JP5172201B2 - Method for producing protein-containing solution - Google Patents

Description

  The present invention relates to a method for producing a protein-containing solution by efficiently removing cell debris from a cell disruption solution.

  When a useful protein produced in a cell is isolated or purified and used, it is necessary to crush cells by physical or chemical means, and then remove cell fragments that coexist in the cell lysate. As means for removing cell debris, it is common to use means such as centrifugation, centrifugation and filtration. However, there are several problems when trying to remove cell debris by these means. For example, since cell fragments are more difficult to settle than cells, a large centrifugal force is required when removing cell fragments by centrifugation. Therefore, when performing centrifugal separation on an industrial scale, a high-performance and expensive centrifugal separator is required, which increases the cost of the product. Moreover, when removing cell fragments by filtration, the filter medium is likely to be clogged or fouled, resulting in a decrease in protein recovery.

  As a method for solving these problems, for example, a method of adding a cationic polymer flocculant to a cell disruption solution is known (see Patent Document 1). However, the addition of the flocculant precipitates the target protein together with the cell debris, and the function of the target protein, for example, when the protein is an enzyme, the enzyme activity may disappear. In addition, depending on the type and concentration of the flocculant, there is a problem that the viscosity becomes high or it takes time to dissolve uniformly. Further, when cell debris is removed by filtration, because of its high molecular weight, it may cause a decrease in filtration rate, clogging of the filter medium, and fouling.

Japanese Patent Laid-Open No. 63-3798

  By applying an additive that does not cause precipitation or loss of function of the target protein, decrease in the filtration rate, clogging or fouling of the filter medium, and is easy to handle from the viewpoint of viscosity and solubility, It aims at providing the method of removing a cell debris efficiently from a crushing liquid.

  As a result of conducting sincere research to solve the above problems, the present inventors efficiently removed cell debris from the cell lysate by adding an amphoteric surfactant to the cell lysate, and contained protein. The present inventors have found that a solution can be produced and have completed the present invention.

That is, the present invention is as follows.
(1) A method for producing a protein-containing solution comprising the following steps (A) to (D).
(A) Step for culturing cells (B) Step (C) for crushing the cells obtained in step (A) and preparing a cell lysate containing protein and cell debris (C) Step (B) Step of adding amphoteric surfactant to cell lysate containing protein and cell debris (D) Step of removing cell debris from cell lysate added with amphoteric surfactant obtained in step (C)

  According to the present invention, cell fragments can be efficiently removed from the cell disruption solution without causing precipitation or loss of function of the target protein, clogging during filtration, fouling, or the like.

Embodiments of the present invention will be described below. However, the present embodiments are examples for explaining the present invention, and the present invention is not intended to be limited to these embodiments. The present invention can be implemented in various forms without departing from the gist thereof.

The present invention is as follows.
A method for producing a protein-containing solution comprising the following steps (A) to (D).
(A) Cell culturing step
(B) A step of crushing the cells obtained in step (A) to prepare a cell disruption solution containing protein and cell fragments
(C) A step of adding an amphoteric surfactant to the cell disruption solution containing the protein and cell debris obtained in step (B)
(D) A step of removing cell debris from the cell disruption solution added with the amphoteric surfactant obtained in step (C)

In step (A), a cell is a life form that is surrounded by a membrane structure that isolates the outside world, whether it is alive or dead, and that has (or has) genetic information with self-renewal capability and its expression mechanism. Say. Specific examples of cells in the present invention include microbial cells, animal cells, insect cells, plant cells and the like. Specific examples of microorganisms include, for example, bacteria, yeasts, filamentous fungi, actinomycetes, etc., and specific examples thereof include Bacillus stearosa mophilus, Bacillus subtilis, Bacillus cereus Bacillus brevis, Bacillus. Bacteria belonging to the genus Bacillus such as Circillance, Bacillus coagillance, Bacillus lichenihomis, Bacillus megaterium, Bacillus polymixer, Escherichia coli, Escherichia adecarboxylatata, Escherichia anology, Escherichia anandrica and other coliform bacteria Syudomonas such as Syudomonas aeruginosa, Syudomonas aceris, Syudomonas acidborans, Syudomonas petitda, Syudomonas fluorescens, Syudomonas maltofilia Lactic acid bacteria such as Lactobacillus casei, Streptococcus lactis, Lactobacillus acidophilus, Lactobacillus brevis, Lactobacillus bulgaricus, Acetobacter aceti, Acetobacter oxydance, Acetobacter lancen Acetic acid bacteria such as Acetobacter roseum, Acetobacter xylinium, Saccharomyces cerevisiae, Saccharomyces carlsbergensis, Bichia fumentas, Pichia membran afuciens, Hansenula anomala, Hansenula sachiuranas, Chizosatsu caromyces Pombe, Chizosaccharomyces octospora, Endomycopsis fibriga and other yeasts, Mucor racemosus, Mucor Jabanicus, Rhizopus japonicas, Rhizopus Filamentous fungi such as Japanicus, Asparagillus niger, Streptomyces griseus, Streptomyces alban, Streptomyces balgar, Nocardia opaca, Actinoplanes utahensis, Actinoplanes miriuriensis actinomycetes, Examples include Rhodococcus bacteria such as Rhodococcus rhodochrous, Rhodococcus globulus, Rhodococcus luteus, Rhodococcus erythropolis, Rhodococcus equi.

  Furthermore, more specific examples of Escherichia coli (Escherichia coli) include, for example, wild strains such as K12 strain and B strain, or C600 strain, W3110 strain, JM109 strain, XL1- Blue strain, BL21 (DE3) strain and the like can be mentioned.

  More specific examples of Rhodococcus bacteria include, for example, Rhodococcus rhodochrous ATCC999, ATCC12674, ATCC17895, ATCC15998, ATCC33275, ATCC184, ATCC4001, ATCC4273, ATCC4276, ATCC9356, ATCC12483 ATCC14341, ATCC14347, ATCC14350, ATCC15905, ATCC15998, ATCC15998, ATCC17041, ATCC19149, ATCC19150, ATCC21243, ATCC29670, ATCC29672, ATCC29675, ATCC33258, ATCC13808, ATCC17067, ATCC19067, ATCC19067 , ATCC21291, ATCC21785, ATCC21924, IFO14894, IFO3338, NCIMB11215, NCIMB11216, JCM3202, Rhodococcus rhodochrous J1 (FERM BP-1478), Rhodococcus globullus IFO14531, Tedococcus 616 Examples include JCM6164, Rhodococcus erythropolis IFO12538, IFO12320, Rhodococcus equi IFO3730, JCM1313.

  These microorganisms can be obtained from the American Type Culture Collection (ATCC) and other agencies such as the Biotechnology Center, Biotechnology Headquarters, Biotechnology Headquarters, National Institute of Technology and Evaluation, RIKEN BioResource Center, Microbial Materials Development Office, etc. It is available. In the present invention, when the cell is a microorganism, the cell may be referred to as “bacteria” or “bacteria”.

  Specific examples of animal cells include monkey cells COS-7, Vero cells, CHO cells, mouse L cells, rat GH3, human FL cells and the like. Specific examples of insect cells include, for example, Sf9 cells and Sf21 cells. Specific examples of plant cells include tobacco BY-2 cells.

  In addition to the above cells, cells in which genetic manipulation has been performed on the above cells are also included in the range of cells in the present invention. There are no particular limitations on the type of genetic manipulation, but examples include manipulation of introducing a vector into a cell. Hereinafter, in the present invention, such an operation is sometimes referred to as “transformation”, and the transformed cell is sometimes referred to as “transformant”.

  As one aspect of transformation, in order to express the target protein in cells, an expression vector is constructed in which a transcription promoter is placed upstream of the gene encoding the target protein and a terminator is placed downstream if necessary. For example, an operation of introducing a cell into a cell. A vector suitable for each cell can be used, and examples thereof include plasmid DNA, bacteriophage DNA, retrotransposon DNA, artificial chromosome DNA and the like. For example, suitable vectors for E. coli cells include pTrc99A (Centraalbureau voor Schimmelcultures (CBS), the Netherlands; http://www.cbs.knaw.nl/) having a region capable of autonomous replication in E. coli, pUC19 (Takara Bio, Japan), pKK233-2 (Centraalbureau voor Schimmelcultures (CBS), Netherlands; http://www.cbs.knaw.nl/), pET-12 (Novagen, Germany), pET-26b (Novagen) Company, Germany) can be used. Moreover, what modified these vectors as needed can also be used. Any method for cleaving and binding DNA accompanying construction of an expression vector may be used, and a method using a restriction enzyme, a method using topoisomerase, and the like can be used. At that time, if necessary, an appropriate linker may be added.

  The type of promoter is not particularly limited as long as it allows appropriate expression in cells. Examples of promoters that can be used in E. coli include the tryptophan operon trp promoter, the lactose operon lac promoter, and lambda. Examples include phage-derived PL promoters and PR promoters, and modified and designed sequences such as tac promoter and trc promoter can also be used. Examples that can be used in Bacillus subtilis cells include gluconic acid synthase promoter (gnt), alkaline protease promoter (apr), neutral protease promoter (npr), α-amylase promoter (amy), and the like. Examples of those that can be used in Rhodococcus bacteria cells include promoters related to nitrilase expression regulatory genes derived from Rhodococcus erythropolis SK92-B1 strain. On the other hand, the terminator is not necessarily required, but the type of the terminator is not particularly limited, and examples thereof include ρ factor-independent ones such as lipoprotein terminator, trp operon terminator, rrnB terminator and the like.

  Further, ribosome binding sequences such as an SD sequence and a Kozak sequence are known as base sequences important for translation into amino acids, and these sequences can be inserted upstream of a mutated gene. An SD sequence may be added by PCR or the like when a prokaryotic cell is used for a cell, and a Kozak sequence may be added when a eukaryotic cell is used for a cell. Examples of the SD sequence include sequences derived from Escherichia coli or Bacillus subtilis, but are not particularly limited as long as the sequences function in desired cells such as Escherichia coli and Bacillus subtilis. For example, a consensus sequence in which a sequence complementary to the 3 'terminal region of 16S ribosomal RNA is complementary to 4 or more bases may be prepared by DNA synthesis and used.

  The vector may contain a factor (selection marker) for selecting the desired transformant. Examples of selectable markers include drug resistance genes, auxotrophic complementary genes, and assimilative genes, and can be selected according to the purpose and cells. For example, drug resistance genes used as selection markers in E. coli include ampicillin resistance gene, kanamycin gene, dihydrofolate reductase gene, neomycin resistance gene and the like.

  The method for introducing the vector into the cell is not particularly limited, and a known method can be used. When the cells are bacteria, for example, a method using calcium ions, an electroporation method, a protoplast method and the like can be mentioned. When the cell is yeast, for example, electroporation method, spheroplast method, lithium acetate method and the like can be mentioned. In the case where the cell is a filamentous fungus, examples thereof include a protoplast method and a particle gun method. When the cell is an animal cell, examples thereof include an electroporation method, a calcium phosphate method, and a lipofection method. When the cells are insect cells, for example, calcium phosphate method, lipofection method, electroporation method and the like are used. When the cell is a plant cell, for example, the Agrobacterium method, particle gun method, PEG method, electroporation method and the like can be mentioned.

  When culturing the above-mentioned cells, the medium to be used contains a carbon source, nitrogen source, inorganic salts, etc. that can be assimilated by the cells, and can be a natural medium or a synthetic medium as long as the cells can be cultured efficiently. Any of the media may be used. Examples of the carbon source used when the cell is a microorganism include carbohydrates such as glucose, galactose, fructose, sucrose, raffinose and starch, organic acids such as acetic acid and propionic acid, and alcohols such as ethanol and propanol. Examples of the nitrogen source include ammonia, ammonium salts of inorganic acids or organic acids such as ammonium chloride, ammonium sulfate, ammonium acetate, and ammonium phosphate, or other nitrogen-containing compounds. In addition, peptone (derived from milk, animal meat, fish meat or soy protein), yeast extract, meat extract, corn steep liquor, various amino acids and the like may be used. Examples of inorganic substances include monopotassium phosphate, dipotassium phosphate, magnesium phosphate, magnesium sulfate, sodium chloride, ferrous sulfate, manganese sulfate, zinc sulfate, copper sulfate, and calcium carbonate. Moreover, you may add an antifoamer in order to prevent foaming during culture | cultivation as needed. Moreover, you may add a vitamin etc. suitably as needed. Further, during the culture, the culture may be performed under selective pressure in order to prevent the vector and the target gene from falling off. That is, a drug corresponding to the case where the selection marker is a drug resistance gene may be added to the medium, and the nutrient factor corresponding to the case where the selection marker is an auxotrophic complementary gene may be removed from the medium. When the selectable marker is an assimilation gene, a corresponding assimilation factor can be added as a sole factor as necessary. For example, when culturing E. coli transformed with a vector containing an ampicillin resistance gene, ampicillin may be added to the medium as needed during the culture. When cultivating a transformant transformed with an expression vector using an inducible promoter as a promoter, an inducer may be added to the medium as necessary. For example, when cultivating a transformant transformed with an expression vector having a promoter inducible with isopropyl-β-D-thiogalactoside (IPTG), IPTG or the like can be added to the medium. In addition, when cultivating a transformant transformed with an expression vector using a trp promoter inducible with indoleacetic acid (IAA), IAA or the like can be added to the medium. The medium can be sterilized by any method as long as the medium can be sterilized without the presence of microorganisms capable of growth. For example, autoclaving (eg, heat sterilization at 121 ° C. for 20 minutes) ) And filtration sterilization (for example, filtration with a filter having a pore size of 0.45 μm or 0.2 μm). When there is a concern about reaction between medium components during heat sterilization, one or more medium components may be sterilized separately from other medium components and mixed after sterilization.

  The conditions for culturing the cells (culture conditions) are not particularly limited as long as the growth of the cells is not hindered and the target protein is appropriately produced in a form having its function. The culture temperature is, for example, 10 ° C. to 45 ° C., preferably 10 ° C. to 40 ° C., more preferably 15 ° C. to 40 ° C., and even more preferably 20 ° C. to 37 ° C. May be changed. The culture time is, for example, 5 to 120 hours, preferably 5 to 100 hours, more preferably 10 to 100 hours, and still more preferably about 15 to 80 hours. The pH of the medium before or during the culture may be a value suitable for cell growth, and the culture can be performed while adjusting the pH as necessary. For example, if the cells are Escherichia coli, the pH is adjusted to 6-9. As the pH adjuster, an inorganic or organic acid, an alkaline solution, or the like can be used.

  Examples of the culture method include solid culture, stationary culture, shaking culture, and aeration and agitation culture, and a method suitable for cell growth is selected. For example, when culturing Escherichia coli, examples of the medium include one or more nitrogen sources such as yeast extract, tryptone, polypeptone, corn steep liquor, soybean or wheat bran leachate, sodium chloride, potassium monophosphate, Add one or more inorganic salts such as potassium potassium phosphate, magnesium sulfate, magnesium chloride, ferric chloride, ferric sulfate or manganese sulfate, and if necessary, saccharide raw materials, vitamins, antibiotics, inducers Etc. to which etc. were added are used. It is appropriate to adjust the initial pH of the medium to 7-9. The culture may be performed by a solid culture method, but it is preferable to employ a liquid culture method as much as possible, and further, aerobic conditions by shaking culture or aeration and agitation culture (jar fermenter) Cultivation in is preferred. When performing aeration and agitation culture, the operation method is not limited, and it can be performed in any of a batch culture, a fed-batch culture, a semi-batch culture, and a continuous culture. Also good. In particular, when it is desired to increase production per apparatus, per hour, per cost, or per operation by high concentration culture, semi-batch culture can be performed. The fed medium component used in the semi-batch method may have the same composition as the batch medium component or the composition may be changed, but the concentration of the medium component compared to the initial medium Is preferably at a higher concentration. The volume of the feed medium is not particularly limited, but for example, a volume of 1/2 or less of the initial medium can be added. Examples of feeding modes that can be used for feeding medium include constant flow, constant, exponential, stepwise increase, and specific growth rate controlled flow. Specific growth-rate control, pH-stat fed-batch (pH-stat), DO-stat fed-batch (DO-stat), glucose concentration control fed-batch (glucose concentration control), acetic acid concentration monitoring fed-batch (acetate concentration monitoring) And fuzzy neural network and the like, but are not particularly limited as long as desired cell growth and protein production can be achieved. The end of culture when semi-batch culture is performed does not have to be limited after the end of feeding of the fed-batch medium, and the culture is continued as needed, and the culture ends when desired cell growth and protein production are achieved. It can be.

  Examples of a medium for culturing a transformant obtained by using animal cells as cells include generally used RPMI1640 medium, DMEM medium, or a medium obtained by adding fetal calf serum or the like to these mediums. The culture is usually performed at 37 ° C. for 1 to 30 days in the presence of 5% CO 2. During culture, antibiotics such as kanamycin and penicillin may be added to the medium as necessary. When the transformant is a plant cell or plant tissue, the culture can be performed by using a normal plant culture medium such as an MS basic medium or an LS basic medium. As a culture method, any of a normal solid culture method and a liquid culture method can be employed.

  Cells obtained by culturing can be washed or concentrated by means such as centrifugation or membrane filtration, if necessary. Centrifugation is not particularly limited as long as it can supply a centrifugal force for sedimenting cells, and a cylindrical shape, a separation plate shape, or the like can be used. As a centrifugal force, it can carry out at about 500G-20,000G, for example. The membrane that can be used for membrane filtration may be either a microfiltration (MF) membrane or an ultrafiltration (UF) membrane as long as the desired washing or concentration can be achieved, but usually a microfiltration (MF) membrane. Is preferably used. For example, microfiltration can be classified into dead-end and crossflow (tangential flow) systems based on the flow direction, and classified into gravity, pressure, vacuum, and centrifugal force systems based on how pressure is applied. Yes, based on the operation mode, it can be classified into batch type, continuous type, etc., either of which can be used. Materials for MF membranes can be broadly classified into polymer membranes, ceramic membranes, metal membranes, and their composite types. Cell or target protein recovery rate (if the target protein is an enzyme, activity recovery rate is also included) ) Is not particularly limited as long as it does not decrease, particularly polymer membranes such as polysulfone, polyethersulfone, polytetrafluoroethylene, polyvinylidene fluoride, polyvinyl chloride, polypropylene, polyolefin, polyethylene, polycarbonate Polyacrylonitrile, mixed cellulose ester, copper ammonia method regenerated cellulose ester, polyimide, nylon, Teflon (registered trademark), etc. are preferably used. The pore size of the membrane is not particularly limited as long as it can capture cells and can be washed or concentrated. Usually, a pore size of about 0.1 to 0.5 μm can be used.

  At the time of the washing or concentration described above, dilution washing can be performed by adding water or, if necessary, a buffer solution or an isotonic solution. The buffer used is not particularly limited as long as it maintains an appropriate state of the cell and does not reduce the recovery rate of the target protein (in the case where the target protein is an enzyme, the activity recovery rate is also reduced). For example, the buffer component concentration is 5 to 500 mM, preferably about 5 to 150 mM, and the pH is about 5 to 9. Examples of the buffer component vary depending on the pH range in which the buffer capacity is expected, and examples thereof include tris (hydroxymethyl) aminomethane (Tris), sodium or potassium phosphate, citrate, acetate, and the like. Specific examples include 20 mM Tris-sulfate buffer (pH 8), 20 mM sodium phosphate buffer (pH 7), and the like. Examples of the isotonic solution include 0.7 to 0.9% sodium chloride solution. If there are substances that can stabilize the target protein, they may be added.

  Next, the cells obtained as described above are crushed to prepare a cell lysate containing protein and cell fragments (Step B).

  Cell disruption methods include ultrasonic treatment, high-pressure treatment using a French press or homogenizer, grinding treatment using a bead mill, collision treatment using an impact crushing device, enzyme treatment using lysozyme, cellulase, pectinase, etc., freeze-thawing treatment, hypotonic solution Treatment, phage lysis induction treatment, and the like, and any of these methods can be used alone or in combination as necessary. If the target protein recovery rate from the cells (if the target protein is an enzyme, the activity recovery rate is included in addition to the protein recovery rate, the same applies hereinafter), the type of crushing treatment is particularly limited. It will never be done. The sufficiently high target protein recovery rate or activity recovery rate is, for example, preferably 85% or more, more preferably 90% or more, still more preferably 95%, and most preferably 99% or more. When crushing cells on an industrial scale, taking into consideration operability, recovery rate, cost, etc., for example, high pressure treatment, grinding treatment, collision treatment, or a combination of these treatments with enzyme treatment etc. preferable.

When grinding by a bead mill, the beads used can be crushed by, for example, filling about 80 to 85% of a density of 2.5 to 6.0 g / cm ³ and a size of 0.1 to 1.0 mm, Either a batch system or a continuous system can be adopted as the operation system. The cell concentration is not particularly limited, but may be, for example, about 6 to 12% for bacteria and about 14 to 18% for yeasts.
When high-pressure treatment is performed, the treatment pressure is not particularly limited as long as the target protein recovery rate from the cells is sufficiently high. For example, about 40 to 200 MPa, preferably about 60 to 150 MPa, more preferably about 80 to 120 MPa. Crushing can be performed at a pressure of The cell concentration is not particularly limited, but may be, for example, about 20% or less. If necessary, it is possible to perform multistage processing by arranging the devices in series or using a device having a multi-stage structure, thereby improving crushing and operating efficiency. Usually, since a temperature rise of 2 to 3 ° C. occurs per processing pressure of 10 MPa, it is preferable to perform a cooling process as necessary.

  In the case of the collision treatment, for example, the cell slurry is preliminarily made into frozen fine particles (for example, 50 μm or less) by spray rapid freezing treatment (freezing speed: for example, several thousand degrees C. per minute), and this is performed at a high speed (for example, about 300 m / s The cells can be efficiently crushed by causing the carrier gas to collide with the collision plate.

  By performing the treatment as described above, the cells are crushed, intracellular proteins including the target protein are leaked, and a cell lysate containing cell fragments (part of the cells generated by the crushing process) can be obtained. . In addition, intracellular nucleic acids can be leaked together with the target protein. If the viscosity of the processing solution increases and handling becomes difficult due to the leaked nucleic acid, or if the target protein recovery rate decreases in the subsequent cell debris removal step, nucleic acid removal is performed as necessary. Treatment or nucleic acid degradation treatment can be performed. As a method for removing or decomposing nucleic acid in the cell disruption solution, any method can be used as long as it does not decrease the target protein recovery rate and can remove or degrade nucleic acid. As described in Volume 5, pages 200-201, a method of precipitating nucleic acid by adding protamine sulfate or streptomycin to a cell disruption solution, a method of degrading nucleic acid with a nucleolytic enzyme, a solution using dextran-polyethylene glycol For example, a method of performing separation. It may also be useful to add additional physical crushing treatments. Among these methods, in particular, when it is desired to rapidly degrade nucleic acids while avoiding complicated processes, a method of degrading nucleic acids with a nucleolytic enzyme can be employed. The nucleolytic enzyme used in the nucleolytic enzyme treatment may be any nucleolytic enzyme as long as it acts on at least deoxyribonucleic acid (DNA), has a nucleolytic reaction catalytic ability, and lowers the degree of DNA polymerization. However, an exogenous nucleolytic enzyme may be added separately. Examples of the nucleolytic enzyme added separately include bovine spleen-derived DNase I (Takara Bio, Japan), porcine spleen-derived DNase II (Wako Pure Chemicals, Japan), Serratia marcescens-derived nucleolytic enzyme Benzonase Nuclease (Takara Bio, Japan), Nuclease from Staphylococcus aureus (Wako Pure Chemicals, Japan). The amount of enzyme to be added varies depending on the type of enzyme and the definition of the number of units (U), but can be appropriately set by those skilled in the art. If necessary, a cofactor such as magnesium required for the nucleolytic enzyme may be added. The treatment temperature varies depending on the nucleolytic enzyme to be used, but a temperature of 20 to 40 ° C. is used if it is a nucleolytic enzyme derived from a room temperature species.

  Next, an amphoteric surfactant is added to the cell disruption solution containing the protein and cell debris obtained as described above (step C).

  In general, a surfactant is a substance that changes the properties of an interface or surface with a small amount. An amphoteric surfactant is a surfactant that dissolves in water and dissociates into ions, and a cation is present in the molecule. A surfactant having at least one functional group and one anionic functional group. Amphoteric surfactants are anionic under basic conditions and cationic under acidic conditions. The amphoteric surfactant used in the present invention efficiently removes cell debris from the cell disruption solution without losing the function of the target protein (the activity of the target protein is an enzyme when the target protein is an enzyme; hereinafter the same applies). Any anionic functional group in the molecule is preferably a carboxylic acid or sulfonic acid, and the molecular weight is preferably 1000 or less. Specific examples of amphoteric surfactants preferably used in the present invention include alkylamino fatty acids or salts thereof, alkylbetaines and alkylamine oxides, and more preferably alkyldiaminoethylglycine and salts thereof. More specifically, alkyldiaminoethylglycine hydrochloride and sodium alkyldiaminoethylglycine hydrochloride are mentioned.

  These amphoteric surfactants can be used singly or in combination of two or more kinds, and further do not prevent the use in combination with other substances such as a polymer flocculant. The amount of amphoteric surfactant added to the cell lysate varies depending on the type and cell concentration, and should be such that cell fragments can be efficiently removed from the cell lysate without losing the function of the target protein. It is not limited. For example, when alkyldiaminoethylglycine hydrochloride is added to the E. coli cell disruption solution, 1 to 50 parts by mass, preferably 2 to 40 parts by mass, more preferably 5 to 100 parts by mass of the dry mass of the disrupted E. coli cells. -30 mass parts, More preferably, 10-20 mass parts may be added. After the amphoteric surfactant is added to the cell lysate, stirring is performed so that the amphoteric surfactant is uniformly dissolved. For example, the mixture is stirred for 1 minute to 24 hours, preferably 3 minutes to 12 hours, more preferably 5 minutes to 1 hour. After the amphoteric surfactant is uniformly dissolved, it can be allowed to stand still. The temperature and pH when an amphoteric surfactant is added to the cell lysate are limited as long as the concentration can efficiently remove cell debris from the cell lysate without losing the function of the target protein. Is not to be done. For example, the temperature may be 0 ° C to 50 ° C, preferably 0 to 30 ° C, more preferably 0 to 0 ° C, and the pH may be 4 to 10, preferably 5 to 9, more preferably 6 to 8. Good. When pH adjustment is necessary, acid or alkali may be added, or a buffer solution may be added. In addition, a substance that stabilizes the target protein may be added.

  Although it is not always necessary that an apparent change occurs in the cell disruption solution or cell fragment after the addition of the amphoteric surfactant, it is preferable that the size of the cell fragment in the cell disruption solution changes. For example, although depending on cell culture conditions, storage conditions, and disruption method, the average particle size of the cell disruption contained in the cell disruption solution obtained by disrupting E. coli cell disruption twice at high pressure (100 MPa) is usually However, when an amphoteric surfactant is added according to the present invention, the average particle size can be 1.5 μm or more. The average particle size of the cell fragments can be determined by, for example, an image analysis method, a Coulter method, a centrifugal sedimentation method, a laser diffraction scattering method, or the like.

  Next, cell debris is removed from the cell lysate added with the amphoteric surfactant obtained as described above (step D).

As a method for removing cell debris, methods such as natural sedimentation, centrifugation, and filtration can be used. Centrifugation or filtration is preferred.
Centrifugation can be performed as described above. That is, there is no particular limitation as long as a centrifugal force that precipitates cells can be supplied, and a cylindrical shape, a separation plate shape, or the like can be used. As a centrifugal force, it can carry out at about 500G-20,000G, for example. According to the present invention, by using an amphoteric surfactant in the cell disruption solution, the cell fragment is easily precipitated and can be separated efficiently.

  Filtration using MF membrane or UF membrane can be performed as described above. As one of the preferable embodiments in the present invention, pressure filtration with a filter paper or a filter cloth combined with a filter aid can be mentioned. The filter paper may be any filter paper as long as it can efficiently remove cell debris from the cell disruption solution, and examples thereof include purified cotton fiber (cellulose) -based materials or glass fiber filter paper. For example, JIS P3801 Either qualitative analysis (1 to 4 types) or quantitative analysis (5 types A to C and 6 types) can be used. Preferably, 3 types, 5 types A, 5 types B, 6 types, 7 types, and the like can be used. The filter cloth may be any filter cloth as long as cell fragments can be efficiently removed from the cell disruption solution. Examples of the material for the filter cloth include polypropylene, polyester, polyamide (nylon), vinylidene chloride, vinylon, and cotton. Examples of the thread form of the filter cloth include spun yarn (short fiber yarn), multifilament yarn (long fiber yarn), monofilament yarn (long single fiber yarn), and split-type ultrafine fiber yarn. . Examples of the filter cloth structure include plain weave, twill, double weave, felt, and satin weave. As the breathability of the filter cloth, for example, 0.01 to 50 (cm 3 / cm 2 · sec) can be used. Specific types of pressure filtration on an industrial scale include a filter press (pressing filtration), a pressure leaf filter, a continuous pressure drum filter, a screw press, a belt press, and the like. For example, it can be performed using a filter press.

  The filter aid used in combination with the filter paper or filter cloth may be any filter aid that can efficiently remove cell debris from the cell disruption solution. For example, in addition to diatomaceous earth and perlite (pearlite), activated carbon, cellulose-based filter aid, and the like can be used. Specific examples of diatomaceous earth include, for example, radio lights # 100, # 200, # 300, # 500, # 500S, # 600, # 700, # 800, # 800S, # 900, # 2000, # 3000, fine Flow A, Fine Flow B, Sparkle Flow and Special Flow (Showa Chemical Industry Co., Ltd., Japan), Celite Filter Cel, # 577, Standard Super Cel, # 512, Hyflo Super Cel, # 503, # 535, # 545 and # 560 (World Minerals, USA), Dicalite # 215, Superaid, UF, Speedflow, # 231, Speedplus, # 375, SpeedEX (Grefco, USA), etc. Specific examples of perlite include Topco # 31, # 34, # 36 and # 38 (Showa Chemical Industry Co., Ltd., Japan), RocaHelp # 419, # 429, # 439, # 479, # 4109, # 4159 And # 4189 (Mitsui Metals Mining Co., Ltd., Japan). Specific examples of activated carbon include white birch C, white birch M, white birch A, white birch P, carborafine, strong white birch, refined white birch and special white birch (Nippon Enviro Chemicals, Japan), Kuraray Coal PW, PK and PDX. (Kuraray Chemical Co., Ltd., Japan). Specific examples of cellulosic filter aids include KC Flock W-50, W-100G, W-200G, W-300G and W-400G (Nippon Paper Chemicals Co., Ltd., Japan), Sera Flock and Arbocel (Showa Chemical Industry Co., Ltd., Japan).

  The filter aid can be used by either a precoat or body feed method. The precoat refers to a process or method for forming a thin film of filter aid on the filter medium surface. By performing the pre-coating, a filtrate with high clarity can be obtained from the beginning of filtration. Moreover, peeling of the filter cake containing cell fragments can be facilitated and clogging of the filter medium can be prevented. A part of the cell disruption solution may be used as the solution for suspending the filter aid used for the precoat. Moreover, you may use water or a buffer solution simply. Examples of the amount of the filter aid used for the precoat include 0.5 kg / m 2 to 2 kg / m 2.

  Body feed refers to a method of performing filtration while adding a filter aid to a stock solution (cell disruption solution). By performing body feed, the resistance of the compressible particles is reduced, the amount of filtration per hour is increased, and the time until the filter medium is clogged can be extended. The amount of the filter aid used for the body feed is not limited as long as the filtration can be performed efficiently. Also, the type of cells, the culture conditions or the disruption method, the type of amphoteric surfactant to be added, It is appropriately selected depending on the concentration, the type of filter aid, and the like. For example, an amount of 50 to 500 parts by mass, preferably 100 to 500 parts by mass, and more preferably 150 to 500 parts by mass can be used with respect to 100 parts by mass of the dry mass of the disrupted E. coli cells.

  The pressure at the time of filtration is not limited as long as the pressure can be efficiently filtered, and may be determined in consideration of the pressure resistance of the filter medium. For example, it can be performed at a pressure of about 0.05 MPa to 1 MPa, preferably about 0.1 MPa to 1 MPa, more preferably about 0.2 MPa to 1 MPa.

The obtained filtrate can be made into a protein-containing solution containing the target protein. If necessary, the protein-containing solution may be adjusted to pH by adding an acid, an alkali or a buffer component, or may be added a substance that stabilizes the target protein. The protein solution can be stored under the condition that the function of the target protein (the activity when the target protein is an enzyme) does not disappear until the protein solution is used. The temperature at the time of storage may be, for example, 0 ° C. to 50 ° C., preferably 0 to 30 ° C., more preferably 0 to 0 ° C. when performing refrigerated storage. -80 ° C to 0 ° C. The pH during storage may be, for example, 4 to 10, preferably 5 to 9, and more preferably 6 to 8.
In addition, the protein-containing solution may be used, if necessary, by general biochemical methods used for protein isolation and purification, such as ammonium sulfate precipitation, various chromatographies (eg gel filtration chromatography (eg Sephadex column), ion exchange chromatography). Subject to processing such as chromatography (eg DEAE-Toyopearl), affinity chromatography, hydrophobic chromatography (eg butyl Toyopearl), anion chromatography (eg MonoQ column), SDS polyacrylamide gel electrophoresis, etc. It can also be concentrated, isolated or purified.

  The protein-containing solution thus obtained can be used for the intended application according to the function of the protein. When the target protein is an enzyme, it can be used as a catalyst for an enzyme reaction by contacting with an appropriate substrate. Further, if necessary, the target protein may be immobilized and used as a catalyst for the enzyme reaction. Examples of the immobilization method and immobilization carrier include immobilization on polysaccharides (cellulose, agarose), inorganic substances (porous glass, metal oxide), synthetic polymers (polyacrylamide, polystyrene resin), etc., by a carrier binding method. And immobilization to glutaraldehyde and the like by a crosslinking method, immobilization to polysaccharides (alginic acid, carrageenan), polyacrylamide, nylon and the like by a comprehensive method.

  Here, halohydrin epoxidase will be described in detail as one specific embodiment of the protein in the present invention.

Halohydrin epoxidase, also called halohydrin hydrogen halide lyase, halohydrin dehalogenase or haloalcohol dehalogenase, has the activity to convert 1,3-dihalo-2-propanol to epihalohydrin, as described below. It is an enzyme (EC number: 4.5.1.-) having an activity to catalyze the reverse reaction. The halohydrin epoxidase is roughly classified into three groups (group A, group B, group C) based on amino acid sequence homology (J. Bacteriology 183 (17), 5058-5066, 2001). As halohydrin epoxidases belonging to Group A, HheA (Biosci. Biotechnol. Biochem. 58 (8), 1451-1457, 1994) derived from Corynebacterium sp. N-1074 strain, Arthrobacter HheA _AD2 (J. Bacteriology 183 (17), 5058-5066, 2001) derived from Arthrobacter sp. AD2 strain, Deh-PY1 (J. Health. Sci derived from Arthrobacter sp.) PY1 strain .50 (6), 605-612, 2004). The halohydrin epoxidase belonging to group B includes HheB (Biosci. Biotechnol. Biochem. 58 (8), 1451 (1994)) derived from Corynebacterium sp. N-1074 strain, Mycobacterium genus HheB _GP1 derived from (Mycobacterium sp.) GP1 strain (J. Bacteriology 183 (17), 5058-5066, 2001), DehA derived from Arthrobacter erithii H10a strain (Enz. Microbiol. Technol. 22, 568 -574, 1998). The halohydrin epoxidases belonging to group C include Agrobacterium radiobacter AD1 strain HheC (J. Bacteriology 183 (17), 5058-5066, 2001), Agrobacterium tumefaciens ( Agrobacterium tumefaciens) -derived HalB (http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=protein&val=4960076#feature_4960076) and the like.

  Here, the halohydrin epoxidase is a so-called wild type halohydrin epoxidase. A wild-type halohydrin epoxidase refers to a halohydrin epoxidase that can be isolated from a natural organism, and in the amino acid sequence constituting the enzyme, intentional or unintentional amino acid deletion, addition, insertion, Alternatively, it means a halohydrin epoxidase that has no substitution with other amino acids and retains its naturally derived attributes.

  Among the wild-type halohydrin epoxidases described above, those whose amino acid sequences have been clarified can be found in the GenBank database (http: // www) provided by the National Center for Biotechnology Information (NCBI). .ncbi.nlm.nih.gov / entrez / query.fcgi? CMD = search & DB = protein), it is registered with the following Accession No.

Accession No. BAA14361 (Amino acid sequence of HheA from Corynebacterium sp. N-1074)
Accession No. AAK92100 (amino acid sequence of HheA _AD2 derived from Arthrobacter sp. AD2 strain)
Accession No. BAA14362 (Amino acid sequence of HheB from Corynebacterium sp. N-1074)
Accession No. AAK73175 (amino acid sequence of HheB _GP1 derived from Mycobacterium sp. GP1 strain)
Accession No. AAK92099 (amino acid sequence of HheC derived from Agrobacterium radiobacter AD1 strain)
Accession No. AAD34609 (Amino acid sequence of HalB derived from Agrobacterium tumefaciens)

  The halohydrin epoxidase exemplified in the present invention includes a deletion, addition, insertion or other deletion of one or more amino acid residues in the amino acid sequence of the wild-type halohydrin epoxidase in addition to the wild-type halohydrin epoxidase. Halohydrin epoxidase (hereinafter sometimes referred to as a halohydrin epoxidase mutant) in which substitution of the amino acid residues with amino acid residues has occurred. In particular, among halohydrin epoxidase mutants, those with improved enzyme performance (improved halohydrin epoxidase) are examples of suitable proteins produced by the method of the present invention.

  Examples of the improved halohydrin epoxidase include those having improved halohydrin epoxidase activity, stereoselectivity, product inhibition resistance, product accumulation ability and the like per transformant. These improved halohydrin epoxidases include those having the attribute that halohydrin epoxidase activity per transformant is higher than that of wild-type halohydrin epoxidase, the substrate 1,3-dihalo-2-propanol Alternatively, when epihalohydrin or 4-halo-3-hydroxybutyronitrile is produced from epihalohydrin, the optical purity of the product is the same as that when the product is produced from the same substrate by wild-type halohydrin epoxidase. Reaction inhibition by one having the attribute of being higher than the optical purity of the product, chloride ion or 4-halo-3-hydroxybutyronitrile, which is a product from 1,3-dihalo-2-propanol or epihalohydrin Improved resistance to wild type halohydrin epoxidase, In the case of producing epihalohydrin or 4-halo-3-hydroxybutyronitrile from the 1,3-dihalo-2-propanol or epihalohydrin, which has the attribute that the product can be produced and accumulated at a high concentration, etc. Is included.

（式中、Ｘ1、Ｘ2はハロゲン原子） 1,3-dihalo-2-propanol is a compound shown below.

(Where X1 and X2 are halogen atoms)

  As the halogen atom, fluorine, chlorine, bromine and iodine are preferable, and chlorine and bromine are particularly preferable. Specifically, 1,3-difluoro-2-propanol, 1,3-dichloro-2-propanol (hereinafter sometimes referred to as “DCP”), 1,3-dibromo-2-propanol, 1,3- Examples include diiodo-2-propanol, and 1,3-dichloro-2-propanol and 1,3-dibromo-2-propanol are preferable.

（式中、Xはハロゲン原子） Epihalohydrin is a compound shown below.

(Where X is a halogen atom)

  As the halogen atom, fluorine, chlorine, bromine and iodine are preferable, and chlorine and bromine are particularly preferable. Specific examples thereof include epifluorohydrin, epichlorohydrin (hereinafter sometimes referred to as “ECH”), epibromohydrin, epiiodohydrin, and the like, and particularly preferably epichlorohydrin, epibromo It is a hydrin.

（式中、Ｘはハロゲン原子） 4-halo-3-hydroxybutyronitrile is a compound shown below.

(Where X is a halogen atom)

  As the halogen atom, fluorine, chlorine, bromine and iodine are preferable, and chlorine and bromine are particularly preferable. Specifically, 4-fluoro-3-hydroxybutyronitrile, 4-chloro-3-hydroxybutyronitrile (hereinafter sometimes referred to as “CHBN”), 4-bromo-3-hydroxybutyronitrile, 4 -Iodo-3-hydroxybutyronitrile and the like can be mentioned, and 4-chloro-3-hydroxybutyronitrile and 4-bromo-3-hydroxybutyronitrile are preferable.

  Epihalohydrin is a useful substance as a raw material for synthesizing various pharmaceuticals and physiologically active substances. For example, (R)-(−)-4-halo-3-hydroxybutyronitrile obtained by ring-opening cyanation of (R) -epihalohydrin is known to be useful as a raw material for the synthesis of L-carnitine. (Japanese Patent Laid-Open No. 57-165352).

  In the present invention, “halohydrin epoxidase activity” means an activity of converting 1,3-dihalo-2-propanol into epihalohydrin and an activity of catalyzing the reverse reaction. The “halohydrin epoxidase activity” can be determined by measuring the production amount of epihalohydrin or chloride ion from 1,3-dihalo-2-propanol per hour. The amount of epihalohydrin produced can be quantified by, for example, liquid chromatography or gas chromatography. In addition, the amount of chloride ions produced can be determined, for example, by adding an alkaline solution continuously or intermittently so as to keep the pH, which decreases with the production of chloride ions, at a certain value. For convenience. The halohydrin epoxidase activity calculated by this method is sometimes called “dechlorination activity” or simply “activity”. In addition, antibodies against improved halohydrin epoxidase can be prepared and calculated by immunological techniques such as Western blot or ELISA. In addition, if it is assumed that the halohydrin epoxidase activity is proportional to the expression level in the transformant, it can also be analyzed by SDS-PAGE or other analytical means, for example, by comparing with a sample with known halohydrin epoxidase activity. It can be obtained indirectly. SDS-PAGE can be performed by those skilled in the art using a known method.

  For at least some halohydrin epoxidases, 4-halo-3-hydroxybutyronitrile is obtained by ring-opening cyanation of epihalohydrin in the presence of a cyanide compound in addition to the above-mentioned “halohydrin epoxidase activity”. Has the activity of catalyzing the reaction to produce That is, in addition to the activity of converting 1,3-dihalo-2-propanol to epihalohydrin and the activity of catalyzing the reverse reaction, epihalohydrin is subjected to ring-opening cyanation in the presence of a cyanide to give 4-halo-3-hydroxy. It has been shown to catalyze reactions that produce butyronitrile.

As an example using the reaction, a method for producing optically active 4-halo-3-hydroxybutyronitrile from 1,3-dihalo-2-propanol (Japanese Patent Laid-Open Nos. 03-053889 and 2001-25397) And a method for producing optically active 4-halo-3-hydroxybutyronitrile (Japanese Patent Laid-Open No. 03-053890) from epihalohydrin. In this case, the cyanide compound includes cyanide ion (CN ⁻ ) when added to a reaction solution such as hydrogen cyanide, potassium cyanide (hereinafter sometimes referred to as “KCN”), sodium cyanide, cyanic acid, or acetone cyanohydrin. ) Or a compound that generates hydrogen cyanide or a solution thereof.

  In the present invention, the term “halohydrin epoxidase activity per transformant” means “halohydrin epoxidase activity per unit mass of transformant dry cells”, which is also referred to as “cell specific activity”. (In the present specification, dry cells may be referred to as “DC”). Further, “halohydrin epoxidase activity per soluble protein” means “halohydrin epoxidase activity per unit mass of soluble protein” and is also referred to as “protein specific activity”. Furthermore, in the present invention, for convenience, it is assumed that a certain amount of soluble protein can be obtained from a certain amount of transformant, and “cell specific activity” is proportional to “protein specific activity”. . That is, if “protein specific activity” is high (low), “cell specific activity” is high (low). In the present invention, “liquid activity” means halohydrin epoxidase activity per unit solution amount. By dividing the “liquid activity” by the bacterial concentration or soluble protein concentration of the solution, “bacterial cell specific activity” or “protein specific activity” can be calculated. In the present invention, the “activity recovery rate” means a relative ratio (%) of activities recovered after the operation, assuming that the activity before a certain operation is 100%. In addition, the term “optical activity” refers to a state of a substance in which one enantiomer is contained more than the other enantiomer, or a substance composed of only one of the enantiomers. . In addition, “optical purity” is approximately equal to “enantiomeric excess (% ee)” and is defined by the following equation.

  Optical purity ≒ Enantiomeric excess = 100 x (| [R]-[S] |) / ([R] + [S]) (% ee)

  Here, [R] and [S] indicate the concentration of each enantiomer in the data. “Stereoselectivity” refers to the property that halohydrin epoxidase preferentially catalyzes the reaction of either enantiomer when a product is produced from a substrate. .

  Isolation and purification of halohydrin epoxidase from the culture can be performed by hydrophobic chromatography (eg, butyl Toyopearl), anion chromatography (eg, MonoQ column), SDS polyacrylamide gel electrophoresis, etc. alone or in appropriate combination. By using it, halohydrin epoxidase can be isolated and purified from the culture. The isolated halohydrin epoxidase can be retained on a suitable carrier and used as an immobilized enzyme in the same manner as the above-described cells or cells.

  The halohydrin epoxidase-containing solution produced as described above or the halohydrin epoxidase contained therein can be used as an enzyme catalyst for substance production. That is, it can use for the conversion reaction shown to (1)-(3) below.

(1) Conversion of 1,3-dihalo-2-propanol to epihalohydrin This conversion reaction includes 1,3-dihalo-2-propanol or a halohydrin epoxidase-containing solution prepared as described above or contained therein. By contacting with halohydrin epoxidase. 1,3-dihalo-2-propanol as a substrate is a compound represented by the formula (1). As the halogen atom, fluorine, chlorine, bromine and iodine are preferable, and chlorine and bromine are particularly preferable. Specific examples include 1,3-difluoro-2-propanol, 1,3-dichloro-2-propanol, 1,3-dibromo-2-propanol, 1,3-diiodo-2-propanol, and preferably 1,3-dichloro-2-propanol and 1,3-dibromo-2-propanol.

  The substrate concentration in the conversion reaction solution is preferably 0.01 to 15 (W / V)%. Within this range, it is preferable from the viewpoint of enzyme stability, and 0.01 to 10% is particularly preferable. The substrate can be added to the reaction solution all at once or in divided portions. It is desirable from the viewpoint of accumulation to make the substrate concentration constant by divided addition.

  As a solvent for the reaction solution, water or a buffer solution having an enzyme activity near the optimum pH of 4 to 10 is preferable. As the buffer solution, for example, a buffer solution composed of a salt such as phosphoric acid, boric acid, citric acid, glutaric acid, malic acid, malonic acid, o-phthalic acid, succinic acid or acetic acid, Tris buffer or Good A buffer solution or the like is preferable.

  The reaction temperature is preferably 5 to 50 ° C. and the reaction pH is preferably 4 to 10. The reaction temperature is more preferably 10 to 40 ° C. The reaction pH is more preferably pH 6-9. The reaction time is selected as appropriate depending on the concentration of the substrate, etc., the bacterial cell concentration, or other reaction conditions, but it is preferable to set the conditions so that the reaction is completed in 1 to 120 hours. In this reaction, the optical purity can be further improved by removing chlorine ions generated as the reaction proceeds from the reaction system. This removal of chlorine ions is preferably performed by adding silver nitrate or the like.

  Epihalohydrin produced and accumulated in the reaction solution can be collected and purified using a known method. For example, an epihalohydrin syrup can be obtained by performing extraction with a solvent such as ethyl acetate and removing the solvent under reduced pressure. Further, these syrups can be further purified by distillation under reduced pressure.

(2) Conversion of 1,3-dihalo-2-propanol to 4-halo-3-hydroxybutyronitrile This conversion reaction was carried out by converting 1,3-dihalo-2-propanol into the halo produced as described above. It is performed by contacting with a hydrin epoxidase-containing solution or a halohydrin epoxidase contained therein. 1,3-dihalo-2-propanol as a substrate is a compound represented by the formula (1). 1,3-dichloro-2-propanol, 1,3-dibromo-2-propanol, and the like are preferable.

In addition, as the cyanide compound, a compound that generates cyanide ion (CN ⁻ ) or hydrogen cyanide or a solution thereof when added to a reaction solution such as hydrogen cyanide, potassium cyanide, sodium cyanide, cyanic acid, or acetone cyanohydrin is used. it can. The substrate concentration in the reaction solution is preferably 0.01 to 15 (W / V)%, particularly preferably 0.01 to 10% from the viewpoint of enzyme stability. Moreover, the usage-amount of a cyanide compound has the preferable 1-3 times amount (mol) of a substrate from a viewpoint of enzyme stability.

  The reaction conditions can be the same as in (1) above. The 4-halo-3-hydroxybutyronitrile produced and accumulated in the reaction solution can be collected and purified using a known method. For example, after removing cells from the reaction solution using a method such as centrifugation, extraction with a solvent such as ethyl acetate is performed, and the solvent is removed under reduced pressure to remove 4-halo-3-hydroxybutyronitrile. You can get syrup. Further, these syrups can be further purified by distillation under reduced pressure.

(3) Conversion of epihalohydrin to 4-halo-3-hydroxybutyronitrile This conversion reaction is carried out by reacting epihalohydrin with a halohydrin epoxidase-containing solution prepared as described above or a halohydrin epoxidase contained therein. This is done by contact. Epihalohydrin as a substrate is a compound represented by the formula (2). As the halogen atom, fluorine, chlorine, bromine and iodine are preferable, and chlorine and bromine are particularly preferable. Specific examples include epifluorohydrin, epichlorohydrin, epibromohydrin, epiiodohydrin, and the like, with epichlorohydrin and epibromohydrin being particularly preferred.

Further, as the cyanide compound, a compound that generates cyanide ion (CN ⁻ ) or hydrogen cyanide or a solution thereof when added to a reaction solution such as hydrogen cyanide, potassium cyanide, sodium cyanide, cyanic acid, or acetone cyanohydrin can be used. Reaction conditions, collection and purification methods can be carried out in the same manner as (2) above.

  Hereinafter, the present invention will be described more specifically with reference to examples.

Production of expression plasmid and transformant A halohydrin epoxidase HheB (Biosci. Biotechnol. Biochem. 58 (8), 1451 (1994)) derived from Corynebacterium sp. Strain N-1074, In the amino acid sequence of HheB (2 ^nd ) translated from the second start codon (SEQ ID NO: 1),
(1) An improved halohydrin epoxidase (hereinafter referred to as “D”) in which the second alanine residue from the N-terminus is replaced with lysine (referred to as A2K) and the 199th aspartic acid residue is replaced with histidine (referred to as D199H). Expression plasmid pSTK002-D199H expressing HheB (2 ^nd ) -D199H, the amino acid sequence of which is represented by SEQ ID NO: 2),
(2) Improved halohydrin epoxy in which the second alanine residue from the N-terminus is replaced with lysine, the 133th threonine residue alanine (referred to as T133A), and the 199th aspartic acid residue is replaced with histidine. Daze (hereinafter, HHEB (2 ^nd) is sometimes referred to as -T133A + D199H, the amino acid sequence represented by SEQ ID NO: 3) expression plasmid pSTK002-T133A + D199H expressing,
(3) The second alanine residue from the N-terminus is lysine, the 133th threonine residue is alanine, the 136th phenylalanine residue is serine (referred to as F136S), the 199th aspartic acid residue is histidine each substituted improved halohydrin epoxidase (hereinafter, sometimes referred to as ^{HheB (2 nd) -T133A + F136S} + D199H, the amino acid sequence represented by SEQ ID NO: 4) expression plasmid pSTK002-T133A expressing + F136S + D199H,
Were prepared as follows. PKK233-2 (Centraalbureau voor Schimmelcultures (CBS), Netherlands; http://www.cbs.knaw.nl/) was used as an expression vector, and Escherichia coli W3110 was used as a host.

First, D199H site-specific mutation was introduced using expression plasmid pSTK002 as a template and primers MDH-09 and MDH-10. Plasmid pSK002 was prepared as follows. First, an expression plasmid (expression vector) that expresses an improved halohydrin epoxidase in which the amino acid residue downstream of the amino acid residue encoded by the translation initiation codon (second amino acid residue) is replaced with lysine pKK233-2) was prepared as follows.
The halohydrin epoxidase gene hheB (2nd) was amplified by PCR. The composition of the PCR reaction solution (total volume 50 μl) is as shown in Table 1.

プライマーとして用いたオリゴヌクレオチドの配列は以下の通りである。
DH-09：GATCATGAAAAACGGAAGACTGGCAGGCAAGCG（配列番号５：33ヌクレオチドからなり、その配列中に制限酵素BspHI認識部位（TCATGA）およびハロヒドリンエポキシダーゼ遺伝子hheB(2^nd)の翻訳開始コドン以降を有し、２番目のアミノ酸に対応するコドンはAAAでリジンをコードする）
DH-07：CGCCTGCAGGCTACAACGACGACGAGCGCCTG (配列番号６：32ヌクレオチドからなり、その配列中に制限酵素Sse8387I兼PstI認識部位（CCTGCAGG）およびハロヒドリンエポキシダーゼ遺伝子hheB(2^nd)終止コドン下流領域を有する) <Table 1>

The sequence of the oligonucleotide used as a primer is as follows.
DH-09: GATCATGAAAAACGGAAGACTGGCAGGCAAGCG (SEQ ID NO: 5: 33 nucleotides, including the restriction enzyme BspHI recognition site (TCATGA) and the halohydrin epoxidase gene hheB (2 ^nd ) after the translation start codon) The codon corresponding to the amino acid of AAA encodes lysine with AAA)
DH-07: CGCCTGCAGGCTACAACGACGACGAGCGCCTG (SEQ ID NO: 6 consists of 32 nucleotides, and has a restriction enzyme Sse8387I and PstI recognition site (CCTGCAGG) and a halohydrin epoxidase gene hheB (2 ^nd ) stop codon downstream region)

  In addition, pST111 used as a template is described in Japanese Patent Publication No. 5-317066, and E. coli transformant JM109 / pST111 using a recombinant vector containing pST111 is designated as an accession number “FERM P-12065”. It is deposited on March 1, 1991 at the Research Center for Biological Biology.

Each 50 μl of the prepared PCR reaction solution was subjected to the heat cycle treatment shown in Table 2.
<Table 2>

  The PCR reaction solution after the heat cycle treatment was purified by GFX PCR DNA band and GelBand Purification kit (GE Healthcare Bioscience), and then double digested with restriction enzymes BspHI and PstI. After digestion products were separated by agarose gel electrophoresis, a band (about 0.8 kb) containing the full length of the halohydrin epoxidase gene was purified with QIAquick Gel Extraction Kit (QIAGEN). On the other hand, it is a derivative of pKK233-2 (Centraalbureau voor Schimmelcultures (CBS), the Netherlands; http://www.cbs.knaw.nl/) and can be prepared by the method described in WO2006 / 041226. -2 (+ Sse) was digested with restriction enzymes NcoI and PstI and then purified by phenol extraction, chloroform extraction and ethanol precipitation (Molecular Cloning, A Laboratory Manual, 2nd ed. (Cold Spring Harbor Laboratory Press (1989))) . This was mixed with the PCR amplification product containing the full length halohydrin epoxidase gene described above, and then Solution I (DNA Ligation Kit ver. 2 (Takara Bio)) was added to the mixture to make a ligation mixture. The mixture was incubated for 12 hours at 16 ° C. to bind the PCR amplification product and the expression vector pKK233-2 (+ Sse).

  E. coli JM109 strain competent cell prepared in advance (E. coli JM109 strain was inoculated into 1 ml of LB medium (1% bactotryptone, 0.5% bacto yeast extract, 0.5% NaCl) and aerobically treated at 37 ° C for 5 hours. After culturing, add 0.4 ml of the preculture to 40 ml of SOB medium (2% bactotryptone, 0.5% bacto yeast extract, 10 mM NaCl, 2.5 mM KCl, 1 mM MgSO4, 1 mM MgCl2), and incubate at 18 ° C. for 20 hours. The obtained culture was collected by centrifugation (3,700 × g, 10 minutes, 4 ° C.), and then cooled TF solution (20 mM PIPES-KOH (pH 6.0), 200 mM KCl, 10 mM CaCl2, 40 mM MnCl2) 13 ml, left at 0 ° C for 10 minutes, centrifuged again (3,700 xg, 10 minutes, 4 ° C) to remove the supernatant, and the resulting E. coli cells were suspended in 3.2 ml of cold TF solution. Add 0.22 ml of dimethyl sulfoxide, leave it at 0 ° C for 10 minutes, and store it at -80 ° C using liquid nitrogen. For example, it was allowed to stand for 30 minutes at 0 ℃. Subsequently, the competent cell was subjected to heat shock at 42 ° C. for 30 seconds and cooled at 0 ° C. for 2 minutes. After that, 1 ml of SOC medium (20 mM glucose, 2% bactotryptone, 0.5% bacto yeast extract, 10 mM NaCl, 2.5 mM KCl, 1 mM MgSO4, 1 mM MgCl2) was added and cultured with shaking at 37 ° C. for 1 hour. . After culture, 200 μl of the culture solution was applied to an LB Amp agar medium (LB medium containing ampicillin 100 mg / L, 1.5% agar) and cultured at 37 ° C. overnight. A plurality of transformant colonies grown on an agar medium were cultured overnight at 37 ° C. in 1.5 ml of LB Amp medium (LB medium containing ampicillin 100 mg / L). After collecting each of the obtained culture broths, the recombinant plasmid was recovered using Flexi Prep (GE Healthcare Bioscience). Using a capillary DNA sequencer CEQ2000 (Beckman Coulter), the base sequence of the PCR amplification product cloned in the plasmid was analyzed according to the attached manual, and it was confirmed that no error mutation occurred in the PCR reaction. The plasmid in which the DNA fragment derived from PCR amplification was cloned was named pSTK002, and the E. coli JM109 strain transformant containing the plasmid was named JM109 / pSTK002.

The characteristics of the plasmid (pSTK002) are as follows.
pSTK002: An improved halohydrin epoxidase gene encoding an improved halohydrin epoxidase HheB (2nd) in which the second amino acid residue (alanine residue) is replaced by lysine is present on the expression vector pKK233-2 It has been cloned.

  Next, the following were prepared as primers for causing each amino acid residue substitution of T133A, F136S and D199H.

MDH-09: CGACTGCCCGAGAGCACGCGCTGCTCGCG (SEQ ID NO: 7: codon encoding the 199th aspartic acid residue of halohydrin epoxidase HheB (2 ^nd ) consisting of 29 nucleotides and consisting of the amino acid sequence shown in SEQ ID NO: 1 ) Is a sense primer that has been changed to a codon encoding histidine (CAC))

MDH-10: CGCGAGCAGCGCGTGCTCTCGGGCAGTCG (SEQ ID NO: 8: antisense primer consisting of 29 nucleotides and having a complementary sequence of MDH-09)

· MDH-05: CGCTGGCCTACAGCGCGGCGCGTTTCGCT (SEQ ID consists 9:29 nucleotides, codons encoding the 133 th threonine residue of SEQ ID NO: 1 halohydrin epoxidase consisting of the amino acid sequence shown in HheB (2 ^nd) (ACG) Sense primer in which is changed to a codon encoding alanine (GCG)

MDH-06: AGCGAAACGCGCCGCGCTGTAGGCCAGCG (SEQ ID NO: 10: antisense primer consisting of 29 nucleotides and having a complementary sequence of MDH-06)

· MDH-28: CGCTGGCCTACAGCGCGGCGCGTTCCGCT (SEQ ID consists 11:29 nucleotides, codons encoding the 133 th threonine residue of SEQ ID NO: 1 halohydrin epoxidase consisting of the amino acid sequence shown in HheB (2 ^nd) (ACG) A sense primer in which is changed to a codon that encodes alanine (GCG) and a codon that encodes the 136th phenylalanine residue (TTC) to a codon that encodes serine (TCC)

MDH-29: AGCGGAACGCGCCGCGCTGTAGGCCAGCG (SEQ ID NO: 12: antisense primer consisting of 29 nucleotides and having a complementary sequence of MDH-28)

  Site-directed mutagenesis was performed using the QuickChange Site-Directed Mutagenesis Kit (STRATAGENE). The composition of the reaction solution (total amount 50 ul) was as shown in Table 3.

上記組成の各反応液について、表４の熱サイクル処理を行った。 <Table 3>

About each reaction liquid of the said composition, the thermal cycle process of Table 4 was performed.

添付のマニュアルに従い、熱サイクル処理を行った各反応液にDpnIを1ul添加し、37℃で１時間インキュベートした。 <Table 4>

In accordance with the attached manual, 1 ul of DpnI was added to each reaction solution subjected to the heat cycle treatment and incubated at 37 ° C. for 1 hour.

E. coli W3110 strain competent cell is inoculated E. coli W3110 strain in 1 ml of LB medium (1% bactotryptone, 0.5% bacto yeast extract, 0.5% NaCl) and pre-aerobically aerobically cultured at 37 ° C for 5 hours. 0.4 ml of the preculture was added to 40 ml of SOB medium (2% bactotryptone, 0.5% bacto yeast extract, 10 mM NaCl, 2.5 mM KCl, 1 mM MgSO ₄ , 1 mM MgCl ₂ ) and cultured at 18 ° C for 20 hours. The collected culture was collected by centrifugation (3,700 × g, 10 minutes, 4 ° C.), and then cooled with TF solution (20 mM PIPES-KOH (pH 6.0), 200 mM KCl, 10 mM CaCl2, 40 mM MnCl2). Add 10 ml, leave at 0 ° C for 10 minutes, centrifuge again (3,700 xg, 10 minutes, 4 ° C) to remove the supernatant, suspend the resulting Escherichia coli cells in 3.2 ml of cold TF solution, 0.22 ml Of dimethyl sulfoxide was added and allowed to stand at 0 ° C. for 10 minutes, and then stored at −80 ° C. using liquid nitrogen.

  To 200 ul of a solution obtained by melting the E. coli W3110 strain competent cell, the solution was added to the DpnI treatment solution and allowed to stand at 0 ° C. for 30 minutes. Subsequently, a heat shock was applied at 42 ° C. for 30 seconds, and the mixture was cooled at 0 ° C. for 2 minutes. Then, 1 ml of SOC medium (20 mM glucose, 2% bactotryptone, 0.5% bacto yeast extract, 10 mM NaCl, 2.5 mM KCl, 1 mM MgSO4, 1 mM MgCl2) was added, and cultured with shaking at 37 ° C. for 1 hour. . 200 ul of each culture solution after the culture was applied to LB Amp agar medium (LB medium containing ampicillin 100 mg / L, 1.5% agar) and cultured overnight at 37 ° C. A plurality of transformant colonies grown on an agar medium were cultured overnight at 37 ° C. in 1.5 ml of LB Amp medium (LB medium containing ampicillin 100 mg / L). After collecting each of the obtained culture broths, the recombinant plasmid was recovered using Flexi Prep (GE Healthcare Bioscience).

Using a capillary DNA sequencer CEQ2000 (Beckman Coulter), the nucleotide sequence was analyzed, the D199H site-directed mutagenesis to HHEB (2 ^nd) gene was confirmed that it is introduced according to the attached manual. The plasmid, the Escherichia coli W3110 strain transformant containing the plasmid, and the halohydrin epoxidase protein produced by the transformant were named pSTK002-D199H, W3110 / pSTK002-D199H and HheB (2 ^nd ) -D199H, respectively. .

Subsequently, T133A site-specific mutation was introduced. Except for using pSTK002-D199H as a template, MDH-05 as a sense primer, and MDH-06 as an antisense primer, as in the case of the D199H site-specific mutation described above, site-directed mutagenesis, Escherichia coli W3110 strain Transformation, plasmid extraction and sequence confirmation were performed. The resulting plasmid, halohydrin epoxidase is produced by strain W3110 transformants and transformants E. coli containing the plasmid protein respectively pSTK002-T133A + D199H, W3110 / pSTK002-T133A + D199H and HHEB (2 ^nd ) -T133A + D199H.

In addition, F136S site-specific mutation was introduced. PSTK002-T133A + D199H as a template, MDH-28 as a sense primer, and MDH-29 as an antisense primer, except that site-directed mutagenesis, E. coli W3110 strain transformation, plasmid extraction and sequence confirmation were performed. The obtained plasmid, the Escherichia coli W3110 strain transformant containing the plasmid, and the halohydrin epoxidase protein produced by the transformant were pSTK002-T133A + F136S + D199H, W3110 / pSTK002-T133A + F136S + D199H and HheB was named ^{(2 nd) -T133A + F136S +} D199H.

Cultivation of cells and preparation of cell lysate The E. coli transformants W3110 / pSTK002-T133A + D199H and W3110 / pSTK002-T133A + F136S + D199H obtained in Example 1 were cultured as follows.

  Colonies of W3110 / pSTK002-T133A + D199H and W3110 / pSTK002-T133A + F136S + D199H were prepared in a 100 ml preculture medium (polypeptone N 20 g / L, yeast extract 5 g / L, dihydrogen phosphate, respectively, in a 500 ml flask. Potassium 1.5 g / L, ampicillin sodium 0.1 g / L; pH 7.2) was inoculated, and cultured with shaking at a temperature of 37 ° C. and a rotation speed of 210 rpm for 6 hours. The pre-culture medium is prepared by dissolving the required amounts of each component other than ampicillin sodium in water and making up to 100 ml, followed by heat sterilization (121 ° C, 20 minutes), cooling to room temperature, and filtering through a 0.45 μm filter in advance. It was prepared by adding 100 ul of ampicillin sodium aqueous solution (100 g / L) that had been sterilized under aseptic conditions. 20 ml of each preculture solution obtained was prepared in a 1.6 L main culture initial medium (fructose 40 g / L, polypeptone N 20 g / L, yeast extract 5 g / L, dipotassium hydrogen phosphate 1.5 g prepared in a 3 L jar fermenter. / L, magnesium sulfate heptahydrate 2.375 g / L, manganese sulfate pentahydrate 0.2 g / L, calcium chloride dihydrate 0.02 g / L, zinc sulfate heptahydrate 0.02 g / L, ampicillin sodium 0.1 g / L, Pluronic L-61 (ADEKA, Japan) 0.5g / L), inoculate two each, temperature 37 ° C, rotation speed 750rpm, air flow 2L / min, normal pressure, pH6 Culture was carried out under the control of .8-7.2 (using 25% aqueous sodium hydroxide and 24% aqueous sulfuric acid). The primary culture medium was prepared by dissolving the required amount of fructose in water and making up to 400 ml, then heat sterilizing (121 ° C, 20 minutes), and the required amounts of each component other than fructose and ampicillin sodium in water. The solution was sterilized by heating (121 ° C, 20 minutes) after being diluted to 1.2 L under aseptic conditions. After cooling to room temperature, ampicillin sodium aqueous solution (filtered and sterilized with a 0.45 μm filter in advance) 100 g / L) was added to prepare 1.6 ml. Main culture fed-batch medium (fructose 300 g / L, polypeptone N 187.5 g / L, ampicillin sodium 0.3 g / L, pluronic L-61 1.25 g / L) at a constant rate of about 15 ml / hr from about 16 hours after the start of culture The addition of was started. The main culture fed-batch medium was prepared by dissolving the necessary amounts of each component other than ampicillin sodium in water and making up to the above concentration, then heating to a temperature of about 50 ° C., and separately preliminarily heat-sterilized 0.45. Perform pressure filtration (0.2 MPa) under aseptic conditions using a filter made of μm mixed cellulose (Advantech Co., Ltd., Japan) and a pressure filter, cool to room temperature, and filter sterilize with a 0.45 μm filter in advance. An ampicillin sodium aqueous solution (100 g / L) was added to a final concentration of 0.3 g / L. During the culture, the culture was performed for about 71 hours while sampling timely. The dissolved oxygen concentration in the culture decreased to around 1 ppm and recovered to around 7 ppm after about 10 hours from the start of the culture. It decreased again after adding the fed-batch medium, and most of the time zone shifted between 1 ppm and 5 ppm. After completion of the culture, the cells were collected and washed. For W3110 / pSTK002-T133A + D199H, take 3076g (OD630 = 111) from the mixture of two jar fermenter cultures, centrifuge at 12,000rpm (141,000G) for 10 minutes, and wet cells 370g Got. 1625 g of water was added to the wet cells and resuspended uniformly to obtain a cell suspension (OD630 = 161). The obtained cell suspension was cooled to about 10 ° C., and then crushed at about 100 MPa using a high-pressure homogenizer PA2K (NiroSoavi, Italy). After cooling to about 10 ° C. again, crushing was performed again at about 100 MPa to obtain a cell disruption solution (cell disruption solution). For W3110 / pSTK002-T133A + F136S + D199H, take 1821g (OD630 = 154) from one jar fermenter culture and centrifuge at 12,000rpm (141,000G) for 10 minutes to obtain 367g wet cells. Got. 1305 g of water was added to the wet cells and resuspended uniformly to obtain a cell suspension (OD630 = 155). The obtained cell suspension was cooled to about 10 ° C., and then crushed at about 100 MPa using a high-pressure homogenizer PA2K (NiroSoavi, Italy). After cooling again to about 10 ° C., crushing was performed again at about 100 MPa to obtain a cell disruption solution (cell disruption solution; OD630 = 8.3, pH 6.8).

Efficient removal of cell debris by centrifugation from a cell lysate added with amphoteric surfactant Prepare 6 series of 1 ml of W3110 / pSTK002-T133A + F136S + D199H-derived cell lysate obtained in Example 2 In series, water 0.1ml (control), alkyldiaminoethylglycine hydrochloride (10% solution) 0.1ml, cationic flocculant K-403B (10% solution) 0.1ml, cationic flocculant K-408 (10% Solution) 0.1 ml, cationic flocculant K-409 (10% solution) 0.1 ml and cationic flocculant K-415 (10% solution) 0.1 ml were added. K-403B, K-408, K-409, and K-415 are cationic polymer flocculants and were obtained from Dianitics (Japan). After suspension, the mixture was allowed to stand at room temperature for 20 minutes, and then centrifuged at 4,500 rpm for 1 minute. The absorbance and dechlorinating activity of the obtained supernatants were measured, and the relative activity of each series of liquid activity was calculated (the liquid activity value of the series to which water was added was taken as 100%). The absorbance was measured by diluting the sample as appropriate and measuring at a wavelength of 630 nm. The dechlorination activity was measured as follows.

  100 ml of a reaction solution for activity measurement (50 mM DCP, 50 mM Tris-sulfuric acid (pH 8)) was prepared, and the temperature was adjusted to 20 ° C. The diluted crude enzyme solution derived from each transformant was added to the reaction solution to start the reaction. The decrease in pH accompanying the release of chloride ions due to the halohydrin epoxidase activity was continuously adjusted to maintain the pH at 8 using a 0.01 N aqueous sodium hydroxide solution using an automatic pH controller. From the amount of 0.01N aqueous sodium hydroxide solution added to maintain the pH at 8 during the 10-minute reaction, the amount of chloride ion produced was calculated, and the halohydrin epoxidase activity (dechlorination activity) ( U) was calculated. 1 U was defined to correspond to the amount of enzyme from which 1 μmol chloride ion was desorbed per minute from DCP under the above conditions. . The results are shown in Table 5.

<Table 5>

  The absorbance of the series of centrifugal supernatants to which water was added was 5 or more, and it was confirmed that the cell debris was not sufficiently removed by precipitation. The absorbance of the centrifugal supernatant of the series to which cationic polymer flocculants K-403B, K-408, K-409, and K-415 were added was 0.01 to 0.02, confirming that cell debris was removed by precipitation. However, the activity was greatly reduced, and it was considered that halohydrin epoxidase was inactivated or precipitated with cell debris by the addition of the flocculant. On the other hand, in the series to which alkyldiaminoethylglycine hydrochloride was added, it was confirmed that cell fragments were sufficiently precipitated and removed (absorbance 0.01) while maintaining the activity.

Efficient removal of cell debris by filtration from cell lysate containing amphoteric surfactant (Part 1)
Four series of 30 ml of W3110 / pSTK002-T133A + F136S + D199H-derived cell disruption solution obtained in Example 2 were prepared. In each series, 3 ml of water and 3 ml of a 7.4% aqueous solution of alkyldiaminoethylglycine hydrochloride (final concentration 0.67% and 3 ml of 8.4% aqueous alkyldiaminoethylglycine hydrochloride (final concentration 0.76%) and 3 ml of 10% aqueous alkyldiaminoethylglycine hydrochloride (final concentration 0.91%) were added. After each stirring for about 10 minutes, 3 g of Radiolite Clear Flow (Showa Chemical Industry Co., Ltd., Japan) was added, and the mixture was further stirred for about 5 minutes. Using a No. 5A filter paper (Advantech Co., Ltd., Japan) with a filtration area of approximately 12 cm2, pre-coated with 1 g of Radiolite Clear Flow, and a pressure filter (Advantech Co., Ltd., Japan) at a pressure of 0.2 MPa The filtrate was subjected to pressure filtration, and the amount of the filtrate obtained after 20 minutes and the halohydrin epoxidase activity (dechlorination activity) of the filtrate were measured. The results are shown in Table 6.

<Table 6>

  Compared to the sample without addition of alkyldiaminoethylglycine hydrochloride (0w / v%), the sample with addition of alkyldiaminoethylglycine hydrochloride has improved filterability depending on its concentration, and more filtrate is obtained over a period of time. It was confirmed that In addition, it was confirmed that the activity was maintained without decreasing as compared with the cell disruption solution.

Efficient removal of cell debris by filtration from cell lysate containing amphoteric surfactant (Part 2)
Two series of 470 ml (series 1) and 467 ml (series 2) were prepared from the W3110 / pSTK002-T133A + F136S + D199H-derived cell lysate obtained in Example 2, and 10% alkyldiaminoethyl hydrochloride was prepared for each series. 47.4 ml and 46.5 ml of an aqueous glycine solution were added (the final concentration was 0.91%, respectively). After stirring for about 10 minutes each, 47.0g Celite Hyflo Super Cel (World Minerals, USA) is in Series 1, and 46.7g Radiolight Special Flow is in Series 2 (Showa Chemical Industry Co., Ltd., Japan) And stirred for about 5 minutes. No. 5A filter paper (Advantech Co., Ltd., Japan) with a filtration area of about 163cm2 pre-coated with 9g of filter aid (series 1 is Celite Hyflo Super Cel, series 2 is radiolite special flow) and pressure filtration Using an apparatus (Advantech Co., Ltd., Japan), pressure filtration was performed at a pressure of 0.2 MPa. With respect to the obtained filtrates of Series 1 and Series 2 and the cell disruption solution of Example 2 as a target, halohydrin epoxidase activity (dechlorination activity), dry residue concentration, sugar concentration and protein concentration were measured. . The dry residue concentration was determined by drying each sample at 120 ° C. until reaching a constant weight and measuring the mass of the residue. The sugar concentration was determined by adding 0.5 ml of 5 w / w% phenol solution to 0.5 ml of sample solution diluted 100-fold with water according to the principle of the phenol-sulfuric acid method, adding 2.5 ml of concentrated sulfuric acid, and allowing to stand at room temperature for 1 hour. After cooling, the absorbance was measured by measuring the absorbance at a wavelength of 490 nm (calculating the sugar concentration of the sample from a calibration curve obtained using a glucose solution having a known concentration). The protein concentration was determined using a Bio-Rad protein assay (Bio-Rad, USA) according to the attached protocol. The results are shown in Table 7.

<Table 7>

  Compared to cell lysate, the filtrates of Series 1 and Series 2, which were filtered by adding alkyldiaminoethylglycine hydrochloride, had lower dry residue concentration, sugar concentration, and protein concentration while retaining dechlorination activity. It was recognized that In other words, it was confirmed that the dry residue and sugar that are thought to contain cell debris were efficiently removed by filtration with addition of alkyldiaminoethylglycine hydrochloride.

Efficient removal of cell debris by filtration from cell lysate containing amphoteric surfactant (Part 3)
1845 ml was taken from the W3110 / pSTK002-T133A + D199H-derived cell disruption solution obtained in Example 2, and 185 ml of a 10% aqueous solution of alkyldiaminoethylglycine hydrochloride was added (the final concentration was 0.91%). After stirring for about 30 minutes, 185 g of Celite Hyflo Super Cel (World Minerals, USA) was added and further stirred for about 15 minutes. No. 5A filter paper (Advantech Co., Ltd., Japan) with a filtration area of about 163cm2 pre-coated with 9g of filter aid (series 1 is Celite Hyflo Super Cel, series 2 is radiolite special flow) and pressure filtration Using a vacuum vessel (Advantech Co., Ltd., Japan), pressure filtration was performed at a pressure of 0.2 MPa to obtain 1623 ml of filtrate (= “filtrate”). Subsequently, 186 g of water was put into a pressure filter in which a filter cake remained, and pressure filtration was performed again at a pressure of 0.2 MPa to obtain 173 ml of a cleaning solution (= “water cleaning solution 1”). Further, 186 g of water was put into a pressure filter in which a filter cake remained, and pressure filtration was performed again at a pressure of 0.2 MPa to obtain 163 ml of a cleaning solution (= “water cleaning solution 2”). A trace amount was collected from the filtrate, water washing liquid 1 and water washing liquid 2, and the remaining filtrate, water washing liquid 1 and water washing liquid 2 were mixed to obtain 1937 ml of mixed filtrate. Cell disruption fluid, filtrate, water washing solution 1, water washing solution 2 and mixed filtrate were measured for halohydrin epoxidase activity (dechlorination activity), and the liquid activity value and total activity value (liquid activity value and liquid volume (Represented by the product). The results are shown in Table 8.

<Table 8>

  It was confirmed that by washing the filter cake with water, the activity remaining in the cake can be recovered, and finally less than 90% of the total activity of the cell lysate can be recovered.

4-Halo-3-hydroxy from 1,3-dihalo-2-propanol and cyanide using a halohydrin epoxidase-containing solution obtained by adding amphoteric surfactant to remove cell debris Production of butyronitrile W3110 / pSTK002-T133A + F136S + D199H cell lysate obtained in Example 2 (= “cell lysate”) and series 1 derived from the cell lysate obtained in Example 5 The filtrate (referred to as “filtrate”) was brought into contact with 1,3-dichloro-2-propanol (DCP) in the presence of potassium cyanide (KCN) to give 4-chloro-3-hydroxybutyronitrile ( CHBN) was prepared as follows. The basic composition of the reaction solution was as shown in Table 9, and the reaction scale was 2 ml.

<Table 9>

  The reaction was carried out at 20 ° C. for 3 hours. After completion of the reaction, the concentrations of DCP, ECH and CHBN in the reaction solution and the optical purity of the produced R-CHBN were analyzed under the analysis conditions shown below.

<Concentration analysis of DCP, ECH and CHBN in reaction solution>
Analysis of DCP, ECH, and CHBN concentrations in the reaction solution was performed by reverse phase HPLC. The reverse phase HPLC analysis conditions are shown in Table 10.

<Table 10>

  100 μl of the reaction completion solution was diluted and mixed with 400 μl of the moving bed described in the above table, and then analyzed under the analysis conditions described in the above table. A calibration curve was prepared in advance using DCP, ECH, and CHBN solutions with known concentrations, and the concentrations of DCP, ECH, and CHBN in the reaction solution were determined using the calibration curve.

<Optical purity analysis of produced CHBN>
The optical purity analysis of the produced CHBN was performed by normal phase HPLC after esterification of CHBN. Normal phase HPLC analysis conditions are shown in Table 11.

<Table 11>

  Extraction was carried out by adding an equal amount of diisopropyl ether (hereinafter sometimes referred to as IPE) to about 400 μl of the reaction completion solution. The IPE layer was separated, and a small amount of anhydrous sodium sulfate was added and stirred. 100 μl of the IPE layer was collected, and 10 μl of (R) -α-methoxy-α- (trifluoromethyl) phenylacetyl chloride (hereinafter sometimes referred to as (R) -MTPA) and 40 μl of pyridine were added. After reacting overnight at room temperature, IPE was added to make about 400 μl. Extraction was performed twice by adding 400 μl of 1N hydrochloric acid, and then 400 μl of saturated aqueous sodium hydrogen carbonate solution was added to the separated IPE layer, and extraction was performed twice. A small amount of anhydrous sodium sulfate was added to the separated IPE layer and stirred, and then the IPE layer was volatilized by an aspirator. The residue was suspended in the moving bed described in the above table, and then analyzed under the analysis conditions described in the above table. Each concentration was calculated from the area area ratio of (R) -CHBN- (R) -MTPA ester and (S) -CHBN- (R) -MTPA ester, and the optical purity of CHBN was calculated. The results are shown in Table 12.

<Table 12>

  Even when the filtrate was used, it was confirmed that a reaction result comparable to that obtained when the cell disruption solution was used was obtained.

Measurement of particle size of cell debris before and after addition of amphoteric surfactant The jar fermenter culture of Escherichia coli W3110 was carried out by the method of Example 2. The obtained culture solution was centrifuged at 12,000 rpm (141,000 G) for 10 minutes, and the supernatant was removed to obtain wet cells. The same amount of water as the removed supernatant was added to the wet cells and resuspended to be uniform to obtain a cell suspension (OD630 = about 150). The obtained cell suspension was cooled to about 10 ° C., and then crushed at about 100 MPa using a high-pressure homogenizer PA2K (NiroSoavi, Italy). After cooling to about 10 ° C. again, crushing was performed again at about 100 MPa to obtain a cell disruption solution (cell disruption solution). Take a part of the cell disruption solution, add alkyldiaminoethylglycine hydrochloride to a final concentration of 0.91 w / v%, and stir at room temperature for 30 minutes to obtain a cell disruption solution (added with amphoteric surfactant ) ”. About the obtained cell lysate and cell lysate (added with amphoteric surfactant), the particle size distribution was measured by the electric resistance method using Multisizer3 (Beckman Coulter, USA) under the following conditions.

Aperture diameter: 30, 50μm
Dispersant: 0.1% sodium hexametaphosphate ultrasonic wave: 3 minutes Samples were measured with ISOTON II (Beckman Coulter, USA) after quantitative dilution to obtain an appropriate concentration of Multisizer 3. The results are shown in Table 13.

<Table 13>

  It was confirmed that by adding alkyldiaminoethylglycine hydrochloride, the average diameter and median diameter of the cell fragments increased from less than 1 μm to 2 μm or more.

SEQ ID NOs: 2-4: Mutant peptides SEQ ID NOs: 5-12: Synthetic DNA

Claims (1)

The manufacturing method of the halohydrin epoxidase containing solution including the process of (A)-(D) below.
(A) Step of culturing cells (B) Step of crushing the cells obtained in step (A) to prepare a cell disruption solution containing halohydrin epoxidase and cell fragments (C) Step (B) Step (D) Addition of alkyldiaminoethylglycine or a salt thereof to the cell disruption solution containing the halohydrin epoxidase and cell fragments obtained in step (D) Alkyldiaminoethylglycine or a salt thereof obtained in step (C) Of removing cell debris from the cell disruption solution added with