JP2007043910A - Improved nitrile hydratase - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To obtain a protein having nitrile hydratase activity with further improved heat resistance and/or amide compound resistance by improving a wild type nitrile hydratase. <P>SOLUTION: The protein is a protein (A) containing an amino acid sequence in which a specific amino acid residue is replaced with another amino acid residue in an amino acid sequence of a wild type nitrile hydratase and having nitrile hydratase activity or a protein (B) containing an amino acid sequence in which one or a plurality of amino acid residues except the specific amino acid residue are deleted, replaced and/or added in the amino acid sequence of the protein (A) and having nitrile hydratase activity. <P>COPYRIGHT: (C)2007,JPO&INPIT

Description

  The present invention relates to an improved (mutant) nitrile hydratase and a method for producing the same. Furthermore, the present invention relates to a gene DNA encoding the enzyme, a recombinant vector containing the gene DNA, a transformant or transductant having the recombinant vector, and a method for producing an amide compound.

  In recent years, nitrile hydratase, an enzyme having nitrile hydration activity that hydrates nitrile groups and converts them into amide groups, was discovered, and corresponding amides from nitrile compounds using the enzyme or microbial cells containing the enzyme. A method for producing the compound is disclosed. This production method is known to have a higher conversion rate and selectivity from a nitrile compound to a corresponding amide compound than conventional chemical synthesis methods.

  Examples of microorganisms that produce nitrile hydratase include, for example, the genus Corynebacterium, the genus Pseudomonas, the genus Rhodococcus, the genus Rhizobium, the genus Klebsiella, and the pseudonocardia. Examples include microorganisms belonging to genera and the like. Among them, Rhodococcus rhodochrous J1 strain has been used for industrial production of acrylamide and has proved its usefulness. Moreover, the gene which codes the nitrile hydratase which the strain produces is also clear (refer patent document 1). Furthermore, the acquisition of an enzyme with improved heat resistance has been desired to be developed from the viewpoint of reducing the amount of enzyme during the reaction and reducing the cost.

  On the other hand, not only using nitrile hydratase and its gene isolated from microorganisms that exist in nature, but also against nitrile hydratase, activity, substrate specificity, Vmax, Km, thermal stability, substrate stability, Attempts have been made to introduce mutations into nitrile hydratase for the purpose of changing the stability of the product (see Patent Documents 2 and 3).

However, there are few specific examples in which heat resistance or amide compound resistance is improved by introducing a mutation into a specific amino acid residue in the amino acid sequence of wild-type nitrile hydratase. There is no known example of improving both tolerances. Developing these nitrile hydratases with improved heat resistance and / or amide compound resistance and using them in the production of amide compounds is very useful from the viewpoint of production costs such as catalyst costs.
Japanese Patent No. 3162091 Japanese Patent Application No. 2004-156593 International Publication No. 2004/056990 Pamphlet

  Accordingly, an object of the present invention is to provide a protein having nitrile hydratase activity with improved heat resistance and / or amide compound resistance by improving wild-type nitrile hydratase, and further, gene DNA encoding the protein, Recombinant vector containing the gene DNA, transformant or transductant containing the recombinant vector, nitrile hydratase collected from a culture of the transformant or transductant, a method for producing the same, and the culture Another object is to provide a method for producing an amide compound using a processed product of the culture.

  That is, the present invention is as follows.

(1) The following protein (A) or (B).
(A) In the amino acid sequence of wild-type nitrile hydratase, the amino acid residue of (a) below and the amino acid residue of (b) and / or (c) below are substituted with other amino acid residues And a protein characterized by having nitrile hydratase activity (a) The most upstream C residue of the amino acid sequence C (S / T) LCSC constituting the prosthetic molecule binding region in the amino acid sequence of the α subunit Amino acid residue 60 residues upstream (b) Amino acid residue 17 residues downstream of the most downstream C residue of the amino acid sequence C (S / T) LCSC (c) The amino acid sequence C (S / T) ) Amino acid residue 40 residues downstream of the most downstream C residue of LCSC (B) In the amino acid sequence of the protein of (A), except for the amino acid residue after substitution, one or several amino acid residues A protein comprising an amino acid sequence in which an amino acid residue is deleted, substituted and / or added, and having nitrile hydratase activity
(2) The following protein (A) or (B).
(A) In the amino acid sequence of wild-type nitrile hydratase, the amino acid residue of (a) below and the amino acid residue of (b) and / or (c) below are substituted with other amino acid residues And a protein characterized by having nitrile hydratase activity (a) The most upstream C residue of the amino acid sequence C (S / T) LCSC constituting the prosthetic molecule binding region in the amino acid sequence of the α subunit Amino acid residue 60 residues upstream (b) Amino acid residue 209 residues upstream of the C-terminal amino acid residue in the β subunit amino acid sequence (c) 82 residues upstream of the C-terminal amino acid residue In the amino acid sequence of the protein of (A), one or several amino acid residues are deleted, substituted and / or removed except for the amino acid residue after the substitution. It comprises added amino acid sequence, and characterized by having a nitrile hydratase activity protein
(3) The following protein (A) or (B).
(A) In the amino acid sequence of wild-type nitrile hydratase, the amino acid residue of (a) below and the amino acid residue of (b) and / or (c) below are substituted with other amino acid residues And a protein characterized by having nitrile hydratase activity (a) The most upstream C residue of the amino acid sequence C (S / T) LCSC constituting the prosthetic molecule binding region in the amino acid sequence of the α subunit Amino acid residue 60 residues upstream (b) 95 amino acid residues downstream of the most downstream C residue of the amino acid sequence C (S / T) LCSC (c) The amino acid sequence C (S / T) ) Amino acid residue (B) 93 residues downstream of the most downstream C residue of LCSC In the amino acid sequence of the protein of (A), except for the amino acid residue after substitution, one or several amino acid residues A protein comprising an amino acid sequence in which an amino acid residue is deleted, substituted and / or added, and having nitrile hydratase activity
(4) The following protein (A) or (B).
(A) The amino acid sequence of the wild-type nitrile hydratase includes an amino acid sequence in which the following amino acid residues (a), (b) and (c) are substituted with other amino acid residues, and has nitrile hydratase activity. (A) The amino acid residue 60 residues upstream of the most upstream C residue of the amino acid sequence C (S / T) LCSC that constitutes the prosthetic molecule binding region in the amino acid sequence of the α subunit Group (b) 95 amino acid residues downstream of the most downstream C residue of the amino acid sequence C (S / T) LCSC, and (c) 209 from the amino acid residue at the C terminal in the amino acid sequence of the β subunit. Amino acid residue upstream of residue (B) In the amino acid sequence of the protein of (A), one or several amino acid residues are deleted, substituted and removed except for the amino acid residue after the substitution. / Or include additional amino acid sequences, and protein characterized by having the nitrile hydratase activity
(5) The following protein (A) or (B).
(A) The amino acid sequence of the wild-type nitrile hydratase includes an amino acid sequence in which the following amino acid residues (a), (b) and (c) are substituted with other amino acid residues, and has nitrile hydratase activity. (A) The amino acid residue 60 residues upstream of the most upstream C residue of the amino acid sequence C (S / T) LCSC that constitutes the prosthetic molecule binding region in the amino acid sequence of the α subunit Group (b) amino acid residue 93 residues downstream from the most downstream C residue of the amino acid sequence C (S / T) LCSC; (c) 82 amino acid residues from the C-terminal amino acid residue in the β subunit amino acid sequence; Amino acid residue upstream of residue (B) In the amino acid sequence of the protein of (A), except for the amino acid residue after the substitution, one or several amino acid residues are deleted, substituted and Or include additional amino acid sequences, and protein characterized by having the nitrile hydratase activity
(6) A gene DNA encoding the protein of any one of (1) to (5) above.

 (7) A recombinant vector comprising the gene DNA of (6) above.

 (8) A transformant or transductant comprising the recombinant vector of (7) above.

 (9) A nitrile hydratase collected from a culture obtained by culturing the transformant or transductant of (8) above.

 (10) A method for producing nitrile hydratase, comprising collecting nitrile hydratase from a culture obtained by culturing the transformant or transductant of (8) above.

 (11) A culture obtained by culturing the transformant of (8) above or a treated product of the culture is brought into contact with a nitrile compound, and an amide compound produced by the contact is collected. A method for producing an amide compound.

  According to the present invention, a novel improved (mutant) nitrile hydratase having improved heat resistance and / or amide compound resistance can be provided. Among them, the improved nitrile hydratase with improved heat resistance and amide compound resistance is very useful in the production of amide compounds.

  According to the present invention, the gene DNA encoding the improved nitrile hydratase, the recombinant vector containing the gene DNA, the transformant or transductant containing the recombinant vector, the transformant or transduction A nitrile hydratase collected from a body culture, its production, and a method for producing an amide compound using the culture or a treated product of the culture can be provided.

The present invention is described in detail below.
1. Improved nitrile hydratase (a) Wild type nitrile hydratase The improved nitrile hydratase of the present invention is an improved type (mutant) of wild type nitrile hydratase, and its origin is not particularly limited. Here, “wild-type nitrile hydratase” refers to nitrile hydratase that can be isolated from organisms in the natural world (for example, microorganisms such as soil bacteria), an amino acid sequence constituting the enzyme, and a gene encoding the enzyme Is a nitrile hydratase that has not been artificially deleted, inserted, or substituted with other amino acids or bases, and retains its natural properties. It includes not only nitrile hydratase derived from known microorganisms but also nitrile hydratase derived from unknown organisms.

  The structure of “wild-type nitrile hydratase” has a higher-order structure in which domains of α subunit and β subunit are assembled, and has a non-heme iron atom or a non-choline nuclear cobalt atom as a prosthetic molecule. . These nitrile hydratases are distinguished by the names of iron-type nitrile hydratase and cobalt-type nitrile hydratase, respectively.

  Representative examples of iron-type nitrile hydratase include those derived from Rhodococcus genus N-771. This iron-type nitrile hydratase has been subjected to X-ray crystal structure analysis, and its three-dimensional structure has been clarified. As a result, the enzyme is non-heme iron via four amino acid residues in the cysteine cluster (Cys-Ser-Leu-Cys-Ser-Cys (SEQ ID NO: 26)) of the α subunit that forms the active center. Is combined with.

  Examples of cobalt-type nitrile hydratase include those derived from Rhodococcus rhodochrous J1 strain (hereinafter sometimes referred to as “J1 bacteria”) or those derived from Pseudonocardia thermophila. it can. Cobalt-type nitrile hydratase derived from J1 bacteria has a cobalt atom via a region represented by a cysteine cluster (Cys-Thr-Leu-Cys-Ser-Cys (SEQ ID NO: 27)) of the α subunit forming the active center. Are connected. The cysteine cluster of Pseudonocardia thermophila-derived cobalt-type nitrile hydratase has cysteine sulfinic acid (Csi) as the fourth cysteine from the upstream side of the cysteine cluster derived from J1 bacterium. The sixth cysteine (Cys) on the downstream side is cysteine sulfenic acid (Cse).

As described above, the prosthetic molecule is bound to the region represented by the cysteine cluster “C (S / T) LCSC (SEQ ID NO: 26 or 27 (hereinafter the same))” in the α subunit. Examples of the nitrile hydratase containing such a prosthetic molecule binding region include Rhodococcus rhodochrous J1 (FERM BP-1478), Rhodococcus rhodochrous M8 (SU1731814), Rhodococcus rhodochrous M33 (VKM Ac-1515D), Rhodococcus rhodochrous. Derived from ATCC 39484 (JP 2001-292772), Bacillus smithii (JP 9-248188), Pseudonocardia thermophila (JP 9-275978) or Geobacillus thermoglucosidasius Examples include nitrile hydratase having an amino acid sequence and nitrile hydratase encoded by a gene sequence. The amino acid sequence (single letter code) of the α subunit of wild-type nitrile hydratase derived from various microorganisms including the prosthetic molecule binding region “C (S / T) LCSC” is shown in FIGS. 5-1, 5-2 and 5- Shown in 3. Each amino acid sequence is connected in the order shown in FIGS. 5-1, 5-2 and 5-3 (in each of FIGS. 28-51).
(B) Improved nitrile hydratase The present invention is an improved (mutant) nitrile hydratase obtained by subjecting a wild type nitrile hydratase to amino acid substitution. The amino acid sequence of the wild-type nitrile hydratase to be substituted is published in GenBank. For example, the accession number (Accession No.) of the α subunit (SEQ ID NO: 2, 4) derived from Rhodococcus rhodochrous J1 (FERM BP-1478) is “P21219”, and the β subunit (SEQ ID NO: 1, 3). The accession number is “P21220”. The accession number of the α subunit derived from Rhodococcus rhodochrous M8 (SU1731814) is “ATT79340”, and the accession number of the β subunit is “AAT79339”. Further, the accession number of the α subunit derived from Pseudomonas thermophila JCM3095 is “1IRE_A”, and the accession number of the β subunit is “1IRE_B”.

  In addition, in the amino acid sequence in which a specific amino acid residue is substituted, one or several (for example, about 1 to 10, preferably about 1 to 5) amino acid residues (however, the amino acid after the above substitution) An improved nitrile hydratase having a nitrile hydratase activity consisting of an amino acid sequence deleted, substituted and / or added, and having nitrile hydratase activity is also within the scope of the present invention.

  The “improved nitrile hydratase” in the present invention includes an amino acid residue of the following (a) and at least one amino acid residue selected from the following (b) to (g) in the amino acid sequence of wild-type nitrile hydratase: Include an amino acid sequence substituted with another amino acid residue, and has a nitrile hydratase activity. The amino acid residues (f) and (g) below are amino acid residues in the amino acid sequence of a wild-type nitrile hydratase derived from a bacterium belonging to the species Rhodococcus rhodochrous among various wild-type nitrile hydratases. preferable.

(A) an amino acid residue 60 residues upstream of the most upstream C residue of the amino acid sequence C (S / T) LCSC constituting the prosthetic molecule binding region in the amino acid sequence of the α subunit (b) the amino acid sequence (C) 40 residues downstream of the most downstream C residue of the amino acid sequence C (S / T) LCSC (D) an amino acid residue that is 95 residues downstream of the most downstream C residue of the amino acid sequence C (S / T) LCSC; and (e) a most downstream of the amino acid sequence C (S / T) LCSC. An amino acid residue 93 residues downstream from the C residue on the side (f) an amino acid residue 209 residues upstream of the C-terminal amino acid residue in the amino acid sequence of the β subunit (g) the C-terminal amino acid residue Amino acid 82 residues upstream Residues As the improved nitrile hydratase of the present invention, among the above-mentioned proteins, the amino acid residues (a) and (b) in the amino acid sequence of wild-type nitrile hydratase,
The amino acid residues of (a) and (c) above,
The amino acid residues (a), (b) and (c) above,
The amino acid residues of (a) and (d) above,
The amino acid residues of (a) and (e) above,
(A), (d) and (e) amino acid residues,
Amino acid residues of (a) and (f) above,
Amino acid residues of (a) and (g) above,
Amino acid residues (a), (f) and (g) above,
The amino acid residues of (a), (d) and (f) above, or the amino acid residues of (a), (e) and (g) above are substituted with other amino acid residues, A protein characterized by having nitrile hydratase activity is preferred. As an example, in the amino acid sequence of the α subunit of wild-type nitrile hydratase derived from J1 bacterium, the amino acid sequence C (S / T) LCSC constituting the prosthetic molecule binding region is 60 residues upstream from the most upstream C residue. Amino acid residues (asparagine) in the present invention are substituted with other amino acids, and 17 amino acid residues (glutamic acid) and / or 40 residues downstream from the most downstream C residue of C (S / T) LCSC An enzyme protein containing an amino acid sequence in which a downstream amino acid residue (aspartic acid) is substituted with another amino acid and having nitrile hydratase activity is preferred. Examples of such amino acid substitutions include “Nα ↑ 60D, Eα ↓ 17G, Dα ↓ 40G” and the like. In addition, in the improved nitrile hydratase as an example, the 42nd amino acid residue (asparagine) from the N-terminal side in the amino acid sequence of the α subunit of wild-type nitrile hydratase derived from J1 is replaced with another amino acid. In addition, the 124th amino acid residue (glutamic acid) and / or the 147th amino acid residue (aspartic acid) is substituted with another amino acid, and the enzyme protein has nitrile hydratase activity. I can also say.

  In addition, the alphabetical representation of amino acids can be represented by one ordinary letter, and the alphabet displayed on the left side of the number (for example, “60”) indicating the number of amino acid residues up to the substitution site is the one-letter representation of the amino acid before substitution. The alphabet displayed on the right side indicates the one-letter code of the amino acid after substitution. Specifically, when expressed as “Nα ↑ 60D”, in the base sequence of “α subunit (SEQ ID NO: 2), asparagine (N) that is 60 residues upstream from the most upstream C residue in the CTLCSC region. ) Means an amino acid substitution aspect of the improved nitrile hydratase in which aspartic acid (D) is substituted. Here, the notation “α ↑” means that the substitution position is upstream from the most upstream C residue (excluding the C residue) of CTLCSC, and conversely “α ↓” In the case of the notation, it means that the substitution position is downstream (not including the C residue) from the most downstream C residue in the CTLCSC region.

  In addition, when expressed as “Dβ ← 209G”, the 209th asparagine from the amino acid residue at the C-terminal in the base sequence of the β subunit (SEQ ID NO: 1) (counted including the amino acid residue) "Amino acid substitution mode of improved nitrile hydratase in which acid (D) is substituted with glycine (G)" (amino acids are described in single letter notation. The same applies to other amino acid substitutions) .) For example, in the case of wild-type nitrile hydratase derived from J1 bacterium, the 21st amino acid residue (aspartic acid) from the N-terminal side in the amino acid sequence of the β subunit is the other amino acid residue. It can also be said that it is an embodiment substituted with a group (glycine).

  The aspect of amino acid substitution in the preferable improved nitrile hydratase of the present invention described above can be represented by the following notations 1 to 11.

1. Nα ↑ 60D, Eα ↓ 17G
2. Nα ↑ 60D, Dα ↓ 40G
3. Nα ↑ 60D, Eα ↓ 17G, Dα ↓ 40G
4). Nα ↑ 60D, Dβ ← 209G
5. Nα ↑ 60D, Iα ↓ 95T
6). Nα ↑ 60D, Dβ ← 209G, Iα ↓ 95T
7). Nα ↑ 60D, Iβ ← 82T
8). Nα ↑ 60D, Eα ↓ 93G
9. Nα ↑ 60D, Iβ ← 82T, Eα ↓ 93G
Ten. Nα ↑ 60D, Dβ ← 209G, Iβ ← 82T
11． Nα ↑ 60D, Iα ↓ 95T, Eα ↓ 93G
Among these, the improved nitrile hydratase subjected to amino acid substitution in the above-described aspects 1, 2, 6 and 9 is more preferable, and the improved nitrile hydratase subjected to amino acid substitution in the above-described aspects 1 and 6 is particularly preferable. preferable.

  Preferred examples of the base substitution for causing the amino acid substitution include the following embodiments.

  Nα ↑ 60D: The codon “AAC” located 178 to 180 bases upstream (toward the 5 ′ end) from the first T of the base sequence TGCACTCTGTGTTCGTGC (304 to 321 in SEQ ID NO: 4) is replaced with GAC or GAT. In particular, it is preferable to replace A located 179 bases upstream with G (AAC → GAC).

  Eα ↓ 17G: Codon “GAG” located 49 to 51 bases downstream (3 ′ end direction) from the last C of the base sequence TGCACTCTGTGTTCGTGC (positions 304 to 321 in SEQ ID NO: 4) to GGT, GGC, GGA or GGG Replace. In particular, it is preferable to replace A located 50 bases downstream with G (GAG → GGG).

  Dα ↓ 40G: Codon “GAT” located 118 to 120 bases downstream (toward the 3 ′ end) from the last C of the base sequence TGCACTCTGTGTTCGTGC (positions 304 to 321 in SEQ ID NO: 4) is GGT, GGC, GGA or GGG Replace with. In particular, it is preferable to replace A located downstream of 119 bases with G (GAT → GGT).

  Eα ↓ 93G: The codon “GAA” located 277 to 279 bases downstream (3 ′ end direction) from the last C of the base sequence TGCACTCTGTGTTCGTGC (304 to 321 in SEQ ID NO: 4) is added to GGT, GGC, GGA or GGG Replace with. In particular, it is preferable to replace A located 278 bases downstream with G (GAA → GGA).

  Iα ↓ 95T :: Codon “ATC” located 283 to 285 bases downstream (3 ′ end direction) from the last C of the base sequence TGCACTCTGTGTTCGTGC (positions 304 to 321 in SEQ ID NO: 4), ACT, ACC, ACG or Replace with ACA. In particular, it is preferable to replace T located downstream of 284 bases with C (ATC → ACC).

  Dβ ← 209G: Base sequence GCG (685 to 687th position in SEQ ID NO: 3 (codon of C-terminal amino acid residue of amino acid sequence of SEQ ID NO: 1)) upstream of 622 to 624 bases upstream (to the 5 ′ end) The codon “GAC” located in is replaced with GGC, GGA, GGT or GGG. In particular, it is preferable to replace A located upstream of 623 bases with G (GAC → GGC).

  Iβ ← 82T: 241 to 243 bases upstream (in the 5 ′ end direction) from the first G of the base sequence GCG (the 685th to 687th positions in SEQ ID NO: 3 (codon of the C-terminal amino acid residue of the amino acid sequence of SEQ ID NO: 1)) The codon “ATC” located at is replaced with ACT, ACC, ACG or ACA. In particular, it is preferable to replace T located upstream of 242 bases with C (ATC → ACC).

  For example, the substitution sites of wild-type nitrile hydratase α ↑ 60, α ↓ 17, α ↓ 40, α ↓ 93, and α ↓ 95 are the 42nd position in the α subunit (SEQ ID NO: 2) of J1 bacteria, respectively. , 124th, 147th, 200th and 202nd amino acid residues. Further, the mutation sites of β ← 209 and β ← 82 correspond to the 21st and 148th amino acid residues in the β subunit (SEQ ID NO: 1) of J1 bacterium, respectively.

  The activity of the improved nitrile hydratase of the present invention is improved in heat resistance and / or amide compound resistance with respect to the activity of wild-type nitrile hydratase while retaining the properties derived from nature.

Here, "nitrile hydratase activity", a nitrile compound, the corresponding hydration reaction be converted to amide compound _{(RCN + H 2 O → RCONH} 2) is an enzyme that catalyzes. The activity measurement can be calculated by bringing a nitrile compound as a substrate into contact with nitrile hydratase and converting it to the corresponding amide compound, and then quantifying the amide compound. As the substrate, any nitrile compound can be used as long as it reacts with nitrile hydratase, but acrylonitrile is preferred. As reaction conditions, the substrate concentration is 2.5%, the reaction temperature is 10 ° C to 30 ° C, and the reaction time is 10 minutes to 30 minutes. The enzymatic reaction is stopped by adding phosphoric acid. Thereafter, the amide compound can be quantified by analyzing the produced acrylamide by HPLC.

  “Improving heat resistance” means that the residual activity of the heat-treated mutant strain is 10% or more higher than the residual activity of the parent strain (wild type) subjected to the same treatment. As a method for the heat treatment, after the culture solution or the collected and washed cultured microbial cells are placed in a container, the container is placed in a heating device such as a water bath or an incubator and kept warm for a certain period of time. At this time, a heat treatment may be performed by adding a nitrile compound or an amide compound for enhancing the stability of the enzyme. As the conditions for the heat treatment, it is preferable to appropriately examine the treatment temperature and the treatment time, and to set conditions under which the activity of the parent strain is reduced to 50% or less compared to that before the heat treatment. Specifically, heat treatment is performed in the range of 50 to 70 ° C. for 5 to 30 minutes. Residual activity refers to the ratio between the amount of amide compound produced by activity measurement using heat-treated cells and the amount of amide compound produced by activity measurement using the same amount of untreated cells. As the untreated microbial cells, a culture solution or a cultivated microbial cell that has been collected and washed is kept cold at 4 ° C.

  Further, “amide compound resistance” means that nitrile hydratase activity can be maintained even in the presence of an amide compound. A culture of a transformant having an improved nitrile hydratase or an improved nitrile hydratase isolated from the transformant in the presence of an amide compound such as acrylamide (for example, a high concentration of 30 to 50%) By analyzing the consumption or consumption rate of nitrile compounds such as acrylonitrile, nitrile hydratase whose consumption or consumption rate exceeded 1.1 times compared to the nitrile hydratase derived from the parent strain (wild type) It can be evaluated that the compound is resistant.

Examples of the amide compound include the following general formula (1):
R-CONH ₂ (1)
(Here, R is an optionally substituted linear or branched alkyl or alkenyl group having 1 to 10 carbon atoms, an optionally substituted cycloalkyl group having 3 to 18 carbon atoms, or aryl. Or a saturated or unsaturated heterocyclic group which may be substituted.)
The amide compound represented by these is mentioned. In particular, acrylamide in which R is “CH ₂ ═CH—” is preferred.

  The above-mentioned improved nitrile hydratase is obtained by amino acid substitution of wild-type nitrile hydratase. For example, the amino acid sequence of nitrile hydratase derived from Rhodococcus rhodochrous strain J1 (SEQ ID NOs: 1 and 2) is modified. It can be obtained by selecting a nitrile hydratase with improved heat resistance and / or amide compound resistance. In addition, Rhodococcus rhodochrous J1 strain was established as FERM BP-1478 in the National Institute of Advanced Industrial Science and Technology Patent Biological Deposit Center (1st, 1st East, 1st Street, Tsukuba City, Ibaraki Prefecture, September 6th, 1987). Deposited internationally by date.

  Also in nitrile hydratases other than J1 bacteria, it is considered that the heat resistance and / or amide compound resistance is improved depending on the position of the mutation, the amino acid species to be mutated, and the DNA sequence. As such bacteria, Rhodococcus rhodochrous M8 (SU1731814), Rhodococcus rhodochrous M33 (VKM Ac-1515D) or Rhodococcus rhodochrous ATCC39484 (Japanese Patent Laid-Open No. 2001-292772), Bacillus smithii (specialty) Kaihei 09-248188), Pseudocardia thermophila (JP 09-275978), Geobacillus thermoglucosidasias, and the like. Rhodococcus rhodochrous M33 (VKM Ac-1515D) is a strain selected as a strain that constitutively expresses nitrile hydratase by spontaneous mutation from the M8 strain (SU1731814). There is no mutation in the amino acid sequence and gene sequence of the nitrile hydratase itself (US Pat. No. 5,827,699).

Wild-type nitrile hydratase can be substituted with amino acids by contacting and acting on a microorganism having nitrile hydratase activity with a drug that acts as a mutation source such as hydroxylamine or nitrous acid, by inducing mutation by ultraviolet irradiation, or nitrile An error prone PCR method or the like in which mutations are randomly introduced into a gene encoding hydratase using PCR can be employed.
(B-1) Error prone PCR
One method for studying the function and properties of proteins using mutants is random mutagenesis. The random mutagenesis method is a method for producing a mutant by introducing a random mutation into a gene encoding a specific protein. In random mutagenesis by PCR, base mutation can be introduced (Error prone PCR) by setting conditions with low stringency during DNA amplification. In this error prone PCR, mutations are introduced at arbitrary sites over the entire DNA to be amplified. Then, information on amino acids and domains important for protein-specific functions can be obtained by examining the functions of mutants in which mutations have been introduced at arbitrary sites.

  In the present invention, for example, an amino acid residue 60 residues upstream from the most upstream C residue of C (S / T) LCSC constituting the prosthetic molecule binding region, and the most downstream side of C (S / T) LCSC The improved nitrile hydratase in which the amino acid residue downstream and / or 40 residues downstream from the C residue is substituted has improved heat resistance and / or amide compound resistance than the wild type nitrile hydratase. Show high activity.

  The mutation can be obtained by introducing a random mutation into the wild type nitrile hydratase gene by Error prone PCR. The present invention is an improved nitrile hydratase obtained by the error prone PCR method, wherein the host has higher heat resistance and / or amide compound resistance than wild-type nitrile hydratase and has high nitrile hydratase activity. Is also included.

  As a nitrile hydratase used as a template for Error prone PCR, a nitrile hydratase gene derived from a wild strain, or a DNA amplified by Error prone PCR can be used.

The reaction conditions for Error prone PCR include, for example, a composition in which the mixing ratio of any one, two, or three of dNTP (dGTP, dCTP, dATP, or dTTP) in the reaction solution is reduced compared to other dNTPs. The conditions to do are mentioned. This increases the possibility that other dNTPs will be mistakenly used at sites where dNTPs with a reduced blending ratio are required during DNA synthesis, and mutations are introduced. As other reaction conditions, conditions may be mentioned preferably a composition with an increased MgCl ₂ and / or MnCl ₂ content in the reaction solution.
(B-2) Improved nitrile hydratase derived from Rhodococcus rhodochrous J1 strain and its gene Examples of the improved nitrile hydratase of the present invention include, for example, Rhodococcus An amino acid substitution 60 residues upstream from the most upstream C residue of the C (S / T) LCSC constituting the prosthetic molecule binding region, and the most downstream of the C (S / T) LCSC Also included are those encoded by a gene into which a mutation corresponding to an amino acid substitution 17 residues downstream from the C residue on the side and / or an amino acid substitution 40 residues downstream is introduced.

DNA encoding such an improved nitrile hydratase is based on the wild type nitrile hydratase gene, Molecular Cloning, A Laboratory Manual 2nd ed., Cold Spring Harbor Laboratory Press (1989), Current Protocols in Molecular Biology, John It can be prepared according to the site-specific displacement induction method described in Wiley & Sons (1987-1997) and the like. In order to introduce mutations into DNA, mutation introduction kits using site-directed mutagenesis, such as QuickChange ^TM Site-Directed Mutagenesis Kit (manufactured by Stratagene) using known techniques such as Kunkel method and Gapped duplex method. GeneTailor ^™ Site-Directed Mutagenesis System (manufactured by Invitrogen), TaKaRa Site-Directed Mutagenesis System (Mutan-K, Mutan-Super Express Km, etc .: manufactured by Takara Bio Inc.) and the like.

  The gene of the present invention also includes a DNA that hybridizes with a DNA comprising a base sequence complementary to the base sequence of the gene under stringent conditions and encodes a protein having nitrile hydratase activity. .

  Such an improved nitrile hydratase gene is obtained by a known hybridization method such as colony hybridization, plaque hybridization, Southern blotting, and the like using a cDNA library and a complementary sequence thereof or a fragment thereof as a probe. It can be obtained from a genomic library. A library prepared by a known method can be used, and a commercially available cDNA library and genomic library can also be used.

  “Stringent conditions” are conditions at the time of washing after hybridization, wherein the salt concentration is 300 to 2000 mM, the temperature is 40 to 75 ° C., preferably the salt concentration is 600 to 900 mM, and the temperature is 65 ° C. means. For example, 2 × SSC and conditions such as 50 ° C. can be mentioned. Those skilled in the art can code the nitrile hydratase of the present invention in consideration of other conditions such as the concentration of the probe, the length of the probe, and the reaction time in addition to the conditions such as the salt concentration and temperature of the buffer. Conditions for obtaining the DNA to be obtained can be appropriately set.

  For detailed procedures of the hybridization method, Molecular Cloning, A Laboratory Manual 2nd ed. (Cold Spring Harbor Laboratory Press (1989)) can be referred to. Examples of the DNA that hybridizes include DNA containing a base sequence having at least 40%, preferably 60%, more preferably 90% or more identity to the gene DNA of the present invention, or a partial fragment thereof.

Amino acid that replaces a specific amino acid residue in the amino acid sequence of wild-type nitrile hydratase, for example, the C residue at the most upstream side of C (S / T) LCSC constituting the prosthetic molecule binding region in the α subunit Any amino acid substituting an amino acid residue 60 residues upstream and 17 amino acid residues downstream and / or 40 residues downstream from the most downstream C residue of C (S / T) LCSC The type is not limited as long as the polypeptide (protein) containing the amino acid after substitution has nitrile hydratase activity.
(C) Recombinant vector, transformant The nitrile hydratase gene needs to be incorporated into a vector so that it can be expressed in the host organism to be transformed or transduced. Examples of the vector include plasmid DNA, bacteriophage DNA, retrotransposon DNA, artificial chromosome DNA, and the like.

  In addition, the host used for transduction in the present invention is not particularly limited as long as the target nitrile hydratase can be expressed after the introduction of the recombinant vector. For example, bacteria such as Escherichia coli and Bacillus subtilis, yeast, animal cells, insect cells, plant cells and the like can be used. When Escherichia coli is used as a host, it is preferable to use an expression vector having high expression efficiency, for example, an expression vector pkk233-2 (manufactured by Amersham Bioscience) having a trc promoter or pTrc99A (manufactured by Amersham Bioscience).

  In addition to the nitrile hydratase gene, a promoter, terminator, enhancer, splicing signal, poly A addition signal, selection marker, ribosome binding sequence (SD sequence) and the like can be linked to the vector. Examples of the selection marker include kanamycin resistance gene, dihydrofolate reductase gene, ampicillin resistance gene, neomycin resistance gene and the like.

  When a bacterium is used as a host, for example, Escherichia coli can be mentioned, and examples of Rhodococcus bacteria include Rhodococcus rhodochrous ATCC12674, Rhodococcus rhodochrous ATCC17895, Rhodococcus rhodochrous ATCC19140, and the like. These ATCC strains are available from the American Type Culture Collection.

  The method for introducing a recombinant vector into bacteria is not particularly limited as long as it is a method for introducing DNA into bacteria. Examples thereof include a method using calcium ions and an electroporation method.

  When yeast is used as a host, for example, Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pichia pastoris, and the like are used. The method for introducing a recombinant vector into yeast is not particularly limited as long as it is a method for introducing DNA into yeast, and examples thereof include an electroporation method, a spheroplast method, and a lithium acetate method.

  When animal cells are used as hosts, monkey cells COS-7, Vero, CHO cells, mouse L cells, rat GH3, human FL cells and the like are used. Examples of methods for introducing a recombinant vector into animal cells include an electroporation method, a calcium phosphate method, and a lipofection method.

  When insect cells are used as hosts, Sf9 cells, Sf21 cells and the like are used. As a method for introducing a recombinant vector into insect cells, for example, calcium phosphate method, lipofection method, electroporation method and the like are used.

When plant cells are used as hosts, tobacco BY-2 cells and the like can be mentioned, but are not limited thereto. As a method for introducing a recombinant vector into a plant cell, for example, an Agrobacterium method, a particle gun method, a PEG method, an electroporation method, or the like is used.
(D) Production method of culture and improved nitrile hydratase In the present invention, the improved nitrile hydratase can be produced by culturing the transformant and collecting it from the resulting culture.

  The present invention also includes a method for producing an improved nitrile hydratase, wherein the improved nitrile hydratase is collected from the culture.

  In the present invention, the “culture” means any of culture supernatant, cultured cells, cultured cells, or disrupted cells or cells. The method for culturing the transformant of the present invention is carried out according to a usual method used for culturing a host. The desired improved nitrile hydratase accumulates in the culture.

  The medium for culturing the transformant of the present invention contains a carbon source, a nitrogen source, inorganic salts, and the like that can be assimilated by the host fungus, and any natural medium can be used as long as the transformant can be cultured efficiently. Either a medium or a synthetic medium may be used. Examples of the carbon source include carbohydrates such as glucose, galactose, fructose, sucrose, raffinose and starch, organic acids such as acetic acid and propionic acid, and alcohols such as ethanol and propanol. Examples of the nitrogen source include inorganic acids such as ammonia, ammonium chloride, ammonium sulfate, ammonium acetate, and ammonium phosphate, or ammonium salts of organic acids, and other nitrogen-containing compounds. In addition, peptone, yeast extract, meat extract, corn steep liquor, various amino acids, and the like may be used. Examples of inorganic substances include monopotassium phosphate, dipotassium phosphate, magnesium phosphate, magnesium sulfate, sodium chloride, ferrous sulfate, manganese sulfate, zinc sulfate, copper sulfate, and calcium carbonate. Moreover, you may add an antifoamer in order to prevent foaming during culture | cultivation as needed. Further, cobalt ions and iron ions, which are nitrile hydratase prosthetic molecules, may be added to the medium, and nitriles and amides serving as enzyme inducers may be added.

  During the culture, the vector and the target gene may be cultured under selective pressure in order to prevent the loss of the vector and the target gene. That is, a drug corresponding to the case where the selection marker is a drug resistance gene may be added to the medium, or a nutrient factor corresponding to the case where the selection marker is an auxotrophic complementary gene may be removed from the medium. When the selectable marker is an assimilation gene, a corresponding assimilation factor can be added as a sole factor as necessary. For example, when culturing Escherichia coli transformed with a vector containing an ampicillin resistance gene, ampicillin may be added as needed during the culture.

  When cultivating a transformant transformed with an expression vector using an inducible promoter as a promoter, an inducer may be added to the medium as necessary. For example, when cultivating a transformant transformed with an expression vector having a promoter inducible with isopropyl-β-D-thiogalactoside (IPTG), IPTG or the like can be added to the medium. In addition, when cultivating a transformant transformed with an expression vector using a trp promoter inducible with indolacetic acid (IAA), IAA or the like can be added to the medium.

  The culture conditions for the transformant are not particularly limited as long as the productivity of the desired improved nitrile hydratase and the growth of the host are not hindered, but are usually 10 ° C to 40 ° C, preferably 20 ° C. C. to 37.degree. C. for 5 to 100 hours. The pH is adjusted using an inorganic or organic acid, an alkaline solution or the like. For example, in the case of Escherichia coli, the pH is adjusted to 6-9. Examples of the culture method include solid culture, stationary culture, shaking culture, and aeration and agitation culture. In particular, when culturing E. coli transformants, aerobic by shaking culture or aeration and agitation culture (jar fermenter). It is preferable to culture under typical conditions.

  When cultured under the above culture conditions, the improved nitrile hydratase of the present invention is produced in a high yield in the above culture, that is, at least one of a culture supernatant, cultured cells, cultured cells, or cells or disrupted cells. Can accumulate.

  When improved nitrile hydratase is produced in cells or cells after culturing, the desired improved nitrile hydratase can be collected by disrupting the cells or cells. As a method for disrupting cells or cells, high-pressure treatment using a French press or homogenizer, ultrasonic treatment, grinding treatment using glass beads, enzyme treatment using lysozyme, cellulase or pectinase, freeze-thaw treatment, hypotonic solution treatment, It is possible to use a lysis inducing treatment with a phage or the like. After crushing, the cells or cell crushing residues (including the cell extract insoluble fraction) can be removed as necessary. Examples of the method for removing the residue include centrifugation and filtration. If necessary, the residue removal efficiency can be increased by using a flocculant or a filter aid. The supernatant obtained after removing the residue is a soluble fraction of the cell extract and can be a crude purified modified nitrile hydratase solution.

  In addition, when improved nitrile hydratase is produced in cells or cells, the cells or cells themselves can be recovered by centrifugation, membrane separation, etc., and used without being crushed.

  When the improved nitrile hydratase is produced outside the cells or cells, the culture solution is used as it is, or the cells or cells are removed by centrifugation or filtration. Then, if necessary, the improved nitrile hydratase is collected from the culture by extraction with ammonium sulfate precipitation, and further, if necessary, dialysis, various chromatography (gel filtration, ion exchange chromatography, affinity chromatography, etc.) Can also be isolated and purified.

  The production yield of nitrile hydratase obtained by culturing the transformant is, for example, SDS-PAGE (polyacrylamide) in units such as per culture broth, per microbial wet weight or dry weight per crude enzyme solution protein, etc. It can be confirmed by gel electrophoresis) or nitrile hydratase activity measurement, but is not particularly limited. SDS-PAGE can be performed by those skilled in the art using a known method. Moreover, the value of the activity mentioned above can be applied to the nitrile hydratase activity.

  In the present invention, an improved nitrile hydratase can be produced by employing a cell-free protein synthesis system without using any living cells.

  The cell-free protein synthesis system is a system that synthesizes a protein in an artificial container such as a test tube using a cell extract. The cell-free protein synthesis system used in the present invention includes a cell-free transcription system that synthesizes RNA using DNA as a template.

  In this case, the organism corresponding to the host corresponds to the organism from which the following cell extract is derived. Here, eukaryotic cell-derived or prokaryotic cell-derived extracts such as wheat germ, Escherichia coli and the like can be used as the cell extract. Note that these cell extracts may be concentrated or not concentrated.

The cell extract can be obtained, for example, by ultrafiltration, dialysis, polyethylene glycol (PEG) precipitation or the like. Furthermore, in the present invention, cell-free protein synthesis can also be performed using a commercially available kit. Examples of such kits include reagent kits PROTEIOS ^™ (Toyobo), TNT ^™ System (Promega), synthesizer PG-Mate ^™ (Toyobo), RTS (Roche Diagnostics) and the like.

The improved nitrile hydratase obtained by cell-free protein synthesis as described above can be purified by appropriately selecting chromatography as described above.
2. Method for Producing Amide Compound The improved nitrile hydratase produced as described above can be used for substance production as an enzyme catalyst. For example, an amide compound can be produced by bringing the improved nitrile hydratase into contact with a nitrile compound.

  As the enzyme catalyst, as described above, a gene is introduced so that the improved nitrile hydratase gene is expressed in an appropriate host, and a culture after culturing the host or a treated product of the culture is used. Can do. Examples of the treated product include those in which the cultured cells are included in a gel such as acrylamide, those treated with glutaraldehyde, and those supported on an inorganic carrier such as alumina, silica, zeolite, and diatomaceous earth.

  The nitrile compound used as the substrate is selected in consideration of the substrate specificity of the enzyme, the stability of the enzyme to the substrate, and the like. As the nitrile compound, acrylonitrile is preferable.

The reaction method and the method for collecting the amide compound after completion of the reaction are appropriately selected depending on the characteristics of the substrate and the enzyme catalyst. The enzyme catalyst is preferably recycled as long as its activity is not deactivated. In view of preventing deactivation and facilitating recycling, the enzyme catalyst is preferably used in the form of a treated product.

Hereinafter, the present invention will be described more specifically with reference to examples, but the present invention is not limited thereto.

Acquisition of improved nitrile hydratase gene (1) Construction of mutant gene library As a template plasmid, the most upstream C residue in the prosthetic molecule binding region CTLCSC region of the amino acid sequence of the α subunit (SEQ ID NO: 2) Thus, plasmid p79 (FIG. 1) in which asparagine (N) upstream of 60 residues was mutated to aspartic acid (D) was used.

  Here, as a method for preparing plasmid p79, a site-directed mutagenesis method was used, and a commercially available kit: QuikChange XL Site-Directed Mutagenesis Kit (Stratagene) was used. Plasmid pJH601 (FIG. 2) was used as a template for introducing mutations.

  Plasmid pJH 601 is an expression plasmid for wild-type nitrile hydratase, and has been designated as the accession number FERM BP-10314 by the National Institute of Advanced Industrial Science and Technology, Patent Biological Depositary Center (1st, 1st East, 1st Street, Tsukuba City, Ibaraki Prefecture, 6th) Deposited internationally on December 26, 2002.

Two kinds of primers for introducing mutations were synthesized. The underlined portion indicates the mutation introduction site.
α ↑ 60-F: gtcgtttcgtactacgag GAC gagatcggcccgatgg (SEQ ID NO: 5)
α ↑ 60-R: ccatcgggccgatctc GTC ctcgtagtacgaaacgac (SEQ ID NO: 6)
PCR for introducing the mutation was performed under the following conditions using GeneAmp9700 (PE Bioscience).

<Composition of PCR reaction solution>
Template plasmid pHJ601 (10ng) 2μl
10 × Reaction Buffer 5 μl
Primer α ↑ 60-F (100ng / μl) 1μl
Primer α ↑ 60-R (100ng / μl) 1μl
2.5mM dNTPmix 1μl
Sterile water 36μl
QuickSolution 3μl
Pfu Turbo DNA Polymerase 1μl
<Reaction conditions>
1 minute at 95 ° C
(50 seconds at 95 ° C, 50 seconds at 60 ° C, 14 minutes at 68 ° C) x 18 cycles
7 minutes at 68 ° C
After completion of PCR, 10 μl of the reaction solution was subjected to 0.7% agarose gel electrophoresis, and an amplified fragment of about 11 kb was detected. After confirming the amplified fragment, 1 μl of Dpn I (supplied with the kit) was added to the PCR reaction solution and reacted at 37 ° C. for 1 hour to remove the template plasmid. Next, transformation was performed using XL10-GOLD ultracompetent cells (included in the kit). 2 μl of DpnI-treated PCR reaction solution and 45 μl of competent cells were mixed and incubated at 4 ° C. for 30 minutes. Then, heat shock was performed at 42 ° C. for 30 seconds, and 0.5 ml of NZY ⁺ medium (1% NZ amine, 0.5% yeast extract, 0.5% NaCl, 12.5 mM MgCl ₂ , 12.5 mM MgSO ₄ , 0.4% glucose, pH 7 .5) was added. After the addition, it was cultured at 37 ° C. for 1 hour. 250 μl of this culture solution was plated on an LB plate (1% NaCl, 1% tryptone, 0.5% yeast extract, 2% agar, 50 mg / L ampicillin) and cultured at 37 ° C. for 1 day.

  After culturing, several colonies grown on the plate were each cultured in 1.5 ml of LB medium (50 mg / L ampicillin), and then the plasmid was extracted using FlexiPrep Kit (Amersham Bioscience). After extraction, the base sequence of the obtained plasmid was determined, and it was confirmed that the target mutation was introduced. In this way, Nα ↑ 60D mutation-introduced plasmid: p79 was obtained.

  Next, random mutation was introduced into the nitrile hydratase gene.

  Random mutagenesis utilized base substitution by error incorporation of nucleotides in PCR (Error prone PCR).

  Error prone PCR for the nitrile hydratase gene was performed using GeneAmp9700 (PE Bioscience) under the following conditions.

<Composition of PCR reaction solution>
Template plasmid (p79) (10ng) 1μl
10 × PCR Buffer (GIBCO) 10 μl
50 mM MgCl ₂ (GIBCO) 3 μl
Primer Trc-02 (100ng / μl) 1μl
Primer Trc-03 (100ng / μl) 1μl
2.5mM dNTPmix 8μl
10 mM dITP 2 μl
10 mM dBraUTP 2 μl
Sterile water 71 μl
Taq DNA polymerase (GIBCO) 1μl
<Primer>
TRC-02: ggaattcgtataatgtgtggaattgtgagc (SEQ ID NO: 7)
TRC-03: ggctgaaaatcttctctcatccgcc (SEQ ID NO: 8)
<Reaction conditions>
(30 seconds at 94 ° C, 30 seconds at 65 ° C, 3 minutes at 72 ° C) x 30 cycles
After completion of PCR, 5 μl of the reaction solution was subjected to 0.7% agarose gel electrophoresis to detect a 3 kb PCR amplification product. The reaction solution containing the PCR product was purified with GFX column (Amersham Bioscience) and cleaved with restriction enzymes Nco I and Hind III. The restriction enzyme-treated PCR product was subjected to 0.7% agarose gel electrophoresis, and a band around 3 Kb was recovered. The collected PCR product was ligated with the vector pTrc99A (NcoI-HindIII site) using a Ligation Kit (Takara Shuzo). This ligation product was used to transform E. coli JM109. The bound product and 100 μl of E. coli JM109 competent cell were mixed and incubated at 4 ° C. for 30 minutes, and heat shock was performed at 42 ° C. for 40 seconds. Thereafter, 0.5 ml of SOC medium (2% tryptone, 0.5% yeast extract, 10 mM NaCl, 2.5 mM KCl, 20 mM MgCl ₂ , 20 mM MgSO ₄ , 0.2% glucose, pH 7.0) was added thereto, and the mixture was added at 37 ° C. for 1 Incubate for hours. 250 μl of this culture solution was plated on an LB plate (1% NaCl, 1% tryptone, 0.5% yeast extract, 2% agar, 50 mg / L ampicillin) and cultured at 37 ° C. for 1 day. An E. coli JM109 transformant containing the nitrile hydratase gene was obtained.
(2) Screening of improved nitrile hydratase and identification of substitution site For screening, E. coli JM109 transformant containing the nitrile hydratase gene obtained in (1) above and E. coli JM producing wild type nitrile hydratase were used. 109 / pJH601 was used. Each of the above strains was inoculated into a 96-well deep well plate containing 1 ml of LB-Amp medium (1 mM IPTG, containing 5 μg / ml CoCl ₂ ), followed by liquid culture at 37 ° C. for 12 hours. Subsequently, the culture solution was subjected to a heat treatment for 20 minutes at a temperature of 60 ° C., and then the residual nitrile hydratase activity was measured by the following method. Screening was performed on tens of thousands of transformants having nitrile hydratase genes mutated randomly.

  For the activity measurement, an equal amount of 5% acrylonitrile / 50 mM phosphate buffer pH 7.7 was added to the bacterial solution and reacted at 30 ° C. for 30 minutes. After completion of the reaction, 0.1M phosphoric acid was added in an amount equivalent to the reaction solution and centrifuged. The supernatant after centrifugation was appropriately diluted and subjected to HPLC, and the resulting acrylamide concentration was analyzed (WAKOSIL 5C8 (Wako Pure Chemical Industries) 250 mm, 10% acetonitrile containing 5 mM phosphoric acid, mobile phase flow rate 1 ml / min and Ultraviolet absorption detector wavelength 260nm). As a comparative control, the activity was measured using each of the untreated bacteria kept at 4 ° C. without heat treatment, and the residual activity (%) after the heat treatment was determined based on the obtained activity value.

  Plasmids were recovered by culturing a transformant producing an improved nitrile hydratase having a higher residual activity compared to cells producing wild type (wt) nitrile hydratase (pJH601). The recovered plasmids were named pA100, pA105, pA127, and pA166. The results of residual activity are shown in Table 1. The base sequence of each plasmid was determined by BeckmanCEQ-2000XL.

  The mode of amino acid substitution in the amino acid sequence encoded by the mutated gene sequence of the plasmid is shown below.

pA100: Nα ↑ 60D, Dβ ← 209G, Iα ↓ 95T
pA105: Nα ↑ 60D, Iβ ← 82T, Eα ↓ 93G
pA127: Nα ↑ 60D, Eα ↓ 17G
pA166: Nα ↑ 60D, Dα ↓ 40G

Position-specific random mutation A random mutation was introduced at the site of α ↓ 17 to identify an improved enzyme with improved heat resistance.
(1) Plasmid construction In the amino acid sequence (SEQ ID NO: 2) of the α subunit of the template plasmid p79, an amino acid residue that is 17 residues downstream from the most downstream C residue of the CTLCSC region constituting the prosthetic molecule binding region A random mutation was introduced into the base sequence (codon) corresponding to. Site-directed mutagenesis was used for mutagenesis, and a commercially available kit: QuikChange XL Site-Directed Mutagenesis Kit (Stratagene) was used. The experiment followed the operation manual.

Two kinds of primers for introducing mutations were synthesized. The underlined portion indicates the mutation introduction site.
α ↓ 17RM-F: gtacaagagcatg NNS taccggtcccgagtgg (SEQ ID NO: 9)
α ↓ 17RM-R: ccactcgggaccggta SNN catgctcttgtac (SEQ ID NO: 10)
PCR for introducing the mutation was performed under the following conditions using GeneAmp9700 (PE Bioscience).
<Composition of PCR reaction solution>
Template plasmid p79 (10ng) 2μl
10 × Reaction Buffer 5 μl
Primer α ↓ 17RM-F (100ng / μl) 1μl
Primer α ↓ 17RM-R (100ng / μl) 1μl
2.5mM dNTPmix 1μl
Sterile water 36μl
QuickSolution 3μl
Pfu Turbo DNA Polymerase 1μl
<Reaction conditions>
1 minute at 95 ° C
(50 seconds at 95 ° C, 50 seconds at 60 ° C, 14 minutes at 68 ° C) x 18 cycles
7 minutes at 68 ℃
After completion of PCR, 10 μl of the reaction solution was subjected to 0.7% agarose gel electrophoresis, and an amplified fragment of about 11 kb was detected. After confirming the amplified fragment, 1 μl of DpnI (supplied with the kit) was added to the PCR reaction solution and reacted at 37 ° C. for 1 hour to remove the template plasmid.

Next, transformation was performed using XL10-GOLD ultracompetent cells (included in the kit). Mix 2 μl of DpnI-treated PCR reaction solution and 45 μl of competent cells, incubate at 4 ° C for 30 minutes, heat shock at 42 ° C for 30 seconds, then 0.5 ml of NZY + medium (1% NZamine, 0.5% Yeast extract, 0.5% NaCl, 12.5 mM MgCl ₂ , 12.5 mM MgSO ₄ , 0.4% glucose, pH 7.5) was added, and the mixture was further cultured at 37 ° C. for 1 hour. 250 μl of this culture solution was plated on an LB plate (1% NaCl, 1% tryptone, 0.5% yeast extract, 2% agar, 50 mg / L ampicillin) and cultured at 37 ° C. for 1 day.
(2) Evaluation of heat resistance The colony obtained in (1) above and XL10 / pJH601 were each inoculated into a 96-well deep well plate containing 1 ml of LB-Amp medium (containing 1 mM IPTG, 5 μg / ml CoCl ₂ ), Liquid culture was performed at 37 ° C. for 12 hours. The obtained culture solution was subjected to a heat treatment for 20 minutes at a temperature of 60 ° C., and then the residual nitrile hydratase activity was measured. The activity measurement was performed in the same manner as in Example 1 (2). As a comparative control, the activity was measured using each of the untreated bacteria kept at 4 ° C. without heat treatment, and the residual activity (%) after the heat treatment was determined based on the obtained activity value. The results of residual activity are shown in Table 2.

  For those having a higher residual activity than pJH601, the nucleotide sequence was further determined.

  In the amino acid sequence of the α subunit, the amino acid 17 residues downstream from the C residue (the 107th amino acid residue in the amino acid sequence shown in SEQ ID NO: 2) on the most downstream side of CTLCSC constituting the prosthetic molecule binding region Even when the residue (the 124th amino acid residue in the amino acid sequence shown in SEQ ID NO: 2) was substituted with another amino acid, the heat resistance was improved.

Preparation and Evaluation of Rhodococcus Transformant (1) Plasmid Construction In the amino acid sequence of the α subunit by the following method, 60 residues upstream of the C residue at the most upstream of the CTLCSC region constituting the prosthetic molecule binding region A plasmid for Rhodococcus having a mutation (Nα ↑ 60D) in the residue was prepared. The mutation was introduced by site-directed mutagenesis using a commercially available kit: QuikChange XL Site-Directed Mutagenesis Kit (Stratagene). The experiment followed the operation manual. PSJ034 was used as a template plasmid for introducing the mutation. pSJ034 is a plasmid that expresses nitrile hydratase in Rhodococcus, and pSJ034 was prepared from pSJ023 by the method described in JP-A-10-337185.

  PSJ023 is a transformant “R. rhodochrous ATCC12674 / pSJ023”, and under the accession number FERM BP-6232, National Institute of Advanced Industrial Science and Technology, Patent Biological Depositary Center ) Was deposited internationally on March 4, 1997.

Two kinds of primers for introducing mutations were synthesized. The underlined portion indicates the mutation introduction site.
α ↑ 60-F: gtcgtttcgtactacgag GAC gagatcggcccgatgg (SEQ ID NO: 5)
α ↑ 60-R: ccatcgggccgatctc GTC ctcgtagtacgaaacgac (SEQ ID NO: 6)
Position-directed mutagenesis PCR was performed using GeneAmp9700 (PE Bioscience) under the following conditions.
<Composition of PCR reaction solution>
Template plasmid pSJ034 (10ng) 2μl
10 × Reaction Buffer 5 μl
Primer α ↑ 60-F (100ng / μl) 1μl
Primer α ↑ 60-R (100ng / μl) 1μl
2.5mM dNTPmix 1μl
Sterile water 36μl
QuickSolution 3μl
Pfu Turbo DNA Polymerase 1μl
<Reaction conditions>
1 minute at 95 ° C
(50 seconds at 95 ° C, 50 seconds at 60 ° C, 14 minutes at 68 ° C) x 18 cycles
7 minutes at 68 ° C
After completion of PCR, 10 μl of the reaction solution was subjected to 0.7% agarose gel electrophoresis, and an amplified fragment of about 11 kb was detected. After confirming the amplified fragment, 1 μl of Dpn I (supplied with the kit) was added to the PCR reaction solution and reacted at 37 ° C. for 1 hour to remove the template plasmid.

Next, transformation was performed using XL10-GOLD ultracompetent cells (included in the kit). 2 μl of DpnI-treated PCR reaction solution and 45 μl of competent cells were mixed and incubated at 4 ° C. for 30 minutes, followed by heat shock at 42 ° C. for 30 seconds. Thereafter, 0.5 ml of NZY ⁺ medium (1% NZ amine, 0.5% yeast extract, 0.5% NaCl, 12.5 mM MgCl ₂ , 12.5 mM MgSO ₄ , 0.4% glucose, pH 7.5) was added to the bacterial solution, and 37 Incubation was performed at 0 ° C. for 1 hour. 250 μl of this culture solution was plated on an LB plate (1% NaCl, 1% tryptone, 0.5% yeast extract, 2% agar, 50 mg / L ampicillin) and cultured at 37 ° C. for 1 day.

  Several colonies obtained were cultured in 1.5 ml of LB medium (50 mg / L ampicillin), and a plasmid was prepared using FlexiPrep Kit (Amersham Bioscience). Finally, the base sequence of the obtained plasmid was determined, and it was confirmed that the target mutation was introduced. In this manner, a mutation-introducing plasmid p79R (FIG. 3) of Nα ↑ 60D was obtained.

  Next, mutation was introduced site-specifically in the same manner as described above using p79R as a template plasmid. Plasmids were prepared in which mutations Dβ ← 209G, Iβ ← 82T, Eα ← 17G, Dα ↓ 40G, Eα ↓ 93G, and Iα ↓ 95T were introduced.

  The sequence of each primer is as follows.

β ← 209-F: gtcccctatcagaagGGCgagcccttcttc (SEQ ID NO: 11)
β ← 209-R: gaagaagggctcGCCcttctgataggggac (SEQ ID NO: 12)
β ← 82-F: ctctcggtgacaagACCaaagtgaagagtatg (SEQ ID NO: 13)
β ← 82-R: catactcttcactttGGTcttgtcaccgagag (SEQ ID NO: 14)
α ↓ 17-F: gtacaagagcatgGGGtaccggtcccgagtgg (SEQ ID NO: 15)
α ↓ 17-R: ccactcgggaccggtaCCCcatgctcttgtac (SEQ ID NO: 16)
α ↓ 40-F: cggtttcgacatccccGGTgaggtggaggtc (SEQ ID NO: 17)
α ↓ 40-R: gacctccacctcACCggggatgtcgaaaccg (SEQ ID NO: 18)
α ↓ 93-F: gtaatgcgctcacaccgcagGGAgtgatcgtatg (SEQ ID NO: 19)
α ↓ 93-R: catacgatcacTCCctgcggtgtgagcgcattac (SEQ ID NO: 20)
α ↓ 95-F: cacaccgcaggaagtgACCgtatgagtgaag (SEQ ID NO: 21)
α ↓ 95-R: cttcactcatacGGTcacttcctgcggtgtg (SEQ ID NO: 22)
The obtained plasmids are pAR100 (Nα ↑ 60D, Dβ ← 209G, Iα ↓ 95T), pAR105 (Nα ↑ 60D, Iβ ← 82T, Eα ↓ 93G), pAR127 (Nα ↑ 60D, Eα ↓ 17G), pAR166, respectively. (Nα ↑ 60D, Dα ↓ 40G).
(2) Production of Rhodococcus transformants Cells in the logarithmic growth phase of Rhodococcus rhodochrous ATCC 12674 were collected using a centrifuge, washed three times with ice-cold sterile water, and suspended in sterile water. 1 μl of the plasmid prepared in (1) above and 10 μl of the cell suspension were mixed and ice-cooled. A suspension of DNA and bacterial cells was placed in a cuvette and subjected to electric pulse treatment at 2.0 KV and 200 OHMS using a gene introduction device Gene Pulser (BIO RAD). The cuvette containing the electric pulse treatment solution was allowed to stand for 10 minutes under ice-cooling, and heat shocked at 37 ° C. for 10 minutes. Then, add 500 μl of MYK medium (0.5% polypeptone, 0.3% bacto yeast extract, 0.3% bacto malt extract, 0.2% K ₂ HPO ₄ , 0.2% KH ₂ PO ₄ ) to the cuvette and let stand at 30 ° C for 5 hours. Then, it was applied to MYK agar medium containing 50 μg / ml kanamycin. Colonies after 3 days of culture at 30 ° C. were used as transformants.
(3) Evaluation of heat resistance of transformants of Rhodococcus The residual nitrile hydratase activity after heat treatment was examined using the obtained transformants of Rhodococcus. As a comparative control, Rhodococcus rhodochrous ATCC12674 / pSJ034 (hereinafter referred to as ATCC12674 / pSJ034) having wild type nitrile hydratase was used.

  The nitrile hydratase activity of the cell suspension was measured by the following method.

  Mix 0.2 ml of bacterial cell solution and 4.8 ml of 50 mM phosphate buffer (pH 7.7), and add 5 ml of 50 mM phosphate buffer (pH 7.7) containing 5.0% (w / v) acrylonitrile to the mixture. And allowed to react at 10 ° C. with shaking for 10 minutes.

  Subsequently, the cells were separated by filtration, and the amount of acrylamide produced was quantified using gas chromatography.

<Analysis conditions>
Analytical instrument: Gas chromatograph GC-14B (manufactured by Shimadzu Corporation)
Detector: FID (detection 200 ° C)
Column: 1m glass column packed with Polapack PS (Waters column filler) Column temperature: 190 ° C
Nitrile hydratase activity was converted from the amount of acrylamide. Here, the nitrile hydratase activity is defined as 1 U for the amount of enzyme that produces 1 μmol of acrylamide per minute.

ATCC12674 / pSJ034 and each transformant obtained in the step (2) above were inoculated into MYK medium (50 μg / ml kanamycin), shake-cultured at 30 ° C. for 2 days, and GGPK medium (1.5% glucose, 1% sodium glutamate, 0.1% yeast extract, 0.05% K ₂ HPO ₄ , 0.05% KH ₂ PO ₄ , 0.05% MgSO ₄ · 7H ₂ O, 1% CoCl ₂ , 0.1% urea, 50 μg / ml kanamycin, pH 7.2) % Inoculation. The cells were cultured with shaking at 30 ° C. for 3 days and collected by centrifugation. Thereafter, the cells were washed with 100 mM phosphate buffer (pH 8.0) and finally suspended in a small amount of the same buffer.

  In the heat treatment, 0.5 ml of an appropriately diluted cell suspension was placed in a test tube, kept in a water bath at a temperature of 65 ° C. for 30 minutes, and then cooled in ice. As a comparative control, the activity was measured using each of the untreated bacteria kept at 4 ° C. without heat treatment, and the residual activity (%) after the heat treatment was determined based on the obtained activity value. The results of residual activity are shown in Table 3.

  ATCC12674 / pSJ034 containing wild-type nitrile hydratase had a residual activity of 23% after heat treatment at 65 ° C. for 30 minutes. In contrast, Rhodococcus rhodochrous ATCC 12674 / pAR100 to pAR166 containing an improved nitrile hydratase retained a residual activity of 40% or more. Therefore, the improved nitrile hydratase has improved heat resistance.

Evaluation of Amide Compound Resistance Using the transformant obtained in Example 3, amide compound resistance was evaluated. The said evaluation was performed with the following reaction liquid composition and reaction conditions. In addition, according to the measurement result of the activity measured by the method of Example 3 (3), the amount of each cell suspension used in the reaction is 100 mM phosphoric acid so that the same enzyme activity unit (U) amount is obtained. Prepared with buffer (pH 8.0). As a control, ATCC12674 / pSJ034 with wild type nitrile hydratase was used.

<Reaction solution composition>
95% 50% acrylamide solution
Acrylonitrile 3g
1M phosphate buffer 1g
Bacterial fluid (same enzyme activity unit (U) amount) 1g
<Reaction conditions>
Reaction for 20 hours with stirring (30 ℃)
Before starting the reaction (0 hour), 0.5 hour and 20 hours later, 1 ml of the reaction solution was sampled and filtered using a 0.22 μm filter. The obtained filtrate was subjected to gas chromatography. The analysis conditions were the same as the analysis conditions for acrylamide determination shown in (4) of Example 3.

  Table 4 shows the analysis result of the ratio (%) of the remaining acrylonitrile.

  The improved nitrile hydratase contained less acrylonitrile than the wild-type nitrile hydratase (pSJ034). Therefore, the improved nitrile hydratase maintained nitrile hydratase activity even in the presence of a high concentration of acrylamide, and improved resistance to acrylamide. When the results of Example 4 are combined, it can be said that the improved nitrile hydratase has improved both heat resistance and amide compound resistance.

Introduction of mutation into nitrile hydratase derived from Rhodococcus rhodochrous M8 strain, preparation of transformant and evaluation (1) Construction of plasmid containing nitrile hydratase gene derived from Rhodococcus rhodochrous M8 strain (hereinafter referred to as M8 strain) It can be obtained from the strain center IBFM (VKPM S-926).
Strain M8 in 100 ml MYK (0.5% polypeptone, 0.3% bacto yeast extract, 0.3% bacto malt extract, 1% glucose, 0.2% K ₂ HPO ₄ , 0.2% KH ₂ PO ₄ ) medium (pH 7.0), 30 The culture was shaken at 72 ° C. for 72 hours. The culture solution was centrifuged, and the collected cells were suspended in 4 ml of Saline-EDTA solution (0.1 M EDTA, 0.15 M NaCl (pH 8.0)). 8 mg of lysozyme was added to the suspension, shaken at 37 ° C. for 1-2 hours, and then frozen at −20 ° C.

  Next, 10 ml of Tris-SDS solution (1% SDS, 0.1 M NaCl, 0.1 M Tris-HCl (pH 9.0)) was added to the suspension with gentle shaking. Furthermore, proteinase K (Merck) (final concentration 0.1 mg) was added to the suspension and shaken at 37 ° C. for 1 hour. Next, an equal amount of TE saturated phenol was added and stirred (TE: 10 mM Tris-HCl, 1 mM EDTA (pH 8.0)) and centrifuged. The upper layer was collected, twice the amount of ethanol was added, and the DNA was wound with a glass rod. Thereafter, this was centrifuged sequentially with 90%, 80%, and 70% ethanol to remove phenol.

  Next, DNA was dissolved in 3 ml of TE buffer, ribonuclease A solution (100 ° C., heat-treated for 15 minutes) was added to 10 μg / ml, and the mixture was shaken at 37 ° C. for 30 minutes. Further, proteinase K (Merck) was added and shaken at 37 ° C. for 30 minutes. An equal amount of TE-saturated phenol was added thereto, and after centrifugation, the mixture was separated into an upper layer and a lower layer.

  The upper layer was further centrifuged with an equal amount of TE saturated phenol, and then separated into an upper layer and a lower layer. This operation was repeated again. Thereafter, the same amount of chloroform (containing 4% isoamyl alcohol) was added to the upper layer and centrifuged to recover the upper layer. Next, twice the amount of ethanol was added to the upper layer, and the DNA was wound with a glass rod and collected to obtain chromosomal DNA.

PCR was performed using Thermalcycler personal (Takara Shuzo) under the following conditions.
<PCR reaction solution composition>
Template DNA (chromosomal DNA) 1μl
10 × ExTaq Buffer (Takara Shuzo) 10μl
Primer MH-01 1μl
Primer MH-02 1μl
5mM dNTPmix 8μl
Sterile water 78μl
ExTaqDNA polymerase (Takara Shuzo) 1μl
<Primer>
MH-01: ccatggatggtatccacgacacaggcggcatgacc (SEQ ID NO: 24)
MH-02: aagcttcacgctggcctcgagcgcctttgtccag (SEQ ID NO: 25)
<Reaction conditions>
(30 seconds at 94 ° C, 30 seconds at 65 ° C, 3 minutes at 72 ° C) x 30 cycles
After completion of PCR, 5 μl of the reaction solution was subjected to 0.7% agarose gel electrophoresis, and a 1.5 kb amplified fragment was detected. The reaction completed solution was purified with GFX column (Amersham Bioscience) and cleaved with restriction enzymes NcoI and HindIII. The PCR product treated with the restriction enzyme was subjected to 0.7% agarose gel electrophoresis, and a band around 1.5 kb was recovered. The collected PCR product was ligated to a vector (NcoI-HindIII site of pTrc99A) using Ligation Kit (Takara Shuzo), and transformed into E. coli JM109. Several clones from the resulting transformant colonies were inoculated into 1.5 ml of LB-Amp medium and cultured with shaking at 37 ° C. for 12 hours. After culture, the culture was collected by centrifugation. By using Flexi Prep (Amersham Bioscience), plasmid DNA was extracted from the collected cells. The obtained plasmid DNA was cleaved with restriction enzymes NcoI and HindIII, and then electrophoresed on a 0.7% agarose gel, and a clone in which the nitrile hydratase gene fragment (1.5 kb) was correctly ligated was selected and pMH301 (FIG. 4) and Named.
(2) Production of mutation-introducing transformant Mutation was introduced into the base sequence of nitrile hydratase derived from M8 strain (SEQ ID NO: 23). Position-directed mutagenesis was carried out in the same manner as in Example 3 (1) except that the plasmid used was pMH301 (FIG. 3), a nitrile hydratase expression plasmid derived from the M8 strain.

  The obtained mutation-introduced plasmids were named as follows.

pMH701 (Nα ↑ 60D)
pMH702 (Nα ↑ 60D, Dβ ← 209G, Iα ↓ 95T)
pMH703 (Nα ↑ 60D, Iβ ← 82T, Eα ↓ 93G)
pMH704 (Nα ↑ 60D, Eα ↓ 17G)
pMH705 (Nα ↑ 60D, Dα ↓ 40G)
The plasmid was transformed into Escherichia coli JM109 to prepare a transformant having a mutation introduced. The obtained transformant was inoculated into 10 ml of LB-Amp medium (containing 1 mM IPTG, 5 μg / ml CoCl ₂ ) and liquid-cultured at 37 ° C. for 12 hours.
(3) Evaluation of heat resistance The culture obtained in the step (2) was subjected to a heat treatment for 20 minutes at a temperature of 60 ° C. Next, the residual activity of nitrile hydratase was measured. The activity measurement was performed by the same method as (2) of Example 1. As a comparative control, the activity was measured using each of the untreated bacteria kept at 4 ° C. without heat treatment, and the residual activity (%) after the heat treatment was determined based on the obtained activity value. The results of residual activity are shown in Table 5.

  Also in the nitrile hydratase derived from the M8 strain, the improved nitrile hydratase had higher residual activity than the wild-type nitrile hydratase (pHM301). Therefore, the improved nitrile hydratase has improved heat resistance.

FIG. 6 is a structural diagram of plasmid p79. It is a block diagram of plasmid pJH601. FIG. 6 is a structural diagram of plasmid p79R. FIG. 6 is a structural diagram of plasmid pMH301. It is a figure which shows the amino acid sequence (part of N terminal side) of alpha subunit of wild type nitrile hydratase derived from various microorganisms including prosthetic molecule binding region “C (S / T) LCSC”. It is a figure which shows the same amino acid sequence as FIG. 5-1, and has shown the arrangement | sequence following the amino acid sequence of FIG. It is a figure which shows the amino acid sequence similar to FIG. 5-1, and has shown the arrangement | sequence (part by the side of C terminal) following the amino acid sequence of FIG.

Sequence number 5: Synthetic DNA
Sequence number 6: Synthetic DNA
SEQ ID NO: 7: synthetic DNA
Sequence number 8: Synthetic DNA
SEQ ID NO: 9: synthetic DNA
Sequence number 9: n is a, c, g, or t (location 14-15).
SEQ ID NO: 10: synthetic DNA
Sequence number 10: n is a, c, g, or t (location 18-19).
SEQ ID NO: 11: synthetic DNA
SEQ ID NO: 12: synthetic DNA
SEQ ID NO: 13: synthetic DNA
SEQ ID NO: 14: Synthetic DNA
SEQ ID NO: 15: synthetic DNA
SEQ ID NO: 16: synthetic DNA
Sequence number 17: Synthetic DNA
Sequence number 18: Synthetic DNA
Sequence number 19: Synthetic DNA
SEQ ID NO: 20: synthetic DNA
SEQ ID NO: 21: synthetic DNA
SEQ ID NO: 22: synthetic DNA
SEQ ID NO: 24: Synthetic DNA
SEQ ID NO: 25: synthetic DNA

Claims (11)

The following protein (A) or (B).
(A) In the amino acid sequence of wild-type nitrile hydratase, the amino acid residue of (a) below and the amino acid residue of (b) and / or (c) below are substituted with other amino acid residues And a protein characterized by having nitrile hydratase activity (a) The most upstream C residue of the amino acid sequence C (S / T) LCSC constituting the prosthetic molecule binding region in the amino acid sequence of the α subunit Amino acid residue 60 residues upstream (b) Amino acid residue 17 residues downstream of the most downstream C residue of the amino acid sequence C (S / T) LCSC (c) The amino acid sequence C (S / T) ) Amino acid residue 40 residues downstream of the most downstream C residue of LCSC (B) In the amino acid sequence of the protein of (A), except for the amino acid residue after substitution, one or several amino acid residues A protein comprising an amino acid sequence in which an amino acid residue is deleted, substituted and / or added, and having nitrile hydratase activity The following protein (A) or (B).
(A) In the amino acid sequence of wild-type nitrile hydratase, the amino acid residue of (a) below and the amino acid residue of (b) and / or (c) below are substituted with other amino acid residues And a protein characterized by having nitrile hydratase activity (a) The most upstream C residue of the amino acid sequence C (S / T) LCSC constituting the prosthetic molecule binding region in the amino acid sequence of the α subunit Amino acid residue 60 residues upstream (b) Amino acid residue 209 residues upstream of the C-terminal amino acid residue in the β subunit amino acid sequence (c) 82 residues upstream of the C-terminal amino acid residue In the amino acid sequence of the protein of (A), one or several amino acid residues are deleted, substituted and / or removed except for the amino acid residue after the substitution. It comprises added amino acid sequence, and characterized by having a nitrile hydratase activity protein The following protein (A) or (B).
(A) In the amino acid sequence of wild-type nitrile hydratase, the amino acid residue of (a) below and the amino acid residue of (b) and / or (c) below are substituted with other amino acid residues And a protein characterized by having nitrile hydratase activity (a) The most upstream C residue of the amino acid sequence C (S / T) LCSC constituting the prosthetic molecule binding region in the amino acid sequence of the α subunit Amino acid residue 60 residues upstream (b) 95 amino acid residues downstream of the most downstream C residue of the amino acid sequence C (S / T) LCSC (c) The amino acid sequence C (S / T) ) Amino acid residue (B) 93 residues downstream of the most downstream C residue of LCSC In the amino acid sequence of the protein of (A), except for the amino acid residue after substitution, one or several amino acid residues A protein comprising an amino acid sequence in which an amino acid residue is deleted, substituted and / or added, and having nitrile hydratase activity The following protein (A) or (B).
(A) The amino acid sequence of the wild-type nitrile hydratase includes an amino acid sequence in which the following amino acid residues (a), (b) and (c) are substituted with other amino acid residues, and has nitrile hydratase activity. (A) The amino acid residue 60 residues upstream of the most upstream C residue of the amino acid sequence C (S / T) LCSC that constitutes the prosthetic molecule binding region in the amino acid sequence of the α subunit Group (b) 95 amino acid residues downstream of the most downstream C residue of the amino acid sequence C (S / T) LCSC, and (c) 209 from the amino acid residue at the C terminal in the amino acid sequence of the β subunit. Amino acid residue upstream of residue (B) In the amino acid sequence of the protein of (A), one or several amino acid residues are deleted, substituted and removed except for the amino acid residue after the substitution. / Or include additional amino acid sequences, and protein characterized by having the nitrile hydratase activity The following protein (A) or (B).
(A) The amino acid sequence of the wild-type nitrile hydratase includes an amino acid sequence in which the following amino acid residues (a), (b) and (c) are substituted with other amino acid residues, and has nitrile hydratase activity. (A) The amino acid residue 60 residues upstream of the most upstream C residue of the amino acid sequence C (S / T) LCSC that constitutes the prosthetic molecule binding region in the amino acid sequence of the α subunit Group (b) amino acid residue 93 residues downstream from the most downstream C residue of the amino acid sequence C (S / T) LCSC; (c) 82 amino acid residues from the C-terminal amino acid residue in the β subunit amino acid sequence; Amino acid residue upstream of residue (B) In the amino acid sequence of the protein of (A), except for the amino acid residue after the substitution, one or several amino acid residues are deleted, substituted and Or include additional amino acid sequences, and protein characterized by having the nitrile hydratase activity   A genetic DNA encoding the protein according to any one of claims 1 to 5.   A recombinant vector comprising the gene DNA according to claim 6.   A transformant or transductant comprising the recombinant vector according to claim 7.   A nitrile hydratase collected from a culture obtained by culturing the transformant or transductant according to claim 8.   A method for producing nitrile hydratase, comprising collecting nitrile hydratase from a culture obtained by culturing the transformant or transductant according to claim 8.   A culture obtained by culturing the transformant according to claim 8 or a treated product of the culture is brought into contact with a nitrile compound, and an amide compound produced by the contact is collected. Production method.