residue in the amino acid sequence shown in SEQ ID NO: 2) on the remaining C-terminal side from the starting amino acid residue is replaced with another amino acid The transformant was confirmed to have higher halohydrin epoxidase activity per transformant than wild-type halohydrin epoxidase.

Screening for improved halohydrin epoxidase by random mutation

(1) Preparation of halohydrin epoxidase mutant library In order to obtain a more useful improved halohydrin epoxidase, a halohydrin epoxidase gene mutant library into which random mutations were introduced by error-induced PCR was prepared. And screened for improved halohydrin epoxidase and its gene from the library.
Using pSTT002 prepared in Example 1 (2) as a template, a halohydrin epoxidase gene mutant library was prepared by error-induced PCR as follows. 100 μl of a PCR reaction solution having the composition shown in the following table was prepared.

The sequence of Trc-03 used as a primer is as follows.
Trc-03: GGCTGAAAATCTTCTCTCATCCGCC (SEQ ID NO: 61: consisting of 25 nucleotides, corresponding to the downstream region of the multiple cloning site of pTrc99A)
The prepared 100 μl PCR reaction solution was dispensed into 10 μl × 10 PCR reaction tubes, and each was subjected to the following thermal cycle treatment.

  10 PCR reaction liquids that had been subjected to heat cycle treatment were mixed, and as in Example 1 (2), purification of PCR reaction liquid and restriction enzyme digestion (double digestion with NcoI and PstI) and purification from gel, The current vector pTrc99A was subjected to restriction enzyme digestion (double digestion with NcoI and PstI) and purification, ligation reaction and transformation. Colonies that appeared on the plate were used as a halohydrin epoxidase gene mutant library.

(2) Screening for improved halohydrin epoxidase (primary evaluation)
Using the halohydrin epoxidase gene mutant library prepared in Example 2 (1), screening (primary evaluation) of an improved halohydrin epoxidase was performed as follows. To a 96-well plate (deep well), 500 μl of LBAmp medium containing 1 mM IPTG as a final concentration was dispensed per well, and colonies of the halohydrin epoxidase gene mutant library were inoculated into each well. In addition, about 1-2 of 96 wells, JM109 / pSTT002 colony used as an evaluation control was inoculated. After culturing at 37 ° C. and 800 rpm for about 16 hours, 20 μl of the obtained culture solution was dispensed into a flat 96-well plate. Using a centrifuge (Sakuma Seisakusho 50A-IVD) and a rotor (Sakuma Seisakusho HM-2HLS), the flat 96-well plate was subjected to centrifugation (3000 rpm, 5 minutes, 4 ° C.). After removing the culture supernatant, 40 μl of an evaluation reaction solution 1 (400 mM DCP, 800 mM (R) -CHBN, 0.025% bromocresol purple (BCP), 50 mM Tris-sulfuric acid (pH 8)) was added to each well. After suspension, leave at room temperature and observe the color change of the reaction mixture over time (the BCP color changes from purple to yellow due to the pH drop associated with the generation of chloride ions by halohydrin epoxidase activity) A strain that was discolored significantly earlier than the control JM109 / pSTT002 was selected. The primary evaluation was performed on about 20,000 colonies, and 77 strains were selected.

(3) Screening for improved halohydrin epoxidase (secondary evaluation)
The secondary evaluation was performed as follows for the 77 primary evaluation selected strains selected in Example 2 (2). The 77 strains selected for primary evaluation were cultured in a 96-well plate (deep well) in the same manner as in Example 2 (2). Samples were dispensed into flat 96-well plates. Using a centrifuge (Sakuma Seisakusho 50A-IVD) and a rotor (Sakuma Seisakusho HM-2HLS), the flat 96-well plate was subjected to centrifugation (3000 rpm, 5 minutes, 4 ° C.). After removing the culture supernatant, for each culture solution precipitate (cells), the evaluation reaction solution 1 and the evaluation reaction solution 2 described in Example 2 (2) (400 mM DCP, 0.025% bromocresol purple (BCP)) 40 μl of 50 mM Tris-sulfuric acid (pH 8) was added to each well. After suspension, the mixture was allowed to stand at room temperature, the color change of the reaction solution was observed over time, and the system in which the reaction solution for evaluation 1 was added showed a color change significantly earlier than the control JM109 / pSTT002 For each strain, a strain having a small difference between the coloration rate in the evaluation reaction solution 1 addition system and the coloration rate in the evaluation reaction solution 2 addition system was selected. The secondary evaluation was performed on 77 primary selection-selected strains, and 20 strains were selected.

(4) Confirmation of mutations in halohydrin epoxidase gene in selected secondary evaluation strains For 20 secondary selection strains selected in Example 2 (3), mutations in the halohydrin epoxidase gene of each strain were analyzed. . From each strain culture solution obtained in Example 2 (3), plasmids were collected using Flexi Prep (GE Healthcare Bioscience), and each was used with a capillary DNA sequencer CEQ2000 (Beckman Coulter) according to the attached manual. The nucleotide sequence of the halohydrin epoxidase gene in the plasmid was analyzed. The results are shown in Table 2.

  Of the 20 strains analyzed, 12 (# 1007, # 1009, # 1014, # 1019, # 1023, # 1024, # 1034, # 1037, # 1038, # 1066, # 1068, # 1072) were amino acids. Two strains (# 1002, # 1005) have halohydrin epoxidase with substitution mutation F136S, and two strains (# 1020, # 1055) have amino acid substitution mutation V75A. 1 strain (# 1018) has a halohydrin epoxidase having the amino acid substitution mutation D199H, and 1 strain (# 1029) has a halohydrin epoxidase having the amino acid substitution mutation V25I. It was confirmed that the strain (# 1057) expressed halohydrin epoxidase having amino group substitution mutations H57R and Y87F, respectively. Each transformant, the halohydrin epoxidase expressed by them, and the halohydrin epoxidase gene encoding it were named as shown in Table 2.

(5) Screening for improved halohydrin epoxidase (tertiary evaluation)
Six strains (JM109 / pSTT002-V25I, JM109 / pSTT002-H57R + Y87F, JM109 / pSTT002-) selected in Example 2 (3) and confirmed to have the halohydrin epoxidase gene mutation in Example 2 (4) A total of 7 strains of V75A, JM109 / pSTT002-T133A, JM109 / pSTT002-F136S and JM109 / pSTT002-D199H) and JM109 / pSTT002 as controls were subjected to tertiary evaluation as follows. 1 ml of LBAmp medium was dispensed into a Wasselman test tube, and each of the test tubes was inoculated with 6 strains selected for secondary evaluation and a colony of JM109 / pSTT002. After culturing at 37 ° C. and 210 rpm for about 8 hours, 100 μl of each culture solution obtained was inoculated into LBAmp medium (100 ml in a 500 ml Erlenmeyer flask) containing 1 mM IPTG as a final concentration, and the culture was performed at 37 ° C. and 210 rpm. Incubate for hours. Each bacterial cell was recovered from 100 ml of each obtained culture solution by centrifugation (3,700 × g, 10 minutes, 4 ° C.), washed with 20 mM Tris-sulfate buffer (pH 8.0), and then the bacterial concentration was 12.5 gDC. / L was suspended in the same buffer. Using the obtained cell suspension, a reaction using the reaction solution in which the DCP concentration of the reaction solution was 400 mM in the method described in Example 1 (3) and a reaction in the method described in Example 1 (3) In a method using a reaction solution in which the DCP concentration of the solution was 400 mM and (R) -CHBN was added to a final concentration of 800 mM, in the absence of (R) -CHBN and in the presence of (R) -CHBN The halohydrin epoxidase activity (dechlorination activity) was measured. The activity of each cell suspension used for the activity measurement was defined by defining 1 U as the amount of enzyme desorbing 1 μmol of chloride ion per minute from DCP under the above-mentioned conditions. The liquid activity of each cell suspension was calculated by dividing by the amount of each cell suspension used. Furthermore, the cell specific activity of each strain was calculated by dividing the liquid activity by the bacterial concentration. The results are shown in Table 3.

  For JM109 / pSTT002-H57R + Y87F, JM109 / pSTT002-V75A, JM109 / pSTT002-F136S, and JM109 / pSTT002-D199H, the cell specific activity in the absence of (R) -CHBN is the same as that of JM109 / pSTT002. It was confirmed that the activity was higher than the specific activity. Further, for JM109 / pSTT002-H57R + Y87F, JM109 / pSTT002-T133A, JM109 / pSTT002-F136S, and JM109 / pSTT002-D199H, the cell specific activity in the presence of (R) -CHBN is the same as that of JM109 / pSTT002. It was confirmed that it was higher than the body specific activity. That is, the halohydrin epoxidase expressed by these transformants is an improved halohydrin epoxidase activity improvement per transformant in the absence of (R) -CHBN or in the presence of (R) -CHBN. It was confirmed to be a hydrin epoxidase.

Screening for improved halohydrin epoxidase by site-specific random mutation

(1) Preparation of site-specific random mutant library Among the improved halohydrin epoxidases found in Example 2 (5), amino acid mutations that have an effect of improving halohydrin epoxidase activity per transformant The halohydrin epoxidase Hheb (2 ^nd ) (SEQ ID NO: 2) contains the 133rd threonine residue (T133), the 136th phenylalanine residue (F136) and the 199th aspartic acid residue (D199). It was found. Attempts were made to obtain more useful improved halohydrin epoxidases by randomly mutating amino acids at these sites.
The following were prepared as random primers that can mutate T133, F136, and D199 to 20 essential amino acids.

MDH-14: CGCTGGCCTACAGCNNNGCGCGTTTCGCT (consisting of SEQ ID NO: 62: 29 nucleotides, the 141st amino acid of halohydrin epoxidase HheB (1 ^st ) (SEQ ID NO: 1) or the 133rd (SEQ ID NO: 2) of HheB (2 ^nd ) Sense primer whose amino acid codon is a random base (NNN; N is either adenine, thymine, guanine or cytosine)
MDH-15: AGCGAAACGCGCNNNGCTGTAGGCCAGCG (SEQ ID NO: 63: antisense primer consisting of 29 nucleotides and having a complementary sequence of MDH-14)

MDH-16: CAGCACGGCGCGTNNNGCTCAGCGCGGGT (consisting of SEQ ID NO: 64: 29 nucleotides, the 144th amino acid of halohydrin epoxidase HheB (1 ^st ) (SEQ ID NO: 1) or the 136th amino acid of HheB (2 ^nd ) (SEQ ID NO: 2) A sense primer whose amino acid codon is a random base (NNN; N is either adenine, thymine, guanine or cytosine)
MDH-17: ACCCGCGCTGAGCNNNACGCGCCGTGCTG (SEQ ID NO: 65: antisense primer consisting of 29 nucleotides and having a complementary sequence of MDH-16)

MDH-18: CGACTGCCCGAGAGNNNGCGCTGCTCGCG (SEQ ID NO: 66: 29 nucleotides, 207th amino acid of halohydrin epoxidase HheB (1 ^st ) (SEQ ID NO: 1) or 199th of HheB (2 ^nd ) (SEQ ID NO: 2) Sense primer whose codon encoding amino acid is a random base (NNN; N is any one of adenine, thymine, guanine or cytosine)
MDH-19: CGCGAGCAGCGCNNNCTCTCGGGCAGTCG (SEQ ID NO: 67: antisense primer consisting of 29 nucleotides and having a complementary sequence of MDH-18)

Site-directed mutagenesis was performed with the QuickChange Site-Directed Mutagenesis Kit (STRATAGENE) using the above primer and template pSTT002. The composition of the reaction solution (total volume 50 μl) was as shown in the following table (series 1 was a T133 random mutant, series 2 was an F136 random mutant,
Series 3 aims to obtain D199 random mutants, respectively).

The combinations of primers used for each series are as follows.
Series 1: Sense primer MDH-14, Antisense primer MDH-15
Series 2: Sense primer MDH-16, Antisense primer MDH-17
Series 3: Sense primer MDH-17, Antisense primer MDH-18
About each reaction liquid of the said composition, the thermal cycle process of the following table | surface was performed.

  In accordance with the attached manual, 1 μl of DpnI was added to each reaction solution subjected to the heat cycle treatment, and incubated at 37 ° C. for 1 hour. Using the DpnI treatment solution, transformation was performed in the same manner as in Example 2 (1). Colonies that appeared on the plate were used as a halohydrin epoxidase gene site-specific (T133, F136, D199) mutant library.

(2) Screening of improved halohydrin epoxidase from site-specific random mutants From the halohydrin epoxidase gene site-specific (T133, F136, D199) mutant library prepared in Example 3 (1) Further useful improved halohydrin epoxidases were screened. To a 96-well plate (deep well), 500 μl of LBAmp medium containing 1 mM IPTG as a final concentration was dispensed per well, and the halohydrin epoxidase gene site-specific (T133, F136, D199) 200 colonies for each series of mutant libraries were inoculated into each well. In addition, JM109 / pSTT002-T133A, JM109 / pSTT002-F136S, JM109 / pSTT002-D199H and JM109 / pSTT002, which were used as evaluation controls, were inoculated together. After culturing at 37 ° C. and 800 rpm for about 16 hours, 20 μl of the obtained culture solution was dispensed into a flat 96-well plate. Using a centrifuge (Sakuma Seisakusho 50A-IVD) and a rotor (Sakuma Seisakusho HM-2HLS), the flat 96-well plate was subjected to centrifugation (3000 rpm, 5 minutes, 4 ° C.). After removing the culture supernatant, the evaluation reaction solution 1 and the evaluation reaction solution 3 described in Example 2 (2) (200 mM (S) -CHBN, 0.025% bromocresol purple (BCP), 50 mM Tris-sulfuric acid ( 40 μl of pH 8)) was added to each well. After suspension, the mixture was allowed to stand at room temperature, and the color change of the reaction solution was observed over time. In the system to which the reaction solution for evaluation 1 was added, the strain showed a color change significantly earlier than the control JM109 / pSTT002. In addition, the strain in which the reaction solution 3 for evaluation was added and the color change was significantly faster than the control JM109 / pSTT002, and the coloration speed and the reaction solution 3 for the evaluation in the reaction solution 1 addition system for each strain. A strain having a coloration rate ratio in the addition system different from that of the control JM109 / pSTT002 was selected. The evaluation was carried out on 200 colonies of each series, 7 strains from series 1 (T133 random mutant library), 7 strains from series 2 (F136 random mutant library), 19 from series 3 (D199 random mutant library). A stock was selected.

(3) Confirmation of mutation of halohydrin epoxidase gene in selected strain of site-specific random mutation library Seven strains from series 1 (T133 random mutant library) selected in Example 3 (2), series 2 (F136 random) Mutations in the halohydrin epoxidase gene of each strain were analyzed for a total of 33 strains, 7 strains from the mutant library) and 19 strains from the series 3 (D199 random mutant library). From each strain culture solution obtained in Example 3 (2), plasmids were collected using Flexi Prep (GE Healthcare Bioscience), and each was collected using a capillary DNA sequencer CEQ2000 (Beckman Coulter) according to the attached manual. The nucleotide sequence of the halohydrin epoxidase gene in the plasmid was analyzed. The results are shown in Table 4.

  Table 2 shows the halohydrin epoxidase expressed by the analyzed 33 strains and the halohydrin epoxidase gene encoding the halohydrin epoxidase gene in consideration of duplication with those already obtained as an aspect of amino acid substitution mutation. So named.

(R) -CHBN synthesis reaction by improved halohydrin epoxidase

(1) Preparation of improved halohydrin epoxidase crude enzyme solution In order to examine the optical purity of (R) -CHBN synthesized by the improved halohydrin epoxidase obtained in Example 2 and Example 3, A crude enzyme solution was prepared from a transformant expressing each improved halohydrin epoxidase. 15 transformant strains expressing the improved halohydrin epoxidase (JM109 / pSTT002-T133A, JM109 / pSTT002-T136C, JM109 / pSTT002-T133S, JM109 / pSTT002-F136A, JM109 / pSTT002-F136S, JM109 / pSTT002-F136W, JM109 / pSTT002-D199Q, JM109 / pSTT002-D199E, JM109 / pSTT002-D199H, JM109 / pSTT002-D199S, JM109 / pSTT002-D199T, JM109 / pSTT002-D199M, JM109 / pSTT002D-199 A total of 16 strains of D199I, JM109 / pSTT002-D199Y) and JM109 / pSTT002 as a control were subjected to tertiary evaluation as follows. One ml of LBAmp medium was dispensed into a Wasselman test tube, and 15 secondary selection strains and JM109 / pSTT002 colonies were inoculated into each test tube. After culturing at 37 ° C. and 210 rpm for about 8 hours, 100 μl of each culture solution obtained was inoculated into LBAmp medium (100 ml in a 500 ml Erlenmeyer flask) containing 1 mM of IPTG as the final concentration, and 16 ° C. and 37 rpm at 16 rpm. Incubate for hours. Each bacterial cell was recovered from 100 ml of each obtained culture solution by centrifugation (3,700 × g, 10 minutes, 4 ° C.), washed with 20 mM Tris-sulfate buffer (pH 8.0), and then the bacterial concentration was 12.5 gDC. / L was suspended in the same buffer. 3 ml of the obtained bacterial cell suspension is ice-cooled using an ultrasonic crusher VP-15S (Tytec, Japan) under conditions of output control 4, DUTY CYCLE 40%, PULS, TIMER = B mode 10s. For 10 minutes. The disrupted cell suspension was subjected to centrifugation (23,000 × g, 5 minutes, 4 ° C.), and the supernatant was collected as a crude enzyme solution. About each obtained crude enzyme liquid, the halohydrin epoxidase activity (dechlorination activity) was measured by the method using the reaction liquid which made the DCP density | concentration of the reaction liquid 400 mM in the method of Example 1 (3), respectively. did. The activity of each cell suspension used for the activity measurement is defined as 1 U corresponding to the amount of enzyme desorbing 1 μmol chloride ion per minute from DCP under the above conditions. The liquid activity of each cell suspension was calculated by dividing by the amount of each cell suspension used in the above.

(2) Analytical method DCP, ECH and CHBN concentration analysis and optical purity analysis of the produced CHBN in the reaction solution carried out in the synthesis reaction of (R) -CHBN by the improved halohydrin epoxidase described below are as follows. went.
<Concentration analysis of DCP, ECH and CHBN in reaction solution>
Analysis of DCP, ECH and CHBN concentrations in the reaction solution was performed by reverse phase HPLC. The reverse phase HPLC analysis conditions are shown in the table below.

100 μl of the reaction completion solution was diluted and mixed with 400 μl of the moving bed described in the above table, and then analyzed under the analysis conditions described in the above table. A calibration curve was prepared in advance using DCP, ECH, and CHBN solutions with known concentrations, and the concentrations of DCP, ECH, and CHBN in the reaction solution were determined using the calibration curve.
<Optical purity analysis of produced CHBN>
The optical purity analysis of the produced CHBN was performed by normal phase HPLC after esterification of CHBN. Normal phase HPLC analysis conditions are shown in the table below.

  Extraction was carried out by adding an equal amount of diisopropyl ether (hereinafter sometimes referred to as IPE) to about 400 μl of the reaction completion solution. The IPE layer was separated, and a small amount of anhydrous sodium sulfate was added and stirred. 100 μl of the IPE layer was collected, and 10 μl of (R) -α-methoxy-α- (trifluoromethyl) phenylacetyl chloride (hereinafter sometimes referred to as (R) -MTPA) and 40 μl of pyridine were added. After reacting overnight at room temperature, IPE was added to make about 400 μl. Extraction was performed twice by adding 400 μl of 1N hydrochloric acid, and then 400 μl of saturated aqueous sodium hydrogen carbonate solution was added to the separated IPE layer, and extraction was performed twice. A small amount of anhydrous sodium sulfate was added to the separated IPE layer and stirred, and then the IPE layer was volatilized by an aspirator. The residue was suspended in the moving bed described in the above table, and then analyzed under the analysis conditions described in the above table. Each concentration was calculated from the area area ratio of (R) -CHBN- (R) -MTPA ester and (S) -CHBN- (R) -MTPA ester, and the optical properties of CHBN were as described above (described above). Purity was calculated.

(3) Synthesis of (R) -CHBN by improved halohydrepoxidase Using the crude enzyme solution derived from each improved halohydrin epoxidase-expressing transformant prepared in Example 4 (1), DCP was used in the presence of potassium cyanide. The CHBN synthesis reaction from was carried out. The basic composition of the reaction solution was as shown in the following table, and the reaction scale was 2 ml.

  The reaction was carried out at 20 ° C. for 3 hours. After completion of the reaction, the concentrations of DCP, ECH and CHBN in the reaction solution and the optical purity of the produced CHBN were analyzed under the analysis conditions described in Example 4 (2). The results are shown in Table 5.

In the reaction using the crude enzyme solution derived from the transformant strain JM109 / pSTT002 that expresses wild-type halohydrin epoxidase, only 77 mM of CHBN accumulated, whereas each of those expressing the improved halohydrin epoxidase In the reaction using the crude enzyme solution derived from the transformant strain, 87 to 149 mM CHBN was accumulated. Accordingly, it was shown that these improved halohydrin epoxidases can accumulate higher concentrations of product than wild-type halohydrin epoxidases.
In addition, the optical purity of (R) -CHBN synthesized using a crude enzyme solution derived from a transformant strain JM109 / pSTT002 expressing wild-type halohydrin epoxidase was 91.6% ee, but improved type Transformant strains expressing halohydrin epoxidase (JM109 / pSTT002-T133A, JM109 / pSTT002-T133C, JM109 / pSTT002-D199Q, JM109 / pSTT002-D199E, JM109 / pSTT002-D199H, JM109 / pSTT002-D199S, JM109 / PSTT002-D199T, JM109 / pSTT002-D199L, JM109 / pSTT002-D199M, JM109 / pSTT002-D199I and JM109 / pSTT002-D199Y) (R) -CHBN having an optical purity of 93.1% (R) -CHBN synthesized by these improved halohydrin epoxidases has higher optical purity than (R) -CHBN synthesized by wild-type halohydrin epoxidases. It was confirmed. Therefore, it was considered that these improved halohydrin epoxidases have improved stereoselectivity for DCP and / or intermediate ECH.

Confirmation of improved halohydrin epoxidase activity in the presence of chloride ion

  Chloride ion is a product in the synthesis of 4-halo-3-hydroxybutyronitrile from 1,3-dihalo-2-propanol and cyanide by halohydrin epoxidase. The synthesis reaction can be inhibited. The halohydrin epoxidase activities of wild type halohydrin epoxidase and improved halohydrin epoxidase in the presence of high concentrations of chloride ions were investigated and compared. Using the crude enzyme solution derived from the wild type halohydrin epoxidase expression transformant strain JM109 / pSTT002 and the improved halohydrin epoxidase expression transformant strain JM109 / pSTT002-D199H prepared in Example 4 In the method described in Example 1 (3), a method using a reaction solution in which the DCP concentration of the reaction solution is 400 mM, and in the method described in Example 1 (3), the DCP concentration of the reaction solution is set to 400 mM, and The halohydrin epoxidase activity (dechlorination activity) in the absence (0 mM) and presence (100 mM and 200 mM) of sodium chloride was determined by a method using a reaction solution to which sodium was added to a final concentration of 100 mM or 200 mM. The relative activity value was calculated by setting the activity of the crude enzyme solution derived from each transformant in the absence of sodium chloride (0 mM) as 100%. The results are shown in Table 6.

  The halohydrin epoxidase activity of the crude enzyme solution derived from the transformant strain JM109 / pSTT002 expressing wild-type halohydrin epoxidase decreased to 44% and 40% in the presence of 100 mM and 200 mM chloride ions, respectively. In contrast, the halohydrin epoxidase activity of the crude enzyme solution derived from the improved halohydrin epoxidase-expressing transformant strain JM109 / pSTT002-D199H was 91% in the presence of 100 mM and 200 mM chloride ions, respectively. It showed 78% residual activity. Therefore, it was confirmed that the improved halohydrin epoxidase has higher resistance to reaction inhibition by chloride ions than the wild-type halohydrin epoxidase.

Production and evaluation of improved halohydrin epoxidase expression transformant (Rhodococcus genus host)

(1) Production of a transformant (Rhodococcus bacterium host) expressing an improved halohydrin epoxidase A transformant (Rhodococcus bacterium host) expressing an improved halohydrin epoxidase is produced and transformed. The body was evaluated. First, substitution mutation (T141A) of the 141st threonine residue of halohydrin epoxidase HheB (1 ^st ) (SEQ ID NO: 1) with the expression plasmid pJHB057 described in JP-A-2007-49932 as a template, 144 An improved halohydrin epoxidase expression plasmid into which the substitution mutation of the phenylalanine residue at the serine (F144S) and the substitution mutation of the 207th aspartate residue at the substitution of histidine (D207H) were introduced was prepared. The following were prepared as primers used for mutagenesis.

MDH-05: CGCTGGCCTACAGCGCGGCGCGTTTCGCT (Sequence number 68: Sense primer consisting of 29 nucleotides, the codon encoding the 141st amino acid of halohydrin epoxidase HheB (1 ^st ) is GCG (encodes alanine))
MDH-06: AGCGAAACGCGCCGCGCTGTAGGCCAGCG (SEQ ID NO: 69: antisense primer consisting of 29 nucleotides and having a complementary sequence of MDH-05)

MDH-07: CAGCACGGCGCGTTCCGCTCAGCGCGGGT (sense primer consisting of SEQ ID NO: 70:29 nucleotides, the codon encoding the 144th amino acid of halohydrin epoxidase HheB (1 ^st ) is TCC (encodes serine))
MDH-08: ACCCGCGCTGAGCGGAACGCGCCGTGCTG (SEQ ID NO: 71: antisense primer consisting of 29 nucleotides and having a complementary sequence of MDH-07)

MDH-09: CGACTGCCCGAGAGCACGCGCTGCTCGCG (sense primer consisting of SEQ ID NO: 72:29 nucleotides, the codon encoding the 207th amino acid of halohydrin epoxidase HheB (1 ^st ) is CAC (encodes histidine))
MDH-10: CGCGAGCAGCGCGTGCTCTCGGGCAGTCG (SEQ ID NO: 73: antisense primer consisting of 29 nucleotides and having a complementary sequence of MDH-09)

  Site-directed mutagenesis was performed with the QuickChange Site-Directed Mutagenesis Kit (STRATAGENE) using the above primer and template pJHB057. The composition of the reaction solution (total amount 50 μl) was as shown in the following table (series 1 is for obtaining the T141A mutant, series 2 is for the F144S mutant, and series 3 is for obtaining the D207H mutant).

The combinations of primers used for each series are as follows.
Series 1: Sense primer MDH-05, Antisense primer MDH-06
Series 2: Sense primer MDH-07, Antisense primer MDH-08
Series 3: Sense primer MDH-09, Antisense primer MDH-10
About each reaction liquid of the said composition, the thermal cycle process of the following table | surface was performed.

In accordance with the attached manual, 1 μl of DpnI was added to each reaction solution subjected to thermal cycling, and incubated at 37 ° C. for 1 hour. Using the DpnI treatment solution, E. coli was transformed in the same manner as in Example 2 (1). A plurality of transformant colonies grown on the agar medium were cultured overnight at 37 ° C. in 1.5 ml of LB Amp medium (LB medium containing ampicillin 100 mg / L). After collecting each of the obtained culture solutions, the recombinant plasmid was recovered using Flexi Prep (GE Healthcare Bioscience). Using the capillary DNA sequencer CEQ2000 (Beckman Coulter), according to the attached manual, analyze the nucleotide sequences of the PCR amplification products cloned in the three types of plasmids and confirm that no error mutation has occurred in the PCR reaction. did. The plasmid from which the DNA fragment derived from the PCR amplification product of the series 1 was cloned was pJHB057-T141A, the plasmid from which the DNA fragment from the PCR amplification from the series 2 was cloned was cloned as pJHB057-F144S, and the DNA fragment from the PCR amplification product from the series 3 was cloned. The resulting plasmid was named pJHB057-D207H, and E. coli JM109 strain transformants containing these plasmids were named JM109 / pJHB057-T141A, JM109 / pJHB057-F144S and JM109 / pJHB057-D207H, respectively. (The number indicating the position of the amino acid residue is a number indicating the position of the amino acid residue in HheB (1 ^st ) (SEQ ID NO: 1).)
Using the obtained pJHB057-T141A, pJHB057-F144S and pJHB057-D207H, the transformation of Rhodococcus rhodochrous J1 strain (Accession No. “FERM BP-1478”) according to the method described in JP-A-2007-49932 Went. The plasmids of the obtained colonies were confirmed, and three types of transformants J1 / pJHB057-T141A, J1 / pJHB057-F144S and J1 / pJHB057-D207H were obtained.

(2) Evaluation of transformants (Rhodococcus bacteria host) expressing improved halohydrin epoxidase Three transformants obtained in Example 6 (1) (J1 / pJHB057-T141A, J1 / pJHB057) -F144S and J1 / pJHB057-D207H) were evaluated as follows. A total of 4 strains of the three transformants and J1 / pJHB057 were used as GGPK medium (1.5% glucose, 1% sodium glutamate, 0.1% bactoeast extract, 0.05% K ₂ HPO ₄ , 0.05% KH _{2, respectively).} PO ₄ , 0.05% MgSO ₄ · 7H ₂ O, kanamycin 50 μg / ml, pH 7.2) was inoculated into 100 ml, and cultured with shaking at 30 ° C. for 72 hours. Each bacterial cell was recovered from 100 ml of each obtained culture solution by centrifugation (3,700 × g, 10 minutes, 4 ° C.), washed with 20 mM Tris-sulfate buffer (pH 8.0), and then the bacterial concentration was 12.5 gDC. / L was suspended in the same buffer. 3 ml of the obtained bacterial cell suspension is ice-cooled using an ultrasonic crusher VP-15S (Tytec, Japan) under conditions of output control 4, DUTY CYCLE 40%, PULS, TIMER = B mode 10s. For 10 minutes. The disrupted cell suspension was subjected to centrifugation (23,000 × g, 5 minutes, 4 ° C.), and the supernatant was collected as a crude enzyme solution. About each obtained crude enzyme liquid, the halohydrin epoxidase activity (dechlorination activity) was measured by the method using the reaction liquid which made the DCP density | concentration of the reaction liquid 400 mM in the method of Example 1 (3), respectively. did. 1 U is defined as the amount of enzyme desorbing 1 μmol chloride ion per minute from DCP under the above conditions, and the activity of each crude enzyme solution used for activity measurement is used for activity measurement. The liquid activity of each crude enzyme solution was calculated by dividing by the amount of each crude enzyme solution. Furthermore, the specific activity per protein of each strain was calculated by dividing the liquid activity by the protein concentration. The protein concentration was measured using a Bio-Rad protein assay (Bio-Rad). The results are shown in Table 7.

Substitution mutation of 141st threonine residue to alanine (T141A), substitution mutation of 144th phenylalanine residue to serine (F144S) and 207th aspartic acid residue in HheB (1 ^st ) (SEQ ID NO: 1) Improved halohydrin epoxidase in which a substitution mutation (D207H) of histidine is introduced is an improved halo that improves halohydrin epoxidase activity per transformant even when a Rhodococcus bacterium is used as a host. It was confirmed to be a hydrin epoxidase.

SEQ ID NO: 3 to 28: Mutant peptide SEQ ID NO: 31 to 56: Mutant DNA
SEQ ID NOs: 57 to 61: Synthetic DNA
SEQ ID NO: 62: synthetic DNA
Sequence number 62: n represents a, c, g, or t (location: 15-17)
SEQ ID NO: 63: synthetic DNA
Sequence number 63: n represents a, c, g, or t (location: 13 to 15)
SEQ ID NO: 64: synthetic DNA
Sequence number 64: n represents a, c, g, or t (location: 14-16)
SEQ ID NO: 65: synthetic DNA
Sequence number 65: n represents a, c, g, or t (location: 14-16)
SEQ ID NO: 66: synthetic DNA
Sequence number 66: n represents a, c, g, or t (location: 15-17)
SEQ ID NO: 67: synthetic DNA
Sequence number 67: n represents a, c, g, or t (location: 13-15)
Sequence number 68-73: Synthetic DNA
Sequence number 74: Xaa represents arbitrary amino acid residues (location: 2-13, 15, 16, 19)
Sequence number 75: Xaa represents arbitrary amino acid residues (location: 2, 5-8, 10)
Sequence number 76-83: Mutant peptide Sequence number 84-91: Mutant DNA

Claims (14)

The following amino acid sequence I:
S-α1-α2-α3-α4-α5-α6-α7-α8-α9-α10-α11-α12-Y-α13-α14-AR-α15 (SEQ ID NO: 74)
(S represents a serine residue, Y represents a tyrosine residue, A represents an alanine residue, R represents an arginine residue, and α1 to α15 each independently represent an identical or different arbitrary amino acid residue.)
And the following amino acid sequence II:
L-β16-RL-β17-β18-β19-β20-E-β21 (SEQ ID NO: 75)
(L represents a leucine residue, R represents an arginine residue, E represents a glutamic acid residue, and β16 to β21 each independently represent the same or different arbitrary amino acid residues.)
An improved halohydrin epoxy comprising an amino acid sequence in which any one or a plurality of amino acid mutations selected from the following (A) to (D) are introduced into the amino acid sequence of a wild-type halohydrin epoxidase containing Dase.
(A) Amino acid mutation in which one amino acid residue on the C-terminal side from the starting amino acid residue is replaced with another amino acid (B) Amino acid mutation in which α14 residue is replaced with another amino acid (C) α15 residue Amino acid mutation in which is replaced with another amino acid (D) Amino acid mutation in which β21 residue is replaced with another amino acid The following amino acid sequence I:
S-α1-α2-α3-α4-α5-α6-α7-α8-α9-α10-α11-α12-Y-α13-α14-AR-α15 (SEQ ID NO: 74)
(S represents a serine residue, Y represents a tyrosine residue, A represents an alanine residue, R represents an arginine residue, and α1 to α15 each independently represent an identical or different arbitrary amino acid residue.)
And the following amino acid sequence II:
L-β16-RL-β17-β18-β19-β20-E-β21 (SEQ ID NO: 75)
(L represents a leucine residue, R represents an arginine residue, E represents a glutamic acid residue, and β16 to β21 each independently represent the same or different arbitrary amino acid residues.)
An improved halohydrin epoxy comprising an amino acid sequence into which any one or a plurality of amino acid mutations selected from the following (E) to (H) is introduced into the amino acid sequence of a wild-type halohydrin epoxidase containing Dase.
(E) Amino acid mutation in which one residue C-terminal amino acid residue from the starting amino acid residue is substituted with lysine or asparagine (F) Amino acid mutation in which α14 residue is substituted with alanine, cysteine or serine (G) α15 Amino acid mutation in which residue is replaced with alanine, serine or tryptophan (H) Amino acid mutation in which β21 residue is replaced with glutamine, glutamic acid, histidine, serine, threonine, tyrosine, leucine, isoleucine or methionine   The improved halohydrin epoxidase according to claim 1 or 2, wherein the wild-type halohydrin epoxidase is classified into group B.   The improved halohydride according to any one of claims 1 to 3, wherein the wild-type halohydrin epoxidase is derived from a bacterium belonging to the genus Corynebacterium or Mycobacterium. Phosphoepoxidase.   The improved halohydrin epoxidase according to any one of claims 1 to 3, wherein the amino acid sequence of the wild-type halohydrin epoxidase is the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2. Either of the following (i) to (iii) selected from the amino acid sequence of the wild-type halohydrin epoxidase or an amino acid sequence into which a plurality of amino acid mutations are introduced: 2. The improved halohydrin epoxidase according to item 1.
(I) One or several amino acid residues selected from amino acid residues other than the amino acid residue at the C-terminal side, α14 residue, α15 residue and β21 residue from the starting amino acid residue (Ii) Amino acid residues one residue C-terminal from the starting amino acid residue, amino acid residues included in amino acid sequence I, and amino acid residues other than amino acid residues included in amino acid sequence II Amino acid mutation in which one or several amino acid residues selected from the group are deleted (iii) Amino acid sequence I and amino acid sequence in a region consisting of two or more residues from the starting amino acid residue and C-terminal amino acid residues Amino acid mutation in which one or several arbitrary amino acid residues are inserted in a region other than the region consisting of II   A gene encoding the improved halohydrin epoxidase according to any one of claims 1 to 6.   A recombinant vector comprising the gene according to claim 7.   A transformant or transductant obtained by introducing the recombinant vector according to claim 8 into a host.   A culture obtained by culturing the transformant or transductant according to claim 9.   An improved halohydrin epoxidase collected from the culture of claim 10.   A method for producing an improved halohydrin epoxidase, comprising culturing the transformant or transductant according to claim 9 and collecting the improved halohydrin epoxidase from the resulting culture.   Epihalohydrin is obtained by contacting the improved halohydrin epoxidase according to any one of claims 1 to 6 and 11 and / or the culture according to claim 10 with 1,3-dihalo-2-propanol. A method for producing an epihalohydrin, characterized by comprising:   The improved halohydrin epoxidase according to any one of claims 1 to 6 and 11, and / or the culture according to claim 10, in the presence of a cyanide compound, 1,3-dihalo-2-propanol or epihalohydrin. A process for producing 4-halo-3-hydroxybutyronitrile, characterized in that 4-halo-3-hydroxybutyronitrile is produced by contacting with.