JPS6115691A - Beta-urogastrone gene, corresponding plasmid recombinant, corresponding transformat, and preparation of beta-urogastrone - Google Patents

Abstract

PURPOSE:To design and to synthesize a gene of beta-urogastrone having physiological activities such as inhibition of secretion of acid in the stomach, cell growth promotion, etc., and to obtain a large amount of the gene in high purity by a genetic engineering method. CONSTITUTION:A promotor, SD sequence, restricted enzyme recognition site, etc. necessary for developing beta-urogstrone gene sequence shown by the formula are connected. lambdaPL or lacUV5 is cited as the promotor, and pBR322 as a plasmid vector is used. A fused protein with a different protein such as beta-lactomase, etc. may be developed as method of development of peptide. Since the fused protein is transferred and accumulated in a periplasmic layer of Escherichia coil and it exists partially, it is easily separated and purified. Oligonucleotide of beta- urogastrone can be synthesized by a well-known method using polystyrene resin, etc.

Description

DETAILED DESCRIPTION OF THE INVENTION The present invention relates to a β-urogastrone gene, a corresponding plasmid recombinant, a corresponding transformant, and a method for producing β-urogastrone.

β-Urogastrone is a polypeptide hormone synthesized in human salivary glands (e.g., Heltz et al.
al, Gut, ±9.408-413 (1978
), its secondary structure consists of 53 amino acids in the sequence shown below, and has three disulfide bonds within the molecule (H
, Gregory et at.

Int, J, pept+ae protein
(Res., 9°107-118 (1977))
.

Asn 3er ASCI Ser Glu
Cys Pr.

leu Ser His Asp aly
Tyr cysLeu His Asp Gl
y Vat Cys MetTyr lie
Glu Ala leu ASD LysT
yr Ala Cys Asn Cys V
at VatGly Tyr Ile Gly
Glu Ara CysGln Tyr
Aro AsE) Leu LYS Trl)
Trp Glu Leu Arg In this specification, the abbreviations of amino acids are as follows.

A an: Asparagine, Ser: Serine A SD
: aspartic acid, Qlu: glutamate cys nigistein, P'0 nibroline leu : leucine, )lis: histidine GIV nigericin,
TVr: Tyrosine Val: Valine, Met:
Methionine 11e: Isoleucine, Ala: Alanine L YS: Lysine, Gln: Glutamine A
rQ: Arginine, Trp nitributophane P he
: Phenylalanine β-urogastrone has physiological activities such as suppressing gastric acid secretion and promoting cell growth (E Ider et al.
.

Gut, 16.887-893 (1975)).

Therefore, β-urogastrone is useful as a treatment for ulcers and wounds.

Currently, β-urogastrone is produced by extracting, separating, and purifying it from urine, since it is excreted in small amounts in human urine. However, there are problems with this method, such as that it is difficult to obtain a large amount of the product in quantity, and that it is difficult to obtain a product of high purity because it involves purification from a wide variety of components. Therefore, it is desired to produce β-urogastrone in large quantities and with high purity.

Trap-1-'L'
The present inventors have discovered that the above needs can be satisfactorily met by using a series of genetic engineering techniques in which the urogastrone gene is designed, synthesized, incorporated into a vector, transformed, and expressed, leading to the completion of the present invention.

The present invention provides a plasmid vector containing a gene containing part or all of the expression code for β-urogastrone, a promoter that controls the expression of the gene, and an SD sequence linked upstream of the β-urogastrone gene. A transformant in which a host cell is transformed with the inserted plasmid recombinant, a plasmid recombinant capable of expressing the β-urogastrone gene, and a plasmid recombinant capable of expressing the β-urogastrone gene is transformed into a host cell, The present invention relates to a method for producing β-urogastrone, which comprises culturing the transformant and collecting the expressed β-urogastrone.

Host cells in the present invention are not particularly limited, but include, for example, Bacillus subtilis, Pseudomonas, and yeast, among which Escherichia coli is particularly preferred.

Designing a base sequence of a gene suitable for expression in a transformant according to the amino acid sequence of β-urogastrone is as follows:
The test was conducted according to the following criteria.

(1) Select and use trinucleotide codons that are frequently used by host cells, especially E. coli. 5 (2) A specific restriction enzyme recognition site is provided within the gene and at both ends thereof, and the site is arbitrarily manipulated to facilitate ligation with other genes and insertion into a plasmid vector.

(3) When assembling and linking synthesized genes, ensure that there is no linkage of genes that differ from the desired linkage state, or that the linkage is minimized.

(4) When β-urogastrone is expressed as a fusion protein, there should be a means to easily separate the unnecessary fusion protein.

A specific example of a preferable base sequence (hereinafter referred to as a genetic check) selected as a component of the β-urogastrone gene is shown below using the above criteria as a blue line.

Gene I: 5' AAT AGOGAT TCT GAG TG
CCCA CTG3' TTA TCG CTA A
GA CTCACG GGT GACTCT CAC
GAT GGCTAT TGT CTG CA
CAGA GTG CTA CCG ATA
ACA GACGTGGAG GGT GTT
TGCATG TACATCGAACTG C
CA CAA ACG TACATG TAG
CTTGOT TTG GAT AAA
TACGCG TGT AACCGA AACC
TA TTT ATG CGCACA TTG
TGT GTA GTG GGT TAT
ATCGGT GAAACA CAT CACC
CA ATA TAG CCA CTTCGC
TGT CAA TACCGT GAT CT
G AAAGCG ACA GTT ATG
GCA CTA GACTTTTTGG TGG
GAA TTG CGT 3'ACCACC
CTT AACGCA 5' In the present specification, the abbreviations of bases are as follows: A represents adenine, G represents guanine, C represents cytosine 1, and ■ represents thymine.

The above genetic check is an embodiment of the β-urogastrone gene corresponding to the amino acid sequence of β-urogastrone, and the present invention is not limited to this, and genes whose base sequences are slightly different from this are also included in the present invention. Ru.

When actually expressing β-urogastrone using the above gene ■, it is necessary to add restriction enzyme recognition sites before and after the above gene, taking into consideration the connection with the promoter, SD sequence, vector, etc. necessary for expression. There is. restriction enzyme 11
The part is not particularly limited and may be any part.

A specific example (referred to as gene (2)) in which a start codon, a stop codon, and a restriction enzyme recognition site are added before and after the above gene (2) is shown below together with the recognition sites.

Gene ■ Knee 15 -1.1CTA CC
G ATA ACA GACGTG CTG
CCACACCCA ATA TAG CCA
CTT GCG ACAa In the above, the abbreviations for restriction enzymes are as follows.

E: EcoRI, Ta: TaqIBG: B(ll
I[, S: Sau3AIMb: MbO Eng, H
f:l-1inflBa:Bam) (:I, Hd:
Hindl [MI: MluI, Th: ThaI When constructing the above gene (2), it is advantageous to divide the gene (2) into the first half and the second half.

A specific example will be published below.

First, in accordance with the nucleotide sequence of gene ① and considering the addition of a restriction enzyme recognition site at the end of the first half, oligonucleotides with 11, 13, or 15 bases (A-
1 to A-16 and B-1 to B-16 (32 in total) are synthesized. Next, 4 to 6 of these blocks are assembled and connected to form a block (block 1i block 7, a total of 7 blocks). Each oligonucleotide and each block are shown below.

Block 1: (A-1) (A-2) 5' A
ATTCGAAGATCTGCATGAATAGC
3' GCTTCTAGACGTA C
TTATCGCTAA (A-16)
(A-15>(A-3) GATTCTGAGTG 3'GACT
CACGGGTGA 5' (A-14) Block 2: (A-4) (A-5) 5'
CCCACTGTCTCACGATGGCTATTG3
'CAGAGTGCTACCGAT
AACAGACGT (A-13) (A-1
2) (A-6) TCTGCACGACGGT 3'GCTG
CCACAAA 5' (A-11) Block 3: (A-7) (A-8) 5' GT
TTGCATGTA CATCGAAGCTTCG
3'3' CGTACATGT
AGCT TCGAAGCCTAG 5' (A-1
0) (A-9) Block 4: (B-1) (B-2) 5' AG
CTTTGGATA AATACGCGTGTA8C
T 3'to' AACCTAT
TTATGCGCACATTGACACA 5'(B
-16> (B-15) Block 5
: (B-3) (B-4) 5' GT
GTAGTGGGGT TATATCGGTGAACG
C3'3' TCACCCAATATAG
CCACTTGCGACAG 5' (B-14)
(B-13) Block 6: (B-5) (B-6) 5' TG
TCAATACCG TGATCTGAAATGGT
G 3'3' TTATGGC
ACTAGA CTTTACCAGCCTT 5'
(B-12) (B-11') Block 7: (B-7) (B-8>5' GG
AATTGCGTT AATAGTGAAGATCT
G 3'3' AACGCAAT
TATCA CTTCTAGACCTAG 5'(
B-10) (B-9) Next, blocks 1 to 3 are connected to form subunit A, and blocks 4 to 3 are connected to form subunit A.
7 to construct subunit B. Each subunit is shown below.

Subunit A: 3' CTA G 5' Subunit B: Subunit A has the restriction enzyme BanHI recognition site added to the end of the first half of gene ■, and subunit B has the restriction enzyme Hindl of gene ■ added to the end. [This is the second half after the iaX site.

Each of the aforementioned oligonucleotides can be synthesized by a known method. - As an example, the outline of the synthesis by solid phase method is described below (for example, H, It.

etc., NU(jleic Ac1ds Re5ear
ch, 1Q.

1755-1769 (see 1982).

That is, oligonucleotide synthesis by the solid phase method is performed by sequentially coupling mononucleotides or dinucleotides to nucleosides supported on polystyrene resin to form a predetermined base sequence.

To prepare the nucleoside-supporting resin, for example, 1% cross-linked polystyrene resin rs-X manufactured by Bio-Ra Laboratories, Inc.
N-(chloromethyl)phthalimide is reacted over trifluoromethanesulfonic acid catalyst using IJ (200-400 mesh) and then reacted with hydrazine to obtain aminomethylated polystyrene resin. A nucleoside-supporting resin is obtained by connecting a nucleoside with a 5' hydroxyl group and an amino group protected to the amino group using succinic acid as a spacer.

On the other hand, various methods are known for synthesizing mononucleotides and dinucleotides (for example, C9Br0ka, Nuc
leic Ac1ds Research, 8
5461-5471 (1980)). for example,
The mononucleotide is 0-chlorophenyl phosphate di(O)
A monotriacylide obtained by reacting resort, triazole, and a nucleoside whose 5'-OH group is protected with a dimethoxytrityl group (DMTr) in the presence of triethylamine is reacted with β-cyanoethanol using 1-methylimidazole as a catalyst. ,
The reaction product was subjected to column chromatography on silica gel and eluted with chloroform containing 2-5% methanol to obtain the fully protected mononucleotide in a yield of 70-80%.
It can be obtained in %.

Next, the dinucleotide is prepared by treating the fully protected mononucleotide obtained above with an acid such as benzenesulfonic acid to free the 5'-OH group, and combining it with the previously obtained monotriacylide. After the reaction, the reaction product is subjected to silica gel column chromatography and eluted with chloroform containing 2-5% methanol to obtain a fully protected dinucleotide with a yield of 60-80%. .

In-phase synthesis of oligonucleotides can be performed, for example, by Bache
Advantageously, this is carried out using a DNA synthesizer manufactured by Company S. The previously obtained nucleoside-supporting resin was placed in a reaction tube, washed with dichloromethane-isopropanol (85:15), and then a dichloromethane-isopropanol solution of zinc bromide (1M) was added.

The dimethoxytrityl group at the 5' position is removed. Repeat several times until the solution is no longer colored. Zn2 remaining after washing with dichloromethane-isopropanol (85:15)
Triethylammonium acetate (0,
After washing with a 5M dimethylformamide solution and further washing with tetrahydrofuran, the resin is dried by passing nitrogen gas through it for several minutes.

Separately, dissolve a fully protected dinucleotide or mononucleotide in pyridine and add triethylamine.
After shaking and standing at room temperature for several hours, the solution was distilled off under reduced pressure, and the contents were azeotroped several times with lysine to form a triethylammonium salt. This is mesitylene-sulfonyl-
5-Nitrotriazole (0.3M) (MSNT, condensing agent) is dissolved in a pyridine solution, added to the previously dried resin, and reacted for 60 minutes at room temperature. After the reaction was completed, the reaction solution was removed, washed with pyridine, and dimethylaminopyridine (0,
The mixture is left for 5 minutes in a mixture of 1M) tetrahydrofuran-pyridine solution and acetic anhydride to mask unreacted hydroxyl groups. Finally, the resin is washed with pyridine to complete one cycle of the solid phase synthesis method. You can extend Chinchō by 1 or 2 in one cycle.

A completely protected oligonucleotide supported on a resin can be obtained by repeating the same operation and successively condensing mononucleotides or dinucleotides until a predetermined length is reached.

The resulting resin was added with tetramethylguanidinium-2-pyridinealdoximate (0.5M) in pyridine-water (9
0:10) solution and leave at 40°C for 1 hour. Then, the resin is separated through a Pasteur pipette filled with a cotton plug, the resin is washed alternately with pyridine and ethanol, and the washing liquid is combined with the furnace solution and concentrated at 40° C. under reduced pressure.

The residue was dissolved in 101,101 liters of ethyl ammonium dicarbonate aqueous solution (TEAB) and washed with ether.

The aqueous layer is subjected to Sephadex G-50 column chromatography and eluted with 10w+M TEAB solution. The absorbance of each fraction is measured at 260 nw+, and the fraction containing the first eluted peak is concentrated. The residue is fractionated and purified using, for example, high performance liquid chromatography until a single peak is obtained. Since the 5'-end of the oligonucleotide purified in this way is still protected with a dimethoxytrityl group, it is treated with an 80% acetic acid aqueous solution for 15 minutes to remove dimethoxytritylation, and then subjected to high-performance liquid chromatography, etc. Purify until a single peak is obtained.

An outline of the synthesis of oligonucleotides by the above-mentioned solid phase method is shown in the following equation.

<Production process> L The thus purified oligonucleotides are used for producing blocks and subunits after their base sequences are confirmed by the secondary development method using homochromatography and the Maxam-Gilbert method.

Confirmation of the base sequence by the secondary expansion method is performed using the method of Wu et al. (E
, Jay, R.A., Balbara, R.

Padmanabhan and R.Wu,
Nucleic Acids Res, supra, 331
(1974)).

In this method, first, distilled water is added to a freeze-dried oligonucleotide to dissolve it to a concentration of about 0.1 μg/μQ. Take a part of this and add γ-52P-ATP and Tt
The 5' end is labeled with 32p using polynucleotide kinase, followed by partial degradation using snake venom phosphoosiesterase. Spot this on cellulose acetate,
After performing separation based on base differences by electrophoresis as the first dimension, transfer to diethylaminoethyl cellulose (DEAE cellulose plate''),
Oligonucleotides are separated by chain length by performing secondary round interlayer separation using a limited degradation product of RNA called homomixture (this operation is called homochromatography). Furthermore, the nucleotide sequence of the oligonucleotide was determined by autoradiography.
It is something to be read from the beginning. If it is difficult to confirm using this method, analyze using the Maxam-Gilbert method as necessary (A, M).

Maxa II and W, G11bert, Pr
oc, Natl.

Acad, Sci, USA, 74.560 (197
7), A., M., Maxam and W.

(3Nbert, 1vlethods in E
nzyw+o1. , Vo165゜p 499. ,
Academic Press 1980).

This is also called a chemical decomposition method, and uses a reaction specific to the base to cleave it at the position of the base.
The sequence is read sequentially from the 5' or 3' side based on the bands that appear by electrophoresis. As for base-specific reactions, guanine is specifically methylated by dimethyl sulfate, guanine and adenine are both depurinated by acid, and thymine and cytosine co-react with hydrazine under low salt conditions. However, it takes advantage of the fact that hydrazine reacts only with cytosine under high salt conditions. After the reaction with the above four types of bases is completed, the DNA strand is cleaved at the position of the base by reaction with piperidine, such as decomposition, substitution, β-dissociation, etc. The base composition can be determined by performing electrophoresis using polyacrylamide gel on the four types of reactants mentioned above, and depending on which reaction a band is generated.

Next, each oligonucleotide is ligated. That is, in order to properly link the oligonucleotides, the 16 types of oligonucleotides A-1 to A-16 corresponding to subunit A were added to A-1, A-2, A-3, A-1, A-2, A-3, and A-1 as shown in FIG.
Block 1 consisting of A-14, A-15 and A-16 and A-4, A-5, A-6, A-11, A-12 and A-
Block 2 consisting of 13 and A-7, A-8, A-9
and A-10 are divided into three sets and connected, and after separating those of a size that are considered to be correctly combined, these are further connected to obtain subunit A. Specifically, a part of the 5' end of 16 types of oligonucleotides A-1 to A-16 was labeled with 32P using γ-52P-ATP and Tt polynucleotide kinase, and then ATP'
phosphorylates the remaining OH at the 5' end. Next, each of the three sets of blocks was ligated using TaDNA ligase and ATP at 4°C in one apparatus, separated by 8% polyacrylamide gel electrophoresis, and further incubated at 4°C. Part of the DNA is ligated using Ta DNA ligase and ATP. The 5' ends of A-1 and A-9 are rotationally symmetrical because they are recognition sites for restriction enzymes, and can form a dimeric structure. Therefore, the finally obtained ligation product of A-1 to A-16 was extracted with restriction enzyme 1:coR.
Subunit A is obtained by cleavage using I and BalllHI. This contains a portion of 32p and is also small in quantity, so as shown in Figure 1, pBR32 is used as a vector.
A recombinant plasmid called DLJGI was created by cutting 2 with EOORI and BalHI r and incorporating subunit A into it. In subunit B, similarly to subunit A, the 16 oligonucleotides B-1 to B-16 are divided into four blocks as shown in FIG. 2 and linked.
These are further connected. This is the regulatory enzyme Hindl.
Cleavage with [[ and Ba1lHI yields subunit B.

In this case as well, for the same reason as subunit A, as shown in Figure 2, p BR322 is converted to Hindl [[ and BaI! 9LJG2 was created by cutting the lH construction and incorporating subunit B into it.
Create something called

Furthermore, as shown in Figure 3, pUGl was combined with Hindll [and 3
The pLIG3 containing the structural gene for β-urogastrone is created by cutting it with Al and inserting what was extracted from pUO3 using the same restriction enzyme.

1) UGl, 1) UO3 and p UO3 are obtained by integrating subunit A1, which is the first half of the structural gene of β-urogastrone, subunit B, which is the second half, and the entire structural gene into the vector EIBR322.

These plasmids were transformed using the calcium method (
E., Lederberg, 3.

Cohen, J., Bacteriol.
119. 1072 (1974)), it can be added to Escherichia coli 88101 strain and multiplied in large quantities.

D LIGl, I) To confirm whether UO3 and pUO3 exist in the host, after separating the plasmids by alkaline extraction, pUGl and pUO3 are extracted from Ba1, which is not present on vector pBR322.
It can be determined by whether there is a recognition site for I[. Again o U
O3 and pLIG3 are the same <MI not on pBR322
It can also be determined by whether or not it is disconnected by LII. To explain the alkaline extraction method, E. coli is cultured at 37°C, collected, and lysozyme is activated to dissolve the outer membrane.
Denature the DNA with a mixture of 2N sodium hydroxide and 1% sodium lauryl sulfate, and add 3M sodium acetate pH 4,
This method takes advantage of the property that when neutralized in step 8, DNA derived from chromosomes remains denatured, but extranuclear plasmids return to their original state. When obtaining a large amount of highly pure plasmid, it can be further separated from RNA by density gradient ultracentrifugation using cesium chloride and ethidium bromide and passing through a Biogel A 501 column.

Thus, the β-urogastrone gene is obtained.

Next, a method for transforming and expressing the β-urogastrone gene in host cells will be described. Although any known host cell can be used, E. coli is preferably used.

Examples of methods for expressing the β-urogastrone gene using E. coli include a system in which β-urogastrone is directly expressed, a system in which it is expressed as a fusion protein with a heterologous protein such as β-lactamase, and the like.

In order to directly express the β-urogastrone gene,
It is necessary to introduce a promoter and an SD sequence upstream of the gene in order to make the gene work. Promoters are not particularly limited, but include promoters of high expressivity, such as λP, which is the leftward promoter of λ phage.
L% Escherichia coli β.

- 1acUV5 and the like located upstream of the galactosidase gene are preferred. When APL is used as a promoter, the SD sequence is not particularly limited, but AGG
It is preferable to use the 4 base sequence of A. Furthermore, when IacUV5 is used as a promoter, it is preferable to use the SD sequence that exists as a set with IacUV5 as it is, or to use one that is chemically synthesized.

A case will be described in which the APL-8D sequence-β-urogastrone gene is used as the β-urogastrone gene direct expression system in the present invention.

In this case, although APL is a strong promoter (J, Hed!l1l), both et al.
ular and Qeneral Genetic
s, 163.197-203 (1978)), λP
Since the plasmid incorporating the L promoter alone exhibits a lethal effect on host E. coli, it is necessary to allow APL to act after E. coli has been grown under conditions that do not exhibit a lethal effect. On the other hand, Cl857, a gene in λ phage
is a temperature-sensitive mutation of the CI repressor that acts on the operator of APL, and is a temperature-sensitive mutation of the CI repressor that acts on the APL operator.
In this case, the CI repressor binds to the APL operator and completely suppresses its promoter activity, allowing E. coli to grow. Therefore, by culturing and propagating under these conditions and then raising the temperature to a high temperature (37°C or higher) (referred to as heat induction), the CI repressor can be denatured and inactivated, and the λPL promoter can be activated for the first time. . Also, s of pscroll etc.
Tringent replication machine m'rr: Plasmids with a relaxed replication mechanism such as Motsuy lasmid and pBR322 can coexist within the same E. coli cell without showing any incompatibility.

Taking the above points into consideration, we constructed plasmid pGH37 in which the Cl857 gene was integrated into the tetracycline-resistant Bunsmid vector+SC101 (lac UV5 promoter was placed upstream of it to ensure efficient expression of Cl857). and then incubate it with E. coli (H810'i
strain) and transformed it (ECI-2 strain),
It was considered appropriate to use it as a host for the β-urogastrone expression vector.

According to the present invention, ECl-
Two useful plasmids were retained in E. coli by transforming the two strains. 11 Two Plarv
id 5yste11 is completed.

As a result, for example, at the time of culturing at 30°C, pGH3
The CI repressor from 7 binds to the APL operator inserted into the second plasmid, allowing E. coli to proliferate itself.

After sufficient growth in this state, when the temperature is raised to 40°C and cultured, the CI repressor is inactivated and dissociated from the operator, so the λPL promoter becomes active and β-
Urogastrone becomes expressed.

A similar idea is fibroblast interferon, 5
V-40 small has been used to express antigens, etc., but in these cases, the Cl857 gene is the DNA of the λ phage integrated into the host chromosome,
In other words, a so-called λ lysogen was used as a host. (R.

Deryck et al., Nature;
287.193-197 (1980), C, De
rom et at.

Gene, 17.45-54 (1982), K.

Kljpper et at, Nature,
289.555 ~ In contrast, in the system of the present invention, another plasmid exhibiting tetracycline resistance contains Cl85
Since the 7 genes are combined, there is no risk that the λ phage integrated into the host chromosome will be induced to proliferate, and the strain can be easily managed.

Of course, this is the first time that this has been applied to a β-urogastrone expression system.

Next, a case will be described in which a part of the β-lactamase gene and the β-urogastrone gene are linked and the β-urogastrone gene is expressed as a fusion protein. The advantages of this method are that β-urogastrone is protected as the fusion protein is difficult to be degraded by proteases within the large mm, and that the fusion protein migrates and accumulates in the periplasmic layer of the Oshima bacterium. e
t at.

Proc, Natl, Acad, Sci,
USA, 78°5401-5405 (1981))
In addition, the localization facilitates separation and purification.

Specifically, an appropriate restriction enzyme cleavage site in the β-lactamase gene encodes two basic amino acids that can serve as enzyme cleavage sites that allow β-urogastrone to be excised and removed from the fusion protein. After inserting the gene, the β-urogastrone gene may be linked.

In the above, the sequence of two basic amino acids is -
Lys-Ara- or -Arg-LV8- is preferred. Examples of enzymes that recognize this amino acid sequence and cut out β-urogastrone from the fusion protein include kallikrein and trypsin. Furthermore, restriction enzymes that cut the β-lactamase gene include, for example, X*FI, HinclI, 3caJ, P
Examples include vuI, PstI, BolI, and BaO.

According to the present invention, the β-lactamase β-urogastrone recombinant plasmid combined as described above can express a large amount of the fusion protein in E. coli.

The above expression system can be confirmed by directly analyzing the gene base sequence using the Maxam-Gilbert method, or by confirming gene insertion and its direction by mini-prevalence or mapping methods ().
1. CC031rnboi+ etc., Nucleic A
c1ds Research, 7.1513~1
523 (1979)), radioimmunoassay for β-urogastrone, etc.

By culturing the thus obtained transformant of the present invention according to a conventional method, the desired β-urogastrone can be collected in large quantities and with high purity.

EXAMPLES Hereinafter, the present invention will be explained in more detail with reference to Examples.

Example 1 1% cross-linked polystyrene resin [RS-XIJ (200-400 mesh) manufactured by Bio-Ra Laboratories] was mixed with N-(chloromethyl)phthalimide (2.41 g), trifluoromethanesulfonic acid (0.22 mG) and dichloromethane ( 50II112) at room temperature for 2 hours. After the reaction, the resin was separated from the furnace and dichloromethane,
After sequentially washing with ethanol and methanol and drying under reduced pressure, a 5% solution of drazine in ethanol (50!IQ) was heated and refluxed overnight. The furnace-separated resin is converted into ethanol,
After sequentially washing with dichloromethane and methanol, it was dried under reduced pressure. Aminomethylated polystyrene resin (2,5a) obtained by the above operations, monosuccinic acid ester of 5'-o-dimethoxytrityl nucleoside (0,75-
M), dicyclohexylcarbodiimidopyridine (1aM) was added to dichloromethane (301G) and left overnight at room temperature. After washing the separated resin sequentially with dichloromethane, methanol, and pyridine,
Anhydrous vinegar 1! (90:10) and left at room temperature for 30 minutes. The obtained nucleoside-supporting resin was separated, washed with pyridine and dichloromethane, dried under reduced pressure, and used for solid phase synthesis reaction.

Synthesis of 0 dinucleotide A specific operation will be described using the synthesis of a dinucleotide having a completely protected TA base sequence as an example. Adenosine (13,14 g) whose 5' hydroxyl group was protected with a dimethoxytrityl (DMTr) group and the amino group with a benzoyl group and triazole (6,34o) were dissolved in anhydrous dioxane, and 8.35-triethylamine was added under water cooling. 0-Chlorphenyl phosphate dichlororesort (6,86!J) after 10
The mixture was added dropwise over a period of minutes, and then stirred at room temperature for 2.5 hours.

The generated triethylamine hydrochloride was removed by chance, the furnace liquid was concentrated to about 2/3, and β-cyanoethanol (3,6a
) and 1-methyl-imidazole (4,8111) were added and stirred at room temperature for 3 hours, and the reaction solution was concentrated under reduced pressure.

The residue was dissolved in ethyl acetate, washed three times with 0.1M sodium phosphate water m'a and twice with water, and then concentrated under reduced pressure to obtain a crude product 19.960. It was subjected to silica gel column chromatography and chloroform-methanol (9
8:2).

By repeating this purification operation, completely protected adenosine mononucleotide 15.12G was obtained. Adenosine mononucleotide 7.81 thus obtained
The mixture was added to a 2% solution of benzenesulfone in chloroform-methanol (70:30) and stirred for 20 minutes under water cooling. After neutralization with an aqueous sodium bicarbonate solution, the separated chloroform layer was washed with water and concentrated under reduced pressure to obtain a crude product of 7.110. This product was subjected to silica gel column chromatography and eluted with chloroform-methanol (97:3) to obtain 4.31 (l) adenosine mononucleotide with the 5' hydroxyl group free.

Thymidine (1,6413) whose 5' hydroxyl group was protected with dimethoxytrityl group and triazole (0,95o) were
Dissolve 11Q in anhydrous dioxane and add triethylamine (
1,251119), and then add O-chlorphenyl phosphate dichlororesort (0.69 m
G) was added dropwise over 5 minutes, and then stirred at room temperature for 1 hour. After the reaction was completed, the triethylamine hydrochloride formed was separated off, 1M pyridine aqueous solution 1.111112 was added to the furnace solution, and after stirring for 10 minutes, the 5'water WI group-free adenosine mononucleotide (1,170) obtained above was obtained. dioxane solution (101G) and 1-methylimidazole (0,72-)
was added and stirred at room temperature for 3 hours. After the reaction was completed, the residue obtained by concentration under reduced pressure was dissolved in ethyl acetate, washed with a 0.1M aqueous sodium phosphate solution and then with water, and concentrated under reduced pressure to obtain a crude product of 2.39°. This was subjected to silica gel column chromatography and eluted with chloroform-methanol (98:2) to obtain the completely protected dimer TA of 2.39a.

We describe the solid phase synthesis of the undecanucleotide AATTCGAAGAT, the oligonucleotide A-1, the undecanucleotide AATTCGAAGAT.

Separately prepared nucleoside T-supported resin 4011 (
+ was placed in a reaction tube, and after washing three times with dichloromethane-isopropanol (85:15), the dimethoxytrityl group at the 5' position was removed with a dichloromethane-isopropanol solution of zinc bromide (1M).

This operation was repeated several times until the solution was no longer colored. After washing with dichloromethane, the resin was further washed with a dimethylformamide solution of triethylammonium acetate (0.5M) to remove remaining ZnQ+, and after washing with tetrahydrofuran, nitrogen gas was passed for several minutes to dry the resin.

Separately prepared fully protected dinucleotide GA50
1! Dissolve J in pyridine (1-) and dissolve triethylamine (
11111) was added, shaken and left at room temperature for several hours, the solution was distilled off under reduced pressure, and the contents were azeotroped several times with lysine to form a triethylammonium salt. This was mesitylene-sulfonyl-5-nitrotriazole (0,
3M) in pyridine solution, added to the previously dried resin, and reacted for 60 minutes at room temperature. After the reaction was completed, the reaction solution was removed, washed with pyridine, and left for 5 minutes in a mixture of dimethylaminopyridine (0.1 M) in a tetrahydro7-pyridine solution (0.812) and acetic anhydride (0.2111). Unreacted hydroxyl groups were masked.Finally, the resin was washed with pyridine to complete one cycle of the solid phase synthesis method.Two chains can be extended in one cycle.Similar operations were repeated to obtain dinucleotides AA and CG.
, TT, and AA were sequentially condensed to obtain a protected undecanucleotide AATTCGAAGAT supported on a resin.

Tetramethylguanidium-2- was added to 20 u of the obtained resin.
Add 0.6 of a solution of pyridine aldoximate (0.5 M) in pyridine-water (90:10) and leave at 40°C for 1 hour. The resin was washed alternately with pyridine and ethanol, and the washing liquid was combined with the liquid and heated under reduced pressure for 40 minutes.
Concentrate at °C. The residue was dissolved in 2 mg of 11011I triethylammonium dicarbon WI salt aqueous solution (TEAB) and washed three times with ether. Sephadex G-
50 columns (2xlOOcm) and 101MTEA.
It was eluted with B solution. The absorbance of each fraction was set to 26 On.
The fraction containing the first eluting peak was concentrated. The residue was fractionated and purified by high performance liquid chromatography (bomb: Model 6000A manufactured by Waters, detector: Model 440 detector) until a single peak was obtained. The column for high performance liquid chromatography was μ-BOndapak C+ a (manufactured by Waters), and the elution solvent was (5→40%) acetonitrile-0.1 Mmtrinitriethylammonium acetate aqueous solution. Since the undecanucleotide purified in this manner is still protected at the 5' end with a dimethoxytrityl group, it is treated with an 80% aqueous acetic acid solution for 15 minutes to remove dimethoxytritylation, and then subjected to high-performance liquid chromatography again. Purified to a single peak. High performance liquid chromatography (D column)
k C+ a (manufactured by Waters) (5 → 25
%) acetonitrile-0.1 M aqueous triethylammonium acetate solution.

Thereafter, oligonucleotides A-2 to 16 and B-1 to 16 were synthesized in the same manner.

The yields and yields of A-1 to 16 and B-1 to 16 obtained above are shown in Tables 1 and 2.

The yield of the synthesis reaction in the solid-phase synthesis of oligonucleotides was calculated from the amount of dimethoxytritanol eliminated in each cycle. A jar of dimethoxytritanol is 60
5% perchloric acid-ethanol (60:40) solution
It was determined by measuring the absorbance at 000 cm.

Solid phase synthesis was carried out using 40 rag resin (nucleoside containing 10.
10+M/.

resin) was used. The yields up to one stage before the final stage are shown in Table 1 below.

Furthermore, after the final cycle, the oligonucleotide of interest is removed from the resin and then deprotected to obtain dimethoxytritanol contained in the reaction mixture, making it impossible to measure the absorbance of only dimethoxytritanol. It is difficult to determine the total yield of the condensation reaction including the final step.

Table 1 Furthermore, the yield of each oligonucleotide is shown in Table 2 below when the oligonucleotide was cleaved from the resin, deprotected and purified using 20Il1g of the resin after solid phase synthesis was completed.

The yield was determined by measuring the absorbance of the final purified product at 260 ni and converting it from the sum of the absorbances of the nucleotide bases. still,
In the synthesis of oligonucleotides, yield is not really an issue, but purity is. Therefore, since only the central portion of the peak was collected at each stage of purification, the yield was low and the total yield of the final product was 1 to 2%.

0 oligonucleotide base was analyzed by a secondary development method using homochromatography using WU or the like. Below, oligonucleotide A
-3 will be described as an example.

Oligonucleotide A-35μQ was dissolved in 50μQ of distilled water, and 7μQ of this solution was added with 250ffiM Tris-HCl (11H7,6>, 50M magnesium chloride, 10μQ of distilled water).
1M spermine, 50mM dithiothreitol (DTT)
) and then 0.5μ of a γ-52P-ATP aqueous solution (rPB10168J manufactured by Amersham).
Q and Tt polynucleotide kinase (Takara Shuzo No.
.

2020A) 0.5μQ, further Gcil water 16μ
Q was added to make a total of 30 μQ. This was left in a water bath at 37°C for 60 minutes, and the 5' end of the oligonucleotide was labeled with 32p. The reaction was stopped by immersing it in a 100°C water bath for 2 minutes, and after concentrating the total amount to about 5μQ,
Spotted on a DEAE cellulose plate (manufactured by Machier-Nagel) cut into 20 cm x 20 cm pieces, homomixture ■ (rYeast RNA manufactured by Sigma) was spotted.
Take 100 pieces of TVI) e VIJ, shake with 5M potassium hydroxide aqueous solution 8μQ1 water 42mL for 24 hours at 37℃ to decompose, neutralize with 1N hydrochloric acid, dissolve 210g of urea, and then adjust the total amount to 500111111 and heat to -20℃. save. Dissolve and filter before use)
(This is called homochromatography because it is developed at 0°C.) The development was carried out by spotting 0.1% aqueous solutions of each of Xylene Sea Tool FF, Orange G, and Acid Tsukusin as markers, and continued until the blue marker of the Xylene Sea Tool FF rose about 10 cm. After drying, the plate was wrapped in polyvinylidene chloride film and an autoradiogram was taken. Approximately 15 minutes of exposure time at room temperature was sufficient.

The X-ray film was developed, and the spot position of the 32p-labeled oligonucleotide was transferred to tracing vapor, and based on this, a rough mark was made on the DEAE cellulose plate. DEAE cell O- at spot position
After washing with ethanol, the solution was eluted with a TEAE II equilibrated solution (a 1M aqueous solution of triethylamine dicarbonate, in which triethylamine was dissolved in water by dropping it little by little while passing carbon dioxide gas through it). Dry in a concentrator, TEA
After removing the E buffer, the counts were determined and 1000 cp
It was dissolved in distilled water so that the ratio was 1/μQ. This is 7μQ
0.4 II each! Transfer to three 2-volume reaction tubes and add 25
01M Tris-hydrochloric acid (1)H8,0), 2μQ each of 50111M magnesium chloride and snake venom phosphoosyesterase (N0.1 manufactured by Boehringer Mannheim Yamanouchi)
08260) in water to give 0.1μg/μQ, 0.2
Add 1 μQ each of μg/μQ and 0.5 μg/μQ to one reaction tube and store at 37°C for 3 hours.
The reaction was allowed to proceed for 0 minutes. The reaction was stopped by adding 5 μQ of 51 M EDTA dinatosanodium aqueous solution '7.0) and immersing it in a 100°C water bath for 2 minutes. A portion of this was spotted on a DEAE cellulose plate and homomixtured. V or ■ (rYeas manufactured by Sigma)
tRNA Type VIJ 10Q is decomposed by shaking it with 5M potassium hydroxide aqueous solution 10- and water 40- for 24 hours and is V, and the one decomposed by shaking for 48 hours is ■.Both were dissolved in 1N hydrochloric acid after decomposition. Neutralize with
After dissolving 210g of urea, all! @500m12 and store at -20℃. Dissolve and filter before use. ) was used to perform homochromatography, and autoradiography was used to confirm whether partial decomposition was complete.

In the case of oligonucleotide A-3, 11 spots were observed, confirming that the partial decomposition was successful. 1
After 1N, 1μQ of it was taken and added to cellulose acetate H (manufactured by Mathier-Nagel, 50cm x
Cut 35co+later into two 25C11X36(Il
A spot was placed in the center of the line drawn with a pencil. At both ends, 0.5μQ of each 0.1% aqueous solution of Xylene Cyrtool FF, Orange G and Acid Tsukusin was used as a marker.
It was spot on. This was electrophoresed in an acetic acid and pyridine aqueous solution, and stopped when the blue marker spot of the xylene cyan tool FF and the yellow marker spot of the orange G had a difference in travel distance of about 10C11 (approximately 45 minutes at 1800V). ). Dry with a hair dryer and remove 1.5 CI from one end of DEAE cellulose plate (20c*X 20cm)
! The lower end of the cellulose acetate membrane was aligned with the line drawn at the 1 position and placed on the membrane. Place 5 to 6 sheets of Whatman 3MM paper (cut into 2.5cm x 20cm pieces) moistened with distilled water on top, add a glass plate and a weight of about 2kg, and leave it for about 40 minutes to form the oligomer part. DEA the decomposed product
Transferred onto E-cellulose plates. Remove cellulose acetate membrane and Whatman 3MM paper and apply DEAE
After expanding the plate to about 10 cm with distilled water, expand it with homomixture ■. Transfer to a tank and heat at 70℃ for about 2 hours.
Time unfolded. After development, it was dried, and a 32p label aqueous solution was spotted and dried at the origin, blue marker, and yellow marker positions of the first dimension, and at the positions of the secondary round blue marker and yellow marker. Autoradiography was performed by wrapping in polyvinylidene chloride film, and the xm film was developed and analyzed.

As for A-3, as shown in Figure 4, the GAT is connected from the 5' side.
Confirmed as TCTGAGTG.

A-1, A-2, A-4 to A-16 and B-1 to B-1
6 was similarly analyzed and confirmed to have the predetermined base sequence.

Furthermore, the base sequence of each oligonucleotide was
It was also analyzed using the Gilbert method. Hereinafter, oligonucleotide A-6 will be described as an example.

Add 610 μg of oligonucleotide A to 100 μQ of distilled water.
7 μQ was taken and the same procedure as in the case of A-3 was carried out to obtain a product labeled with 5'321. This was dissolved in 30μQ of distilled water and divided into four 1.51111 volume Etzbendorf tubes: 2 5μQX and 2 10μ9X. One of the 5μQ was used for guanine reaction, and 200μQ of DMSII solution (50mM sodium cacodylate (+) H8,O), 1iM disodium EDTA) was added II! 1 μQ of dimethyl was added and reacted at 20° C. for 30 minutes. Next, 50 u of DMS reaction stop solution (1.5 M sodium acetate (pH 7.0), 1 M mercaptoethanol, 100 μo/wltRNA)
Q and 750ttQ of cold ethanol were added and placed in a water bath for 5 minutes to precipitate the DNA. After centrifuging and discarding the supernatant, immediately add 250 μQ of 0.3M sodium acetate aqueous solution to dissolve it, then add 750 μQ of cold ethanol again to remove the
The DNA was precipitated by standing at ℃ for 5 minutes. After centrifugation, the supernatant was discarded, and the precipitate was washed twice with 70% ethanol.

For the reaction between guanine and adenine, add 30μQ of distilled water to a tube containing 10μQ, add 10μQ of 1M vinegar,
The reaction was carried out at 45°C for 90 minutes.

Then Hz reaction stop solution (0.3M sodium acetate, 0.3M sodium acetate, 0.3M sodium acetate,
1-M EDTA disodium, 50 μg/ml
t RNA) and 750 μQ of cold ethanol were added and placed in a water bath for 5 minutes to precipitate the DNA. After centrifugation and discarding the supernatant, immediately add 250μQ of 0.3M sodium acetate aqueous solution to dissolve, and then add 7 mL of cold ethanol again.
DNA was precipitated by adding 50 μQ and placing at 0° C. for 5 minutes.

Centrifuge, discard the supernatant, and dissolve the precipitate in 70% ethanol.
Washed twice.

For the reaction of thymine and cytosine, add 10μQ of distilled water to a tube containing 10μQ, and for the reaction of only cytosine, add 5μQ of distilled water.
Add 15 μQ of 5M sodium chloride aqueous solution to the tube containing Q.
and after adding 30 μQ of hydrazine in both cases,
The reaction was carried out at 5°C for 40 minutes. After the reaction was completed, the same operation as in the case of the reaction between guanine and adenine was performed.

After modifying the base as described above, 100 μQ of a 1M piperidine aqueous solution was added, and the mixture was reacted at 90° C. for 30 minutes. After quenching in water, it was suction-dried in a concentrator. Next, add 50μ of distilled water to completely remove piperidine.
Dissolution was repeated twice for each Q, twice for 30με, and twice for 20μQ, followed by suction drying, and the process was repeated until the smell of piperidine disappeared. The counts of the four tubes were measured and the dye solution (80% formamide (mixed H-type and OH-type desalted with ion exchange resin), IIM EDTA disodium, 1
0mM sodium hydroxide, 0.1% xylene cyatool, 0.1% bromophenol blue) were added, heated at 90°C for 2 minutes, then rapidly cooled, and gel electrophoresis was performed. The gel is 12.5% polyacrylamide, 50% urea.
It was used after performing preliminary electrophoresis for more than 1 hour.

After electrophoresis, wrap the gel with polyvinylidene chloride film.
Autoradiography was performed.

-80℃, - After late exposure and development, A-6 is T from the 5' side.
It was confirmed that the base sequence was CTGCACGACGGT.

Other oligonucleotides A-1 to A-5, A-7 to A-
16 and B-1 to B-16 were similarly confirmed to have the predetermined base sequences.

Next, in order to construct an oligomer block of oligonucleotides, oligonucleotide blocks and subunits were constructed according to the procedure shown in FIG. 1.More details are as follows.

First, A-1, A-2, A-3, A-14, 8-15, and A-16 were each weighed in an amount of about 5 μQ into a 1.5-volume Etzbendorf tube.

50 μQ of distilled water was added to dissolve the solution at a concentration of about 0.1 μg/μQ. 10μQ each of these six types of aqueous solutions (DNA
Separately prepared 2501M Tris-hydrochloric acid (p
H7,6), 6μ91 of a mixture prepared to have 50mM magnesium chloride, 101M spermine, 50mM DTT, then 0.5μQ of γ-32P-ATP aqueous solution (manufactured by Amersham) and 0.5μQ1 of Tt polynucleotide kinase (manufactured by Takara Shuzo ■) Add 13μQ of distilled water to make 30μQ, react at 37℃ for 30 minutes, and then add 30μQ of distilled water.
1 μQ of M ATP aqueous solution was added and the reaction was further continued for 30 minutes. The reaction was stopped by heating at 100° C. for 2 minutes and quenched in ice. A-1, A-2, A-3, A-14, 8-15, and A-16 whose 5' ends were phosphorylated in this way were separated into 10 μQ each in one separate 1.
Transfer 2501M Tris/hydrochloric acid aqueous solution (pH 7.6) to a 5°C Eppendorf tube and add 40μQ150M
40 μQ of magnesium chloride and 35 μQ of distilled water were added to give a total concentration of 175 μQ, and the mixture was heated at 90° C. for 2 minutes. After heating, naturally cooling and returning to room temperature, 200 m M
DTT aqueous solution 10 μQ, 201M ATP aqueous solution 10
μQ and T, DNA ligase (■Nirabon Gene) 5
Add μQ (100 units) and react overnight at 4°C.
-16 linked oligonucleotide block 1 was constructed.

A-4, A-5, A-6, A-11, A-12 and A-
Block 2 of 13 was constructed in the same way.

For blocks 3 of A-7, A-8, A-9 and A-10, after phosphorylating the 5' ends, 10 μQ each was taken and added to a 2501 M Tris/HCl aqueous solution (E) H7,6.
) to 40tIQ, 5011M magnesium chloride to 40μ
Add Q and 55μQ of distilled water to make a total volume of 175μQ9.
It was heated at 0°C for 2 minutes. After heating, naturally cooling and returning to room temperature, 10μQ of 200w M DTT aqueous solution,
10 μQ of 20111 MATP aqueous solution and 5 μQ (100 units) of TA DNA ligase (manufactured by Nirabon Gene) were added, and the mixture was reacted overnight at 4° C. for ligation.

D
NA was precipitated, 12.5% polyacrylamide gel electrophoresis was performed, and autoradiography revealed 72b, p, and 36b, 11. for block 1. For block 2, cut out the band at position 36b, I), for block 3, cut out the band at position 48 b, p, and 24 b, p, respectively,
10IM Tris-HCl (pH 7,6), 10+gM
E[lTA disodium aqueous solution was added and allowed to stand at room temperature overnight to elute.

Centrifuge to separate the supernatant, add phenol, shake well, centrifuge, discard the lower layer, add phenol, repeat the same operation twice, and add Sephadex G-
Phenol and acrylamide were removed through a column with a diameter of 1 C and a length of 20 CI packed with 200
After concentrating to μQ, add 2 times the volume of ethanol and
The mixture was allowed to stand for 30 minutes to allow precipitation.

The resulting three oligonucleotide blocks were combined and mixed with 501M Tris-HCl (pH 7,6), 101M magnesium chloride, and 20M DTT.

TA DNA ligase 5 as a mixture of 1mM ATP
μQ (100 units) was added and allowed to stand overnight at 4°C for ligation. 96 b, p,
and 192b, p, and 101M Tris/HCl (pH 7,6) and 10mM disodium EDTA aqueous solution were added to the band and partially allowed to elute at room temperature. Centrifuge to separate the supernatant, add phenol, shake well, centrifuge, discard the lower layer, add phenol, repeat the same operation twice, and add Sephadex G-50.
After passing through the column, it was concentrated, 2 volumes of ethanol was added, and the DNA was left to stand at -80°C for 30 minutes to precipitate the DNA.

This was cleaved with EcoRI and Ba1HI to obtain subunit A.

Similarly, as shown in Figure 2, B-1, B-2, B-
15 and B-16 are connected to form block 4, B-3,
Connect B-4, B-13 and B-14 to form block 5
, B-5, B-6, B-11 and B-12 are connected to form block 6, and B-7, B-8, B-9 and B-
10 are connected to create block 7, and 2 of each block is
6 b, p.

The bands of 104 b, p, and 208 b were collected by separating the bands of 104 b, p, and 52 b, p, and connecting them in the same manner.
, p, which is )(ind[[and 3am
Cut with HI. Subunit B was thus obtained.

As shown in Fig. 1, pBR322 was diluted with EcoRI and Ba1.
After cutting with HI and removing P on the 5' side with alkaline phosphatase (manufactured by Takara Shuzo) to prevent it from returning to its original state, subunit A was combined with this, and 501M Tris/hydrochloric acid (pH 7,6) was added. , 10mM magnesium chloride, 205M[)TT, and 1mM ATP, 5 μQ of TA DNA ligase was added, and the mixture was allowed to stand overnight at 4°C for ligation. Two volumes of ethanol was added and the mixture was allowed to stand at -80°C for 30 minutes to precipitate, centrifuged to dry the precipitate, and then dissolved in 100 μQ of distilled water. Thus, subunit A
A plasmid pUGl was obtained in which the following was incorporated into pBR322.

This plasmid p, UG1 was introduced into Escherichia coli strain 88101 by a transformation method using the calcium method.

That is, the E. coli H8101 strain used as a host was transferred to 50 m12 L.
B medium (1% Bactodrypton, 0.5% yeast extract,
0.5% sodium chloride) at 37°C and 610n
When the absorbance of m reached 0.25, the culture solution of 401112 was transferred to a centrifuge tube and incubated at 4°C and 6000 rpm for 10 min.
The mixture was centrifuged for a minute, the supernatant was discarded, the precipitate was suspended in ice-cold 0.1 M magnesium chloride 201111, and the mixture was centrifuged again under the same conditions, and the supernatant was discarded. The precipitate was suspended in 20Wl of ice-cooled 0.1M calcium chloride, 0.05M magnesium chloride solution. After cooling on ice for 1 hour, the mixture was centrifuged, the supernatant was discarded, and the precipitate was suspended in ice-cold 0, 1M calcium chloride, 0.05M magnesium chloride solution of 211112.

10 μQ of the above pUG1 aqueous solution was added to 200 μQ of this suspension, cooled on ice for 1 hour, and then placed in a 43.5°C water bath for 30 minutes.
Warmed for seconds. Then add 2.812 LB medium and 37
LB cultured at ℃ for 1 hour and supplemented with 50 μg/- of ampicillin.
Sprinkle 200μQ per Petri dish on a flat medium and heat at 37°C.
Cultured overnight. The grown colonies were further inoculated into both LB flat medium supplemented with 50 μg/ml of ampicillin and LB flat medium supplemented with 20 μg/ml of tetracycline, cultured overnight at 37°C, and those resistant to only 1 ampicillin were isolated. A transformed strain was obtained.

Next, plasmids were isolated on a small scale from this strain using the alkaline extraction method, and those containing the Ba1II cleavage site were selected.This was further cultured in a large amount of medium, and the plasmid pUGl was isolated using the same alkaline extraction method. was separated.

Next, the base sequence of subunit A incorporated into the obtained pUGl was extracted from the EC0RI cleavage site and Ba
The i+HI cleavage site was analyzed from two directions.

First, separately cut pieces were prepared using EOORI and 3a■HI. For those cut with EcoRI, P at the 5' end was removed with alkaline phosphatase, and then 5'32p was labeled using γ-52P-ATP and T4 polynucleotide kinase. Then EcoRI
The 5'32P-labeled product was cut with 5alI, and the approximately 380 b, p fragment was separated by 5% polyacrylamide gel electrophoresis. Furthermore, the fragment cut with BamHI was labeled with 5'32P in the same manner and then cut with PStI, and a fragment of approximately 860 b, p was isolated in the same manner. Crush the cut out gel and 10m
M Tris Salt 1 (E) H7, 6), 10th Corps M EDT
Elution was carried out with a mixture of disodium A disodium and left overnight at room temperature. Centrifuge to separate the supernatant, add phenol, shake, centrifuge, discard the lower layer, add phenol, repeat the same operation twice, and add Sephadex G-
50 column to remove phenol and acrylamide. Concentrate the solution and add 2 volumes of ethanol to -80
The DNA was precipitated by leaving it at ℃ for 30 minutes, washed twice with 70% ethanol, and then dried. It was dissolved in 30 μQ of distilled water, and the DNA base sequence was analyzed by the Maxam-Gilbert method described in the analysis of oligonucleotides. However, the conditions for chemical modification are different from those for oligonucleotides, and for the reaction of guanine, the conditions are
For the reaction of guanine and adenine, use 0.5M acetic acid and add 1μg/μQ of tRN instead of adding 30μQ of water.
11 μQ of aqueous solution A and 19 μQ of water were added. The reaction time was also set at 45°C for 20 minutes. The reaction of thymine and cytosine and the reaction of only cytosine were carried out at 23°C for 7 minutes.

Conditions other than the above were the same as for oligonucleotides. Depending on the number of bases to be analyzed, electrophoresis can be performed up to about 30 bases from the 5' end using a 12.5% polyacrylamide, 50% urea gel, or longer by extending the electrophoresis time on an 8% polyacrylamide, 50% urea gel. I was able to read the number of bases.

The analysis results are shown in Reference Photos 1 and 2. Lanes 1-4 are E
coRI-8alI fragment, lanes 5-8 are Ba
Results for the 5HI-PstI fragment. Lanes 1 and 5 show the guanine reaction products, 2 and 6 show the guanine+adenine reaction products, 3 and 7 show the thymine+cytosine reaction products, and 4 and 8 show the cytosine reaction products, respectively. Reference photo 2 is the result of electrophoresis of the same sample as reference photo 1 with different gel concentrations, and is on the high molecular weight side (reference photo 1).
(corresponding to the upper part) is enlarged. In this way, the base sequence of subunit A could be confirmed.

In the same manner, subunit B and pBR322 were cut with Hindl [[ and 3amHI, respectively, and the larger fragment was separated by electrophoresis and ligated to the plasmid pBR322 in which subunit B was integrated.
Obtained LIG2. H810 in the same way using this
One strain was transformed and colonies resistant only to ampicillin were selected. A plasmid was similarly collected from the colony,
The presence or absence of the BolI cleavage site and the presence or absence of the MIuI cleavage site were examined, and those containing both were selected. After culturing in large quantities, the plasmid pUO2 was collected and pLIG2
The base sequence of subunit B was analyzed from two directions.

That is, after cutting with Hindl[[ and Bag+HI and labeling each with 5′32p,
[For those cut with [, 5alI and BamH
Those cut with PstI were cut with PstI, and the 380 b, p and 890 b, p fragments were separated by 5% polyacrylamide gel electrophoresis.

Similarly, both were analyzed by the Maxam-Gilbert method.

The analysis results are shown in Reference Photo 3. Lanes 1 to 4 are Hind
m-8alI fragment, lanes 5 to 8 are the results of electrophoresis of the same sample at different gel concentrations, and are enlarged views of the high molecular weight side (corresponding to the upper part of lanes 1 to 4). The reaction products in each lane are the same as in Reference Photo 1. In this way, the base sequence of subunit B could be confirmed.

Next, as shown in FIG. 3, pUGl was cut with Hindll and 5alI, and the larger 7 grams were fractionated through a Biogel 1.511 column. Also, 9 UO2
was digested with HlndI[[ and 5alIt', and the smaller fragment was separated by electrophoresis. Combine both,
The β-urogastrone gene, which is subunit A+B, was ligated with T t D,'NA ligase to pBR32.
2+1 UO3 was obtained. This was used to transform E. coli strain H8101. In this case as well, it is resistant only to ampicillin and Mlu
Colonies containing a plasmid having the I cleavage site were selected, cultured on a large scale, and plasmid pUO3 was fractionated. Then, the base sequence of the β-urogastrone gene in EI UO3 was analyzed from two directions. That is, EcoRI and Ba
Label each cut with mHI with 5132p,
3 for those cut with EC0RI and labeled with 32p.
A fragment of approximately 550b,p was separated by cutting with an alkaline process, and Ba! Those that were cut with IHI and labeled with 32p were cut with PstI and a 900 b, p fragment was collected. The DNA base sequences of each were analyzed by the Maxam-Gilbert method.

The analysis results are shown in Reference Photo 4. Lanes 1-4 are BamH
Results for the I-PstI fragment. Lanes 5 to 8 are the results of electrophoresis of the same sample with different gel concentrations, and are enlarged views of the high molecular weight side (corresponding to the upper part of lanes 1 to 4). The reaction products in each lane are the same as in Reference Photo 1. Through this analysis, the base sequence of the β-urogastrone gene could be confirmed.

' An example in which β-urogastrone was expressed using the leftward promoter λPL of the λ phage will be specifically described below.

First, E. coli 881, the host of the APL expression plasmid,
We will describe the construction of ECl-2 strain derived from strain 01, the cloning of a DNA fragment containing the λPL promoter from the DNA of λCl857S7, a mutant strain of λ phage, and the construction of an expression plasmid. We will describe the expression of the vector in the host strain ECl-2.

(a) Construction of ECl-2 strain ECl-2 strain is E. coli 88101 strain carrying plasmid pGH37 expressing the Cl857 gene.

DGH37 was constructed as shown in FIG.

That is, first, λCl857S7 DNAeBllIIIr
Amputated. SI nuclease was used to decompose the single-stranded portion of the 5' end of the DNA generated at this time to make a blunt end. λCl857S cut with a Boll[
The reaction was carried out at 20°C for 30 minutes under conditions containing 1μ0 of y DNA and 200 units of S1 nuclease. From the blunt-ended DNA fragment thus obtained, 1.0% Aga O-
A 2385 base pair fragment containing the entire structural gene of Cl857 was isolated by gel electrophoresis. This fragment was inserted into the PvuI cut site of plasmid I) GLlol to construct plasmids pGH3,6 expressing the Cl857 gene under the control of the 1acUV5 promoter. Next, EIGH36 was digested with two restriction enzymes, EcoRI and PstI, and the resulting 1193 base pair fragment was inserted between the EcoRI and psB cleavage sites of plasmid E) SC101 to create plasmid pGH37.

Next, one of the strains obtained by transforming E. coli H8101 strain with pGH37 by the method described above was transformed into ECl-2.
It was named. This strain is tetracycline resistant and Cl85
7 genes, and can coexist with other plasmids derived from 4pBR322 and the like by transformation. Therefore, strain ECl-2 was used hereafter as a host for the λPL expression plasmid.

<b> Cloning of λPL promoter and construction of expression plasmid First, λCl857Sy DNA was cloned with tlORI and 5al.
λPL promoter, Cl857 gene,
A 5925 base pair fragment containing the λPR promoter region was taken and used as a plasmid E) with EcoRI of BR322.
and 5alI cleavage site to create plasmid pGH2.
5 was created.

Next, pGH25 was cut with Bawl (Ir) and ligated with DBR322, which was also cut with 13a HI, to form pGH25.
Created H34.

Subsequently, pGH34 was digested with Ava and Bgllet, cut into a blunt-end fragment of approximately 4500 base pairs with S1 nuclease, and circularized with Ta DNA ligase to construct plasmid 11GH35.

An outline of the series of operations is shown in FIG.

Next, EIGH35 was cleaved with Hl)aI, and a synthetic oligonucleotide C-
1-1 and C-1-2 were ligated, and plasmid pMC1403 cut with Baw+HI was further ligated to construct plasmid pEG-2. pEG-2 has an ampicillin resistance gene, and utilizes the SD sequences on synthetic oligonucleotides C-1-1 and c-1-2 under the control of the λPL promoter to generate β-galactosidase from the start codon on the same synthetic oligonucleotides. It is constructed to be translated.

Adapters c-1-i and C-1-2 have the following structure.

Plasmid pEG2 actually expresses β-galactosidase in the host EC-2 using the method of Miller (Miller, J. (1972) “Exper
iment in Molecular G
enetics ”New York, Colorado
3pring Harbor L aborato
ry 1) l) 352-355). In this method, the amount of enzyme is quantified using a color reaction in which the synthetic substrate 0NPG (orthonitrophenyl galactoside) is decomposed by β-galactosidase to produce yellow nitrophenol. Miller
The method will be explained in more detail below. The culture solution of the test bacteria whose absorbance was measured at 610 nm was 0.110 to 1.9
0 assay buffer (0,1M sodium phosphate J)
)17.0゜11M1aII Magnesium, 0.1M
B-Me) Lh-butomethanol) is mixed, 0.1-l of toluene is added and stirred vigorously for 15 seconds to increase membrane permeability, and the toluene is evaporated with an aspirator.

Add to this 0.2m12ONPG solution (400+gaONP
G (dissolved in 100-ml assay buffer) and shaken at 30°C for a certain period of time until it turns yellow.

Next, 0.511 G of 1M sodium carbonate is added to stop the enzyme reaction, and the absorbance at 420 ns and 550 nl is measured.

Bacterial liquid 11 brightened with absorbance at 610tv set to 1.0
The β~galactosidase activity in 111 is calculated by the following formula.

β-galactosidase activity ODa 2o -1,7
5X0Ds s.

(units) = x
root XV X0D6 +.

t: wA (Iin) during reaction ■=Amount of test bacteria added to reaction system (0.1m12) ODe
+ o: Absorbance of the test bacterium in the dark at 610°C As a result, when the ECl-2 strain carrying pEG2 was cultured at 30°C, the β-galactosidase activity was 98 units, but after pre-culture at 30°C When cultured at 42°C for 1 hour, the λPL promoter was activated and the β-galactosidase activity was 9637 units. As a result, in pEG2, β below the λPL promoter
- It was proven that the sequence up to galactosidase was correctly linked.

Next, pEG2 has Ba1lI cleavage sites at two sites, but only the BglI site located immediately after the SD sequence of β-galactosidase is required, and the other site is rather unnecessary, so it is cut with Baa + HI and recombined. , I) EK28 with the approximately 770 base pair Ba1HI fragment removed.
was created. With the construction of pEK28, an expression plasmid for the λPL promoter system was completed.

An outline of the series of operations is shown in FIG.

(C) Expression of fused gene between the first half of β-urogastrone and β-galactosidase First, a plasmid +)UGlol having a fusion gene between the first half of β-urogastrone and β-galactosidase was constructed as follows. That is, pMCI 403 containing 1) UGl and β-galactosidase genes, in which only the first half of β-urogastrone was cloned, was digested with BamHI and ligated to construct I) UGlol. In this plasmid, the first half of β-urogastrone and the β-galactosidase gene are linked in the same frame, so when this plasmid is expressed, it is expressed as a so-called fusion protein in which the amino acid sequences of both are linked.

Therefore, in order to express this under the control of the λPL promoter, pLIGlol and DEK28 were each inserted into B! 1
Cleaved with lII[.

A DNA fragment with a protruding 5' end was obtained, and when this was reacted with a large fragment of E. coli DNA bolamerase (K lenow fragment), do (GATC) was added in the presence of four types of nucleotides. Produces blunt ends.

Here, if only d-GTP is added as a nucleotide, only d-guanosine is added and the single-stranded part is broken down using flarese, resulting in d-GTP.
and d ATP is added to perform the TeK Ienow reaction, and then digested with S1 nuclease. d TTP is added and K
Obtained after carrying out the lenow reaction. Also K l
s1 without performing an enow reaction. 5.
type of blunt ends will be obtained.

Here, the conditions for the K lenow reaction and the S1 nuclease reaction are as follows.

* Klenow reaction conditions: Potassium phosphate buffer (pH 7,4) 40mM, β-mercaptoethanol 1sM, magnesium chloride 101M.

The reaction was carried out at 12° C. for 30 minutes under conditions containing 1 μ0 of substrate DNA and 1 unit of enzyme (Klenow 77 component) in 50 μQ of a reaction solution containing 11 RM each of ATPlm M and deoxyribonucleotide trisic acid.

*S1S1 nuclease conditions: 20011M sodium chloride, 30mM sodium acetate, 5sM zinc sulfate (
20°C under conditions containing 1 μg of substrate DNA and 200 units of enzyme in 100 μQ of the reaction solution of El ) (4, 5).
, react for 30 minutes.

Therefore, pEK38 and pLIGlol were each 3a
After cutting with ll[, each fragment was subjected to a combination of K Ienow reaction and 81 nuclease reaction to obtain fragments each having five types of blunt ends. By combining these two, as shown in Table 3, the SD array and
There are 21 possible combinations in which the number of bases and sequences between the start codons of the fusion protein differ from each other.

In reality, the DNA fragments obtained in this way are then
After cutting with l engineer, a fragment containing the gene for the first half of β-urogastrone and β-galactosidase fusion protein was obtained from pUGlol, and λP was obtained from pEK28.
Fragments containing the L promoter were isolated and these were ligated with Ta DNA ligase in the combinations shown in Table 3.

As a result, a recombinant expressing fusion protein No. shown in Table 4 was obtained. For these, the β-galactosidase activity of the expressed fusion protein was measured by Mil.
It was measured by the method of ler. As a result, as shown in Table 4, all showed relatively high expression levels, but especially pUG
103.1) It was revealed that UG104, pLIGI 17, etc. showed high expression levels.

Table 4 Next, the construction of a vector expressing β-urogastrone from pLIG103 and puei 17 is described.

pUG103 and l) LJGl 17, respectively
1 containing the sequence from the λPL promoter to the first half of the β-urogastrone gene by cutting with ndl[ and pvul[
, a 2 kb fragment was isolated. Also, p LIG
2 was digested with EcoRI to obtain 7 fragments of 4.1 kb. Both were ligated with Tt DNA ligase, and E. coli strain ECl-2 was transformed using the method described above to obtain β-
The first half and the second half of the urogastrone gene combine to produce total β
-Plasmid D in which the urogastrone gene is expressed under the control of the λPL promoter UG103-E, I) UGI 1
A recombinant containing 7-E was obtained.

FIG. 8 shows an outline of the above-mentioned series of operations.

0 Fusion protein By linking the β-lactamase gene and the β-UO gastron gene present on the vector plasmid pBR322, β-Urogastrone was expressed as a fusion protein. Examples will be specifically described below.

Donation of 0β-lactamase gene 1) BRHO2 converts DBR322 to AraI and pvu
This is a deletion product obtained by cutting with I, treating with K Ienow, and ligating with Tt DNA ligase, and is resistant to ampicillin (AE
lF? ) and latracycline resistance (TOR) as a marker. I) BRHO3 is pBR32
5 was cut with AvaI and Hindll, and K1°eno
It is a deletion product obtained by ligation after treatment with w, and has ApR and chloramphenicol resistance (CIR) as markers. These plasmids are shown in FIG.

0-Logastrone Gene Donation As a result of cutting DIJG3 constructed as described above with MbOI, 13 types of DNA fragments were obtained. These DNA fragments were named A to M in order of size.

This is shown in FIG. Among these DNA fragments, the H fragment consists of 179 base pairs starting from the asparagine-encoding nucleotide at the N-terminus of the β-urogastrone gene to 16 bases downstream of the stop codon, and contains the entire structural gene of β-urogastrone. Ta. Next, 6% polyacrylamide gel electrophoresis was performed to isolate this H fragment, and the fragments were separated and purified.

The oligonucleotides shown in Table 5 below (the synthesis method has already been described) were used as oOLM adapters. That is, these adapters can be used to enzymatically separate β-urogastrone from the expressed fusion protein.
It was designed and synthesized to encode two consecutive basic amino acids of r1J-LyS, and used in the following operations.

Table 5 0-Lactamase and -〇Gas Ron Muta (1) L
ys-Aro linked β-lactamase and β-urogastrone fusion protein expression system When assembling the β-lactamase β-urogastrone fusion protein expression vector, in order to confirm adapter binding, restriction was made to the region containing the adapter. This was done in such a way that an enzyme recognition site was generated.

■ Creation of p UG2301-2303 pBRH0,2
After cutting completely at 37°C for 3 hours using a 5mm mill,
μg of vector and approximately 0.1 μg of 179b, p, β-urogastrone fragment and E-1 as an adapter.
and E-2 (5' end non-phosphorylated) were ligated in one step at 12°C for 15 hours to obtain a plasmid, which is an expression vector. H8101 was transformed in the same manner as described above.

Of the 499 TCP colonies obtained, 1681!
(33.7%) were found to be ``AD''. When we performed miniprevention on them and examined the size of the plasmid DNA, it was found that it was approximately 200 b, p larger than the vector, and the β-urogastrone gene had been inserted. There were 13 items that could be considered as MlnIl.
I had n top. These were cut with llnfi, and the directionality of the β-urogastrone gene insertion was examined by 1.5% agarose gel electrophoresis. Three of them resulted in fragments of approximately 1050 b, p and approximately 800 b, p, suggesting that β-urogastrone was inserted in the same direction as β-lactamase, and p LIG
2301-11 It was named UG2303.

The above operation is shown in FIG.

(1) Construction of LIG2101-2105 (7) pBR32,2 was used as a plasmid vector. pBR32
2 has only one pvu esite in the β-lactamase gene. According to the method described in ■, as an adapter
Expression vectors were constructed using -1 and E-5. This is shown in FIG.

I got 1626! When TOR colonies of m were examined for Ap susceptibility, 31 (1.9%) were AD 8
There was a time. Tc R, Ap 822 coney was subjected to miniprevention, cut with MIuI, and β
- Insertion of the urogastrone gene was investigated. 20 pieces are Ml
I had a uI site. Directions are HinfI and 3a
m)-II, pUG210
It was found that in pLIG2105, the β-urogastrone gene was inserted in the same direction as the β-lactamase gene.

■ pB to the construction vector of pUG270i-2703
An expression plasmid was constructed using R322 and E-7 and E-8 as adapters in the same manner as in (2). This is the first
Shown in Figure 3.

217 TCP colonies were obtained, of which 106
(48.8%) were AI) 8. We performed mini-prevention on 25 genes, and considered that the β-urogastrone gene was inserted into 8 genes that were approximately 200 b, 'p larger than the vector, and the direction was determined to be Bai+H.
was investigated by cleavage with I. As a result, three β-
It is thought that the β-urogastrone gene was inserted in the same direction as the lactamase, and the genes were named DUG2701-2703.

β- produced by pUG2301 obtained in ① above
The primary structure of a fusion protein of a part of lactamase and β-urogastrone is shown below in correspondence with the base sequence.

TAGTGAAGATCTGGATCCGTTTAGC
GTTTTCCAATGATGAGCACTTTTAA
AGTTCTGCTATGTGGCGCGGTATTA
TCCCGTGTTGACGCCGGGCAAGAGC
Similar to AACTCGGTCGCCGCATAC, above ■
The primary structure of the fusion protein produced by pUG2101 is shown below.

Leu Asn Ser Gly Lys
Ile Leu GluCTCAACAGCGGT
AAG ATCCTT GAGSer Phe
ArgPro Glu' Glu Aro
PheAGT TTT CGCCCCGAA GAA
CGT TTTPro Met Met Se
r Thr pbe Lys ValCCA
ATG ATG AGCACT TTT AAA GT
TLeu Leu Cys Gly Ala
Vat leu 5erCTG CTA TGT
GGCGCG GTA TTA TCCAro
Vat Asp Ala Gly Gln
Glu GinCGT GTT GACGCCGGG
CAA GAG CAALeJJ Gly Ar
o Al'Oile His Tyr 5er
CTCGGT OGCC (3CATA CACTAT
TCTGln Asn Asp Ile Va
t Glu Tyr 5erCAG AAT G
ACTTG GTT GAG TACTCAPro
Val Thr Glu Lys His
Leu ThrCCA GTCACA GAA AA
G CAT CTT ACGASI) GIV M
et Thr Val Ara Glu L
euGAT GGCATG ACA GTA AGA
GAA TTACys Ser Ala A! a
Ile Thr Met 5erTGCAG
T GCT GCCATA ACCATG AGTAs
p Asn Thr Ala Ala As
n Leu LeuGAT AACACT G
CG GCCAAACTTA CTTLeu Thr
Thr iIe Ala Lys Ar
Cl AsnCTG ACA ACG ATCGCT
AAA CGG AAT3er Asp 3e
r Qlu Cys pro 1-eu 3
erAGCGAT TCT GAG TGCCC
A CTG TCTHis Asp Gly
Tyr Cys Leu His AspC
ACGAT GGCTAT TGT CTG C
ACGAGaly vat Cys Met
Tyr Ile Glu AlaGGT GTT
TGCATG TACATCGAA GCTl
eu ASpLys TVI' Ala Cy
s Asn CysTTG GAT AAA T
ACGCG TGT AACTGTVat Val
aly Tyr Ile aly Glu
Ar(JGTA GTG GGT TAT AT
CGGT GAA CGCCys Gln Ty
r Ar11l ASI) Leu IJ
s 7rpTGT CAA TACCGT G
AT CTG AAA TGGTrp Glu
leu Arg(stall) TGG GA
A TTG CGT TAA TAGTGAA
GATCTG GA T CCG T TTA G C
QA T CGGA G GA CCGA A GGA
Similar to GCTAACCGCTTTTTTGCACA, the primary structure of the fusion protein produced by pUG2701 obtained in step ① above is shown below.

Met 513r Ile! Gin His
Phe Arc ValATG AGT AT
T CAA CAT TTCCGT GTCAla
Leu Ile Pro Phe Phe
Ala AlaGCCCTT ATT CCCTTT
TTT GCG GCAPhe Cys Leu
Pro Val Phe Ala His
TTT TGCCTT CCT GTT TTT GC
T CACpro Qlu 7hr Leu
Val Lys Val LysCCA GAA
ACG CTG GTG AAA GTA AAAA
SD Ala Glu ASII Gln
LelJ any AlaGAT GCT GAA
GAT CAG TTG GGT GCAAro
Vat Gly Tyr Ile Glu
Leu Asp・CGA GTG GGT TACA
TCGAA CTG GATLeu Asn Se
r Gly Lys Ile Leu Gl
uCTCAACAGCGGT AAG ATCCTT
GAGSer Phe ArgPro Glu
Glu Ara PbeAGT TTT CGC
CCCGAA GAA CGT TTTPro Me
t Met Ser Thr Phe I
Js VatCCA ATG ATG AGC
ACT TTT AAA GTTleu L
eu cys GIY Ala Va!
leu 3erCTG CTA TGT
GGC, GCG GTA TTA TCCAr
'gVal Asp Ala Gly Gl
n Glu GlnCGT GTT GACG
CCGGG CAA GAG CAALeu
Gly ArgAro Ile His T
yr 5erCTCGGT CGCCGCATA
CACTAT TCTGln Asn Asp
Ile Val Glu Ser A
laCAG AAT GACTTG GTT
GAG TCG GCTLys ArgAsn
3er ASpSer Glu CysAA
A CGG AAT AGCGAT TCT
GAG TGCpro leu Ser
His Asp GiV Tyr CVliC
CA CTG TCT CACGAT GGC
TAT TGTLeu His Asp
Gly Val Cys Met Ty
rCTG CACGAG GGT GTT T
GCATG TAC IIs Glu Ala
Leu Asp cys TVr Ala
ATCGAA GOT TTG GAT AA
A TACGCGCys Asn Cys
Vat Val Gly Tyr
l1eTGT AACTGT GTA GTG
GGT TAT ATCTAGTGAAGATC
TGGATCCGTTTAGCCGACTCACCAG
TCACAGAAAAGCATCTTACGGATE)
LIG2101, I) UG2301 and DUG2701
Based on the base sequence, it was determined whether the β-urogastrone gene was integrated into the desired position of the β-lactamase gene of p8R322 via an adapter. That is, after cutting with MluI and labeling 5'32p, p
UG2101 was subjected to secondary cleavage with EooRI and PStI, and 5'31'p-labeled 7
Fragments of 21b,p and 224b,p were separated.

pLJG2301 was subjected to secondary cleavage with Ba1HI, and fragments of 452 b, p and 87 b, p were separated in the same manner. In pLjG2701, EC
Secondary cleavage was performed with 0RI and PstI, and 5iob,
The fragments of 335 b, p, and 335 b, p were fractionated.

The fragments obtained as described above were analyzed by the Maxam-Gilbert method. The analysis results are shown in Reference Photo 5. In reference photo 5, lanes 1 to 4 are pLIG210
MltlI-PStI fragment of 1 (224b, p
), lanes 5 to 8 are MluI-Ec of pUG2101
oRI fragment (721b,p,), lanes 9-1
2 is the MluI-Bam)-II fragment of pLIG2301 (452b, p,) Lanes 13-16 are pUG
MluI-PstI fragment of 2701 (33
5b, p, ) and lanes 17-20 are p UG2701
MluI-EcoRI7 fragment (610b, p,
). Lanes 1.5.9.13 and 17 are the guanine reaction, lanes 2.6.10.14 and 18 are the guanine+adenine reaction, lane 3.7.
11, 15 and 19 show the thymine+cytosine reaction and lanes 4.8.12.16 and 20 show the cytosine reaction, respectively.

Also, the part marked with ")" in the reference photo is the adapter.

(2) Aro-Lys linked β-lactamase and β-urogastrone fusion protein expression system I) Construction of LIG1102 and 1105 As an expression vector for the β-lactamase β-urogastrone fusion protein, - A gene was constructed in which the β-urogastrone gene was inserted into the PvuI restriction enzyme site, which exists only at one location. This is shown in FIG.

pBR322 was cleaved with PvuI at 37°C for 3 hours, a part of it was examined by agarose gel electrophoresis to confirm that it had been completely cleaved, and then adapter D-1-3
and D-3-2 were combined at 12° C. for 15 hours. After completion of binding, DNA fragments were isolated by 1% agarose gel electrophoresis. Subsequently, the β-urogastrone fragment and the vector are mixed in a molar ratio of approximately 5:1,
Binding was performed at 12°C for 15 hours. After ligation, H8101 was transformed by the method described above, and colonies were selected using TcR as an indicator.

Seventy-one TCR transformants were obtained, and when each was examined for Ap sensitivity, 20 (28.2%) were sensitive to AEI. DNA was prepared from these 20 AE) 8 colonies, and the presence or absence of β-urogastrone gene insertion was determined by M
The presence or absence of a 1 u ■ restriction enzyme site was investigated. Only 5 out of 20 had Mlul sites, and the β-urogastrone gene was inserted. The direction of insertion is HinfI
After cutting the DNA, it was examined by 1.5% agarose gel electrophoresis.
and pUG1105) were inserted in the forward direction.

■ In the construction of D LJGl 004.1201 and 1301, pstI, Hinc was used instead of PvuI.
pUG1004, pUG1004 and pUG1004 were prepared in the same manner using II and
UG1201 and pLIG1301 were obtained, respectively.

These are shown in FIGS. 15, 16, and 17.

Example 3 - The expression plasmid constructed by the above of Logastron was transformed into E. coli 881.
The cells transformed into the 01 strain or the ECl-2 strain were cultured and extracted using the method described below, and the presence or absence of expression was confirmed by radioimmunoassay.

(1) Cultivation and extraction of microorganisms with the β-UO gastron gene (a) Expression system using the λPL promoter Expression plasmid p LIGl 03-E or DUGl 17-E
Two tubes of colonic lECl-2 containing 19 LB medium were cultured at 25°C, and one tube was subjected to heat induction at 42°C for 1 hour when the absorbance at 660 ngi reached 0.3. The other one was cultured as it was at 25°C until the absorbance reached 0.4. After collecting bacteria, PBS solution (1
371M sodium chloride, 2.7mM potassium chloride, 8
．． After washing with 1-M disodium phosphate, 1.51M potassium phosphate (11H7,O)), the bacterial cells were reduced to 3% of the stock solution.
Suspend the cells in PBS solution and destroy the bacterial cells (100
W for 3″0 seconds 3 times).

Next, cell debris was removed by ultracentrifugation (40,000° for 1 hour). The supernatant was dialyzed in 0.0 IN acetic acid aqueous solution,
It was freeze-dried and subjected to subsequent radioimmunoassay (hereinafter referred to as RIA).

(b) Expression system for protein 11 pUG1004.1301.2101.2303 or 2
E. coli He101 strain harboring 703 was precultured at 37°C in LB medium containing 50μl/- of tetracycline, diluted in the same medium at a ratio of 1:100, and 660
The culture was continued with shaking until the absorbance at nm reached 0.4. After collecting bacteria and washing with PBS solution, the bacteria were added to 3% of the original solution in PB.
The cells were suspended in S solution, and the bacterial cells were disrupted using an ultrasonic cell disrupter (Model 5202 manufactured by Ota Seisakusho Co., Ltd., <100 W, 3 times for 30 seconds) while cooling on ice. Next, super sound center (40000o, 1
time) to remove cell debris. Supernatant 0.01N
The product was dialyzed in an aqueous solution of Ii\ acid, freeze-dried, and subjected to RIA.

In addition, in order to confirm that the fusion protein accumulates in the periplasm, we extracted the periplasmic fraction by osmotic shock;
The method of n et al. (Chan, S. J. etat.
Proc, Natl, Acad, Sci,
, USA.

Extraction of the periplasmic fraction was performed according to J. J., 5401-5405 (1981)). [The bacterial suspension of the preculture carried out in B medium was mixed with fresh E medium (dipotassium phosphate 10
g, sodium ammonium hydrogen phosphate 3.5g, magnesium sulfate heptahydrate 0.2Q, citric acid 2g, glucose 2Q, L-proline 0.23m% Q-0 isine 39
．． Diluted 1:100 with 1Q (dissolved 16.85-g of thiamin and 20-g of tetracycline hydrochloride in water), and the absorbance at 660n at 37°C was 0.4. The cells were cultured with shaking until the Bacteria collection (6000rp
ugliness, 10 minutes), then 10-M Tris salt 11 (p
H8,0), washed twice with 30 s M sodium chloride mixture, and added 20% sucrose-50-80 to 1 g of bacterial cells.
The mixture was resuspended in M Tris/HCl (p) 18.0). Immediately add disodium EDTA to a final concentration of IM and mix in a rotary shaker for 10 minutes at 180 rpm.
(24℃), then centrifugation (130,000,1
Bacteria were collected by 1 minute) and resuspended in an equal volume of distilled water. Pour into water, stir occasionally, and after about 10 minutes, centrifuge (13
000Ω for 1 hour), and the supernatant was collected as a periplasm fraction (0-8up). Regarding pellets,
10IIIM Tris/hydrochloric acid (pH 8,0), 30m
The microbial cell protein fraction (0-PI)t) was obtained by suspending it in a M sodium chloride mixture and disrupting it with the above-mentioned ultrasonic waves. These samples were subjected to RIA.

(2) Radioimmunoassay (a) Establishment of RIA system A domestic rabbit was immunized with purified human β-urogastrone as an antigen to prepare an antiserum. After dissolving 300 μa of β-urogastrone in 0.2 vtJ of distilled water, 1.5 μm of 50% polyvinylpyrrolidone solution was added and stirred at room temperature for 2 hours. Complete Freund's Adjuvant 2.0- was added and emulsified, and the mixture was subcutaneously injected into the chest of three domestic rabbits. After repeating the immunization four times every two weeks, an additional 50 μg of antigen was injected intravenously, and 3
A day later, whole blood was collected and serum was separated.

Next, we examined the tightness curve to determine the dilution factor of the antiserum used in the assay, the incubation time to optimize the assay conditions, and the separation method of antibody-bound labeled antigen (bound) and free labeled antigen (free). The following RIA measurement conditions were set.

i.e. 0.5% bovine serum albumin (BSA), 14
A phosphate buffer (10s M, pH 7,4) containing 0i, M sodium chloride, and 25m disodium MEDTA was used as a diluent. 400 μQ of the diluted sample or standard human β-urogastrone 100 μQ1 anti-human β-urogastrone was added and incubated at 4° C. for 24 hours, and then 100 μQ of 125-labeled human β-urogastrone (approximately 5000 cp) was added.

After further incubation at 4°C for 48 hours, a second antibody (anti-rabbit γ-globulin goat serum) (1:20) 100
μQ1 normal rabbit white serum (1:200) 100 μQ, 1 ml 1 MPBS solution containing 5% polyethylene glycol 90
0 μQ was added and incubated at 4° C. for 3 hours. Next, the mixture was centrifuged for 30 minutes at 3000 rl) In, the supernatant was removed, and the precipitate was counted. The content of human β-urogastrone immunoreactive substance in the sample was determined from a standard curve obtained from standard human β-urogastrone.

(b) Confirmation of β-urogastrone productivity in recombinant microorganisms Table 6 shows the results of RIA of the expression system using the λPL promoter.

Table 6 Table 7 shows the RIA results of the fusion protein expression system.

Table 7 Results for o-s up and 0-Ppt are shown in Table 8.

Table 8 From Tables 6 and 7, it was confirmed that both the λPL promoter system that directly expresses β-urogastrone and the system that expresses it as a fusion protein expressed β-urogastrone activity in E. coli. Furthermore, Table 8 shows that in the case of the fusion protein, most of the expressed β-urogastrone activity is localized in the periplasm.
It was 1W1.

The microorganism in which the plasmid pUO3 of the present invention is maintained in Escherichia coli HB101 has been deposited as HBlol (pUG3) at the Institute of Microbial Technology, Agency of Industrial Science and Technology, Ministry of International Trade and Industry, and its accession number is This is Article No. 543 (FERM BP-543). In addition, the microorganism in which plasmid pGH37 was retained in Escherichia coli HB101,
As ECl-2, it was submitted to the same FEIKEN with the accession number FEIKEN Joyori No. 5.
No. 42 (FERM BP-542).

[Brief explanation of drawings]

FIG. 1 shows the process of constructing subunit A. from oligonucleotides A-1 to A-16 and incorporating it into pBR322 to obtain pLIGl. Figure 2 shows p UO2 in which subunit B is incorporated in the same way.
This shows the process of obtaining . FIG. 3 shows the process of obtaining I) tJG3 from I) UGl and pUO2. FIG. 4 shows the results of analyzing the base sequence of oligonucleotide A-3 by a secondary development method using homochromatography. FIG. 5 shows the process for obtaining pGH37. FIG. 6 shows the process for obtaining pGH35. 7th
The figure shows the process for obtaining pEK38. 8th
The diagram shows 1) UG102 to 1) UG122, D UG103
-E and pUGl 17-E are shown. Figure 9 shows pBRHO2 and pBRI-103.
This shows the process of obtaining . Figure 10 shows 1) UO3
Shows the Mbo■ cut DNA fragment, among which the H fragment (1
79b, l), ) indicate that the β-urogastrone gene is included. Figure 11 shows ρLIG2301~
It shows the process for obtaining pLIG2303. 13th
The figure shows the process of obtaining +1 UG2701 to EI UG2703. FIG. 14 shows the process for obtaining pUG1102 and 1) UG1105. FIG. 15 shows the process for obtaining p tJGl 004. FIG. 16 shows the process of obtaining +1 UGl 201. FIG. 17 shows the process for obtaining pUG1301. (Above) Figure 4, Figure 5, Figure 11) (H Figure 12, Figure 16, Figure 14, Figure 15, Figure 16)

Claims (12)

[Claims] (1) A gene containing part or all of the expression code for β-urogastrone. (2) The gene according to claim 1, wherein the β-urogastrone gene has the following base sequence. [There is a base sequence] (3) The gene according to claim 1, which has the following base sequence including the β-urogastrone gene. [There is a base sequence] (4) The gene according to claim 1, which includes two types of subunit structures having the following base sequences. Subunit A: [There is a base sequence] Subunit B: [There is a base sequence] (5) A plasmid recombinant in which a promoter that controls the expression of the β-urogastrone gene and an SD sequence linked upstream of the β-urogastrone gene are inserted into a plasmid vector. (6) β-urogastrone gene, promoter and S
The plasmid recombinant according to claim 5, wherein another gene is further linked between the D sequence or (and) downstream of the gene. (7) The plasmid recombinant according to claim 6, wherein the other gene is a β-lactamase gene. (8) The plasmid recombinant according to any one of claims 5 to 7, wherein the promoter is λP_L or lacUV5. (9) The plasmid recombinant according to any one of claims 5 to 8, wherein the plasmid vector is pBR322. (10) A transformant obtained by transforming a host cell with a plasmid recombinant capable of expressing the β-urogastrone gene. (11) Claim 10 in which the host cell is E. coli
Transformants described in Section. (12) The transformant according to claim 10 or 11, wherein the host cell holds a plasmid recombinant into which Tc^R gene and CI857 gene have been inserted. (12) Production of β-urogastrone, which comprises transforming a host cell with a plasmid recombinant capable of expressing the β-urogastrone gene, then culturing the transformant, and collecting the expressed β-urogastrone. Law.