JPH1143499A - New protein and its dna - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a new protein, comprising an ependyminlike protein, having a specific amino acid sequence and derived from a mammal, capable of manifesting physiological activities for the central nervous system, etc., and useful as a therapeutic agent, a preventing agent, etc., for Alzheimer disease, Parkinson disease, etc. SOLUTION: This new ependyminlike protein (salt) contains an amino acid sequence represented by formula I to III or substantially the same amino acid sequence as that and is derived from a mammal and is capable of manifesting physiological activities for the central nervous system, etc., such as nerve elongating actions, nerve regenerating actions, activating actions on a glial cell (neuroglial cell) and useful as a therapeutic agent or a preventing agent, etc., for Alzhermier disease, Parkinson disease, Huntington's disease, amyotrophic lateral sclerosis, dementia, cerebellar degeneration, etc. The protein is obtained by screening a cDNA library prepared by using a poly(A)<+> RNA derived from a human placenta by hybridization with a labeled probe, integrating the resultant gene into a vector and expressing the gene in a host cell.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a novel protein having a physiological activity on the central nervous system and the like such as a nerve elongating action, a nerve regenerating action, and a glial cell (glial cell) activating action, and a DNA encoding the same.

[0002]

BACKGROUND OF THE INVENTION Traces of memory in the brain can be divided into two phases: acquisition of short-term memory and fixation of long-term memory. Although electroconvulsive shock and anesthesia can destroy short-term memory, it has been found that once established long-term memory has no effect. On the other hand, in contrast to short-term memory, it is known that biochemical reactions and structural changes that lead to the formation of long-term memory can be blocked by protein synthesis inhibitors such as, for example, puromycin, cycloheximide (Flexner, JB etal. Science 141, 57-59 (1963), Agranoff, B.
W. and Klinger, PD Science 146, 95
2-953 (1964), Agranoff, BW et al. Brain Research 1, 300-309 (1966)]. For more than 20 years, therefore, it has been thought that when long-term memory is formed in the brain, the metabolism of certain proteins, such as the synthesis of new proteins, may be involved. However, to date, only a few proteins have been identified that increase turnover after gaining new behavior (Hyden, H and Lange, PW Proceedings of the National Academy of Sciences).・ Of the USA (Proc.
Natl. Acad. Sci. USA) 65, 898-904 (1970), Shasho
ua, VE Science 193, 1264-1266 (197
6)].

One of them, ependimin (ep
endymin) have been reported as two proteins whose expression levels increase after learning in the brain of goldfish using the double labeling method of [ ³ H] valine and [ ¹⁴ C] valine [Shashoua, VE Science
193, 1264-1266 (1976)], studies of early immunohistological distribution [Shashoua, VE Brain Research
Research) 122, 113-124 (1977), Benowitz, LI and
Shashoua, VE BrainResearc
h) 136, 227-242 (1977)]
l) Since these proteins are widely distributed in the zone (ventricular epithelium or ependymal), these proteins are ependymin
β, named ependymin γ. However, these proteins were later considered to be secreted proteins secreted into the cerebrospinal fluid (Shashoua, V.
E. Brain Research 166, 349-35
8 (1979), Shashoua, VE Neurochem. Res. 6, 1129-1147 (1981)], and even more detailed immunohistological distribution
High concentrations of epidymin have been detected in c structures (midbrain region) and cerebrospinal fluid [Schmidt,
R. and Lapp, H. Neurochem. Int. 10, 383-390 (198
7)]. Ependymin β and ependymin γ are SDS-
Given the molecular weights of 35 kDa and 30 kDa on PAGE, they were considered to be separate proteins, but were later found to be proteins with different sugar chains and identical amino acid sequences [Schmidt, R. and Shashou
a, VE Journal of Neurochemistry (J. Neurochem.) 40, 652-660, (1983)]. In addition, it has been reported that these proteins form dimers and contain at least 5% of sugar chains [Shashoua, V. et al.
E. Cell. Mol. Neurobiol. 5, 183-207 (1985)].

[0004] From the discovery process, ependymin has been considered to be related to learning and memory processes. For example, injection of anti-ependymin antibody into the ventricle blocks memory integration [Shashoua, VE Processings of the National Academy.
Of Sciences of the USA (Pro
c. Natl. Acad. Sci. USA) 74, 1743-1747 (1977), Sha
shoua, VE and Moore, ME Brain Research (B
rain Research) 148, 441-449 (1978), Schmidt, R. (Ad
v. Biosci.) 59, 213-222 (1986), Piront, ML and
Schmidt, R. Brain Research 44
2, 53-62 (1988)), ependymin
It has been reported that the concentration greatly influences the expression level as well as the expression level [Schmidt, R. Journal of Neurochemistry (J. Neurochem.) 48, 1870-1878].
(1987), Shashoua, VE and Hesse, GW Brain Research 484, 333-339 (1989), S
chmidt, R. et al. Progress in Brain Research (Progr. Brain Res.) 91, 7-12 (1992)]. recent years,
ependymin was found to be involved in optic nerve regeneration in Goldfish (Thormodsson, FR et al.
Society Neuroscience Abstract (S
oc. Neurosci. Abstr.) 14, 805 (1988)] and found that it is synthesized during optic nerve regeneration [Schmid
t, JT and Shashoua, VE Brain Research (B
rain Research) 446, 269-284 (1988), Thormodsson,
FRet al. Experimental Neurology (Ex
p. Neurol.) 118, 275-283 (1992)]. The most recent study, immunoelectron microscopy and in situ
u Hybridization revealed that ependymins expressed mRNA in reticular fibroblasts in the inner meningeal layer (inner endomeningeal cell layer) and synthesized proteins, but were not expressed in neurons or glial cells. However, after learning, proteins are present in neurons and glial cells where mRNA is absent. Rother, S. et al. Journal of Neurochem. (J. Neurochem.) 65, 1456-1464 (1995), Sch
midt, R. et al. Journal of Neurochem. (J. Neurochem.) 65, 1465-1471 (1995)].

However, all of these studies have used fish such as goldfish,
Min cDNAs include goldfish, zebrafish, salmon, rainbow trout, herring,
It is obtained only by fish such as carp [Koenigstor
fer, A. et al. Journal of Neurochemistry. 52, 310-312 (1989), Koenigstor
fer, A. Journal of Biological Chemistry (J. Biol. Chem.) 264, 13689-13692 (1989), Ste
rrer, S. et al. Neuroscience
37, 277-284 (1990), Muller-Schmid, A. et al. Gene 118, 189-196 (1992), Muller-Schmid, A. e
t al. Journal of Molecular Evolution (J. Molec. Evol.) 36, 578-585 (1993)]. It is expected that proteins corresponding to this ependymin also exist in mammals, and that ependymins-like immune responses are present in rat hippocampal neurons [Schmidt, R. et al. Brain Research 386, 245 -257 (19
86)] Although there are many reports using immunohistochemical techniques, [Fazei, MS et al. European Journal of Neuroscience (Eur. J. Neurosci.) Sup.
pl. 1, 90 (1988), Shashoua VE et al. Brain
Research (Brain Research) 522, 181-190 (1990), Sha
shoua VE etal. Journal of Neuroscience Research (J. Neurosci. Res.) 32, 239-244 (199
2)] It has not been clarified whether a protein corresponding to ependymin actually exists in mammals by biochemical and molecular biology.

[0006]

SUMMARY OF THE INVENTION The present invention provides an ependymin
-Like protein, partial peptide thereof, precursor protein or salt thereof, signal peptide, DNA encoding the protein, etc., recombinant vector, transformant, method for producing the protein, etc., drug containing the protein, etc. or DNA , An antibody against the protein or the like, a method for screening a compound that promotes the function of the protein or the like / kit for screening, and a compound obtained by the screening.

[0007]

Means for Solving the Problems The present inventors have succeeded in cloning a cDNA having a novel nucleotide sequence from a cDNA library derived from human placenta, rat brain and mouse spinal cord, and have succeeded in cloning a protein encoded thereby. Nerve elongation and nerve regeneration in the central nervous system, etc.
Ependymi with biological activity such as glial cell activation
It was found to be an n-like protein. The present inventors have further studied based on these findings,
The present invention has been completed.

That is, the present invention relates to (1) a mammal-derived ependimin-like protein or a salt thereof, (2) an amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, or substantially the same. (3) an amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3;
The protein according to item (2), which is an amino acid sequence containing the amino acid sequence represented by SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 or (and) SEQ ID NO: 7;
(4) SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3
SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3
The protein according to (2), which is an amino acid sequence having about 95% or more homology with the amino acid sequence represented by:
(5) the protein according to (2), which has a nerve elongation effect; (6) a partial peptide of the protein according to (1) or (2) or a salt thereof; (7) SEQ ID NOS: 4 to
The partial peptide according to item (6), which has an amino acid sequence represented by any one of SEQ ID NOs: 9;

(8) SEQ ID NO: 10, SEQ ID NO: 11,
A precursor protein of the protein according to item (2) having the amino acid sequence represented by SEQ ID NO: 12 or SEQ ID NO: 13 or an amino acid sequence substantially identical thereto, or a salt thereof; (9) SEQ ID NO: 14, SEQ ID NO: 1
5, a signal peptide having the amino acid sequence represented by SEQ ID NO: 16 or SEQ ID NO: 17 or an amino acid sequence substantially identical thereto, or a salt thereof, (10)
DNA containing a DNA having a base sequence encoding the protein according to item (1) or (2), (1
1) SEQ ID NO: 18, SEQ ID NO: 19 or SEQ ID NO:
(10) the DNA according to (10) having a base sequence represented by 20, (12) a DNA containing a DNA having a base sequence encoding the precursor protein according to (8),
(13) SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO:
(12) DNA having the nucleotide sequence represented by SEQ ID NO: 29 or SEQ ID NO: 30, (14) DN having the nucleotide sequence encoding the signal peptide according to (9)
A-containing DNA, (15) the DNA according to (14), which has a base sequence represented by SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33 or SEQ ID NO: 34,
(16) a recombinant vector containing the DNA of (10), (17) a transformant transformed with the recombinant vector of (16), (18) a transformant of (18); (1) or (2), wherein the transformant is cultured to produce and accumulate the protein or a salt thereof according to (1) or (2), and to collect the protein or salt.
A method for producing a protein or a salt thereof according to the above,

(19) a medicament comprising the protein according to (1) or (2), the partial peptide according to (6) or a salt thereof, (20) Alzheimer's disease, Parkinson's disease, The medicament according to (19), which is a therapeutic / prophylactic agent for Huntington's disease, amyotrophic lateral sclerosis, dementia or cerebellar degeneration, and (21) D according to (10).
A medicine containing NA, (22) Alzheimer's disease,
The medicament according to (21), which is a therapeutic / prophylactic agent for Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, dementia or cerebellar degeneration, (23) (1) or (2) (24) an antibody against the protein according to (6), the partial peptide according to (6), the precursor protein according to (8) or a salt thereof, (24) an antibody against (1) or (2);
The protein according to item (1) or (2), or the partial peptide according to item (6), wherein the protein according to item (6), the partial peptide according to item (6), or a salt thereof is used. Or a method for screening a compound or a salt thereof that promotes the function of a salt thereof, wherein (25) the function is (i) a nerve elongation effect or a glial cell activation effect in the central nervous system or (ii) a memory formation effect in the brain. (24) the screening method according to (24), wherein the function is a nerve elongation effect, (27) the protein according to (1) or (2), )) The protein described in (1) or (2), the partial peptide described in (6) or a partial peptide thereof, which contains the partial peptide described in (1) or a salt thereof. (28) A screening kit for a compound or a salt thereof which promotes the function of (28), which is obtained by using the screening method according to (24) or the screening kit according to (27). (2) a compound or salt thereof which promotes the function of the protein of (2), the partial peptide of (6) or a salt thereof; (29) a screening method of (24) or (27) (30) a protein comprising a compound that promotes the function of the protein described in (1), the partial peptide described in (6) or a salt thereof, or a salt thereof, which is obtained by using the screening kit of (1), and (30) ) Item (29) which is an agent for treating or preventing Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, dementia or cerebellar degeneration. Of medicine.

Further, the present invention relates to (31) SEQ ID NO:
1, the amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 2 or SEQ ID NO: 3 is 1 or 2 in the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 An amino acid sequence in which one or more amino acids have been added to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3 in which one or more amino acids have been deleted, SEQ ID NO:
Item (2) which is an amino acid sequence in which one or more amino acids in the amino acid sequence represented by 1, SEQ ID NO: 2 or SEQ ID NO: 3 have been substituted with another amino acid, or an amino acid sequence obtained by combining them. Described protein, (32) an amino acid sequence represented by SEQ ID NO: 1, an amino acid sequence represented by SEQ ID NO: 2, an amino acid sequence having Gly added to the N-terminal of the amino acid sequence represented by SEQ ID NO: 2, SEQ ID NO: (1) or having the amino acid sequence represented by SEQ ID NO: 3 or the amino acid sequence represented by SEQ ID NO: 3 having an amino acid sequence obtained by adding the C-terminal 7 amino acids of the amino acid sequence represented by SEQ ID NO: 17 to the N-terminus (2) the protein according to the above,
(33) an amino acid sequence represented by SEQ ID NO: 14,
Amino acid sequence represented by SEQ ID NO: 15, amino acid sequence represented by SEQ ID NO: 16, SEQ ID NO: 16
An amino acid sequence obtained by removing Gly from the C-terminus of the amino acid sequence represented by: (9) the signal peptide according to the above, (34) a DNA having the nucleotide sequence represented by SEQ ID NO: 18, a DNA having the nucleotide sequence represented by SEQ ID NO: 19,
GG is added to the 5 'end of the base sequence represented by SEQ ID NO: 19.
DNA having a base sequence to which C is added, SEQ ID NO: 2
DNA having a base sequence represented by 0 or DNA having a base sequence in which 21 bases at the 3 'end of the base sequence represented by SEQ ID NO: 34 are added to the 5' end of the base sequence represented by SEQ ID NO: 20 (35) DNA having the nucleotide sequence represented by SEQ ID NO: 31; (35) DNA having the nucleotide sequence represented by SEQ ID NO: 32; DNA having the nucleotide sequence represented by SEQ ID NO: 32; DNA having a base sequence,
G from the 3 'end of the base sequence represented by SEQ ID NO: 33
DNA having a base sequence excluding GC, SEQ ID NO: 3
DNA encoding the signal peptide according to (33), which is a DNA having the nucleotide sequence represented by SEQ ID NO: 4 or a DNA having a nucleotide sequence obtained by removing 21 bases from the 3 'end of the nucleotide sequence represented by SEQ ID NO: 34 ,

(36) The antibody according to item (23), the protein according to item (1) or (2), and the antibody according to item (6).
The protein according to item (1) or (2), wherein the partial peptide according to item (8), the precursor protein according to item (8), or a salt thereof is contacted. (3) a method for quantifying the partial peptide, the precursor protein according to (8) or a salt thereof,
3) the antibody according to the above, a test solution and a labeled protein according to the above (1) or (2),
The partial peptide according to item (1) or (2), wherein the partial peptide according to item (8), the precursor protein according to item (8) or a salt thereof is competitively reacted, and the antibody is bound to the labeled item (1) or (2). (1) or (2) in the test solution, wherein the ratio of the protein, the partial peptide according to (6), the precursor protein according to (8) or a salt thereof is measured. ), The partial peptide according to (6), the precursor protein according to (8) or a method for quantifying the salt thereof, (38) the test solution and the (23) insolubilized on a carrier. A test solution characterized by measuring the activity of a labeling agent on an insolubilized carrier after simultaneously or continuously reacting the antibody according to the above item and another labeled antibody according to the item (23). The protein according to item (1) or (2) above, )) The method for quantifying the partial peptide according to the above, the precursor protein according to the item (8) or a salt thereof, (39) (i) the protein according to the item (1) or (2), the method according to the item (6). The partial peptide or the salt thereof according to the above, which is brought into contact with a nerve cell or a nerve tissue; and (ii) the protein according to the above (1) or (2),
The protein according to item (1) or (2), wherein the partial peptide according to item (6) or a salt thereof and a test compound are brought into contact with nerve cells or nerve tissue, according to item (6). (1) characterized in that the functions of partial peptides or salts thereof are measured and compared.
A method for screening a compound or a salt thereof which promotes the function of the protein of the above item or (2), the partial peptide of the above item (6) or a salt thereof,

(40) SEQ ID NO: 18, SEQ ID NO: 1
9, DNA containing a DNA having a nucleotide sequence that hybridizes with the nucleotide sequence represented by SEQ ID NO: 20 under high stringent conditions, (41) a recombinant vector containing the DNA described in (40), (42) No. (4)
(43) culturing the transformant described in (43), wherein the transformant is transformed with the recombinant vector described in (1),
(44) A method for producing a protein or a salt thereof encoded by the DNA according to the item (40), which comprises producing and accumulating a protein or a salt thereof encoded by the DNA according to the item (40); (45) It contains the protein encoded by the DNA of (40) or a salt thereof, which is produced by the production method of (43), and (45) the DNA encoding the partial peptide of (6). DNA,
(46) a recombinant containing the DNA according to (45) or (47) having the nucleotide sequence represented by any one of SEQ ID NOs: 21 to 26, and (47) the DNA according to (46); The vector, (48) the transformant transformed with the recombinant vector according to (47), and (49) the transformant described in (48) are cultured to produce and accumulate a peptide. (6) the method for producing a partial peptide or a salt thereof according to (6),
(50) The DNA according to (10) or (40).
Having a base sequence complementary to or substantially complementary to
(51) a base sequence substantially complementary to the DNA described in (51), (10) or (40), which has an activity capable of promoting the expression of NA; About 60% or more (preferably about 70% or more, more preferably about 80% or more, particularly preferably about 90% or more, and most preferably about 95% or more) homology with the entire base sequence or partial base sequence of the base sequence (50) The oligonucleotide or derivative thereof according to (50), which is a nucleotide sequence having the following: (52) A medicine comprising the oligonucleotide or derivative thereof according to (50), and (53) Alzheimer's disease or Parkinson's disease The pharmaceutical according to (51), which is a therapeutic / preventive agent for a therapeutic / prophylactic agent for Huntington's disease, amyotrophic lateral sclerosis, dementia or cerebellar degeneration. To.

The protein of the present invention includes SEQ ID NO:
The amino acid sequence represented by SEQ ID NO: 1 (SEQ ID NO: 11 or the 38th to 224th amino acid sequence of the amino acid sequence represented by FIG. 1), the amino acid sequence represented by SEQ ID NO: 2 (SEQ ID NO: 12 or the amino acid sequence of FIG. 2) 35th to 224
Amino acid sequence) or the amino acid sequence represented by SEQ ID NO: 3 (SEQ ID NO: 13 or the 38th to 224th amino acid sequence in FIG. 3) or a protein containing an amino acid sequence substantially identical thereto. . The protein of the present invention can be used, for example, in any cells (eg, spleen cells, nerve cells, glial cells, pancreatic β cells) of mammals (eg, human, guinea pig, rat, mouse, rabbit, pig, sheep, cow, monkey, etc.). , Bone marrow cells, mesangial cells, Langerhans cells, epidermal cells, epithelial cells, endothelial cells, fibroblasts, fiber cells, muscle cells, adipocytes, immune cells (eg, macrophages, T cells, B cells, natural killer cells, obesity) Cells, neutrophils, basophils, eosinophils, monocytes), megakaryocytes, synovial cells, chondrocytes, osteocytes, osteoblasts, osteoclasts, mammary cells, hepatocytes or stromal cells, or Progenitor cells of these cells, stem cells or cancer cells), or any tissue in which those cells are present, such as the brain, various parts of the brain (eg, olfactory bulb, amygdala, basal ganglia, hippocampus, Floor, hypothalamus, cerebral cortex, medulla oblongata, cerebellum), spinal cord, pituitary, stomach, pancreas, kidney,
Liver, gonad, thyroid, gallbladder, bone marrow, adrenal gland, skin, muscle, lung, gastrointestinal tract (eg, large intestine, small intestine), blood vessels, heart, thymus, spleen, submandibular gland, peripheral blood, prostate, testicle, ovary, placenta And proteins derived from uterus, bones, joints, skeletal muscles, etc. (particularly, brain and various parts of the brain), and for example, fish such as goldfish, zebrafish, salmon, rainbow trout, herring, carp, etc. Or a synthetic protein.

An amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 is, for example, SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3. Expressed amino acid sequence and about 40%
Or more, preferably about 60% or more, more preferably about 70%
%, More preferably about 80% or more, particularly preferably about 90% or more, and most preferably about 95% or more homology. SEQ ID NO of the present invention:
Examples of the protein having an amino acid sequence substantially identical to the amino acid sequence represented by 1, SEQ ID NO: 2 or SEQ ID NO: 3 include, for example, the aforementioned SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3. Has an amino acid sequence substantially identical to the represented amino acid sequence;
A protein having substantially the same activity as the protein containing the amino acid sequence represented by SEQ ID NO: 2 or SEQ ID NO: 3 is preferred. Examples of substantially the same activity include nerve elongation and nerve regeneration in the central nervous system and the like, glial cell activation, and memory formation in the brain. Substantially the same means that their activities are qualitatively (eg, physiochemically or pharmacologically) the same. Therefore, activities such as nerve elongation, nerve regeneration and glial cell activation are equivalent (eg, about 0.01 to 100 times, preferably about 0.5 to 100 times).
(20 times, more preferably about 0.5 to 2 times), but the degree of these activities and quantitative factors such as the molecular weight of the protein may be different. These activities can be measured according to a method known per se or a method analogous thereto.

The protein of the present invention is a protein having at least one amino acid sequence represented by SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 7. : 1, substantially the same activity as the protein containing the amino acid sequence represented by SEQ ID NO: 2 or SEQ ID NO: 3 (for example, nerve elongation and nerve regeneration in the central nervous system and the like, glial cell activation, Proteins having a memory formation effect in the brain) are also preferable. In addition, SEQ ID NO:
4, the amino acid sequence represented by SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 7 is represented by the amino acid sequence represented by SEQ ID NO: 1, the amino acid sequence represented by SEQ ID NO: 2 and the amino acid sequence represented by SEQ ID NO: 3 The partial amino acid sequence common to the amino acid sequences is shown (FIG. 4). Further, the protein of the present invention is a protein having at least one amino acid sequence represented by SEQ ID NO: 4, SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 7, Substantially the same activity as the protein containing the amino acid sequence represented by SEQ ID NO: 2 or SEQ ID NO: 3 (for example, nerve elongation and nerve regeneration in the central nervous system, glial cell activation, memory in the brain) Also preferred are proteins having a forming action). In addition, SEQ ID NO: 4, SEQ ID NO: 8, SEQ ID NO: 9
Alternatively, the amino acid sequence represented by SEQ ID NO: 7 is the same as the amino acid sequence represented by SEQ ID NO: 1 and SEQ ID NO: 2
The partial amino acid sequence common to the amino acid sequence represented by is shown in FIG. 5 (FIG. 5).

Further, the proteins of the present invention include:
One or more (eg, 1) of the amino acid sequences represented by SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3
An amino acid sequence in which about 20 to about 20, preferably about 1 to 9, and more preferably several (eg, 1 to 5) amino acids have been deleted, SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3 In the amino acid sequence represented by 1 or 2 or more (for example, about 1 to 20, preferably about 1 to 9,
More preferably, an amino acid sequence having several (eg, 1 to 5) amino acids added thereto, SEQ ID NO: 1, SEQ ID NO: 2
Alternatively, one or two or more amino acids in the amino acid sequence represented by SEQ ID NO: 3 (eg, about 1 to 20, preferably 1
About 9 pieces, more preferably several pieces (eg, 1 to 5 pieces)
An amino acid sequence in which the amino acid of the above is replaced with another amino acid,
Alternatively, a protein or the like containing an amino acid sequence obtained by combining them is also used. SEQ ID NO: as above:
When the amino acid sequence represented by 1, SEQ ID NO: 2 or SEQ ID NO: 3 has been deleted, added or substituted, the position of the deletion, addition or substitution is not particularly limited. Positions other than the partial amino acid sequence common to the amino acid sequence represented by 1, the amino acid sequence represented by SEQ ID NO: 2 and the amino acid sequence represented by SEQ ID NO: 3 are exemplified. Specifically, in the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO:
5, a position other than the amino acid sequence represented by SEQ ID NO: 6 or SEQ ID NO: 7 is preferred. When the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2 is deleted, added or substituted, the position of the deletion, addition or substitution is not particularly limited. Amino acid sequence represented by 1 and SEQ ID NO: 2
And positions other than the partial amino acid sequence common to the amino acid sequences represented by Specifically, SEQ ID NO:
In the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2, positions other than the amino acid sequence represented by SEQ ID NO: 4, SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 7 are preferable. Among the above-mentioned proteins, proteins derived from mammals and having ependymin-like activities (for example, nerve elongation and nerve regeneration in the central nervous system, glial cell activation, memory formation in the brain, etc.) are preferred.

In the present specification, the protein has a N-terminus (amino terminus) at the left end and a C-terminus (carboxyl terminus) at the right end according to the convention of peptide labeling. The protein of the present invention, including the protein containing the amino acid sequence represented by SEQ ID NO: 1, usually has a carboxyl group (-COOH) or a carboxylate (-CO
O ⁻ ), but the C-terminal may be an amide (—CONH ₂ ) or an ester (—COOR). Here, as R in the ester, for example, methyl, ethyl, n-
C such as propyl, isopropyl or n-butyl
_1-6 alkyl groups, for example, C _3-8 cycloalkyl groups such as cyclopentyl and cyclohexyl, for example, C _6-12 aryl groups such as phenyl and α-naphthyl, for example, phenyl-C _1-2 such as benzyl and phenethyl An alkyl group or α-naphthyl-C such as α-naphthylmethyl
_In addition to C _7-14 aralkyl groups such as a _1-2 alkyl group, a pivaloyloxymethyl group widely used as an oral ester and the like are used. When the protein of the present invention has a carboxyl group (or carboxylate) other than the C-terminus, the protein of the present invention includes a carboxyl group amidated or esterified. As the ester in this case, for example, the above-mentioned C-terminal ester and the like are used. Further, the protein of the present invention includes:
In the above-mentioned protein, the amino group of the N-terminal amino acid residue (eg, methionine residue) has a protecting group (for example,
Protected by a C _1-6 acyl group such as a C _1-6 alkanoyl such as a formyl group or an acetyl group), a glutamyl group formed by cleavage of the N-terminal side in a living body, pyroglutamylation, A substituent on the side chain of the amino acid (for example, -OH, -SH, amino group, imidazole group, indole group, guanidino group, etc.) is a suitable protecting group (for example, C _1-6 such as formyl group, acetyl group, etc.) Protected with a C _1-6 acyl group such as alkanoyl), amidated (—CONH ₂ ) or esterified (—COOR) carboxyl group on the side chain of an amino acid in the molecule, and / or Alternatively, a complex protein such as a so-called glycoprotein to which a sugar chain is bound is also included.

As a specific example of the protein of the present invention, for example, the amino acid sequence represented by SEQ ID NO: 1 (FIG. 1)
A human-derived (more specifically, human placenta-derived) protein having the 38th to 224th amino acid sequence of SEQ ID NO: 2, the amino acid sequence represented by SEQ ID NO: 2 (the 35th to 224th amino acids in FIG. 2) A protein derived from a rat (more specifically, from the rat brain) having an amino acid sequence (SEQ ID NO: 2) with Gly added to the N-terminal of the amino acid sequence represented by SEQ ID NO: 2
Rat-derived (more specifically, rat brain-derived) protein having the amino acid sequence at position 224 (amino acid sequence at position 224);
A mouse-derived (more specifically, mouse spinal cord-derived) protein having the 224th amino acid sequence), the N-terminal of the amino acid sequence represented by SEQ ID NO: 3 and the C-terminal of the amino acid sequence represented by SEQ ID NO: 17 The amino acid sequence to which 7 amino acids are added (the 31st to 22nd amino acids in FIG. 3)
A protein derived from a mouse (more specifically, derived from the mouse spinal cord) having the fourth amino acid sequence) is used.

The partial peptide of the protein of the present invention may be any peptide as long as it is a partial peptide of the protein of the present invention. For example, at least 10 of the constituent amino acid sequences of the protein of the present invention A peptide having an amino acid sequence of 50 or more, more preferably 100 or more, preferably a nerve elongation or nerve regeneration in the central nervous system or the like, a glial cell activation, or memory formation in the brain Peptides having activity such as action are used. Specifically, the amino acid sequence represented by SEQ ID NO: 4 (FIG. 4, the 41st to 53rd amino acid sequence of the amino acid sequence represented by any one of SEQ ID NOs: 11 to 13) , The amino acid sequence represented by SEQ ID NO: 5 (FIG. 4, SEQ ID NO: 68 to the ninth amino acid sequence represented by any one of SEQ ID NO: 13 to SEQ ID NO: 13)
Ninth amino acid sequence), the amino acid sequence represented by SEQ ID NO: 6 (FIG. 4, twelfth amino acid sequence represented by any one of SEQ ID NOs: 11 to 13).
The second to 146th amino acid sequence) or the amino acid sequence represented by SEQ ID NO: 7 (FIG. 4, SEQ ID NO: 1)
A partial peptide having an amino acid sequence represented by any one of SEQ ID NOs: 1 to 13 (the 195th to 211st amino acid sequences) is used.

The amino acid sequence represented by SEQ ID NO: 4 (FIG. 5, the 41st to 53rd amino acid sequences of the amino acid sequence represented by SEQ ID NO: 11 or SEQ ID NO: 12); The amino acid sequence represented by the amino acid sequence represented by the amino acid sequence represented by SEQ ID NO: 11 or SEQ ID NO: 12 (68th to 106th amino acid sequence) and the amino acid sequence represented by SEQ ID NO: 9 (FIG. 5, SEQ ID NO: No .: 11 or 146th amino acid sequence of the amino acid sequence represented by SEQ ID NO: 12), or the amino acid sequence represented by SEQ ID NO: 7 (FIG. 5, represented by SEQ ID NO: 11 or SEQ ID NO: 12) (A 195th to 211st amino acid sequence of the amino acid sequence). Furthermore, in FIG. 5, the 41st to 106th amino acid sequences and the 121st to 17th amino acid sequences of the amino acid sequence represented by any one of SEQ ID NOs: 11 to 13
A partial peptide having the ninth amino acid sequence or the 187th to 211st amino acid sequences is also preferable.

In the partial peptide of the present invention, one or more (for example, about 1 to 10, preferably several (eg, 1 to 5)) amino acids in the above amino acid sequence are deleted. , Or (and) one or more (eg, about 1 to 10, preferably several (eg, 1 to 5)) amino acids added to the amino acid sequence, or (and) the amino acid One or more of the sequences (eg,
About 1 to 10, preferably several (eg, 1 to 5) amino acids may be substituted with another amino acid. In the partial peptide of the present invention, the C-terminal usually has a carboxyl group (—COOH) or a carboxylate (—COO ⁻ ).
Although, as in the protein of the present invention described above, C-terminal, the amide (-CONH ₂₎ or ester (-COO
R). Further, the partial peptide of the present invention has a structure in which the amino group of the N-terminal amino acid residue (eg, methionine residue) is protected by a protecting group, and Glutamyl group generated by cleavage in the body, pyroglutamylated, amino acid side chain in the molecule is protected by a suitable protecting group, carboxyl group on the amino acid side chain in the molecule Is amidated (—CONH ₂ ) or ester (—C
OOR) and / or a complex peptide such as a so-called glycopeptide to which a sugar chain is bound. Since the partial peptide of the present invention can be used as an antigen for producing antibodies, it is necessary to have activities such as nerve elongation, nerve regeneration, glial cell activation, and memory formation in the central nervous system. There is no.

[0023] The protein of the present invention may be a precursor protein. The precursor protein of the present invention, for example,
N-terminal or (and) of the protein of the present invention described above
It is a protein having one or more, preferably about 1 to 200, more preferably about 1 to 100 amino acids bonded to the C-terminal. Specifically, as the precursor protein of the present invention, the amino acid sequence represented by SEQ ID NO: 10 (the 25th to 224th amino acid sequence in FIG. 1) and the amino acid sequence represented by SEQ ID NO: 11 (FIG. 1)
Amino acids 1 to 224), SEQ ID NO:
The amino acid sequence represented by No. 12 (first to 22 in FIG. 2)
A protein containing the same or substantially the same amino acid sequence as the fourth amino acid sequence) or the amino acid sequence represented by SEQ ID NO: 13 (the first to 224th amino acid sequences in FIG. 3) is used. The precursor protein of the present invention may be, for example, a protein derived from the above-mentioned mammalian cells or any tissue in which those cells are present, and, for example, goldfish, zebrafish, salmon, rainbow trout, It may be a protein derived from fish such as herring and carp, or may be a synthetic protein. The amino acid sequence substantially the same as SEQ ID NO: 10 includes, for example, about 4 amino acids as represented by SEQ ID NO: 10.
0% or more, preferably about 60% or more, more preferably 7% or more.
An amino acid sequence having a homology of 0% or more, more preferably about 80% or more, particularly preferably about 90% or more, and most preferably about 95% or more is used. The precursor protein having an amino acid sequence substantially identical to SEQ ID NO: 10 of the present invention includes the aforementioned SEQ ID NO: 1
Any protein may be used as long as it has an amino acid sequence substantially identical to 0 and can produce the above-described protein of the present invention. Thus, quantitative factors such as the molecular weight of the protein may be different.

The amino acid sequence substantially the same as SEQ ID NO: 11 is, for example, about 40% or more, preferably about 60% or more, of the amino acid sequence represented by SEQ ID NO: 11.
More preferably 70% or more, even more preferably about 80%
Above, particularly preferably about 90% or more, most preferably about 95% or more amino acid sequence having homology is used. The precursor protein having substantially the same amino acid sequence as SEQ ID NO: 11 of the present invention has the same amino acid sequence as SEQ ID NO: 11 and produces the above-described protein of the present invention. Any protein may be used as long as it can be used. Thus, quantitative factors such as the molecular weight of the protein may be different. The amino acid sequence substantially the same as SEQ ID NO: 12 includes, for example, about 40% or more, preferably about 60% or more, more preferably 70% or more, and still more preferably about the amino acid sequence represented by SEQ ID NO: 12. 80% or more, particularly preferably about 90% or more, most preferably about 95%
For example, an amino acid sequence having at least% homology is used. The precursor protein having an amino acid sequence substantially identical to SEQ ID NO: 12 of the present invention has an amino acid sequence substantially identical to SEQ ID NO: 12, and produces the protein of the present invention. Any protein may be used as long as it can be used. Thus, quantitative factors such as the molecular weight of the protein may be different. The amino acid sequence substantially the same as SEQ ID NO: 13 includes, for example, about 4 amino acids as represented by SEQ ID NO: 13.
0% or more, preferably about 60% or more, more preferably 7% or more.
An amino acid sequence having a homology of 0% or more, more preferably about 80% or more, particularly preferably about 90% or more, and most preferably about 95% or more is used. The precursor protein having an amino acid sequence substantially identical to SEQ ID NO: 13 of the present invention includes the aforementioned SEQ ID NO: 1
Any protein may be used as long as it has an amino acid sequence substantially the same as that of No. 3 and can produce the above-described protein of the present invention. Thus, quantitative factors such as the molecular weight of the protein may be different.

The precursor protein of the present invention includes one or two or more amino acid sequences represented by any one of SEQ ID NOs: 10 to 13 (for example, about 1 to 20, Preferably about 1 to 9,
More preferably, an amino acid sequence in which several (eg, 1 to 5) amino acids are deleted, SEQ ID NO: 10 to SEQ ID NO:
13, one or more (for example, about 1 to 20, preferably about 1 to 9, more preferably several (for example, 1 to 5)
)), One or more (eg, 1) of the amino acid sequences represented by any one of SEQ ID NOs: 10 to 13;
It contains an amino acid sequence in which about 20 to about 20, preferably about 1 to 9, and more preferably several (eg, 1 to 5) amino acids have been substituted with another amino acid, or an amino acid sequence obtained by combining them. Proteins and the like are also used. Furthermore, the precursor protein of the present invention has a carboxyl group (-COOH) or carboxylate at the C-terminus.
(—COO ⁻ ), but the C-terminal may be an amide (—CONH ₂ ) or an ester (—COOR) as in the protein of the present invention described above. Further, the precursor protein of the present invention includes, as in the case of the above-described protein of the present invention, those in which the amino group of the N-terminal amino acid residue (eg, methionine residue) is protected with a protecting group, Glutamyl group formed by cleavage in vivo, pyroglutamylated, amino acid side chain in the molecule is protected with a suitable protecting group, carboxyl on the amino acid side chain in the molecule group amide those (-CONH ₂₎ on or ester (-COOR) of and and / or a sugar chain also includes conjugated proteins such as glycoproteins bound.

As a specific example of the precursor protein of the present invention, for example, the precursor protein having the amino acid sequence represented by SEQ ID NO: 1 has an amino acid sequence represented by SEQ ID NO: 14 at the N-terminus. The protein to which the signal peptide of the present invention is bound (ie, the protein having the amino acid sequence represented by SEQ ID NO: 11) and the N-terminal of the precursor protein of the present invention having the amino acid sequence represented by SEQ ID NO: 11 will be described later. A protein in which the signal peptide of the present invention having the amino acid sequence represented by SEQ ID NO: 15 has been cleaved (that is, a protein having the amino acid sequence represented by SEQ ID NO: 10); The N-terminal of the protein of the present invention is represented by SEQ ID NO: 16 described below. (Ie, a protein having the amino acid sequence represented by SEQ ID NO: 12) to which the signal peptide of the present invention having the amino acid sequence represented by SEQ ID NO: 3 , A protein to which the signal peptide of the present invention having the amino acid sequence represented by SEQ ID NO: 17 described below is bound (ie,
A protein having the amino acid sequence represented by SEQ ID NO: 13). Since the precursor protein of the present invention has a signal peptide, the protein of the present invention can be efficiently extracellularly secreted. Further, it is useful as an intermediate for producing the protein of the present invention. The precursor protein of the present invention has the same functions as those of the protein of the present invention described later, for example, physiological functions such as nerve elongation and nerve regeneration in the central nervous system, glial cell activation, and memory formation in the brain. Has the same activity as the protein of the present invention.

The signal peptide of the present invention includes, for example, the amino acid sequence represented by SEQ ID NO: 14 (SEQ ID NO: 11 or the first to 37th amino acid sequences in FIG. 1) and the amino acid sequence represented by SEQ ID NO: 15 A sequence (SEQ ID NO: 11 or the 1st to 24th amino acid sequence in FIG. 1), an amino acid sequence represented by SEQ ID NO: 16 (SEQ ID NO: 12 or the 1st to 34th amino acid sequence in FIG. 2) or A peptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 17 (SEQ ID NO: 13 or the first to 34th amino acid sequences in FIG. 3) is used.
The signal peptide of the present invention may be, for example, a peptide derived from the above-described mammalian cells or any tissue in which the cells are present, and, for example, goldfish, zebrafish, salmon, rainbow trout,
It may be a protein derived from fish such as herring and carp, or may be a synthetic peptide. As the amino acid sequence substantially identical to SEQ ID NO: 14,
For example, a homology of about 60% or more, preferably 70% or more, more preferably about 80% or more, further preferably about 90% or more, and most preferably about 95% or more with the amino acid sequence represented by SEQ ID NO: 14. 1 shows an amino acid sequence having the amino acid sequence. The amino acid sequence substantially the same as SEQ ID NO: 15 includes, for example, about 60% or more, preferably 70% or more, more preferably about 80% or more, and still more preferably about the amino acid sequence represented by SEQ ID NO: 15. An amino acid sequence having a homology of 90% or more, most preferably about 95% or more is shown.

The amino acid sequence substantially identical to SEQ ID NO: 16 is, for example, about 60% or more, preferably 70% or more, more preferably about 80% or more, and more preferably the amino acid sequence represented by SEQ ID NO: 16. Preferably about 90%
Above, most preferably, an amino acid sequence having about 95% or more homology. The amino acid sequence substantially the same as SEQ ID NO: 17 includes, for example, about 60% or more, preferably 70% or more, more preferably about 80% or more, and still more preferably about the amino acid sequence represented by SEQ ID NO: 17. An amino acid sequence having a homology of 90% or more, most preferably about 95% or more is shown. The signal peptide of the present invention has an amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16 or SEQ ID NO: 17, and functions as a signal peptide. Any peptide may be used as long as it can exert the following, and quantitative factors such as molecular weight may be different. In addition, as long as the signal peptide of the present invention can exhibit a function as a signal peptide, one or more (for example, 1 to 6)
Amino acid sequence in which about, preferably several (eg, 1 to 4) amino acids have been deleted,
Or an amino acid sequence to which two or more (eg, about 1 to 6, preferably several (eg, 1 to 4)) amino acids are added, and one or more (eg, 1 to 2) About 6 pieces, preferably several pieces (eg, 1-4
)) May be a protein containing an amino acid sequence in which the amino acid is replaced by another amino acid, or an amino acid sequence obtained by combining them.

Furthermore, the signal peptide of the present invention the C-terminus is usually a carboxyl group (-COOH) or carboxylate (-COO ^-) is a, as in the protein of the present invention described above, C-terminal amide (-CONH ₂ ) Or an ester (—COOR). Specific examples of the signal peptide of the present invention include, for example, a peptide having the amino acid sequence represented by SEQ ID NO: 14,
Peptide having the amino acid sequence represented by SEQ ID NO: 15, peptide having the amino acid sequence represented by SEQ ID NO: 16, peptide having the amino acid sequence obtained by removing Gly from the C-terminal of the amino acid sequence represented by SEQ ID NO: 16, sequence A peptide having an amino acid sequence represented by SEQ ID NO: 17 and a peptide having an amino acid sequence obtained by removing 17 amino acids from the C-terminal of the amino acid sequence represented by SEQ ID NO: 17 are used. The signal peptide of the present invention can efficiently secrete various extracellular secretory proteins (peptides) including the protein of the present invention outside the cell. As the salt of the protein, partial peptide, precursor protein or signal peptide of the present invention, salts with physiologically acceptable bases (eg, alkali metals) and acids (eg, organic acids, inorganic acids) are used, Particularly preferred are physiologically acceptable acid addition salts. Examples of such salts include salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) and organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid) And tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid and benzenesulfonic acid).

The protein, partial peptide, precursor protein, signal peptide or a salt thereof of the present invention (hereinafter referred to as “the peptide”)
In the description relating to these production methods, the protein of the present invention is abbreviated) can be produced from the above-mentioned mammalian cells or tissues by a known method for purifying a protein or peptide, or encodes a protein described later. It can also be produced by culturing a transformant containing DNA. Further, it can also be produced according to the peptide synthesis method described later or according thereto.
When produced from mammalian tissues or cells, the homogenized mammalian tissues or cells are extracted with an acid or the like, and the extract is subjected to a combination of chromatography such as reverse phase chromatography and ion exchange chromatography. It can be purified and isolated. For synthesis of the protein of the present invention or its amide, a commercially available resin for protein synthesis can be used. Examples of such resins include chloromethyl resin, hydroxymethyl resin, benzhydrylamine resin, aminomethyl resin, 4-benzyloxybenzyl alcohol resin, 4-methylbenzhydrylamine resin, PAM resin,
4-hydroxymethylmethylphenylacetamidomethyl resin, polyacrylamide resin, 4- (2 ′, 4′-dimethoxyphenyl-hydroxymethyl) phenoxy resin,
-(2 ', 4'-dimethoxyphenyl-Fmocaminoethyl) phenoxy resin. Using such a resin, an amino acid having an α-amino group and a side chain functional group appropriately protected is condensed on the resin according to the sequence of the target protein or peptide according to various known condensation methods. At the end of the reaction, the protein is cleaved from the resin, and at the same time, various protecting groups are removed. Further, an intramolecular disulfide bond formation reaction is carried out in a highly diluted solution to obtain a target protein or an amide thereof.

With respect to the condensation of the protected amino acids described above,
Various activating reagents that can be used for protein synthesis can be used, and carbodiimides are particularly preferable. Carbodiimides include DCC, N, N'-diisopropylcarbodiimide, N-ethyl-N '-(3-dimethylaminoprolyl)
Carbodiimide and the like are used. For these activations, the protected amino acid was directly added to the resin together with a racemization inhibitor additive (eg, HOBt, HOOBt), or the protected amino acid was previously activated as a symmetric anhydride or HOBt ester or HOOBt ester. It can be added to the resin later. The solvent used for activating the protected amino acid or condensing with the resin can be appropriately selected from solvents known to be usable for the protein condensation reaction. For example, N, N-dimethylformamide, N-
Methylpyrrolidone, chloroform, trifluoroethanol, dimethylsulfoxide, DMF, dimethylsulfoxide, pyridine, chloroform, dioxane, methylene chloride, tetrahydrofuran, acetonitrile, ethyl acetate, N-methylpyrrolidone or an appropriate mixture thereof are used. The reaction temperature is appropriately selected from a range known to be usable for a protein bond formation reaction, and is usually appropriately selected from a range of about -20 ° C to 50 ° C. The activated amino acid derivative is usually used in a 1.5 to 4-fold excess. As a result of the test using the ninhydrin reaction, if the condensation is insufficient, sufficient condensation can be performed by repeating the condensation reaction without removing the protecting group. When a sufficient condensation cannot be obtained by repeating the reaction, the unreacted amino acid can be acetylated using acetic anhydride or acetylimidazole so as not to affect the subsequent reaction.

Examples of the amino-protecting group for the starting material include Z, Boc, tertiary pentyloxycarbonyl, isobornyloxycarbonyl, 4-methoxybenzyloxycarbonyl, Cl-Z, Br-Z, adamantyloxycarbonyl, Trifluoroacetyl, phthaloyl, formyl, 2-nitrophenylsulfenyl, diphenylphosphinothioyl, Fmoc and the like are used. Carboxyl groups can be, for example, alkyl esterified (eg, methyl, ethyl, propyl, butyl, tertiary butyl,
Linear, branched or cyclic alkyl esterification such as cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, 2-adamantyl, etc., aralkyl esterification (for example, benzyl ester, 4-nitrobenzyl ester, 4-methoxybenzyl ester) 4-chlorobenzyl ester, benzhydryl esterification), phenacyl esterification, benzyloxycarbonyl hydrazide, tertiary butoxycarbonyl hydrazide,
It can be protected by trityl hydrazide or the like. The hydroxyl group of serine can be protected, for example, by esterification or etherification. As a group suitable for the esterification, for example, a lower alkanoyl group such as an acetyl group, an aroyl group such as a benzoyl group, a group derived from carbonic acid such as a benzyloxycarbonyl group and an ethoxycarbonyl group, and the like are used. Examples of a group suitable for etherification include a benzyl group, a tetrahydropyranyl group, and a t-butyl group. Examples of the protecting group for the phenolic hydroxyl group of tyrosine include, for example, Bzl, Cl ₂
-Bzl, 2-nitrobenzyl, Br-Z, tert-butyl and the like are used. Examples of the protecting group for imidazole of histidine include Tos, 4-methoxy-2,3,6-trimethylbenzenesulfonyl, DNP, benzyloxymethyl, B
um, Boc, Trt, Fmoc and the like are used.

Examples of the activated carboxyl groups of the raw materials include, for example, corresponding acid anhydrides, azides, active esters [alcohols (eg, pentachlorophenol, 2,4,5-trichlorophenol, 2,4- Dinitrophenol, cyanomethyl alcohol, paranitrophenol, HONB, N-hydroxysuccinimide, N-hydroxyphthalimide, and esters with HOBt). As the activated amino group of the raw material, for example, a corresponding phosphoric amide is used. As a method for removing (eliminating) the protecting group, for example, catalytic reduction in a hydrogen stream in the presence of a catalyst such as Pd black or Pd-carbon, or anhydrous hydrogen fluoride, methanesulfonic acid, trifluoromethane Acid treatment with sulfonic acid, trifluoroacetic acid, or a mixture thereof, base treatment with diisopropylethylamine, triethylamine, piperidine, piperazine, etc., reduction with sodium in liquid ammonia, and the like are also used. The elimination reaction by the acid treatment is as follows:
Generally, the reaction is carried out at a temperature of about -20 ° C to 40 ° C, but in the acid treatment, anisole, phenol, thioanisole, metacresol, paracresol, dimethylsulfide, 1,4-butanedithiol, 1,2-ethanedithiol The addition of such a cation scavenger is effective. Also,
2,4- used as an imidazole protecting group for histidine
The dinitrophenyl group is removed by thiophenol treatment, and the formyl group used as an indole protecting group for tryptophan is treated by acid treatment in the presence of 1,2-ethanedithiol and 1,4-butanedithiol, as described above, It is also removed by an alkali treatment using a dilute sodium hydroxide solution, dilute ammonia or the like.

The protection of the functional group which should not be involved in the reaction of the raw materials, the protecting group, the elimination of the protective group, the activation of the functional group involved in the reaction, and the like can be appropriately selected from known groups or known means. . As another method for obtaining an amide form of a protein, for example, first, after protecting the α-carboxyl group of the carboxy terminal amino acid by amidation, the peptide (protein) chain is extended to a desired chain length on the amino group side, A protein from which only the protecting group for the N-terminal α-amino group of the peptide chain has been removed and a protein from which only the protecting group for the carboxyl group at the C-terminal has been removed, and these proteins are mixed in a mixed solvent as described above. To condense. Details of the condensation reaction are the same as described above. After purifying the protected protein obtained by the condensation, all the protecting groups are removed by the above-mentioned method, and a desired crude protein can be obtained. The crude protein is purified by various known purification means, and the main fraction is freeze-dried to obtain an amide of the desired protein. In order to obtain an ester of a protein, for example, after condensing the α-carboxyl group of the carboxy terminal amino acid with a desired alcohol to form an amino acid ester, an ester of the desired protein is obtained in the same manner as the amide of the protein be able to.

The partial peptide of the present invention can be produced according to a peptide synthesis method known per se or by cleaving the protein of the present invention with an appropriate peptidase. As a method for synthesizing a peptide, for example, any of a solid phase synthesis method and a liquid phase synthesis method may be used. That is,
The target peptide can be produced by condensing a partial peptide or amino acid that can constitute the partial peptide of the present invention with the remaining portion, and removing the protective group when the product has a protective group. Known condensation methods and elimination of protecting groups include, for example, the methods described in (1) to (4) below. M. Bodanszky and MA Ondetti, Peptide Synthesis, Interscience Publisher
s, New York (1966) Schroeder and Luebke, The Peptide,
Academic Press, New York (1965) Nobuo Izumiya et al., Fundamentals and experiments of peptide synthesis, Maruzen Co., Ltd.
(1975) Haruaki Yajima and Shunpei Sakakibara, Biochemistry Laboratory Course 1, Protein Chemistry IV, 205, (1977) Supervised by Haruaki Yajima, Development of Continuing Drugs Volume 14 Peptide Synthesis, Hirokawa Shoten The protein of the present invention can be purified and isolated by a combination of ordinary purification methods such as salting out, dialysis, gel filtration, electrophoresis, solvent extraction, distillation, column chromatography, liquid chromatography, and recrystallization. When the protein obtained by the above method is a free form, it can be converted into an appropriate salt by a known method or a method analogous thereto, or conversely, when the protein is obtained as a salt, a known method or analogous method To the free form or other salts.

The DNA encoding the protein of the present invention may be any DNA containing the above-described nucleotide sequence encoding the protein of the present invention. Genomic DNA, genomic DNA library,
Any of the above-described cell / tissue-derived cDNA, the above-described cell / tissue-derived cDNA library, and synthetic DNA may be used. The vector used for the library may be any of bacteriophage, plasmid, cosmid, phagemid and the like. Reverse Transcription was performed directly using the mRNA fraction prepared from the cells and tissues described above.
scriptase Polymerase Chain Reaction (RT-P
It can also be amplified by the CR method). Specifically, as a DNA encoding a protein containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1 of the present invention, for example,
DN containing the base sequence represented by SEQ ID NO: 18
A or a base sequence that hybridizes under high stringency conditions to the base sequence represented by SEQ ID NO: 18 and substantially the same activity as a protein having the amino acid sequence represented by SEQ ID NO: 1 (eg, , Physiological activities such as nerve elongation and nerve regeneration in the central nervous system, glua cell activation, and memory formation in the brain)
Containing a nucleotide sequence encoding a protein having
Any one may be used as long as it is NA. Examples of the base sequence that hybridizes with the base sequence represented by SEQ ID NO: 18 include, for example, about 60% or more, preferably about 70% or more, more preferably about 80% or more with the base sequence represented by SEQ ID NO: 18. More preferably, a nucleotide sequence having a homology of about 90% or more, most preferably about 95% or more is used.

The DNA encoding a protein having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 2 of the present invention includes, for example, the base sequence represented by SEQ ID NO: 19 D
NA or a base sequence that hybridizes with the base sequence represented by SEQ ID NO: 19 under high stringent conditions, and has substantially the same activity as a protein having the amino acid sequence represented by SEQ ID NO: 2 (eg, Any DNA may be used as long as it contains a base sequence encoding a protein having a nerve elongation action, a nerve regeneration action, a glial cell activation action, a memory formation action in the brain, etc. in the central nervous system. . SEQ ID NO: 19
As a base sequence that hybridizes with the base sequence represented by SEQ ID NO: 19, for example, about 60% or more, preferably about 70% or more, more preferably about 80% or more, and further preferably about A nucleotide sequence having a homology of 90% or more, most preferably about 95% or more is used. Examples of the DNA encoding a protein having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 3 of the present invention include, for example, a DNA containing the base sequence represented by SEQ ID NO: 20, or It has a nucleotide sequence that hybridizes under high stringent conditions to the nucleotide sequence represented by SEQ ID NO: 20, and has substantially the same activity as the protein having the amino acid sequence represented by SEQ ID NO: 3 (eg, central nervous system) Any DNA may be used as long as it contains a nucleotide sequence encoding a protein having a nerve elongation effect, a nerve regeneration effect, a glial cell activation effect, and a brain memory formation activity in a system. SEQ ID NO: 20
As a base sequence that hybridizes with the base sequence represented by, for example, the base sequence represented by SEQ ID NO: 20 is about 60% or more, preferably about 70% or more, more preferably about 80% or more, and still more preferably about 80% or more. A nucleotide sequence having a homology of 90% or more, most preferably about 95% or more is used.

Hybridization can be carried out by a method known per se or a method analogous thereto, for example, molecular chromatography.
Cloning (Molecular Cloning) 2nd (J. Sambrook
et al., Cold Spring Harbor Lab. Press, 1989). When a commercially available library is used, it can be performed according to the method described in the attached instruction manual. More preferably, it can be performed under high stringent conditions. High stringency conditions include, for example, a sodium concentration of about 19 to 40 mM, preferably about 19 to 40 mM.
At 20 mM, the temperature is about 50-70 ° C., preferably about 60 ° C.
The condition of ~ 65 ° C is shown. In particular, when the sodium concentration is about 19
Most preferably, the temperature is about 65 ° C. in mM. More specifically, a DNA having a base sequence encoding a protein containing the amino acid sequence represented by SEQ ID NO: 1
The DNA having the base sequence represented by SEQ ID NO: 18 and the like include the DNA having the base sequence encoding the protein containing the amino acid sequence represented by SEQ ID NO: 2 as the DNA having the base sequence represented by SEQ ID NO: 19. A DNA having a base sequence encoding a protein containing an amino acid sequence having Gly added to the N-terminus of the amino acid sequence represented by SEQ ID NO: 2;
As NA, DNA having a base sequence with GGC added to the 5 ′ end of the base sequence represented by SEQ ID NO: 19, etc. has a base sequence encoding a protein containing the amino acid sequence represented by SEQ ID NO: 3 Examples of the DNA include a DNA having the base sequence represented by SEQ ID NO: 20 and the like, wherein the C-terminal 7 amino acids of the amino acid sequence represented by SEQ ID NO: 17 are added to the N-terminal of the amino acid sequence represented by SEQ ID NO: 3. As a DNA having a nucleotide sequence encoding a protein containing an amino acid sequence, the 5'-end of the nucleotide sequence represented by SEQ ID NO: 20 and the 3'-terminal 2 '
For example, DNA having a base sequence with one base added is used. Further, a DN encoding a protein having at least one amino acid sequence represented by SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO: 7 of the present invention
As A, for example, SEQ ID NO: 21, SEQ ID NO: 2
2, DNA having at least one base sequence represented by SEQ ID NO: 23 or SEQ ID NO: 24, or the like is used. Further, a DN encoding a protein having at least one amino acid sequence represented by SEQ ID NO: 4, SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 7 of the present invention
As A, for example, SEQ ID NO: 21, SEQ ID NO: 2
5, DNA having at least one base sequence represented by SEQ ID NO: 26 or SEQ ID NO: 24 is used.

DNA encoding the partial peptide of the present invention
Any DNA may be used as long as it contains a base sequence encoding the above-described partial peptide of the present invention. In addition, any of genomic DNA, genomic DNA library, cDNA derived from the above-mentioned cells / tissues, cDNA library derived from the aforementioned cells / tissues, and synthetic DNA may be used. The vector used for the library may be any of bacteriophage, plasmid, cosmid, phagemid and the like. In addition, RT-direct purification was performed using the mRNA fraction prepared from the cells and tissues described above.
It can also be amplified by the PCR method. In particular,
Examples of the DNA encoding the partial peptide of the present invention include a DNA having a partial base sequence of a DNA having a base sequence represented by SEQ ID NO: 18, SEQ ID NO: 19 or SEQ ID NO: 20, or SEQ ID NO: 18, It has a nucleotide sequence that hybridizes under high stringent conditions with the nucleotide sequence represented by SEQ ID NO: 19 or SEQ ID NO: 20, and has substantially the same activity as the protein of the present invention (eg, nerve elongation, D having a partial base sequence of DNA encoding a partial peptide having a regenerating action, a glial cell activating action, a memory forming action in the brain, etc.
NA or the like is used. SEQ ID NO: 18, SEQ ID NO: 1
Examples of the DNA that hybridizes with the base sequence represented by SEQ ID NO: 9 or SEQ ID NO: 20 include, for example, SEQ ID NO: 1
8, about 60% or more, preferably about 70% or more, more preferably about 80% or more, and still more preferably about 90% of the nucleotide sequence represented by SEQ ID NO: 19 or SEQ ID NO: 20.
As described above, DNA containing a nucleotide sequence having a homology of about 95% or more is most preferably used.

More specifically, SEQ ID NO: 4 of the present invention
Examples of the DNA encoding the partial peptide containing the amino acid sequence represented by SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 7 include, for example, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23 or SEQ ID NO: : DNA having the base sequence represented by 24, or SEQ ID NO: 2
1, a DNA having a nucleotide sequence that hybridizes under high stringent conditions to the nucleotide sequence represented by SEQ ID NO: 22, SEQ ID NO: 23 or SEQ ID NO: 24
Are used. SEQ ID NO: 21, SEQ ID NO: 22,
Examples of the DNA that hybridizes with the nucleotide sequence represented by SEQ ID NO: 23 or SEQ ID NO: 24 include, for example, the nucleotide sequence represented by SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23 or SEQ ID NO: 24. 60% or more,
DNA containing a nucleotide sequence having a homology of preferably about 70% or more, more preferably about 80% or more, still more preferably about 90% or more, and most preferably about 95% or more.
Are used. Specifically, DNA encoding a partial peptide having the amino acid sequence represented by SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO: 7
As, for example, SEQ ID NO: 21, SEQ ID NO: 22,
A DNA having the base sequence represented by SEQ ID NO: 23 or SEQ ID NO: 24 is used.

The DNA encoding the partial peptide having the amino acid sequence represented by SEQ ID NO: 4, SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 7 includes, for example, SEQ ID NO: 21, SEQ ID NO: 25, SEQ ID NO:
DNA having the nucleotide sequence represented by SEQ ID NO: 26 or SEQ ID NO: 24, or SEQ ID NO: 21, SEQ ID NO: 25,
A DNA having a base sequence that hybridizes with the base sequence represented by SEQ ID NO: 26 or SEQ ID NO: 24 under high stringency conditions is used. Examples of DNA that hybridizes with the base sequence represented by SEQ ID NO: 21, SEQ ID NO: 25, SEQ ID NO: 26 or SEQ ID NO: 24 include, for example, SEQ ID NO: 21, SEQ ID NO:
25, about 60% or more, preferably about 70% or more of the nucleotide sequence represented by SEQ ID NO: 26 or SEQ ID NO: 24;
More preferably about 80% or more, even more preferably about 90%
% Or more, and most preferably about 95% or more. Specifically, as a DNA encoding a partial peptide having the amino acid sequence represented by SEQ ID NO: 4, SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 7, for example, SEQ ID NO: 21, SEQ ID NO: DNA having the base sequence represented by SEQ ID NO: 25, SEQ ID NO: 26 or SEQ ID NO: 24, or the like is used.

Further, in FIG. 4, the amino acid sequence of the 41st to 106th amino acid sequence of the amino acid sequence represented by any one of SEQ ID NOS: 11 to 13 and 12th sequence
Examples of the DNA encoding the partial peptide containing the 1st to 179th amino acid sequence or the 187th to 211st amino acid sequence include, for example, SEQ ID NO:
A base sequence of the 121st to 318th base sequence represented by any one of SEQ ID NOs: 28 to 30;
The base sequence from the 360th position to the 537th position or the 559th position;
To the 633rd base sequence, or SEQ ID NO: 2
8 to SEQ ID NO: 30, the 121st to 318th base sequence, the 360th to 537th base sequence or the 559th to 633rd base sequence of the base sequence represented by any one of SEQ ID NOs: A DNA having a base sequence that hybridizes under high stringent conditions is preferred. Nos. 121 to 121 of the base sequence represented by any one of SEQ ID NOs: 28 to 30
Examples of the DNA that hybridizes with the 318th nucleotide sequence, the 360th to 537th nucleotide sequences or the 559th to 633rd nucleotide sequences include, for example, any of SEQ ID NO: 28 to SEQ ID NO: 30 The nucleotide sequence from the 121st to 318th nucleotide, the 360th to 537th nucleotide or the 559th to 633th nucleotide of the nucleotide sequence represented by SEQ ID NO:
DNA containing a nucleotide sequence having a homology of preferably about 70% or more, more preferably about 80% or more, still more preferably about 90% or more, and most preferably about 95% or more.
Are used. Hybridization methods and high stringency conditions are the same as described above. Specifically, in FIG. 4, the 41st to 106th amino acid sequence and the 121st to 17th amino acid sequence of the amino acid sequence represented by any one of SEQ ID NOs: 11 to 13
D encoding a partial peptide having the ninth amino acid sequence or the 187th to 211st amino acid sequences
As NA, for example, SEQ ID NO: 28 to SEQ ID NO: 3
0 of the base sequence represented by any one of SEQ ID NOs.
1st to 318th nucleotide sequence, 360th to 5th nucleotide sequences
DNA having the 37th nucleotide sequence or the 559th to 633rd nucleotide sequence is preferred.

D encoding the precursor protein of the present invention
The NA may be any as long as it contains a base sequence encoding the precursor protein of the present invention described above. Also, genomic DNA, genomic DNA library, cDNA derived from the above-described cells / tissue, cDNA library derived from the aforementioned cells / tissue, synthetic DN
Any of A may be used. The vector used for the library may be any of bacteriophage, plasmid, cosmid, phagemid and the like. Alternatively, it can be directly amplified by the RT-PCR method using an mRNA fraction prepared from the cells and tissues described above. Specifically, the DNA encoding the precursor protein having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 10 of the present invention includes, for example, the base represented by SEQ ID NO: 27 D containing sequence
NA or a DNA having a base sequence that hybridizes with the base sequence represented by SEQ ID NO: 27 under high stringent conditions and containing a base sequence encoding a protein capable of producing the protein of the present invention described above. Any of them may be used. As the base sequence hybridizing with the base sequence represented by SEQ ID NO: 27, for example, about 60% or more, preferably about 70% or more, more preferably about 80% with the base sequence represented by SEQ ID NO: 27
Above, more preferably about 90% or more, most preferably about 95% or more nucleotide sequences having homology are used. More specifically, as the DNA having the nucleotide sequence encoding the precursor protein having the amino acid sequence represented by SEQ ID NO: 10, a DNA having the nucleotide sequence represented by SEQ ID NO: 27 or the like is used.

The DNA encoding the precursor protein having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 11 of the present invention includes:
For example, a DNA containing the nucleotide sequence represented by SEQ ID NO: 28, or a nucleotide sequence having a nucleotide sequence that hybridizes with the nucleotide sequence represented by SEQ ID NO: 28 under high stringency conditions, DNA containing a base sequence encoding a protein that can be produced
Any one may be used. As a base sequence that hybridizes with the base sequence represented by SEQ ID NO: 28,
For example, the nucleotide sequence represented by SEQ ID NO: 28 and about 60
% Or more, preferably about 70% or more, more preferably about 8%.
A nucleotide sequence having a homology of 0% or more, more preferably about 90% or more, and most preferably about 95% or more is used. More specifically, as the DNA having the base sequence encoding the precursor protein containing the amino acid sequence represented by SEQ ID NO: 11, a DNA having the base sequence represented by SEQ ID NO: 28 is used. Examples of the DNA encoding the precursor protein having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 12 of the present invention include, for example, a DNA containing the base sequence represented by SEQ ID NO: 29, Alternatively, a DNA having a base sequence that hybridizes with the base sequence represented by SEQ ID NO: 29 under high stringent conditions and containing a base sequence encoding a protein capable of producing the protein of the present invention described above. Any one may be used. As the base sequence hybridizing with the base sequence represented by SEQ ID NO: 29, for example, about 60% or more, preferably about 70% or more, more preferably about 80% or more with the base sequence represented by SEQ ID NO: 29, More preferably about 90% or more, most preferably about 95%
Base sequences having the above homology are used. More specifically, as the DNA having the nucleotide sequence encoding the precursor protein containing the amino acid sequence represented by SEQ ID NO: 12, a DNA having the nucleotide sequence represented by SEQ ID NO: 29, or the like is used.

The DNA encoding the precursor protein having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 13 of the present invention includes:
For example, a DNA containing the nucleotide sequence represented by SEQ ID NO: 30 or a nucleotide sequence having a nucleotide sequence that hybridizes with the nucleotide sequence represented by SEQ ID NO: 30 under high stringency conditions, DNA containing a base sequence encoding a protein that can be produced
Any one may be used. The nucleotide sequence that hybridizes with the nucleotide sequence represented by SEQ ID NO: 30 includes:
For example, the nucleotide sequence represented by SEQ ID NO: 30 and about 60
% Or more, preferably about 70% or more, more preferably about 8%.
A nucleotide sequence having a homology of 0% or more, more preferably about 90% or more, and most preferably about 95% or more is used. More specifically, as the DNA having the nucleotide sequence encoding the precursor protein containing the amino acid sequence represented by SEQ ID NO: 13, a DNA having the nucleotide sequence represented by SEQ ID NO: 30 is used. The same hybridization method and high stringency conditions as described above are used.

D encoding the signal peptide of the present invention
The NA may be any as long as it contains the above-described nucleotide sequence encoding the signal peptide of the present invention. Also, genomic DNA, genomic DNA library, cDNA derived from the above-described cells / tissue, cDNA library derived from the aforementioned cells / tissue, synthetic DN
Any of A may be used. The vector used for the library may be any of bacteriophage, plasmid, cosmid, phagemid and the like. Alternatively, it can be directly amplified by the RT-PCR method using an mRNA fraction prepared from the cells and tissues described above. Specifically, the DNA encoding the signal peptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 14 of the present invention includes, for example, the base sequence represented by SEQ ID NO: 31 D contained
NA or a DNA having a base sequence that hybridizes with the base sequence represented by SEQ ID NO: 31 under high stringency conditions and containing a base sequence encoding a peptide capable of exhibiting a function as a signal peptide Any material may be used. As a base sequence hybridizing with the base sequence represented by SEQ ID NO: 31, for example, about 60% or more, preferably about 70% or more, more preferably about 80% with the base sequence represented by SEQ ID NO: 31
Above, more preferably about 90% or more, most preferably about 95% or more nucleotide sequences having homology are used. As the DNA having the base sequence encoding the signal peptide having the amino acid sequence represented by SEQ ID NO: 14 of the present invention, a DNA having the base sequence represented by SEQ ID NO: 31 or the like is used.

The DNA encoding the signal peptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 15 of the present invention includes:
For example, a DNA containing the nucleotide sequence represented by SEQ ID NO: 32, or a nucleotide sequence that hybridizes with the nucleotide sequence represented by SEQ ID NO: 32 under high stringency conditions, and exhibits a function as a signal peptide Containing a nucleotide sequence encoding a peptide capable of
Any one may be used. As a base sequence that hybridizes with the base sequence represented by SEQ ID NO: 32,
For example, the nucleotide sequence represented by SEQ ID NO: 32 and about 60
% Or more, preferably about 70% or more, more preferably about 8%.
A nucleotide sequence having a homology of 0% or more, more preferably about 90% or more, and most preferably about 95% or more is used. More specifically, the DNA having a base sequence encoding a signal peptide having the amino acid sequence represented by SEQ ID NO: 15 of the present invention includes SEQ ID NO: 3
DNA having the base sequence represented by 2 or the like is used. Examples of the DNA encoding a signal peptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 16 of the present invention include, for example,
DN containing the base sequence represented by SEQ ID NO: 33
A, or DNA containing a base sequence that hybridizes with the base sequence represented by SEQ ID NO: 33 under high stringent conditions and contains a base sequence encoding a peptide capable of exhibiting a function as a signal peptide Any material may be used. As the base sequence hybridizing with the base sequence represented by SEQ ID NO: 33, for example, about 60% or more, preferably about 70% or more, more preferably about 80% with the base sequence represented by SEQ ID NO: 33
Above, more preferably about 90% or more, most preferably about 95% or more nucleotide sequences having homology are used. More specifically, the DNA having a base sequence encoding a signal peptide having the amino acid sequence represented by SEQ ID NO: 16 of the present invention includes SEQ ID NO: 33
DNA having the base sequence represented by SEQ ID NO: 16 is Gly from the C-terminal of the amino acid sequence represented by SEQ ID NO: 16.
DNA having a base sequence encoding a signal peptide having an amino acid sequence excluding SEQ ID NO: 3
For example, a DNA having a base sequence obtained by removing GGC from the 3 ′ end of the base sequence represented by 3 is used.

The DNA encoding the signal peptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 17 of the present invention includes:
For example, it has a DNA containing the base sequence represented by SEQ ID NO: 34, or a base sequence that hybridizes with the base sequence represented by SEQ ID NO: 34 under high stringency conditions, and exhibits a function as a signal peptide. Containing a nucleotide sequence encoding a peptide capable of
Any one may be used. As a base sequence that hybridizes with the base sequence represented by SEQ ID NO: 34,
For example, the nucleotide sequence represented by SEQ ID NO: 34 and about 60
% Or more, preferably about 70% or more, more preferably about 8%.
A nucleotide sequence having a homology of 0% or more, more preferably about 90% or more, and most preferably about 95% or more is used. More specifically, the DNA having a base sequence encoding a signal peptide having the amino acid sequence represented by SEQ ID NO: 17 of the present invention includes SEQ ID NO:
Examples of a DNA having a nucleotide sequence encoding a signal peptide having an amino acid sequence obtained by removing 7 amino acids from the C-terminal of the amino acid sequence represented by SEQ ID NO: 17 such as a DNA having a nucleotide sequence represented by SEQ ID NO: 34 include SEQ ID NO: 34 DNA having a base sequence obtained by removing 21 bases from the 3 'end of the base sequence represented by the following formula is used.
The same hybridization method and high stringency conditions as described above are used.

[0049]

DESCRIPTION OF THE PREFERRED EMBODIMENTS The means for cloning DNA encoding the protein, partial peptide or precursor protein of the present invention (hereinafter sometimes abbreviated as the protein of the present invention) includes the following: Amplifying the target DNA from the DNA library or the like by PCR using a synthetic DNA primer having a partial base sequence of DNA encoding
Selection by hybridization of a DNA incorporated into an appropriate vector with a DNA fragment encoding a part or the entire region of the protein of the present invention or a labeled synthetic DNA. Hybridization methods are described, for example, in Molecular Cloning 2nd (J. Sambrook e.).
, Cold Spring Harbor Lab. Press, 1989). When a commercially available library is used, it can be performed according to the method described in the attached instruction manual. The DNA encoding the partial peptide or signal peptide of the present invention can also be produced according to a known oligonucleotide synthesis method. Conversion of DNA base sequence (deletion / addition / substitution)
Using a known kit, for example, Mutan ^™ -G (Takara Shuzo Co., Ltd.), Mutan ^™ -K (Takara Shuzo Co., Ltd.),
It can be carried out according to a method known per se, such as the apped duplex method or the Kunkel method, or a method analogous thereto. DNA encoding the cloned protein of the present invention
Can be used as it is, or digested with a restriction enzyme, or added with a linker, if desired. The DNA may have ATG as a translation initiation codon at the 5 'end and TAA, TGA or TAG as a translation stop codon at the 3' end. These translation initiation codon and translation termination codon can also be added using a suitable synthetic DNA adapter. An expression vector for a DNA encoding the protein of the present invention may be prepared, for example, by (A) cutting out a DNA fragment of interest from the DNA encoding the protein of the present invention;
It can be produced by ligating the DNA fragment downstream of a promoter in an appropriate expression vector.

As a vector, a plasmid derived from Escherichia coli (eg, pBR322, pBR325, pUC12,
UC13), a plasmid derived from Bacillus subtilis (eg, pUB11)
0, pTP5, pC194), yeast-derived plasmids (eg, pSH19, pSH15), bacteriophages such as λ phage, animal viruses such as retrovirus, vaccinia virus, baculovirus, etc.
A1-11, pXT1, pRc / CMV, pRc / RS
V, pcDNAI / Neo, etc. are used. The promoter used in the present invention may be any promoter as long as it is appropriate for the host used for gene expression. For example, when an animal cell is used as a host, CAG promoter, SRα promoter, SV
40 promoter, LTR promoter, CMV (cytomegalovirus) promoter, HSV-TK promoter and the like. Of these, CAG promoter, SRα promoter and the like are preferably used. When the host is Escherichia, trp promoter, lac promoter, recA promoter, .lambda.P _L promoter, lpp promoter, T7 promoter, etc. When the host is Bacillus,
SPO1 promoter, SPO2 promoter, pen
When the host is yeast, such as the P promoter, PHO
5 promoter, PGK promoter, GAP promoter, ADH1 promoter and the like are preferable. When the host is an insect cell, the polyhedrin promoter, P1
0 promoter and the like are preferred.

[0051] In addition to the above, an expression vector optionally containing an enhancer, a splicing signal, a poly-A addition signal, a selection marker, an SV40 replication origin (hereinafter sometimes abbreviated as SV40 ori) and the like may be used. Can be used. As a selection marker, for example, dihydrofolate reductase (hereinafter, dhfr)
Gene), ampicillin resistance gene (hereinafter sometimes abbreviated as Amp ^r ), neomycin resistance gene (hereinafter sometimes abbreviated as Neo)
And the like. The dhfr gene confers methotrexate (MTX) resistance and Neo confers G418 resistance.
In particular, when the dhfr gene is used as a selection marker by using dhfr gene-deficient Chinese hamster cells CHO, cells transformed with the target gene can be selected using a thymidine-free medium. If necessary, a signal sequence suitable for the host may be replaced with the N
Add to the terminal side. When the host is Escherichia, phoA signal sequence, ompA signal sequence, etc., when the host is Bacillus, α-amylase signal sequence, subtilisin signal sequence, etc.
When the host is yeast, MFα signal sequence, SU
When the host is an animal cell such as a C2 signal sequence, for example, an insulin signal sequence, an α-interferon signal sequence, an antibody molecule / signal sequence, etc. can be used. A transformant can be produced by introducing a vector containing the DNA encoding the protein of the present invention thus constructed into a cell.

Examples of the host include Escherichia,
Bacillus, yeast, insect cells, insects, animal cells and the like are used. Specific examples of the genus Escherichia include Escherichia coli K12.DH1.
[Processings of the National Academy of Sciences of the USA (Proc. Natl. Acad. Sci. USA), 60, 160
(1968)], JM103 [Nukuilec Acids
Research, (Nucleic Acids Research), 9, 309
(1981)], JA221 [Journal of Molecular Biolog
y)], 120, 517 (1978)], HB101
[Journal of Molecular Biology, 4
1, 459 (1969)], C600 [Genetics, 39, 440 (1954)] and the like. Examples of the bacterium belonging to the genus Bacillus include, for example, Bacillus subtilis MI114 [Gene, 2
4, 255 (1983)], 207-21 [Journal of Biochemistr
y), 95, 87 (1984)]. Examples of yeast include Saccharomyces cerevisiae AH22, AH22
^{R -, NA87-11A, DKD-5D} , 20B-1
2. Schizosaccharomy
ces pombe) NCYC1913, NCYC2036, Pichia pastoris KM71 (Pichia pastoris) and the like are used.

As insect cells, for example, the virus is A
In the case of cNPV, a cell line derived from night larvae of moth (Spodop
tera frugiperda cell (Sf cell), Trichoplusia ni
MG1 cells from the midgut, H from the eggs of Trichoplusia ni
igh Five ^TM cells, cells derived from Mamestra brassicae or
Estigmena acrea-derived cells and the like are used. When the virus is BmNPV, a silkworm-derived cell line (Bombyx mor
iN; BmN cells). Examples of the Sf cells include Sf9 cells (ATCC CRL1711), Sf21
Cells (Vaughn, JL et al., In vitro
ro), 13, 213-217, (1977)). As insects, for example, silkworm larvae are used [Maeda et al., Nature, 315, 592 (198).
5)]. As animal cells, for example, monkey cells COS-
7. Vero cells, Chinese hamster cells CHO
(Hereinafter abbreviated as CHO cell), dhfr gene-deficient Chinese hamster cell CHO (hereinafter, CHO (dhf
r ^-) cells and abbreviated), L cells, myeloma cells, human F
L cells, 293 cells, C127 cells, mouse cells, BA
LB3T3 cells, Sp-2 / O cells and the like are used.
Among these, CHO cells, CHO (dhfr ⁻ ) cells, 293 cells and the like are preferable. Transformation can be performed using a general technique depending on the host cell used.

For transformation of Escherichia, for example, Procagings of the National Academy of Sciences of the USA (Proc. Natl. Acad. Sci. USA), Vol. 69 , 21
10 (1972) and Gene, 17, 107 (1)
982). In order to transform Bacillus sp., For example, Molecular and General Genetics (Mole
cular & General Genetics), 168, 111 (19
79) and the like.
To transform yeast, see, for example, Methods in Enzymology, 194.
Vol. 182-187 (1991).
Proc. Natl. Acad. Sc of the National Academy of Sciences of the USA
USA), vol. 75, 1929 (1978). To transform insect cells or insects, for example, use bio / technology (Bi
o / Technology), 6, 47-55 (1988). To transform animal cells, for example, the method described in Cell Engineering Separate Volume 8, New Cell Engineering Experiment Protocol, 263-267 (1995) (published by Shujunsha), Virology, 52, 456 (1973). Can be performed according to Examples of a method for introducing an expression vector into cells include the calcium phosphate method [Graham, FL and van der Eb, AJ Virology (Virology) 52, 456-467 (1973)], electroporation [Neumann, E. et al. EMBO J.
1,841-845 (1982)]. Thus, a transformant transformed with the expression vector containing the DNA encoding the protein of the present invention is obtained.

As a method for stably expressing the protein of the present invention by using animal cells, there is a method of selecting, by clone selection, cells in which the expression vector introduced into the above animal cells has been integrated into the chromosome. . Specifically, a transformant is selected using the above-mentioned selection marker as an index. Furthermore, a stable animal cell line having a high expression ability of the protein of the present invention can be obtained by repeatedly performing clonal selection on the animal cells obtained using the selection marker. When the dhfr gene was used as a selection marker, cultivation was carried out while gradually increasing the MTX concentration, and the dhfr gene was selected by selecting resistant strains.
DN encoding the protein of the present invention together with the gene
A can be amplified intracellularly to obtain a more highly expressed animal cell line. The above transformant is cultured under conditions in which a DNA encoding the protein of the present invention can be expressed,
By producing and accumulating the protein of the present invention, the protein of the present invention or a salt thereof can be produced.

When culturing a transformant whose host is Escherichia or Bacillus, a liquid medium is suitable as a medium to be used for cultivation. A carbon source, a nitrogen source, an inorganic substance and the like are contained. As a carbon source, for example, glucose, dextrin, soluble starch, sucrose, etc.As a nitrogen source, for example, ammonium salts, nitrates, corn steep liquor, peptone, casein, meat extract, soybean meal, potato extract and the like Examples of the inorganic or organic substance and the inorganic substance include calcium chloride, sodium dihydrogen phosphate, and magnesium chloride. Also,
Yeast extract, vitamins, growth promoting factors and the like may be added. The pH of the medium is preferably about 5 to 8. As a medium for culturing Escherichia, for example, M9 medium containing glucose and casamino acid [Miller, Journal of Experiments in Molecular Genetics (Journal of Experiments in Mo
lecular Genetics), 431-433, Cold Spring Ha
rbor Laboratory, New York 1972]. If necessary, an agent such as 3β-indolylacrylic acid can be added in order to make the promoter work efficiently. When the host is Escherichia,
The cultivation is usually carried out at about 15 to 43 ° C. for about 3 to 24 hours, and if necessary, aeration and stirring can be added. When the host is a bacterium belonging to the genus Bacillus, culturing is usually performed at about 30 to 40 ° C. for about 6 to
The treatment is performed for 24 hours, and if necessary, ventilation and stirring can be applied.

When culturing a transformant whose host is yeast, for example, Burkholder (Burkho
lder) Minimal medium [Bostian, KL et al., Processings of the National Academy of Sciences of the USA (Proc. Natl. Aca
USA, 77, 4505 (1980)] or an SD medium containing 0.5% casamino acid [Bitter, GA
Proc. Natl. Acad. Sci. USA, Proc. Of the National Academy of Sciences of the USA, 81, 53
30 (1984)]. The pH of the medium is about 5
Adjustment to 8 is preferred. Culture is usually about 20 ° C to 35
C. for about 24-72 hours, adding aeration and agitation as needed. When culturing a transformant in which the host is an insect cell, Grace's Insect Medium (Grace, T .;
CC, Nature, 195, 788 (1962)) to which an immobilized additive such as 10% bovine serum is appropriately added. The pH of the medium is preferably adjusted to about 6.2 to 6.4. The cultivation is usually performed at about 27 ° C. for about 3 to 5 days, and aeration and / or agitation are added as necessary. When culturing a transformant in which the host is an animal cell, examples of the medium include MEM medium containing about 5 to 20% fetal bovine serum [Seience, Vol. 122, 501 (1952)],
DMEM medium [Virology, 8, 39
6 (1959)], RPMI 1640 medium [The Journal of the American Medical Association]
n) Volume 199, 519 (1967)], 199 Medium [Proceeding of the Societe for the Biological Medicine (Proceeding of the Societ)
y for the Biological Medicine), 73, 1 (195
0)]. Preferably, the pH is between about 6-8. The cultivation is usually performed at about 30 ° C. to 40 ° C. for about 15 to 72 hours, and if necessary, aeration and stirring are added. In particular, C
When HO (dhfr ⁻ ) cells and the dhfr gene are used as selection markers, it is preferable to use a DMEM medium containing dialyzed fetal bovine serum containing almost no thymidine. As described above, the protein of the present invention can be produced in a transformant.

The protein of the present invention can be separated and purified from the above culture by, for example, the following method. When the protein of the present invention is extracted from cultured cells or cells, after culturing, the cells or cells are collected by a known method, suspended in an appropriate buffer, and subjected to sonication, lysozyme, and / or freeze-thawing. After the cells or cells are destroyed by the method, a method of obtaining a crude extract of the protein of the present invention by centrifugation or filtration may be used as appropriate. The buffer may contain a protein denaturant such as urea or guanidine hydrochloride, or a surfactant such as Triton X-100 ^™ . When the protein is secreted into the culture solution, after completion of the culture, the supernatant is separated from the cells or cells by a method known per se, and the supernatant is collected. The protein of the present invention contained in the thus obtained culture supernatant or extract can be purified by appropriately combining known separation and purification methods. These known separation and purification methods include methods utilizing solubility such as salting out and solvent precipitation, dialysis, ultrafiltration, gel filtration, and SDS-polyacrylamide gel electrophoresis, and the like. Method using difference in charge, method using charge difference such as ion exchange chromatography, method using specific affinity such as affinity chromatography, and use of difference in hydrophobicity such as reverse phase high performance liquid chromatography A method utilizing a difference between isoelectric points, such as an isoelectric focusing method, is used. When the thus obtained protein of the present invention is obtained in a free form, it can be converted to a salt by a method known per se or a method analogous thereto, and conversely, when the protein of the present invention is obtained in a salt, It can be converted to a free form or another salt by a method analogous thereto. The protein of the present invention produced by the recombinant can be arbitrarily modified or the polypeptide can be partially removed by applying an appropriate protein modifying enzyme before or after purification. Examples of protein modifying enzymes include trypsin, chymotrypsin, arginyl endopeptidase,
Protein kinases, glycosidases and the like are used. The presence of the thus produced protein of the present invention can be measured by an enzyme immunoassay or a radioimmunoassay using a specific antibody.

The protein of the present invention, its partial peptide,
Antibodies to the precursor protein or a salt thereof (hereinafter, abbreviated as the protein of the present invention) may be any of a polyclonal antibody and a monoclonal antibody as long as the antibody can recognize the protein of the present invention. Furthermore, antibodies against the protein or the like of the present invention may have an activity of neutralizing the activity of the protein or the like of the present invention. An antibody against the protein or the like of the present invention can be produced by using the protein or the like of the present invention as an antigen according to a method for producing an antibody or antiserum known per se.

[Preparation of Monoclonal Antibody] (a) Preparation of Monoclonal Antibody-Producing Cell The protein of the present invention is administered to a mammal at a site where the antibody can be produced by administration to itself or together with a carrier and a diluent. You. Complete Freund's adjuvant or incomplete Freund's adjuvant may be administered in order to enhance the antibody-producing ability upon administration. Administration is usually performed once every 2 to 6 weeks, for a total of about 2 to 10 times. Examples of the mammal used include monkeys, rabbits, dogs, guinea pigs, mice, rats, sheep, and goats, and mice and rats are preferably used. When producing monoclonal antibody-producing cells, a mammal having been immunized with the antigen, for example, an individual having an antibody titer is selected from a mouse, and the spleen or lymph node is collected 2 to 5 days after the final immunization and contained therein. By fusing the antibody-producing cells thus obtained with myeloma cells of a homologous or heterologous warm-blooded animal, a monoclonal antibody-producing hybridoma can be prepared. The measurement of the antibody titer in the antiserum, for example, after reacting the antiserum with a labeled protein described below,
This is performed by measuring the activity of the labeling agent bound to the antibody. The fusion operation is performed by known methods, for example, the method of Kohler and Milstein [Nature, 256, 495 (197
5)]. Examples of the fusion promoter include polyethylene glycol (PEG) and Sendai virus, and PEG is preferably used. Examples of myeloma cells include NS-1,
Examples include warm-blooded animal myeloma cells such as P3U1, SP2 / 0, and AP-1, and P3U1 is preferably used. The preferred ratio between the number of antibody-producing cells (spleen cells) and the number of myeloma cells used is about 1: 1 to 20: 1, and PEG (preferably PEG1000 to PEG60) is used.
00) is added at a concentration of about 10-80%,
Incubation at 40 ° C., preferably about 30-37 ° C. for about 1-10 minutes allows efficient cell fusion.

Various methods can be used for screening a monoclonal antibody-producing hybridoma. For example, a hybridoma culture supernatant is added to a solid phase (eg, a microplate) on which a protein antigen has been adsorbed directly or together with a carrier, and then, A method for detecting a monoclonal antibody bound to a solid phase by adding an anti-immunoglobulin antibody labeled with a radioactive substance or an enzyme (an anti-mouse immunoglobulin antibody is used when cells used for cell fusion are mice) or protein A A method in which a hybridoma culture supernatant is added to a solid phase on which an anti-immunoglobulin antibody or protein A is adsorbed, a protein or the like labeled with a radioactive substance or an enzyme is added, and a monoclonal antibody bound to the solid phase is detected. Can be The selection of the monoclonal antibody can be performed according to a method known per se or a method analogous thereto, but is usually performed using HAT (hypoxanthine,
(Aminopterin, thymidine) in a medium for animal cells or the like. As a selection and breeding medium, any medium can be used as long as a hybridoma can grow. For example, 1 to 20%, preferably 10 to
RPMI 1640 medium containing 20% fetal calf serum, 1
GIT medium containing 10% to 10% fetal calf serum (Wako Pure Chemical Industries, Ltd.) or serum-free medium for hybridoma culture (SF
M-101, Nissui Pharmaceutical Co., Ltd.) can be used. The culture temperature is usually 20 to 40 ° C, preferably about 37 ° C.
° C. The culturing time is usually 5 days to 3 weeks, preferably 1 week to 2 weeks. The culture can be usually performed under 5% carbon dioxide. The antibody titer of the hybridoma culture supernatant can be measured in the same manner as the measurement of the antibody titer in the antiserum described above.

(B) Purification of Monoclonal Antibody Separation and purification of monoclonal antibodies can be carried out by the same method as in the separation and purification of normal polyclonal antibodies (eg, salting out, alcohol precipitation, isoelectric precipitation, etc.). , Electrophoresis, adsorption / desorption with an ion exchanger (eg, DEAE), ultracentrifugation, gel filtration, antigen-bound solid phase or an active adsorbent such as protein A or protein G to collect only antibodies and bind Specific Purification Method for Obtaining Antibody by Dissociation].

[Preparation of Polyclonal Antibody] The polyclonal antibody of the present invention can be produced according to a method known per se or a method analogous thereto. For example, a complex of an immunizing antigen (protein antigen) and a carrier protein is formed, a mammal is immunized in the same manner as in the above-described method for producing a monoclonal antibody, and an antibody-containing substance against the protein of the present invention is collected from the immunized animal. Then, the antibody can be produced by separating and purifying the antibody. Regarding a complex of an immunizing antigen and a carrier protein used to immunize a mammal, the type of the carrier protein and the mixing ratio of the carrier and the hapten should be such that the antibody can be efficiently produced against the hapten immunized by crosslinking the carrier. , What may be cross-linked at any ratio, for example,
Hapten 1 by weight ratio of bovine serum albumin, bovine thyroglobulin, keyhole limpet hemocyanin, etc.
On the other hand, a method of coupling at a ratio of about 0.1 to 20, preferably about 1 to 5 is used. Various coupling agents can be used for coupling the hapten and the carrier. For example, glutaraldehyde, carbodiimide, a maleimide active ester, an active ester reagent containing a thiol group or a dithioviridyl group, or the like is used. The condensation product is administered to a mammal (eg, mouse) at a site capable of producing an antibody by itself or together with a carrier and a diluent. Complete Freund's adjuvant or incomplete Freund's adjuvant may be administered in order to enhance the antibody-producing ability upon administration. The administration can usually be performed once every about 2 to 6 weeks, for a total of about 3 to 10 times. The polyclonal antibody is collected from the blood, ascites, etc., preferably from the blood of the mammal immunized by the above method. The polyclonal antibody titer in the antiserum can be measured in the same manner as the above-described antibody titer of the hybridoma culture supernatant. The separation and purification of the polyclonal antibody can be performed according to the same immunoglobulin separation and purification method as the above-described separation and purification of the monoclonal antibody.

A DNA or mRNA containing a base sequence encoding the protein of the present invention, its partial peptide or precursor protein (hereinafter referred to as the DNA or mRNA of the present invention)
Oligonucleotides having a base sequence complementary to or substantially complementary to RNA) or derivatives thereof include, for example, bases complementary to or substantially complementary to the DNA or mRNA of the present invention. Any oligonucleotide or derivative thereof having a sequence and an action capable of promoting the expression of the protein or the like of the present invention may be used. The nucleotide sequence substantially complementary to the DNA or mRNA of the present invention includes, for example, the DN of the present invention.
About 60% or more, preferably about 70%, of the total nucleotide sequence or partial nucleotide sequence of the nucleotide sequence complementary to A or mRNA (that is, the complementary strand of the DNA or mRNA of the present invention).
Above, more preferably about 80% or more, further preferably about 90% or more, and most preferably about 95% or more of nucleotide sequences having homology. In particular, the DN of the present invention
Of the entire base sequence of the complementary strand of A or mRNA, the complementary sequence with the base sequence of the portion encoding the N-terminal site of the protein or the like of the present invention (for example, the base sequence near the start codon) is about 60% or more, preferably Oligonucleotides or derivatives thereof having a homology of about 70% or more, more preferably about 80% or more, even more preferably about 90% or more, and most preferably about 95% or more are suitable. These oligonucleotides or derivatives thereof can be produced using a known DNA synthesizer or the like.

The protein of the present invention, its partial peptide or a salt thereof has physiological activities such as nerve elongation, nerve regeneration, glial cell activation and brain memory formation in the central nervous system. ing. Therefore, the protein of the present invention, its partial peptide or a salt thereof can be used for various uses. Hereinafter, the protein of the present invention, a partial peptide thereof, or a salt thereof (hereinafter, may be abbreviated as the protein of the present invention, etc.), and a DN encoding the protein of the present invention.
A (hereinafter sometimes abbreviated as the DNA of the present invention), antibodies to the protein and the like of the present invention (hereinafter sometimes abbreviated as the antibody of the present invention), and uses of oligonucleotides or derivatives will be described.

(1) Medicine The protein or the like of the present invention or the DNA of the present invention may be, for example, a deficiency of a gene encoding the protein of the present invention or a disease resulting therefrom, or a decrease in the function of the protein of the present invention or a disease resulting therefrom. It is useful as a medicine such as a therapeutic / prophylactic agent. Specifically, the protein or the like of the present invention or the DNA of the present invention can be used, for example, for the treatment and prevention of Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis (ALS), dementia, cerebellar degeneration and the like. It is useful as a drug such as an agent. For example, because the protein or the like of the present invention is reduced or deficient in a living body, the function of the protein or the like of the present invention in cells is insufficient, or when there is a patient who does not normally exhibit,
(B) The DNA of the present invention was administered to the patient to express the protein of the present invention in vivo, and (b) the DNA of the present invention was inserted into cells to express the protein of the present invention. Later, by transplanting the cells into a patient, (c) administering the protein or the like of the present invention to the patient, etc., so that the role of the protein or the like of the present invention in the patient is sufficiently or normally exerted. Can be. When the protein or the like of the present invention is used as the above medicine, for example, tablets, capsules, elixirs, microcapsules, and the like, which are sugar-coated as necessary, or water or other pharmaceutical agents It can be used parenterally in the form of injections, such as sterile solutions or suspensions in liquids that are acceptable. For example, the protein or the like of the present invention is mixed with physiologically acceptable carriers, flavors, excipients, vehicles, preservatives, stabilizers, binders, and the like in the unit dosage form generally required for the practice of the formulation. Can be manufactured. The amount of the active ingredient in these preparations is such that an appropriate dose in the specified range can be obtained. The DNA of the present invention
When used as a prophylactic agent, the DNA can be administered to mammals alone or after insertion into a suitable vector such as a retrovirus vector, adenovirus vector, adenovirus associated virus vector, or the like, in a conventional manner. The DNA of the present invention can be administered as it is or in the form of a formulation together with a physiologically acceptable carrier such as an adjuvant for promoting uptake, and then administered with a gene gun or a catheter such as a hydrogel catheter. When the protein or the like of the present invention is used as the above-mentioned therapeutic / prophylactic agent, at least 90%, preferably 95%
Or more, preferably 98% or more, and more preferably 99% or more.
% Or more is preferably used.

Examples of additives that can be mixed with tablets, capsules and the like include binders such as gelatin, corn starch, tragacanth and acacia, excipients such as crystalline cellulose, corn starch, gelatin, alginic acid. For example, a leavening agent such as sucrose, a lubricant such as magnesium stearate, a sweetening agent such as sucrose, lactose or saccharin, a flavoring agent such as peppermint, reddish oil or cherry and the like are used. When the preparation unit form is a capsule, a liquid carrier such as oil and fat can be further contained in the above-mentioned type of material. Sterile compositions for injection can be formulated according to normal pharmaceutical practice such as dissolving or suspending the active substance in vehicles such as water for injection, and naturally occurring vegetable oils such as sesame oil, coconut oil and the like. As the aqueous solution for injection, for example, physiological saline, isotonic solution containing glucose and other adjuvants (eg, D-sorbitol, D-mannitol, sodium chloride, etc.) and the like are used. For example, it may be used in combination with an alcohol (eg, ethanol), a polyalcohol (eg, propylene glycol, polyethylene glycol), a nonionic surfactant (eg, Polysorbate 80 ^™ , HCO-50) and the like. As the oily liquid, for example, sesame oil, soybean oil and the like are used, and as a solubilizing agent, for example, benzyl benzoate, benzyl alcohol and the like may be used in combination. In addition, buffers (eg, phosphate buffer, sodium acetate buffer), soothing agents (eg, benzalkonium chloride, procaine hydrochloride, etc.), stabilizers (eg, human serum albumin, polyethylene glycol, etc.), storage Agents (eg, benzyl alcohol, phenol, etc.), antioxidants and the like. Pharmaceutical compositions such as prepared injections are usually
Fill into appropriate ampules. The vector into which the DNA of the present invention has been inserted is also formulated in the same manner as described above, and is usually used parenterally.

The preparations thus obtained are safe and have low toxicity, and are therefore useful, for example, in mammals (eg, humans, rats, mice, guinea pigs, rabbits, sheep, pigs, cows, horses, cats, dogs, monkeys). Etc.). The dose of the protein or the like of the present invention varies depending on the target disease, the subject of administration, the administration route, and the like. )), The protein or the like is added in about 0.1 per day.
mg-100 mg, preferably about 1.0-50 mg, more preferably about 1.0-20 mg. When administered parenterally, the single dose of the protein or the like varies depending on the administration subject, target disease, and the like. For example, for the purpose of treating Alzheimer's disease, the protein or the like of the present invention is injected into an adult ( Weighing 60 kg), about 0.01 to 30 mg of the protein or the like per day,
Preferably, about 0.1 to 20 mg, more preferably about 0.1 to 10 mg, is administered by injecting into an affected part (eg, brain). For other animals,
The amount converted per 60 kg can be administered.
The DNA of the present invention can be used in the same manner as described above.

(2) Gene Diagnostic Agent The DNA of the present invention can be used, for example, in mammals (eg, human, rat, mouse,
DNA or mRNA encoding the protein of the present invention in guinea pigs, rabbits, sheep, pigs, cows, horses, cats, dogs, monkeys, etc. (hereinafter, DN of the present invention)
A (abbreviated as A or mRNA) abnormality (gene abnormality) can be detected, and therefore, it is useful as a gene diagnostic agent for DNA, mRNA, or the like of the present invention, such as damage, deficiency, decreased expression, or mutation. The above-described genetic diagnosis using the DNA of the present invention can be performed, for example, by the known Northern hybridization or PCR-SSCP method (Genomics, Vol. 5, pp. 874-879 (19)
89), The Prossings of the National
Proceedings of the Natinal Academy of Sciences
of the United States of America), Vol. 86, 27
66-2770 (1989)). For example, when a decrease in the expression of the mRNA is detected by Northern hybridization or when PC
When a DNA mutation is detected by the R-SSCP method, for example, diseases such as Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis (ALS), dementia, and cerebellar degeneration are included. Alternatively, it can be diagnosed that the possibility of illness is high in the future.

(3) Quantification of the protein of the present invention, its partial peptide, or a salt thereof The antibody of the present invention can specifically recognize the protein of the present invention and the like. It can be used for quantification of proteins and the like, particularly for quantification by sandwich immunoassay. That is, the present invention provides (i)
An antibody against the protein or the like of the present invention is allowed to react competitively with the test solution and the labeled protein or the like of the present invention, and the ratio of the labeled protein or the like of the present invention bound to the antibody is measured. (Ii) a method for quantifying the protein or the like of the present invention in a test solution, and (ii) simultaneous use of a test solution and an antibody of the present invention insoluble on a carrier and another labeled antibody of the present invention; The present invention provides a method for quantifying the protein or the like of the present invention in a test solution, wherein the activity of a labeling agent on an insolubilized carrier is measured after continuous reaction.
In the quantification method (ii), one antibody may be an antibody that recognizes the N-terminal of the protein of the present invention, and the other antibody may be an antibody that reacts with the C-terminal of the protein of the present invention. desirable.

Further, in addition to quantification of the protein of the present invention using a monoclonal antibody against the protein of the present invention (hereinafter sometimes referred to as the monoclonal antibody of the present invention), detection by tissue staining or the like can be performed. Can also. For these purposes, the antibody molecule itself may be used, or F (ab ') ₂ , Fab', or Fab fraction of the antibody molecule may be used. The method for quantifying the protein or the like of the present invention using the antibody of the present invention is not particularly limited. Any method can be used as long as it is a method for detecting the amount of the compound by chemical or physical means and calculating it from a standard curve prepared using a standard solution containing a known amount of antigen. For example, nephelometry, competition method, immunometric method and sandwich method are preferably used,
In terms of sensitivity and specificity, it is particularly preferable to use a sandwich method described later. Labeling agents used in the measurement method using a labeling substance include radioisotopes, enzymes, fluorescent substances,
Light-emitting substances and the like. As radioisotopes,
For example, [ ¹²⁵ I], [ ¹³¹ I], [ ³ H], [ ¹⁴ C] and the like are preferable as the above-mentioned enzymes, which are stable and have high specific activities. For example, β-galactosidase, β-glucosidase, alkali Phosphatase, peroxidase, malate dehydrogenase and the like are used. As the fluorescent substance, for example, fluorescamine, fluorescein isothiocyanate and the like are used. As the luminescent substance, for example, luminol, a luminol derivative, luciferin, lucigenin and the like are used. Further, a biotin-avidin system can be used for binding the antibody or antigen to the labeling agent.

For the insolubilization of the antigen or antibody, physical adsorption may be used, or a method using a chemical bond usually used for insolubilizing and immobilizing proteins or enzymes may be used. As the carrier, for example, agarose,
Dextran, insoluble polysaccharides such as cellulose, polystyrene, polyacrylamide, synthetic resins such as silicon,
Alternatively, glass or the like is used. In the sandwich method, the test solution is reacted with the insolubilized monoclonal antibody of the present invention (primary reaction), and further reacted with another labeled monoclonal antibody of the present invention (secondary reaction). By measuring the activity of the labeling agent, the amount of the protein of the present invention in the test solution can be quantified. 1
The next reaction and the secondary reaction may be performed in the reverse order, simultaneously, or at a different time. The labeling agent and the method of insolubilization can be in accordance with those described above. In the immunoassay by the sandwich method, the antibody used for the solid phase antibody or the labeling antibody is not necessarily one kind, and a mixture of two or more kinds of antibodies is used for the purpose of improving measurement sensitivity and the like. You may. In the method for measuring the protein or the like of the present invention by the sandwich method of the present invention, the antibody of the present invention used in the primary reaction and the secondary reaction is preferably an antibody having a different binding site to the protein or the like of the present invention. . That is, 1
The antibody used for the secondary reaction and the secondary reaction is, for example, 2
The antibody used in the next reaction is a protein such as the protein of the present invention.
When recognizing the end, an antibody used for the primary reaction is preferably an antibody recognizing other than the C-terminal, for example, the N-terminal.

The antibody of the present invention can be used for a measurement system other than the sandwich method, for example, a competition method, an immunometric method, a nephelometry and the like. In the competition method, after an antigen in a test solution and a labeled antigen are allowed to react competitively with an antibody, an unreacted labeled antigen (F) and a labeled antigen (B) bound to the antibody are separated ( B / F separation), B,
F. The amount of any label is measured, and the amount of antigen in the test solution is quantified. In this reaction method, a soluble antibody was used
/ F separation by a liquid phase method using polyethylene glycol, a second antibody against the above antibody, or a solid-phased antibody as the first antibody, or using a soluble first antibody and immobilizing it as the second antibody. And a solid phase immobilization method using a phased antibody. In the immunometric method, an antigen in a test solution and a solid-phased antigen are subjected to a competitive reaction with a fixed amount of a labeled antibody, and then a solid phase and a liquid phase are separated. And an excess amount of the labeled antibody, and then immobilized antigen is added to bind unreacted labeled antibody to the solid phase, and then the solid phase and the liquid phase are separated. Next, the amount of label in any phase is measured to determine the amount of antigen in the test solution. In nephelometry, the amount of insoluble precipitates generated as a result of an antigen-antibody reaction in a gel or in a solution is measured. When the amount of antigen in the test solution is small and only a small amount of sediment is obtained, laser nephrometry using laser scattering is preferably used.

In applying these individual immunological measurement methods to the quantification method of the present invention, no special conditions, operations, and the like need to be set. What is necessary is just to construct the measuring system of the protein etc. of the present invention by adding ordinary technical considerations of those skilled in the art to ordinary conditions and operation methods in each method. For details of these general technical means, reference can be made to reviews, books, and the like. For example, Hiroe Irie, "Radio Immunoassay" (Kodansha, published in 1974), Hiroshi Irie, "Radio Immunoassay" (Kodansha, published in 1979), Eiji Ishikawa et al., "Enzyme Immunoassay" (Medical Shoin, Showa Ed. Ishikawa et al., “Enzyme Immunoassay” (2nd edition) (Issue Shoin, 1982), Eiji Ishikawa et al. “Enzyme Immunoassay” (Third Edition), 3rd Ed. Published in 1962, "Methods in ENZYMOLOGY" Vol. 70 (Immunochem
ical Techniques (Part A)), ibid.Vol. 73 (Immunochem
ical Techniques (Part B)), ibid.Vol. 74 (Immunochem
ical Techniques (Part C)), ibid.Vol. 84 (Immunochem
ical Techniques (Part D: Selected Immunoassays)), ibid., Vol. 92 (Immunochemical Techniques (Part E: Monocl
onal Antibodies and General Immunoassay Method
s)), ibid.Vol. 121 (Immunochemical Techniques (Part
I: Hybridoma Technology and Monoclonal Antibodie
s)) (above, published by Academic Press). As described above, the protein or the like of the present invention can be quantified with high sensitivity by using an antibody against the protein or the like of the present invention. Furthermore, by quantifying the concentration of the protein or the like of the present invention using the antibody of the present invention, various diseases involving the protein or the like of the present invention can be diagnosed. Specifically, when a decrease in the concentration of the protein or the like of the present invention is detected, for example, Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis (ALS), dementia, cerebellar degeneration, etc. It can be diagnosed that the possibility of the disease is high. Thus, the antibodies of the present invention are useful as diagnostic agents for the above diseases. Further, the antibody of the present invention can be used for detecting the protein of the present invention or the like present in a subject such as a body fluid or a tissue. Also, preparation of an antibody column used for purifying the protein of the present invention,
It can be used to detect the protein of the present invention in each fraction at the time of purification.

(4) Screening of Drug Candidate Compounds for Various Diseases The functions of the proteins of the present invention, such as nerve elongation and nerve regeneration in the central nervous system, glial cell activation, brain memory formation and the like. Compounds or salts thereof that promote physiological activity are used as therapeutic / prophylactic agents for various diseases such as Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis (ALS), dementia, and cerebellar degeneration. it can. Therefore, the protein or the like of the present invention is useful as a reagent for screening a compound or its salt that promotes the function of the protein or its salt of the present invention. That is, the present invention provides a method for screening a compound that promotes the function of a protein or the like of the present invention (hereinafter, may be abbreviated as a function promoter of the protein or the like of the present invention) characterized by using the protein or the like of the present invention. Provide a way. More specifically, for example,
(A) A comparison is made between (i) the case where the protein or the like of the present invention is brought into contact with a nerve cell or nerve tissue and (ii) the case where the protein or the like of the present invention or a test compound is brought into contact with a nerve cell or nerve tissue. (B) (i) administering the protein or the like of the present invention to a vertebrate animal; and (ii) using the protein or the like of the present invention and a test compound. A method for screening for a function-promoting agent such as the protein of the present invention, which is characterized in that it is compared with the case of administering to a vertebrate, is provided. Specifically, in the above screening method (a), for example, in the cases (i) and (ii), a nerve elongation effect in the central nervous system of the protein, its partial peptide or a salt thereof, and nerve regeneration It is characterized by measuring and comparing physiological activities such as action and glial cell activating action. The screening method (b) is characterized in that, for example, in the cases (i) and (ii), the protein, its partial peptide, or a salt thereof is measured for brain memory formation and compared. Is what you do.

Examples of the neurons include neuroblastoma, glioma cells or hybrid cells thereof (eg, N cells).
18TG-2, IMR-32, GOTO (eg, GOTO
-P3), NB1, C6BU-1, U251, KNS4
2, KNS81, NG108-15 cells, PC12 cells capable of differentiating into nerves, etc.). As the nerve tissue, for example, mouse neuroepithelial cells, rat hippocampus primary cultured cells, mouse embryo cultured Purkinje cells, mouse dorsal root ganglia and the like are used. Test compounds include, for example, peptides, proteins, non-peptidic compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, plasma, etc., and these compounds are novel compounds. Or a known compound. To carry out the above screening method (a),
The protein of the present invention, its partial peptide or a salt thereof (hereinafter sometimes abbreviated as the protein of the present invention)
Is dissolved or suspended in a buffer suitable for screening to prepare a sample such as the protein of the present invention. Buffers that do not inhibit contact between the protein of the present invention and nerve cells / tissues (for example, pH
Any phosphate buffer or Tris-HCl buffer having a pH of about 4 to 10 (preferably, about 6 to 8) may be used. The contact time is usually about 1 day to 10 days, preferably about 7 days to 10 days. The contact temperature is usually about 37 ° C. Nerve elongation, nerve regeneration, and glial cell activation in the central nervous system and the like of the protein of the present invention can be measured by conventional means such as measurement of visual nerve axon elongation and measurement of changes in intracellular Ca ²⁺ concentration. It can be measured using: For example, the physiological activity such as the nerve elongation action, nerve regeneration action, and glial cell activation action in the case (ii) above is about 20% or more, preferably about 30% or more, as compared with the case of the above (i). A test compound that preferably promotes about 50% or more, more preferably 70% or more, can be selected as a compound that promotes the function of the protein or the like of the present invention.

To carry out the above screening method (b), the protein or the like or the test compound of the present invention is administered to a vertebrate by, for example, intravenous injection, subcutaneous injection, intramuscular injection, oral administration, or the like. In the case of oral administration, the dose of the protein or the like of the present invention is generally about 0.1 to 1 per day for chimpanzees (with a body weight of 60 kg).
00 mg, preferably about 1.0 to 50 mg, more preferably about 1.0 to 20 mg. In the case of parenteral administration, the single dose varies depending on the administration subject, administration method, and the like. For example, in the case of an injection, a chimpanzee (with a body weight of 60 kg) is usually used in an amount of about 0.0
It is convenient to administer about 1 to 30 mg, preferably about 0.1 to 20 mg, more preferably about 0.1 to 10 mg by intravenous injection. For other animals,
The amount converted per 60 kg can be administered.
Examples of vertebrates include fish (for example, carp, salmon, herring, rainbow trout, goldfish, etc.), humans, mice, rats, rabbits, sheep, pigs, cows, horses, cats, dogs, monkeys, chimpanzees, etc. Mammals and the like are used. The memory-forming effect of the protein of the present invention in the brain can be determined by a known method, for example, the Morris water maze experiment (Mo
rris, RGMJ Neurosci. Meth. 11, 47-60 (1984)]
It can be measured according to the following. For example, the above (i
A test compound which promotes the memory formation effect in the case of i) by about 20% or more, preferably 50% or more, more preferably 70% or more as compared with the case of the above (i), promotes the function of the protein or the like of the present invention. Can be selected as the compound.

The screening kit of the present invention contains the protein of the present invention, a partial peptide thereof or a salt thereof. Examples of the screening kit of the present invention include the following. Eagle [Screening reagent] Assay Buffer Hanks' solution protein preparations of the present invention the protein or a salt thereof nerve cell or nerve tissue the nerve cells or nerve tissue of 10 ⁴ cells / well MEM, by using a Hank's solution 24 Cultured at 37 ° C under 5% CO 2 in a well plate Detection Detection Observation with an inverted microscope [Measurement method] The number of cells extending the axon per unit field of view of the well to which the test compound was added was counted, and the test compound was counted. A significant difference test is performed with the number of cells extending nerve axons per unit field of the control wells to which no is added.

The compound obtained by using the screening method or the screening kit of the present invention or a salt thereof may be a test compound described above, for example, a peptide, a protein, a non-peptide compound, a synthetic compound, a fermentation product, a cell extract, It is a compound selected from plant extracts, animal tissue extracts and the like, and is a compound that promotes the functions of the protein and the like of the present invention. The compound that promotes the function of the protein or the like of the present invention itself exerts the function of the protein or the like of the present invention by showing a physiological activity such as a nerve elongation action, a nerve regeneration action, or a glial cell activation action in the central nervous system or the like. It may promote additively or synergistically, or may promote the function of the protein or the like of the present invention, although it does not exhibit the physiological activity itself. As a salt of the compound, a physiologically acceptable base (eg, an alkali metal)
And salts with acids (eg, organic acids, inorganic acids) are used, and physiologically acceptable acid addition salts are particularly preferred. Examples of such salts include salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) and organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid) , Tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid,
For example, salts with methanesulfonic acid and benzenesulfonic acid) are used. The compound or its salt for promoting the function of the protein or the like of the present invention includes, for example, Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis (A
LS), dementia, cerebellar degeneration, and other various diseases.

When a compound obtained by using the screening method or the screening kit of the present invention is used as the above-mentioned therapeutic / prophylactic agent, it can be carried out according to a conventional method. For example, as needed, a sugar-coated tablet, capsule, elixir, microcapsule, etc., orally, or a sterile solution or suspension in water or another pharmaceutically acceptable liquid. It can be used parenterally in the form of injections. For example, the compound or a salt thereof is mixed with physiologically acceptable carriers, flavors, excipients, vehicles, preservatives, stabilizers, binders and the like in a unit dosage form required for generally accepted pharmaceutical practice. Can be manufactured. The amount of the active ingredient in these preparations is such that an appropriate dose in the specified range can be obtained. These tablets, capsules, elixirs, microcapsules, and injections include the above-mentioned treatments containing the protein of the present invention and the like.
The same prophylactic agent is used. Since the preparation obtained in this way is safe and has low toxicity, it can be used, for example, in mammals (eg, humans, mice, rats, rabbits, sheep, pigs, cows, horses, cats, dogs, monkeys, chimpanzees, etc.). Can be administered. The dose of the compound or a salt thereof varies depending on the target disease, the administration subject, the administration route and the like. In a range of about 0.1 to 100 mg, preferably about 1.0 to 50 mg of the compound per day.
g, more preferably about 1.0-20 mg. When administered parenterally, the single dose of the compound varies depending on the administration subject, target disease, and the like. When the compound is administered, the compound is administered in an amount of about 0.01 to 30 mg, preferably about 0.1 to 30 mg per day.
It is convenient to administer about 20 mg, more preferably about 0.1-10 mg, by intravenous injection. In the case of other animals, the dose can be administered in terms of 60 kg.

(5) Oligonucleotide or Derivative Thereof DNA or mRN Encoding Protein etc. of the Present Invention
An oligonucleotide or a derivative thereof that can complementarily bind to A and can promote the expression of the DNA, mRNA or protein of the present invention can promote the function of the protein or the like of the present invention in vivo. Therefore, the oligonucleotide or a derivative thereof can be used as a drug for gene therapy or prevention of diseases such as Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis (ALS), dementia, and cerebellar degeneration. Can be used as When the oligonucleotide or a derivative thereof is used as the above-mentioned therapeutic / prophylactic agent, it can be produced and administered to a mammal in the same manner as the aforementioned therapeutic / prophylactic agent for various diseases containing the protein or DNA of the present invention. it can. Since the preparation obtained in this way is safe and has low toxicity, it can be used, for example, in mammals (eg, humans, mice, rats, rabbits, sheep, pigs, cows, horses, cats, dogs, monkeys, chimpanzees, etc.). Can be administered. When the oligonucleotide or a derivative thereof is used as the above-mentioned therapeutic or prophylactic agent, the oligonucleotide or the derivative thereof is inserted alone or into an appropriate vector such as a retrovirus vector, an adenovirus vector, an adenovirus associated virus vector, or the like. Thereafter, it can be administered to mammals according to conventional means. The oligonucleotide or a derivative thereof can be administered as it is or in the form of a formulation together with a physiologically acceptable carrier such as an auxiliary agent for promoting uptake, and can be administered using a gene gun or a catheter such as a hydrogel catheter. Further, the oligonucleotide or a derivative thereof can be used in a tissue or a cell according to the present invention.
It can also be used as a diagnostic oligonucleotide probe for examining the presence of NA and its expression status.

(6) D encoding the protein of the present invention
Preparation of Non-Human Animal Having NA The transgenic non-human animal expressing the protein or the like of the present invention can be prepared using the DNA of the present invention. Non-human animals include mammals (eg, rats, mice, rabbits, sheep, pigs, cows, cats, dogs, monkeys, etc.) (hereinafter abbreviated as animals), and particularly, mice, rabbits, and the like. It is suitable. When transferring the DNA of the present invention to a subject animal, the DNA
It is generally advantageous to use as a gene construct linked downstream of a promoter capable of being expressed in animal cells. For example, when transferring the DNA of the present invention derived from a mouse, a gene construct linked to downstream of various promoters that are highly homologous thereto and can express the DNA of the present invention in animal cells, For example, D which produces a protein or the like of the present invention at a high level by microinjection into fertilized mouse eggs
NA transfer animals can be created. As this promoter, for example, a ubiquitous expression promoter such as a virus-derived promoter and metallothionein can be used.

DNA transfer at the fertilized egg cell stage
It is ensured that it is present in all germ cells and somatic cells of the target animal. The presence of the protein or the like of the present invention in the germinal cells of the produced animal after DNA transfer means that all the offspring of the produced animal have the protein or the like of the present invention in all of its germinal and somatic cells. The progeny of this type of animal that has inherited the gene has the protein of the present invention in all of its germinal and somatic cells. DNA of the present invention
After confirming that the transgenic animal stably retains the gene by mating, it can be reared and bred in a normal breeding environment as the DNA-bearing animal. Further, by crossing male and female animals having the DNA of interest, homozygous animals having the transgene on both homologous chromosomes are obtained, and by crossing the male and female animals, all the offspring are
Breeding passages can be made to have NA. The animal to which the DNA of the present invention is transferred has high expression of the protein or the like of the present invention, and thus is useful as an animal for screening a compound or a salt thereof that promotes the function of the protein or the like of the present invention. The DNA transgenic animal of the present invention can also be used as a cell source for tissue culture. For example, DN in the tissue of the DNA transgenic mouse of the present invention
The protein or the like of the present invention can be analyzed by directly analyzing A or RNA or by analyzing a tissue in which the protein or the like of the present invention expressed by a gene is present. Cells of a tissue having the protein or the like of the present invention can be cultured by standard tissue culture techniques, and these can be used to study the function of cells from generally difficult-to-culture tissues, such as brain and peripheral tissues. . Also,
By using the cells, for example, a drug that enhances the function of various tissues can be selected. Further, if there is a high expression cell line, the protein of the present invention can be isolated and purified therefrom.

In the present specification and drawings, when bases and amino acids are indicated by abbreviations, IUPAC-IUB
Abbreviations based on Commision on Biochemical Nomenclature or common abbreviations in the field,
An example is given below. When an amino acid can have an optical isomer, the L-form is indicated unless otherwise specified. DNA: deoxyribonucleic acid cDNA: complementary deoxyribonucleic acid A: adenine T: thymine G: guanine C: cytosine RNA: ribonucleic acid mRNA: messenger ribonucleic acid dATP: deoxyadenosine triphosphate dTTP: deoxythymidine triphosphate dGTP: deoxyguanosine triphosphate Phosphate dCTP: Deoxycytidine triphosphate ATP: Adenosine triphosphate EDTA: Ethylenediaminetetraacetic acid SDS: Sodium dodecyl sulfate

Gly: glycine Ala: alanine Val: valine Leu: leucine Ile: isoleucine Ser: serine Thr: threonine Cys: cysteine Met: methionine Glu: glutamic acid Asp: aspartic acid Lysine arginine : Tyrosine Trp: Tryptophan Pro: Proline Asn: Asparagine Gln: Glutamine pGlu: Pyroglutamic acid

The substituents, protecting groups and reagents frequently used in the present specification are represented by the following symbols. Me: methyl group Et: ethyl group Bu: butyl group Ph: phenyl group TC: thiazolidine -4 (R) - carboxamide group Tos: p-toluenesulfonyl CHO: formyl Bzl: benzyl Cl ₂ -Bzl: 2,6-dichlorobenzyl Bom: benzyloxymethyl Z: benzyloxycarbonyl Br-Z: 2-bromobenzyloxycarbonyl Cl-Z: 2-chlorobenzyloxycarbonyl Boc: t-butyloxycarbonyl DNP: dinitrophenol Trp: trityl Bum: t-butoxymethyl Fmoc: N-9-fluorenylmethoxycarbonyl HOBt: 1-hydroxybenztriazole HOOBT: 3,4-dihydro-3-hydroxy-4-oxo-1,2,3-benzotriazine HONB: 1- Dorokishi-5-norbornene-2,3-dicarboximide DCC: N, N'-dicyclohexylcarbodiimide

The sequence numbers in the sequence listing in the present specification indicate the following sequences. [SEQ ID NO: 1] This shows the amino acid sequence of the mature human ependymin-like protein of the present invention. [SEQ ID NO: 2] This shows the amino acid sequence of mature rat ependymin-like protein of the present invention. [SEQ ID NO: 3] This shows the amino acid sequence of mature mouse ependymin-like protein of the present invention. [SEQ ID NO: 4] Human ependymin-like protein, rat ependymin-like protein and mouse ependym of the present invention
1 shows a common amino acid sequence with an in-like protein. [SEQ ID NO: 5] Human ependymin-like protein, rat ependymin-like protein and mouse ependym of the present invention
1 shows a common amino acid sequence with an in-like protein. [SEQ ID NO: 6] Human ependymin-like protein, rat ependymin-like protein and mouse ependym of the present invention
1 shows a common amino acid sequence with an in-like protein. [SEQ ID NO: 7] Human ependymin-like protein, rat ependymin-like protein and mouse ependym of the present invention
1 shows a common amino acid sequence with an in-like protein. [SEQ ID NO: 8] This shows the common amino acid sequence of the human ependymin-like protein of the present invention and the rat ependymin-like protein. [SEQ ID NO: 9] This shows the common amino acid sequence of the human ependymin-like protein of the present invention and the rat ependymin-like protein.

[SEQ ID NO: 10] Human ependymi of the present invention
2 shows the amino acid sequence of the precursor protein of the n-like protein. [SEQ ID NO: 11] This shows the amino acid sequence of the precursor protein of the human ependymin-like protein of the present invention. [SEQ ID NO: 12] This shows the amino acid sequence of the precursor protein of rat ependymin-like protein of the present invention. [SEQ ID NO: 13] This shows the amino acid sequence of the precursor protein of mouse ependymin-like protein of the present invention. [SEQ ID NO: 14] This shows the amino acid sequence of the signal peptide of the human ependymin-like protein of the present invention. [SEQ ID NO: 15] This shows the amino acid sequence of the signal peptide of the human ependymin-like protein of the present invention. [SEQ ID NO: 16] This shows the amino acid sequence of the signal peptide of rat ependymin-like protein of the present invention. [SEQ ID NO: 17] This shows the amino acid sequence of the signal peptide of the mouse ependymin-like protein of the present invention.

[SEQ ID NO: 18] This shows the base sequence of DNA encoding the human ependymin-like protein of the present invention having the amino acid sequence represented by SEQ ID NO: 1. [SEQ ID NO: 19] This shows the base sequence of DNA encoding the rat ependymin protein of the present invention having the amino acid sequence represented by SEQ ID NO: 2. [SEQ ID NO: 20] This shows the base sequence of DNA encoding the mouse ependymin protein of the present invention having the amino acid sequence represented by SEQ ID NO: 3. [SEQ ID NO: 21] This shows the base sequence of DNA represented by SEQ ID NO: 4, which encodes the common amino acid sequence of human ependymin-like protein, rat ependymin-like protein and mouse ependymin-like protein of the present invention. [SEQ ID NO: 22] This shows the base sequence of DNA represented by SEQ ID NO: 5, encoding the common amino acid sequence of human ependymin-like protein, rat ependymin-like protein and mouse ependymin-like protein of the present invention. [SEQ ID NO: 23] This shows the base sequence of DNA encoding the common amino acid sequence of human ependymin-like protein, rat ependymin-like protein and mouse ependymin-like protein of the present invention, represented by SEQ ID NO: 6. [SEQ ID NO: 24] This shows the base sequence of DNA represented by SEQ ID NO: 7, which encodes the common amino acid sequence of human ependymin-like protein, rat ependymin-like protein and mouse ependymin-like protein of the present invention. [SEQ ID NO: 25] This shows the base sequence of DNA represented by SEQ ID NO: 8, encoding the common amino acid sequence between human ependymin-like protein and rat ependymin-like protein of the present invention. [SEQ ID NO: 26] This shows the base sequence of DNA encoding the common amino acid sequence of human ependymin-like protein and rat ependymin-like protein of the present invention, represented by SEQ ID NO: 9.

[SEQ ID NO: 27] This shows the base sequence of DNA encoding the precursor protein of the human ependymin-like protein of the present invention having the amino acid sequence represented by SEQ ID NO: 10. [SEQ ID NO: 28] This shows the base sequence of DNA encoding the precursor protein of human ependymin-like protein of the present invention having the amino acid sequence represented by SEQ ID NO: 11. [SEQ ID NO: 29] This shows the base sequence of DNA encoding the precursor protein of rat ependymin-like protein of the present invention having the amino acid sequence represented by SEQ ID NO: 12. [SEQ ID NO: 30] This shows the base sequence of DNA encoding the precursor protein of the mouse ependymin-like protein of the present invention having the amino acid sequence represented by SEQ ID NO: 13. [SEQ ID NO: 31] This shows the base sequence of DNA encoding the signal peptide of the human ependymin-like protein of the present invention having the amino acid sequence represented by SEQ ID NO: 14. [SEQ ID NO: 32] This shows the base sequence of DNA encoding the signal peptide of the human ependymin-like protein of the present invention having the amino acid sequence represented by SEQ ID NO: 15. [SEQ ID NO: 33] This shows the base sequence of DNA encoding the signal peptide of rat ependymin-like protein of the present invention having the amino acid sequence represented by SEQ ID NO: 16. [SEQ ID NO: 34] This shows the base sequence of DNA encoding the signal peptide of mouse ependymin-like protein of the present invention having the amino acid sequence represented by SEQ ID NO: 17. [SEQ ID NO: 35] In Example 1, the human e
The nucleotide sequence of a probe used for cloning DNA encoding a pendymin-like protein is shown.

The transformant Escherichia coli XL1-Blue obtained in Example 1 described later is used.
/ PhEDN1-95 has been available on August 28, 1996 from the Ministry of International Trade and Industry, National Institute of Advanced Industrial Science and Technology (NIBH).
Deposit No. FERM BP-5640 and deposited with the Fermentation Research Institute (IFO) under the deposit number IFO 16011 from September 2, 1996. The transformant Escherichia coli obtained in Example 3 described below (Esch
erichia coli) SURE / prEDN91-6 has been deposited with the National Institute of Advanced Industrial Science and Technology (NIBH) on November 28, 1996 under the deposit number FERM BP-
No. 5759 and deposited with the Fermentation Research Institute (IFO) under the deposit number IFO 16053 from September 2, 1996. The transformant Escherichia coli SURE / p obtained in Example 5 described later.
mEDN78-13 has been deposited with the Ministry of International Trade and Industry, National Institute of Advanced Industrial Science and Technology (NIBH) on May 20, 1997 under the deposit number FERM BP-5949.
It has been deposited with the Fermentation Research Institute (IFO) as the deposit number IFO 16090 on April 4.

[0092]

EXAMPLES The present invention will be described in more detail with reference to the following Examples, but it should not be construed that the invention is limited thereto. In addition, the genetic manipulation method using Escherichia coli followed the method described in Molecular cloning.

[0093]

Example 1 Cloning of cDNA Encoding Human Ependymin-Like Protein An oligo (dT) primer having an XhoI site at the end and a SuperScript II MMLV RNase H ⁻ from 5 μg of poly (A) ⁺ RNA derived from human placenta (Clontech) First using reverse transcriptase (Gibco BRL)
After synthesis of the strand DNA, a second strand was synthesized using E. coli DNA polymerase I and RNase H to obtain a double-stranded cDNA from poly (A) ⁺ RNA.
This double-stranded DNA was treated with Pfu DNA polymerase (Stratagene) to blunt the ends, and then EcoR
An I adapter was added. The double-stranded DNA having EcoRI adapters added to both ends was subjected to gel filtration to give about 1
After removing the cDNA of 000 bp or less, EcoRI was performed using T4 polynucleotide kinase (Takara Shuzo Co., Ltd.).
A phosphate group was introduced into the adapter. Next, this cDNA
Was cut with XhoI, and then λZAPIIEcoRI-Xh
After incorporation into oI arm (Stratagene), in v
Itro packaging, about 2.1 × 10 ⁷ pf in total
A human placenta cDNA library (insertion rate: 99% or more) was prepared. Approximately 3.0 × 10 ⁶ pfu of cDN
The λ phage from the A library was transformed into E. coli XL1-Blue.
After infection with the MRF 'strain, about 2.
5 × 10 ⁴ plaques were plated and incubated overnight at 37 ° C. to form plaques. After the plaque was transferred onto a nylon membrane filter (Hybond N, Amersham), a denaturing solution [0.5N sodium hydroxide,
1.5 M sodium chloride], neutralization solution [0.5 M Tris-HCl (pH, 7.0), 1.5 M sodium chloride],
2 × SSC [20 × SSC = 3M sodium chloride, 0.1
3M sodium citrate], air-dried, and then irradiated with ultraviolet light to fix the phage DNA on a nylon membrane filter.

On the other hand, an oligonucleotide having a base sequence represented by SEQ ID NO: 35 as a probe [γ-
^[32 P] ATP (DuPont) and T4 polynucleotide kinase (Takara Shuzo Co., Ltd.). Hybridization was performed using a hybridization buffer solution containing a labeled probe [5 × SSPE (20 × SSPE = 3.6).
M sodium chloride, 0.2M sodium phosphate (p
H, 7.7), 20 mM EDTA), 5 × Denhardt's
Solution, 100 μg / ml heat-denatured salmon sperm DNA, 0.1% SD
S], hybridization was carried out at 65 ° C.
The filter is finally 0.1 × SSC, 0.1% SDS
After washing in the solution at 50 ° C., plaques hybridizing with the probe were searched for by taking an autoradiogram. By repeating this method, the phage clone λhEDN59, 64, 82, 9
Eight clones of 0, 91, 95, 99-2, and 112 were infected with helper phage and excised in vivo, and EcoRI-Xho of pBluescriptSK (-)
The plasmid in which the cDNA fragment was inserted into the I site was recovered in E. coli SOLR strain,
9, -64, -82, -90, -91, -95, -99
-2 and -112 were obtained. After culturing the E. coli strain SOLR carrying these plasmids, QIAGEN Plasmid M
Purify the plasmid DNA using the ini Kit (Qiagen) and use the DNA Sequencing Kit (PerkinElmer)
And the nucleotide sequence of the inserted cDNA fragment was determined using a DNA sequencer 377 (Perkin Elmer). Of these, phEDN1-
No. 95 holds a cDNA fragment consisting of 2507 bp (FIG. 1) containing a poly (A) ⁺ chain, and this cDNA fragment contains 22 or 22 amino acid signal peptide.
A novel protein consisting of 4 amino acids was encoded. This protein had two N-glycosylation sites. This protein has weak homology to ependymin, which is present in the teleost brain, and
It had 23.6% homology with in. Furthermore, epend
Since all four cysteine residues conserved in ymins were conserved, this protein was
ependymin-like protein. on the other hand,
PhEDN1-99 among the clones whose nucleotide sequences were determined
In the cDNA inserted into -2, ¹⁹⁰ Arg (CG
G) → ¹⁹⁰ Arg (CGT) and one silent base substitution were observed, and this base is considered to have polymorphism. Plasmid phEDN1- harboring the DNA encoding the human ependymin-like protein of the present invention
95 was introduced into Escherichia coli XL1-Blue strain, and transformed Escherichia coli X1
L1-Blue / phEDN1-95 was obtained.

[0095]

Example 2 Northern Hybridization of Human Tissues A membrane filter (MTN blo) in which 2 μg of poly (A) ⁺ RNA of each human tissue was blotted in advance.
t, Clontech) with a hybridization buffer [50% formamide, 5 × SSPE (20 × SS
PE = 3.6 M sodium chloride, 0.2 M sodium phosphate (pH, 7.7), 20 mM EDTA), 5 × Denh
Pre-hybridization was performed at 42 ° C. in ardt's solution, 0.1% SDS, 100 μg / ml heat-denatured salmon sperm DNA]. On the other hand, the human shown in FIG. 1 as a probe
Bam of cDNA encoding ependymin-like protein
The HI-SpeI 383 bp cDNA fragment (cDNA fragment having the nucleotide sequence at positions 643 to 1025 in the nucleotide sequence shown in FIG. 1) was prepared using [α- ³² P] dCTP (DuPont) and a random primer labeling kit (Amersham). Labeling. Hybridization buffer [50% formamide, 5 × SSPE, 5 ×
After prehybridization at 42 ° C. for 12 hours using Denhardt's solution, 0.1% SDS, 100 μg / ml heat-denatured salmon sperm DNA), hybridization was carried out using a hybridization buffer containing a labeled probe [50% formamide]. 5 × SSPE, 5 × Denhard
Hybridization was carried out at 42 ° C. for 18 hours in t's solution, 0.1% SDS, 100 μg / ml heat-denatured salmon sperm DNA]. The filter is finally 0.1 x SSC
[20 × SSC = 3M sodium chloride, 0.3M sodium citrate] After washing at 55 ° C. in a 0.1% SDS solution, an autoradiogram was taken to detect a band hybridizing with the probe. As a result, the size of the mRNA encoding this protein is about 2.5 kb.
Expression was highest in skeletal muscle, heart and brain, and slightly lower expression was also observed in prostate, ovary and testis. In the kidney, expression was also observed in the fetus (FIG. 6).

[0096]

Example 3 Rat ependymin-like protein homolog c
Cloning of DNA Whole brain was excised from 8-week-old male Sprague Dawley rats, and total RNA was prepared by the guanidine-isothiocyanate method. Poly (A) ⁺ RN was obtained from the total RNA obtained here using an oligo (dT) span column (Pharmacia).
The A fraction was prepared. From 5 μg of this poly (A) ⁺ RNA
An oligo (dT) primer having an otI site at the end and Su
After synthesizing first strand DNA using perScript II MMLV RNase H ^- reverse transcriptase (Gibco BRL), synthesizing second strand DNA using E. coli DNA polymerase I, E. coli DNA ligase and RNase H, Double-stranded cDNA was obtained from poly (A) ⁺ RNA.
The double-stranded DNA was treated with T4 DNA polymerase (Gibco BRL) to blunt the ends,
The all adapter was added. After cutting the double-stranded DNA having a SalI adapter added to both ends with NotI, the resulting DNA was subjected to gel filtration to remove cDNA of about 1000 bp or less, and incorporated into a λgt22A SalI-NotI arm (Gibco BRL). Thereafter, in vitro packaging was performed to prepare a rat brain cDNA library (insertion rate: 99% or more) of about 3.4 × 10 ⁶ pfu in total. Of which approximately 2.2 × 10 ⁶ pfu of E. coli λ phage cDNA library Y1090r ^- after infection with strain, seeded by about 2.2 × 10 ⁴ plaques soft agar plate, incubated overnight at 37 ° C. To form plaques. After the plaque was transferred onto a nylon membrane filter (Hybond N, Amersham), a denaturing solution [0.5 N sodium hydroxide, 1.5 M sodium chloride], a neutralizing solution [0.5 M Tris-HCl (pH, 7.
0), 1.5 M sodium chloride], 2 × SSC [20 ×
SSC = 3M sodium chloride, 0.3M sodium citrate], air-dry, and then irradiate with ultraviolet light.
Phage DNA was immobilized on a nylon membrane filter.

On the other hand, the human probe shown in FIG.
BamH of cDNA encoding ependymin-like protein
The I-SpeI 383 bp cDNA fragment (cDNA fragment having the nucleotide sequence at positions 643 to 1025 in the nucleotide sequence shown in FIG. 1) was prepared by using [α- ³² P] dCTP (DuPont) and a random primer labeling kit (Amersham). Labeling. Hybridization was carried out at 65 ° C. in a hybridization buffer (5 × SSPE, 5 × Denhardt's solution, 100 μg / ml heat-denatured salmon sperm DNA, 0.1% SDS) containing a labeled probe. The filter was finally washed at 60 ° C. in 2 × SSC, 0.1% SDS solution, and an autoradiogram was taken to search for plaque that hybridized with the probe. Repeat this method,
Phage clone λr purified to single clone
Phage DNA was extracted from each of 5 clones of EDN8, 56, 88, 91 and 100, and restriction enzymes SalI,
After cutting with NotI to cut out a cDNA fragment, pGE
Inserting into the SalI-NotI site of M11Zf (−),
PrEDN8, 56, 88, 91-6, 10
0 was obtained. After culturing E. coli strain DH10B carrying these plasmids, the QIAGEN Plasmid Mini Kit
(Qiagen) to purify the plasmid DNA.
The reaction was performed using NA Sequencing Kit (Perkin Elmer), and the base sequence of the inserted cDNA fragment was determined using DNA Sequencer 377 (Perkin Elmer).
Was determined. Of these, prEDN91-6 is po
cDN consisting of 2202 bp (FIG. 2) containing the ly (A) ⁺ chain
This cDNA fragment encodes a 224 amino acid rat ependymin-like protein containing a 33 or 34 amino acid signal peptide, and has three N-glycosylation sites. Amino acid sequence of rat ependymin-like protein is human ependym
It had 74.6% homology to the in-like protein, and all positions of cysteine residues in the mature region were conserved. Plasmid prEDN91-6 carrying the DNA encoding the rat ependymin-like protein of the present invention was introduced into Escherichia coli SURE strain, and transformed into Escherichia coli SURE / prED.
N91-6 was obtained.

[0098]

Example 4 Northern Hybridization of Rat Tissues Tissues (brain, spine, heart, liver, spleen, stomach, small intestine, testis, ovaries, placenta) were collected from 8-week-old Sprague Dawley rats (Charles River Japan). It was excised and total RNA was prepared by the guanidine thiocyanate method. The total RNA was applied to an oligo (dT) span column (Pharmacia) to prepare poly (A) ⁺ RNA. This poly (A) ⁺ RNA
After 2.5 μg was subjected to 1.2% formalin-denatured agarose gel electrophoresis, blotting was performed for 16 hours by capillary blotting on a nylon membrane filter (Biodyne B, Pall Japan). After fixing the RNA blotted on this nylon membrane filter by ultraviolet treatment, a hybridization buffer [50% formamide, 5 × SSPE [20
× SSPE = 3.6 M sodium chloride, 0.2 M sodium phosphate (pH, 7.7), 20 mM EDTA], 5 ×
Pre-hybridization was performed at 42 ° C. in Denhardt's solution, 0.1% SDS, 100 μg / ml heat-denatured salmon sperm DNA]. On the other hand, cDNA of the cDNA encoding the rat ependymin-like protein shown in FIG.
The co47III-PstI 1025 bp cDNA fragment (111st to 1135th of the nucleotide sequence shown in FIG. 2)
CDNA fragment having the third base sequence) [α- ³² P]
Labeling was performed using dCTP and a random primer labeling kit (Amersham). Hybridization was performed using a hybridization buffer solution containing a labeled probe [50% formamide, 5 × SSPE, 5 × Denhardt '
s solution, 0.5% SDS, 100 μg / ml heat-denatured salmon sperm D
NA] at 42 ° C. for 16 hours. The filter is finally 0.1 × SSC, 0.1%
After washing in an SDS solution at 50 ° C., a band hybridized with the probe was detected by taking an autoradiogram (FIG. 7). As a result, m having a size of about 2.4 kb
RNA was highly expressed in the brain, spine and heart, and was weakly expressed in the ovaries and placenta at 17.5 days of gestation.

[0099]

Example 5: Cloning of mouse ependymin-like protein cDNA 8-week-old male C57BL / 6N mouse (Charles Ri, Japan)
ver) was immediately sacrificed by decapitation, and the spinal cord was removed.
Total RNA by cid-phenol guanidine chloroform method
Was prepared. From the total RNA obtained here, oligo (d
T) Poly (A) ⁺ RNA fraction was prepared using a cellulose column (Pharmacia). This poly (A) ⁺ RNA
Oligo (dT) having an XhoI site at the end from 5 μg
First strand using primers and SuperScript II MMLV RNase H ^- reverse transcriptase (Gibco BRL)
After DNA synthesis, E. coli DNA polymerase I, R
Second strand DNA is synthesized using Nase H,
Double-stranded cDNA was obtained from poly (A) ⁺ RNA. This 2
This strand DNA was treated with Pfu DNA polymerase (Stratagene) to blunt the ends, and then an EcoRI adapter was added. A phosphate group was introduced into the EcoRI adapter using T4 polynucleotide kinase (Takara Shuzo) to the double-stranded DNA having an EcoRI adapter added to both ends. After digesting this cDNA with XhoI,
Gel filtration to remove cDNA of about 400 bp or less,
It was incorporated into a λZAP II EcoRI-XhoI arm (Stratagene). This recombinant phage DNA is
Perform in vitro packaging, total about 2.9x
A 10 ⁶ pfu mouse spinal cord cDNA library (insertion rate: 99% or more) was prepared. After infecting E. coli XL1-Blue MRF 'strain with the λ phage of this cDNA library, about 2.7 × 10 ⁴ plaques were spread on a soft agar plate and incubated at 37 ° C. overnight to form plaques. . After the plaque was transferred onto a nylon membrane filter (Hybond N ⁺ , Amersham), a denaturing solution [0.5N sodium hydroxide, 1.5M sodium chloride], a neutralizing solution [0.5M Tris-HCl (pH 7.5)
0), 1.5 M sodium chloride], 2 × SSC [20 ×
SSC = 3M sodium chloride, 0.3M sodium citrate], air-dried, and then irradiated with ultraviolet light to fix the phage DNA on a nylon membrane filter.

On the other hand, Ec of cDNA encoding rat ependymin-like protein shown in FIG. 2 was used as a probe.
The o47 III-PstI 1025 bp cDNA fragment (cDNA fragment having the 111st to 1135th nucleotide sequence of the nucleotide sequence shown in FIG. 2) was converted to [α- ³² P] dC
Labeling was performed using TP (DuPont) and a random primer labeling kit (Amersham). Hybridization was performed using a hybridization buffer solution containing a labeled probe [5 × SSPE, 5 × Denhardt's solution, 100 ×
6 in μg / ml heat-denatured salmon sperm DNA, 0.5% SDS]
Hybridization was performed at 5 ° C. The filter was finally placed in 0.2 × SSC, 0.1% SDS at 50 ° C.
After washing with, plaques hybridizing with the probe were searched for by taking an autoradiogram. By repeating this method, the phage clone λmEDN4,8,30,32,47,5 was purified to a single clone.
1,59,66,68,77,78,81,85,9
Each of the 15,99 clones was infected with a helper phage and excised in vivo.
A plasmid having a cDNA fragment inserted into the EcoRI-XhoI site of K (-) was recovered in E. coli XLOLR strain, and the plasmids were respectively pmEDN4-1,8-1,30-3,3.
2-5, 47-3, 51-5, 59-7, 66-7, 6
8-9,77-11,78-13,81-15,85-
9,98-17,99-19 were obtained. Of these plasmids, pmEDN4-1,8-1,32-5,47-
3,59-7,66-7,68-9,77-11,78
After culturing the E. coli strain XLOLR carrying -13, 81-15, 99-19, respectively, the QIAGEN Plasmid M
Purify the plasmid DNA using the ini Kit (Qiagen) and use the DNA Sequencing Kit (PerkinElmer)
And the nucleotide sequence of the inserted cDNA fragment was determined using a DNA sequencer 377 (Perkin Elmer). Of these, pmEDN78
-13 holds a cDNA fragment consisting of 2403 bp (SEQ ID NO: FIG. 3) containing a poly (A) ⁺ chain, and this cDNA fragment contains a mouse ependy consisting of 224 amino acids containing a signal peptide of 30 or 37 amino acids.
The min-like protein was encoded.

On the other hand, among the clones whose base sequences were determined, pmEDN32-5, 47-3, 77-11, 78
-13, 81-15, 99-19 is pmEDN78-
Poly (A) ⁺ chain was added at the same position as
EDNpm EDN4-1,8-1,59-7,66-
7,68-9 is poly upstream of pmEDN78-13
(A) By recognizing the ⁺ additional signal, the 3 'untranslated region retained a 113-bp shortened cDNA fragment. The amino acid sequence of mouse ependymin-like protein is 91.1 amino acid sequence of rat ependymin-like protein.
%, And 74.4% homology with human ependymin-like protein, and the positions of cysteine residues in the mature region and the two N-glycosylation sites were all conserved. DN encoding mouse ependymin-like protein of the present invention
The plasmid pmEDN78-13 carrying A is introduced into Escherichia coli SURE strain, and the transformant Escherichia coli SURE / pmEDN7
8-13 was obtained.

[0102]

Example 6 Northern Hybridization of Mouse Tissues Tissues (brain, spinal cord, lung, liver) were excised from 8-week-old C57BL / 6N mice (Charles River Japan).
All RN by acid-phenol guanidine chloroform method
A was prepared. From this total RNA, oligo (dT)
Poly (A) ⁺ R over a span column (Pharmacia)
NA was prepared. 2.5 μg of this poly (A) ⁺ RNA was added to 1.
After subjected to 2% formalin denaturing agarose gel electrophoresis, a nylon membrane filter (Nihon Pall, Bi
odyne B) by capillary blotting for 19 hours. After immobilizing the blotted RNA by ultraviolet treatment on this nylon membrane filter, a hybridization buffer [50%
Formamide, 5 × SSPE [20 × SSPE = 3.6
M sodium chloride, 0.2M sodium phosphate (pH
7.7), 20 mM EDTA], 5 × Denhardt's solution, 0.
Prehybridization was performed at 42 ° C. in 5% SDS, 100 μg / ml heat-denatured salmon sperm DNA]. On the other hand, a SpeI 799 bp cDNA fragment of the cDNA encoding the mouse ependymin-like protein (cDNA fragment having the 198th to 996th nucleotide sequences of the nucleotide sequence shown in FIG. 3) was used as a probe [α- ³² P] d
Labeling was performed using CTP and a random primer labeling kit (Amersham). Hybridization was performed using a hybridization buffer solution containing a labeled probe [50% formamide, 5 × SSPE, 5 × Denhardt '
s solution, 0.5% SDS, 100 μg / ml heat-denatured salmon sperm DNA] at 42 ° C. for 18 hours. The filter is finally 0.1 x SSC, 0.1
After washing in a 1% SDS solution at 50 ° C., an autoradiogram was taken to detect a band that hybridized with the probe. As a result, mRNA of about 2.4 kb in size
Was most abundant in the spinal cord and then abundant in the brain. In addition, weak expression was also observed in the lung (FIG. 8).

[0103]

Example 7 Northern Hybridization of Human Central Nervous System Sites A membrane filter (M) in which 2 μg of poly (A) ⁺ RNA of each site of the human brain was blotted in advance.
TN blot (Clontech) with a hybridization buffer [50% formamide, 5 × SSPE
[20 × SSPE = 3.6M sodium chloride, 0.2M
Sodium phosphate (pH 7.7), 20 mM EDTA],
Prehybridization was performed at 42 ° C. in 5 × Denhardt's solution, 0.5% SDS, 100 μg / ml heat-denatured salmon sperm DNA]. On the other hand, human ependymi
BamHI-S of cDNA encoding n-like protein
PEI 383 bp cDNA fragment (cDNA fragment having a # 643 th to the 1025 th nucleotide sequence of the nucleotide sequence shown in Figure 1) ^[alpha-32 P] dCTP (DuPont) and random primer labeling kit (Amersham) Labeled with. Hybridization buffer [50% formamide, 5 × SSPE, 5 × Denha
rdt's solution, 0.1% SDS, 100 μg / ml heat-denatured salmon sperm DNA] and prehybridization at 42 ° C. for 12 hours, followed by hybridization using a hybridization buffer containing a labeled probe [50% formamide]. , 5 × SSPE, 5 × Denhardt's
Solution, 0.1% SDS, 100 μg / ml heat-denatured salmon sperm D
NA] at 42 ° C. for 18 hours. The filter is finally 0.1 × SSC [20 ×
SSC = 3M sodium chloride, 0.3M sodium citrate], and 0.1% SDS. After washing at 55 ° C., an autoradiogram was taken to detect a band hybridizing with the probe [FIG. 9]. As a result, it was found that this mRNA was expressed in most parts of the central nervous system and played an important role in nervous tissue.

[0104]

Example 8 Screening of Human Cultured Cells Expressing Human ependymin-like Protein Searching for human cultured cells necessary for examining the function of human ependymin-like protein, Northern hybridization was performed in the same manner as in Example 2. I checked. Culture of various nervous and glial cells, acid-phenol guanidine chloride
Total RNA was prepared by the oform method. Poly (A) ⁺ RNA was prepared from the total RNA using an oligo (dT) span column (Pharmacia). This poly (A) ⁺ R
After 2.5 μg of NA was subjected to 1.5% formalin-denatured agarose gel electrophoresis, blotting was performed for 16 hours by capillary blotting on a nylon membrane filter (Biodyne B, Pall Japan). After fixing the blotted RNA to this nylon membrane filter by ultraviolet treatment, a hybridization buffer [50% formamide, 5 × SSPE [20
× SSPE = 3.6 M sodium chloride, 0.2 M sodium phosphate (pH 7.7), 20 mM EDTA], 5 × De
Pre-hybridization was performed at 42 ° C. in nhardt's solution, 0.5% SDS, 100 μg / ml heat-denatured salmon sperm DNA]. On the other hand, SpeI-HindII of cDNA encoding human ependymin-like protein was used as a probe.
An I646 bp cDNA fragment (cDNA having the nucleotide sequence from nucleotides 1022 to 1667 of the nucleotide sequence shown in FIG. 1) was labeled with [α- ³² P] dCTP and a random primer labeling kit (Amersham). . Hybridization was performed using a hybridization buffer solution containing a labeled probe [50% formamide,
5 × SSPE, 5 × Denhardt's solution, 0.5% SDS,
100 μg / ml heat-denatured salmon sperm DNA] at 42 ° C.
Hybridization was performed for hours. The filter was finally washed at 50 ° C. in a 0.1 × SSC, 0.1% SDS solution, and an autoradiogram was taken to detect a band hybridizing with the probe. As a result, expression in nervous system cells is low, and glial cells (in particular,
A prominent ependymin-like protein mRN in KNS-81)
Expression of A was observed [FIG. 10].

[0105]

Example 9 Southern Hybridization of Human Genomic DNA 5 μg of human genomic DNA was ligated to various restriction enzymes (BamH
I, HindIII, BglII, SacI), followed by agarose gel electrophoresis, followed by blotting on a nylon membrane filter (PALL, Biodyne B) by capillary blotting for 16 hours. After immobilizing the blotted DNA by ultraviolet treatment on this nylon membrane filter, a hybridization buffer [0.5 M sodium phosphate (pH.
7.4), 7% SDS, 1% BSA, 1 mM EDTA]
Prehybridization was performed at 65 ° C. On the other hand, SpeI-HindIII 646 bp of cDNA encoding human ependymin-like protein was used as a probe.
The cDNA fragment (the nucleotide sequence from the 1022th to the 1667th nucleotide in the nucleotide sequence shown in FIG. 1) was converted to [α- ³² P] dCT
Labeling was performed using P and a random primer labeling kit (Amersham). Hybridization was performed using a hybridization buffer solution containing a labeled probe [0.
5M sodium phosphate (pH 7.4), 7% SDS,
Hybridization was carried out at 65 ° C. for 16 hours in 1% BSA, 1 mM EDTA]. After the filter was finally washed at 50 ° C. in 0.1 × SSC, 0.1% SDS solution,
An autoradiogram was taken to detect a band that hybridized with the probe. As a result, BamH
One band was observed in each of the lanes cut with I, HindIII, BglII, and SacI (FIG. 11), which revealed that the human ependymin-like protein gene was present in one copy per haploid cell.

[0106]

Example 10 Determination of Chromosome Number of Human Ependymin-Like Protein Gene DNA obtained from mouse hybrid cells having various human chromosomes was cut with BamHI, separated by agarose gel electrophoresis, and blotted and fixed in advance. Filter the filter with hybridization buffer [0.5 M sodium phosphate (pH 7.4), 7% S
DS, 1% BSA, 1 mM EDTA] at 65 ° C. On the other hand, as a probe, a SpeI-HindIII 646 bp cDNA fragment of the cDNA encoding the human ependymin-like protein (the 1022 to 1667th base sequence of the base sequence shown in FIG. 1) was randomly synthesized with [α- ³² P] dCTP. Labeling was performed using a primer labeling kit (Amersham). Hybridization buffer solution containing a labeled probe [0.5 M sodium phosphate (pH 7.4), 7%
SDS, 1% BSA, 1 mM EDTA] at 65 ° C.
Hybridization was performed for hours. The filter was finally washed at 50 ° C. in a 0.1 × SSC, 0.1% SDS solution, and an autoradiogram was taken to detect a band hybridizing with the probe. As a result, a single hybridizing band was observed only in each of lanes of DNA obtained from mouse hybrid cells including male human genomic DNA, female human genomic DNA, and human chromosome 7, indicating that the human ependymin-like protein gene was It was revealed that it was present on chromosome 7 (FIG. 12).

[0107]

EFFECT OF THE INVENTION The protein of the present invention, a partial peptide thereof or a salt thereof can be used, for example, for elongating or regenerating nerves in the central nervous system, activating glial cells,
It has physiological activities such as memory formation in the brain.
The protein of the present invention, its partial peptide or a salt thereof, and the DNA encoding the protein of the present invention or its part include, for example, Alzheimer's disease, Parkinson's disease, Huntington's disease, cerebral atrophic lateral sclerosis (AL)
It is useful as a medicament such as an agent for treating or preventing S), dementia, cerebellar degeneration and the like. Further, the DNA of the present invention can be used as a gene diagnostic agent, since abnormal expression of the DNA of the present invention can be detected. Since the antibody against the protein of the present invention, its partial peptide, the precursor protein or a salt thereof can specifically recognize the protein of the present invention, its partial peptide, the precursor protein or a salt thereof, the test solution It can be used for quantification of the protein or the like of the present invention therein. Further, the protein of the present invention, its partial peptide or a salt thereof,
It is useful as a reagent for screening a compound or a salt thereof which promotes the function of the protein of the present invention, its partial peptide or a salt thereof.

[0108]

[Sequence list]

[SEQ ID NO: 1] Sequence length: 187 Sequence type: Amino acid Topology: Linear Sequence type: Peptide sequence Ala Pro Arg Pro Cys Gln Ala Pro Gln Gln Trp Glu Gly Arg Gln Val 1 5 10 15 Met Tyr Gln Gln Ser Ser Gly Arg Asn Ser Arg Ala Leu Leu Ser Tyr 20 25 30 Asp Gly Leu Asn Gln Arg Val Arg Val Leu Asp Glu Arg Lys Ala Leu 35 40 45 Ile Pro Cys Lys Arg Leu Phe Glu Tyr Ile Leu Leu Tyr Lys Asp Gly 50 55 60 Val Met Phe Gln Ile Asp Gln Ala Thr Lys Gln Cys Ser Lys Met Thr 65 70 75 80 Leu Thr Gln Pro Trp Asp Pro Leu Asp Ile Pro Gln Asn Ser Thr Phe 85 90 95 Glu Asp Gln Tyr Ser Ile Gly Gly Pro Gln Glu Gln Ile Thr Val Gln 100 105 110 Glu Trp Ser Asp Arg Lys Ser Ala Arg Ser Tyr Glu Thr Trp Ile Gly 115 120 125 Ile Tyr Thr Val Lys Asp Cys Tyr Pro Val Gln Glu Thr Phe Thr Ile 130 135 140 Asn Tyr Ser Val Ile Leu Ser Thr Arg Phe Phe Asp Ile Gln Leu Gly 145 150 155 160 Ile Lys Asp Pro Ser Val Phe Thr Pro Pro Ser Thr Cys Gln Met Ala 165 170 175 Gln Leu Glu Lys Met Ser Gl u Asp Cys Ser Trp 180 185

[0109]

[SEQ ID NO: 2] Sequence length: 190 Sequence type: Amino acid Topology: Linear Sequence type: Peptide sequence Ser Pro Gly Thr Pro Gln Pro Cys Gln Ala Pro Gln Gln Trp Glu Gly 1 5 10 15 Arg Gln Val Leu Tyr Gln Gln Ser Ser Gly His Asn Ser Arg Ala Leu 20 25 30 Val Ser Tyr Asp Gly Leu Asn Gln Arg Val Arg Val Leu Asp Glu Arg 35 40 45 Lys Ala Leu Ile Pro Cys Lys Arg Leu Phe Glu Tyr Ile Leu Leu Tyr 50 55 60 Lys Asp Gly Val Met Phe Gln Ile Glu Gln Ala Thr Lys Leu Cys Ala 65 70 75 80 Lys Ile Pro Leu Ala Glu Pro Trp Asp Pro Leu Asp Ile Pro Gln Asn 85 90 95 Ser Thr Phe Glu Asp Gln Tyr Ser Ile Gly Gly Pro Gln Glu Gln Ile 100 105 110 Met Val Gln Glu Trp Ser Asp Arg Arg Thr Ala Arg Ser Tyr Glu Thr 115 120 125 Trp Ile Gly Val Tyr Thr Ala Lys Asp Cys Tyr Pro Val Gln Glu Thr 130 135 140 Phe Ile Arg Asn Tyr Thr Val Val Leu Ser Thr Arg Phe Phe Asp Val 145 150 155 160 Gln Leu Gly Ile Lys Asp Pro Ser Val Phe Thr Pro Pro Ser Thr Cys 165 170 175 Gln Thr Ala Gln Pro Glu Lys Met Lys Glu Asn Cys Ser Leu 180 185 190

[0110]

[SEQ ID NO: 3] Sequence length: 187 Sequence type: Amino acid Topology: Linear Sequence type: Peptide sequence Thr Pro Gln Pro Cys Gln Ala Pro Gln Gln Trp Glu Gly Arg Gln Val 1 5 10 15 Leu Tyr Gln Gln Ser Ser Gly His Asn Asn Arg Ala Leu Val Ser Tyr 20 25 30 Asp Gly Leu Asn Gln Arg Val Arg Val Leu Asp Glu Arg Lys Ala Leu 35 40 45 Ile Pro Cys Lys Arg Leu Phe Glu Tyr Ile Leu Leu Tyr Lys Glu Gly 50 55 60 Val Met Phe Gln Ile Glu Gln Ala Thr Lys Gln Cys Ala Lys Ile Pro 65 70 75 80 Leu Val Glu Ser Trp Asp Pro Leu Asp Ile Pro Gln Asn Ser Thr Phe 85 90 95 Glu Asp Gln Tyr Ser Ile Gly Gly Pro Gln Glu Gln Ile Leu Val Gln 100 105 110 Glu Trp Ser Asp Arg Arg Thr Ala Arg Ser Tyr Glu Thr Trp Ile Gly 115 120 125 Val Tyr Thr Ala Lys Asp Cys Tyr Pro Val Gln Glu Thr Phe Ile Arg 130 135 140 Asn Tyr Thr Val Val Met Ser Thr Arg Phe Phe Asp Val Gln Leu Gly 145 150 155 160 Ile Lys Asp Pro Ser Val Phe Thr Pro Pro Ser Thr Cys Gln Ala Ala 165 170 175 Gln Pro Glu Lys Met Ser As p Gly Cys Ser Leu 180

[0111]

[SEQ ID NO: 4] Sequence length: 13 Sequence type: amino acid Topology: Linear Sequence type: Peptide sequence Pro Cys Gln Ala Pro Gln Gln Trp Glu Gly Arg Gln Val 1 5 10

[0112]

[SEQ ID NO: 5] Sequence length: 32 Sequence type: amino acid Topology: linear Sequence type: peptide sequence Gln Ile Asp Gln Ala Thr Lys Gln Cys Ser Lys Met Thr Leu Thr Gln 1 5 10 15 Pro Trp Asp Pro Leu Asp Ile Pro Gln Asn Ser Thr Phe Glu Asp Gln 20 25 30

[0113]

[SEQ ID NO: 6] Sequence length: 25 Sequence type: amino acid Topology: linear Sequence type: peptide Sequence Ser Tyr Glu Thr Trp Ile Gly Ile Tyr
Thr Val Lys Asp Cys Tyr Pro 15
10 15 Val Gln Glu Thr Phe Thr Ile Asn Tyr 20

[0114]

[SEQ ID NO: 7] Sequence length: 17 Sequence type: Amino acid Topology: Linear Sequence type: Peptide sequence Gln Leu Gly Ile Lys Asp Pro Ser Val
Phe Thr Pro Pro Ser Thr Cys 15
10 15 Gln

[0115]

[SEQ ID NO: 8] Sequence length: 39 Sequence type: amino acid Topology: Linear Sequence type: Peptide sequence Ser Tyr Asp Gly Leu Asn Gln Arg Val Arg Val Leu Asp Glu Arg Lys 1 5 10 15 Ala Leu Ile Pro Cys Lys Arg Leu Phe Glu Tyr Ile Leu Leu Tyr Lys 20 25 30 Asp Gly Val Met Phe Gln Ile 35

[0116]

[SEQ ID NO: 9] Sequence length: 26 Sequence type: Amino acid Topology: Linear Sequence type: Peptide sequence Pro Trp Asp Pro Leu Asp Ile Pro Gln Asn Ser Thr Phe Glu Asp Gln 1 5 10 15 Tyr Ser Ile Gly Gly Pro Gln Glu Gln Ile 20 25

[0117]

[SEQ ID NO: 10] Sequence length: 200 Sequence type: amino acid Topology: linear Sequence type: peptide sequence Trp Thr Leu Cys Gly Leu Cys Ser Leu Gly Ala Val Gly Ala Pro Arg 1 5 10 15 Pro Cys Gln Ala Pro Gln Gln Trp Glu Gly Arg Gln Val Met Tyr Gln 20 25 30 Gln Ser Ser Gly Arg Asn Ser Arg Ala Leu Leu Ser Tyr Asp Gly Leu 35 40 45 Asn Gln Arg Val Arg Val Leu Asp Glu Arg Lys Ala Leu Ile Pro Cys 50 55 60 Lys Arg Leu Phe Glu Tyr Ile Leu Leu Tyr Lys Asp Gly Val Met Phe 65 70 75 80 Gln Ile Asp Gln Ala Thr Lys Gln Cys Ser Lys Met Thr Leu Thr Gln 85 90 95 Pro Trp Asp Pro Leu Asp Ile Pro Gln Asn Ser Thr Phe Glu Asp Gln 100 105 110 Tyr Ser Ile Gly Gly Pro Gln Glu Gln Ile Thr Val Gln Glu Trp Ser 115 120 125 Asp Arg Lys Ser Ala Arg Ser Tyr Glu Thr Trp Ile Gly Ile Tyr Thr 130 135 140 Val Lys Asp Cys Tyr Pro Val Gln Glu Thr Phe Thr Ile Asn Tyr Ser 145 150 155 160 Val Ile Leu Ser Thr Arg Phe Phe Asp Ile Gln Leu Gly Ile Lys Asp 165 170 175 Pro Ser Val Phe Thr Pro Pro Ser Thr Cys Gln Met Ala Gln Leu Glu 180 185 190 Lys Met Ser Glu Asp Cys Ser Trp 195 200

[0118]

[SEQ ID NO: 11] Sequence length: 224 Sequence type: amino acid Topology: linear Sequence type: peptide sequence Met Pro Gly Arg Ala Pro Leu Arg Thr Val Pro Gly Ala Leu Gly Ala 1 5 10 15 Trp Leu Leu Gly Gly Leu Trp Ala Trp Thr Leu Cys Gly Leu Cys Ser 20 25 30 Leu Gly Ala Val Gly Ala Pro Arg Pro Cys Gln Ala Pro Gln Gln Trp 35 40 45 Glu Gly Arg Gln Val Met Tyr Gln Gln Ser Ser Gly Arg Asn Ser Arg 50 55 60 Ala Leu Leu Ser Tyr Asp Gly Leu Asn Gln Arg Val Arg Val Leu Asp 65 70 75 80 Glu Arg Lys Ala Leu Ile Pro Cys Lys Arg Leu Phe Glu Tyr Ile Leu 85 90 95 Leu Tyr Lys Asp Gly Val Met Phe Gln Ile Asp Gln Ala Thr Lys Gln 100 105 110 Cys Ser Lys Met Thr Leu Thr Gln Pro Trp Asp Pro Leu Asp Ile Pro 115 120 125 Gln Asn Ser Thr Phe Glu Asp Gln Tyr Ser Ile Gly Gly Pro Gln Glu 130 135 140 Gln Ile Thr Val Gln Glu Trp Ser Asp Arg Lys Ser Ala Arg Ser Tyr 145 150 155 160 Glu Thr Trp Ile Gly Ile Tyr Thr Val Lys Asp Cys Tyr Pro Val Gln 165 170 175 Glu Thr Phe Thr Ile Asn Tyr Ser Val Ile Leu Ser Thr Arg Phe Phe 180 185 190 Asp Ile Gln Leu Gly Ile Lys Asp Pro Ser Val Phe Thr Pro Pro Ser 195 200 205 Thr Cys Gln Met Ala Gln Leu Glu Lys Met Ser Glu Asp Cys Ser Trp 210 215 220

[0119]

[SEQ ID NO: 12] Sequence length: 224 Sequence type: amino acid Topology: Linear Sequence type: Peptide sequence Met Leu Thr Arg Ala Pro Arg Arg Leu Val Gln Gly Pro Arg Glu Thr 1 5 10 15 Trp Leu Leu Gly Gly Leu Trp Val Trp Ile Leu Cys Gly Leu Gly Met 20 25 30 Ala Gly Ser Pro Gly Thr Pro Gln Pro Cys Gln Ala Pro Gln Gln Trp 35 40 45 Glu Gly Arg Gln Val Leu Tyr Gln Gln Ser Ser Gly His Asn Ser Arg 50 55 60 Ala Leu Val Ser Tyr Asp Gly Leu Asn Gln Arg Val Arg Val Leu Asp 65 70 75 80 Glu Arg Lys Ala Leu Ile Pro Cys Lys Arg Leu Phe Glu Tyr Ile Leu 85 90 95 Leu Tyr Lys Asp Gly Val Met Phe Gln Ile Glu Gln Ala Thr Lys Leu 100 105 110 Cys Ala Lys Ile Pro Leu Ala Glu Pro Trp Asp Pro Leu Asp Ile Pro 115 120 125 Gln Asn Ser Thr Phe Glu Asp Gln Tyr Ser Ile Gly Gly Pro Gln Glu 130 135 140 Gln Ile Met Val Gln Glu Trp Ser Asp Arg Arg Thr Ala Arg Ser Tyr 145 150 155 160 Glu Thr Trp Ile Gly Val Tyr Thr Ala Lys Asp Cys Tyr Pro Val Gln 165 170 175 Glu Thr Phe Ile Arg Asn Tyr Thr Val Val Leu Ser Thr Arg Phe Phe 180 185 190 Asp Val Gln Leu Gly Ile Lys Asp Pro Ser Val Phe Thr Pro Pro Ser 195 200 205 Thr Cys Gln Thr Ala Gln Pro Glu Lys Met Lys Glu Asn Cys Ser Leu 210 215 220

[0120]

[SEQ ID NO: 13] Sequence length: 224 Sequence type: amino acid Topology: Linear Sequence type: Peptide sequence Met Pro Ala Arg Ala Pro Arg Arg Leu
Val Gln Gly Pro Arg Gly Thr 15
10 15 Trp Leu Leu Gly Ser Leu Trp Val Trp
Val Leu Cys Gly Leu Gly Met 20 25
30 Ala Gly Ser Leu Gly Thr Pro Gln Pro
Cys Gln Ala Pro Gln Gln Trp 3540
45 Glu Gly Arg Gln Val Leu Tyr Gln Gln
Ser Ser Gly His Asn Asn Arg 50 55
60 Ala Leu Val Ser Tyr Asp Gly Leu Asn
Gln Arg Val Arg Val Leu Asp 65 70
7580 Glu Arg Lys Ala Leu Ile Pro Cys Lys
Arg Leu Phe Glu Tyr Ile Leu 85
90 95 Leu Tyr Lys Glu Gly Val Met Phe Gln
Ile Glu Gln Ala Thr Lys Gln 100 105
110 Cys Ala Lys Ile Pro Leu Val Glu Ser
Trp Asp Pro Leu Asp Ile Pro 115 120
125 Gln Asn Ser Thr Phe Glu Asp Gln Tyr
Ser Ile Gly Gly Pro Gln Glu 130 135
140 Gln Ile Leu Val Gln Glu Trp Ser Asp
Arg Arg Thr Ala Arg Ser Tyr 145 150
155 160 Glu Thr Trp Ile Gly Val Tyr Thr Ala
Lys Asp Cys Tyr Pro Val Gln 165
170 175 Glu Thr Phe Ile Arg Asn Tyr Thr Val
Val Met Ser Thr Arg Phe Phe 180 185
190 Asp Val Gln Leu Gly Ile Lys Asp Pro
Ser Val Phe Thr Pro Pro Ser 195 200
205 Thr Cys Gln Ala Ala Gln Pro Glu Lys
Met Ser Asp Gly Cys Ser Leu 210 215
220

[0121]

[SEQ ID NO: 14] Sequence length: 37 Sequence type: amino acid Topology: Linear Sequence type: Peptide sequence Met Pro Gly Arg Ala Pro Leu Arg Thr
Val Pro Gly Ala Leu Gly Ala 15
10 15 Trp Leu Leu Gly Gly Leu Trp Ala Trp
Thr Leu Cys Gly Leu Cys Ser 20 25
30 Leu Gly Ala Val Gly 35

[0122]

[SEQ ID NO: 15] Sequence length: 24 Sequence type: amino acid Topology: Linear Sequence type: Peptide sequence Met Pro Gly Arg Ala Pro Leu Arg Thr Val Pro Gly Ala Leu Gly Ala 1 5 10 15 Trp Leu Leu Gly Gly Leu Trp Ala 20

[0123]

[SEQ ID NO: 16] Sequence length: 34 Sequence type: Amino acid Topology: Linear Sequence type: Peptide sequence Met Leu Thr Arg Ala Pro Arg Arg Leu Val Gln Gly Pro Arg Glu Thr 1 5 10 15 Trp Leu Leu Gly Gly Leu Trp Val Trp Ile Leu Cys Gly Leu Gly Met 20 25 30 Ala Gly

[0124]

[SEQ ID NO: 17] Sequence length: 37 Sequence type: amino acid Topology: Linear Sequence type: Peptide sequence Met Pro Ala Arg Ala Pro Arg Arg Leu Val Gln Gly Pro Arg Gly Thr 1 5 10 15 Trp Leu Leu Gly Ser Leu Trp Val Trp Val Leu Cys Gly Leu Gly Met 20 25 30 Ala Gly Ser Leu Gly 35

[0125]

[SEQ ID NO: 18] Sequence length: 561 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA sequence GCCCCGCGCC CGTGCCAGGC GCCGCAGCAGAG TGGGAGGGGC GCCAGGTTAT GTACCAGCAA 60 AGTAGCGGGC GCAACAGCCG CGCCCTGCGCGCTCCGCCAGCAGGCT AGAGGAAGGC GCTGATCCCC TGCAAGAGAT TATTTGAATA TATTTTGCTG 180 TATAAGGATG GAGTGATGTT TCAGATTGAC CAAGCCACCA AGCAGTGCTC AAAGATGACC 240 CTGACACAGC CCTGGGATCC TCTTGACATT CCTCAAAACT CCACCTTTGA AGACCAGTAC 300 TCCATCGGGG GGCCTCAGGA GCAGATCACC GTCCAGGAGT GGTCGGACAG AAAGTCAGCT 360 AGATCCTATG AAACCTGGAT TGGCATCTAT ACAGTCAAGG ATTGCTATCC TGTCCAGGAA 420 ACCTTTACCA TAAACTACAG TGTGATATTG TCTACGCGGT TTTTTGACAT CCAGCTGGGT 480 ATTAAAGACC CCTCGGTGTT TACCCCTCCA AGCACGTGCC AGATGGCCCA ACTGGAGAAG 540 ATGAGCGAAG ACTGCTCCTG G 561

[0126]

[SEQ ID NO: 19] Sequence length: 570 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA sequence TCCCCGGGAA CCCCGCAGCC ATGCCAGGCCG CCC
CAGCAGGT GGGAGGGACG TCAGGTTCTG 60 TACCAGCAGA GCAGCGGGCA CAACAGCCGC GCC
CTGGGTGT CCTACGATGGG TTCCAACCAG 120 CGCGTGCGGG TGCTGGACGGA AAGGAAGGGCG CTG
ATCC CCT GCAAGAGATT ATTTGAATAC 180 ATTTACTCT ATAAGGATGGG AGTGATGTTT CAG
ATTGAAC AAGCCACCAA ACTGTGTGCA 240 AAGATACCCT TGGCAGAACC CTGGGATCCT CTC
GACATTC CCCAGAATTC TACCTTTGAA 300 GATCAGACT CTATCGGAGG GCCTCAGGAG CAG
ATCATGG TCCAGGAATG GTCTGACAGG 360 AGGACAGCCA GATCCTATGA AACCTGGGATT GGC
GTTTATA CAGCCAAGGA TTGCTACCCG 420 GTCCAGGAGA CCTTCATTAG GAACTACACT GTG
GTCCTGT CCACTCGGTTT CTTTGATGTG 480 CAGTTGGGCA TTAAAGACCC CTCTGTGTTC ACC
CCACCAA GCCAGCTGCCA GACAGCACAG 540 CCGAGAGAAGA TGAAAGAGAA CTGCTCCCTG
570

[0127]

[SEQ ID NO: 20] Sequence length: 561 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA sequence ACCCCACAGC CATCCCAGGC ACCCCAGCAG TGG
GAGGGAC GCCAGGTTCT GTACCAGCAG 60 AGCAGCGGGC ACAACACCCGCGCCCTGGTG TCC
TACGATG GTCTCAACCA GCGCGTGCCG 120 GTGCTGGACG AGAGGAAAGC GCTGATCCCC TGC
AAGAGAT TATTTGAATA CATTTTACTC 180 TATAAGGAGG GAGTGGATGTT TCAGATTGAA CAA
GCCACCA AACAGTGTGC AAAGATCCCC 240 TTGGTGGAAT CCTGGGATCC TCTGGACATT CCC
CAGAATT CTACCTTTGA AGATCAGTAC 300 TCCATCGGAG GGCCTCAGGA GCAGATCCTG GTC
CAGGAGGT GGTCTGACAG AAGAACAGCA 360 AGATCCTATG AAAACTTGGAT CGGCGTTTTAT ACA
GCCAAGG ATTGTTATCC GGTCCAGGAG 420 ACCTTTCATCA GGAACTACAC TGTGGTCATGTCG TCC
ACGCGGT TCTTTGATGT GCAGCTAGGC 480 ATTAGAGACC CCCTCTGTGT CACCCCACCA AGC
ACATGCCC AGGCAGCGCA GCCAGAGAAG 540 ATGAGTGACG GCTGCTCCTTG
561

[0128]

[SEQ ID NO: 21] Sequence length: 39 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA sequence CCGTGCCAGG CGCCGCAGCA GTGGGAGGGG CGCCAGGTT 39

[0129]

[SEQ ID NO: 22] Sequence length: 96 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA sequence CAGATTGACC AAGCCACCAA GCAGTGCTCA AAG
ATGACCCC TGACACAGCC CTGGGATCCT 60 CTTGACATTC CTCAAAACTC CACCTTTGAA GAC
CAG 96

[0130]

[SEQ ID NO: 23] Sequence length: 75 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA sequence TCCTATGAAA CCTGGATTGG CATCTATACA GTCAAGGATT GCTATCCTGT CCAGGAAACC 60 TTTACCATAA ACTAC 75

[0131]

[SEQ ID NO: 24] Sequence length: 51 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA sequence CAGCTGGGTA TTAAAGACCC CTCGGTGTTT ACC
CCTCCAA GCACGTGCCA G51

[0132]

[SEQ ID NO: 25] Sequence length: 117 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA sequence TCCTACGACG GGCTCAACCA GCGCGTGCGCGTGG
CTTGGACG AGAGGAAGGC GCTGATCCCC 60 TGCAAGAGAT TATTTTGAATA TATTTTGCTG TAT
AAGGATG GAGTGATGTT TCAGATT 117

[0133]

[SEQ ID NO: 26] Sequence length: 78 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA sequence CCCTGGGATC CTCTTGACAT TCCTCAAAAC TCCACCTTTG AAGACCAGTA CTCCATCGGG 60 GGGCCTCAGG AGCAGATC 78

[0134]

[SEQ ID NO: 27] Sequence length: 600 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA sequence TGGACCCTGT GCGGCCTGTG CAGCCTGGGG GCGGTGGGAG CCCCGCGCCC GTGCCAGGCG 60 CCGCAGCAGT GGGAGGGGCG CCAGGTTATG TACCAGCAAA GTAGCGGCCGCA CCTACGACGG GCTCAACCAG CGCGTGCGGG TGCTGGACGA GAGGAAGGCG 180 CTGATCCCCT GCAAGAGATT ATTTGAATAT ATTTTGCTGT ATAAGGATGG AGTGATGTTT 240 CAGATTGACC AAGCCACCAA GCAGTGCTCA AAGATGACCC TGACACAGCC CTGGGATCCT 300 CTTGACATTC CTCAAAACTC CACCTTTGAA GACCAGTACT CCATCGGGGG GCCTCAGGAG 360 CAGATCACCG TCCAGGAGTG GTCGGACAGA AAGTCAGCTA GATCCTATGA AACCTGGATT 420 GGCATCTATA CAGTCAAGGA TTGCTATCCT GTCCAGGAAA CCTTTACCAT AAACTACAGT 480 GTGATATTGT CTACGCGGTT TTTTGACATC CAGCTGGGTA TTAAAGACCC CTCGGTGTTT 540 ACCCCTCCAA GCACGTGCCA GATGGCCCAA CTGGAGAAGA TGAGCGAAGA CTGCTCCTGG 600

[0135]

[SEQ ID NO: 28] Sequence length: 672 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA sequence ATGCCAGGAC GCGCTCCCCT CCGCACCGTC CCG
GGCGCCC TGGGTGCCTG GCTGCTGGGC 60 GGCCTCTGGGCCTGCGACCCT GTGCGGCCTG TGC
AGCCTGG GGGCGGTGGGG AGCCGCCGC 120 CCGTGCCAGG CCGCCGCAGCA GTGGGAGGGG CGC
CAGGTTTA TGTACCAGCA AAGTAGCGGG 180 CGCAACAGCC GGCCCTCTGCT CTCCTACCAC GGG
CTCAACC AGCGCGTGCG GGTGCTGGAC 240 GAGAGGAAGG CGCTGATCCCC CTGCAAGAGA TTA
TTTGAAT ATTTTTGCT GTATAAGGAT 300 GGAGTGATGT TTCAGATTGA CCAAGCCACC AAG
CAGTGCT CAAAGATGAC CCTGACACAG 360 CCCTGGGATC CCTTGGACAT TCCTCAAAAC TCC
ACCTTTTG AAGACCAGTA CTCCATCGGG 420 GGGCCTCAGGG AGCAGATCAC CGTCCAGGAG TGG
TCGGACA GAAAGTCAGC TAGATCCTAT 480 GAAACCTGGA TTGGCATCTA TACAGTCAAG GAT
TGCTATAC CTGTCCAGGA AACCTTTACC 540 ATAAAACTACA GTGTGATATT GTCTACGCGG TTT
TTTGACA TCCAGCTGGGG TATTAAGAC 600 CCCTCGGTGT TTACCCCTCC AAGCACGGTGC CAG
ATGGCCC AACTGGAGAA GATGAGCGAA 660 GACTGCTCCT GG
672

[0136]

[SEQ ID NO: 29] Sequence length: 672 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA sequence ATGCTCACAC GCGCTCCCCG CCGCCTGGTC CAG
GGGCCCC GGGAGACCTG GCTGCTTGGC 60 GGCCTCTGGG TCTGGAATT GTGCGGCCTG GGG
ATGGCGG GCTCCCCGGG AACCCCGCAG 120 CCATGCCAGG CGCCCCAGCA GTGGGAGGGA CGT
CAGGTTC TGTACCAGCA GAGCAGCGGG 180 CACAACAGCC GGCCCCTGGGT GTCCTACGAT GGT
CTCAACC AGCGCGTGCG GGGCTGCGAC 240 GAAAGGAAGG CGCTGATCCC CTGCAAGAGA TTA
TTTGAAT ACATTTACT CTATAAGGAT 300 GGAGTGATGT TTCAGATTGA ACAAGCCACC AAA
CTGTGTG CAAAGATACC CTTGGGAGAA 360 CCCTGGGATC CTCTCGGACAT TCCCGAGAAT TCT
ACCTTTTG AAGATCAGTA CTCTATCGGA 420 GGGCCTCAGGG AGCAGATCAT GGTCCAGGAA TGG
TCTGACA GGAGGACAGC CAGATCCTAT 480 GAAACCTGGA TTGGCGTTTA TACGCCAAG GAT
TGCTACC CGGTCCAGGA GACCTTCATT 540 AGGAACTACA CTGTGGTCCT GTCCACTCGG TTC
TTTGATG TGCAGTTGGGG CATTAAAGAC 600 CCCTCTGTGT TCACCCCACC AAGCACGGTGC CAG
ACAGCAC AGCCAGAGAA GATGAAAGAG 660 AACTGCTCCC TG
672

[0137]

[SEQ ID NO: 30] Sequence length: 672 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA sequence ATGCCCGCGC GCGCTCCCCG CCGCCTGGTC CAGGGGCCTC GGGGGACCTG GCTGCTGGGA 60 AGCCTCTGGG TCTGGGTGCT GTGCGGCCTG GGGATGGCGCCCGG CACCCCAGCA GTGGGAGGGA CGCCAGGTTC TGTACCAGCA GAGCAGCGGG 180 CACAACAACC GCGCCCTGGT GTCCTACGAT GGTCTCAACC AGCGCGTGCG GGTGCTGGAC 240 GAGAGGAAAG CGCTGATCCC CTGCAAGAGA TTATTTGAAT ACATTTTACT CTATAAGGAG 300 GGAGTGATGT TTCAGATTGA ACAAGCCACC AAACAGTGTG CAAAGATCCC CTTGGTGGAA 360 TCCTGGGATC CTCTGGACAT TCCCCAGAAT TCTACCTTTG AAGATCAGTA CTCCATCGGA 420 GGGCCTCAGG AGCAGATCCT GGTCCAGGAG TGGTCTGACA GAAGAACAGC AAGATCCTAT 480 GAAACTTGGA TCGGCGTTTA TACAGCCAAG GATTGTTATC CGGTCCAGGA GACCTTCATC 540 AGGAACTACA CTGTGGTCAT GTCCACGCGG TTCTTTGATG TGCAGCTAGG CATTAAGGAC 600 CCCTCTGTGT TCACCCCACC AAGCACATGC CAGGCAGCGC AGCCAGAGAA GATGAGTGAC 660 GGCTGCTCCT TG 672

[0138]

[SEQ ID NO: 31] Sequence length: 111 Sequence type: nucleic acid Number of strands: double strand Topology: linear Sequence type: cDNA sequence ATGCCAGGAC GCGCTCCCCT CCGCACCGTC CCGGGCGCCC TGGGTGCCTG GCTGCTGGGC 60 GGCCTCTGGG CCTGGACCCT GTGCGGCCTG TGCAGCCTGG AGGGG

[0139]

[SEQ ID NO: 32] Sequence length: 72 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA sequence ATGCCAGGAC GCGCTCCCCT CCGCACCGTC CCGGGCGCCC TGGGTGCCTG GCTGCTGGGC 60 GGCCTCTGGG CC 72

[0140]

[SEQ ID NO: 33] Sequence length: 102 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA sequence ATGCTCACAC GCGCTCCCCG CCGCCTGGTC CAGGGGCCCC GGGAGACCTG GCTGCTTGGC 60 GGCCTCTGGG TCTGGATATT GTGCGGCCTG GGGATGGCGG GC 102

[0141]

[SEQ ID NO: 34] Sequence length: 111 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA sequence ATGCCCGCGC GCGCTCCCCG CCGCCTGGTC CAGGGGCCTC GGGGGACCTG GCTGCTGGGA 60 AGCCTCTGGG TCTGGGTGCT GTGCGGCCTG GGGATGGCGG GCTCCCGG A

[0142]

[SEQ ID NO: 35] Sequence length: 21 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: synthetic DNA sequence AGGTGGAGTT TTGAGGAATG T 21

[0143]

[Brief description of the drawings]

FIG. 1 shows the nucleotide sequence of the DNA encoding the human ependymin-like protein of the present invention obtained in Example 1 and the amino acid sequence encoded thereby. Arrows indicate signal peptide cleavage sites. The site surrounded by a square indicates an N-glycosylation site. Underlines indicate the ATTTA sequence and poly (A) ⁺ additional signal, respectively, involved in mRNA instability.

FIG. 2 shows the rat ependymin of the present invention obtained in Example 3.
1 shows the nucleotide sequence of DNA encoding the protein and the amino acid sequence encoded thereby. Arrows indicate signal peptide cleavage sites. The site surrounded by a square indicates an N-glycosylation site. Underlines indicate poly (A) ⁺ additional signals.

FIG. 3 shows the mouse ependymin of the present invention obtained in Example 5.
1 shows the nucleotide sequence of DNA encoding the protein and the amino acid sequence encoded thereby. Arrows indicate signal peptide cleavage sites. The site surrounded by a square indicates an N-glycosylation site. Underlines indicate poly (A) ⁺ additional signals.

FIG. 4 shows the amino acid sequence of the human ependymin-like protein of the present invention obtained in Example 1, the amino acid sequence of the rat ependymin-like protein of the present invention obtained in Example 3, and the present invention obtained in Example 5. FIG. 2 shows a diagram comparing the amino acid sequences of mouse ependymin-like proteins. hEpendymin is the amino acid sequence of the human ependymin-like protein of the present invention,
endymin indicates the amino acid sequence of the rat ependymin-like protein of the present invention, and mEpendymin indicates the amino acid sequence of the mouse ependymin-like protein of the present invention. The shaded area is
Amino acid sequence of human ependymin-like protein, rat epe
1 shows amino acid residues homologous to the amino acid sequences of ndymin-like protein and mouse ependymin-like protein.

FIG. 5 shows a comparison of the amino acid sequence of the human ependymin-like protein of the present invention obtained in Example 1 with the amino acid sequence of the rat ependymin-like protein of the present invention obtained in Example 3. Human is the amino acid sequence of the human ependymin-like protein of the present invention, and Rat is the rat ependymin-like protein of the present invention.
1 shows the amino acid sequence of the protein. Shaded portions indicate amino acid residues homologous to the amino acid sequence of human ependymin-like protein and the amino acid sequence of rat ependymin-like protein.

FIG. 6 shows the results obtained by examining the expression level of mRNA encoding the human ependymin-like protein of the present invention in human tissues by Northern hybridization (electrophoresis photograph). Heart is the heart, Brain is the brain, Placenta is the placenta, Lung is the lungs, Liver is the liver, Skeletal Muscle is the skeletal muscle, Kidney is the kidney, Pancreas is the pancreas, Spleen is the spleen, and Thymus is the thymus Prostate, Prostate, Testis
Is testis, Ovary is ovary, Small Intestine is small intestine, Co
lon for colon, Peripheral Blood for peripheral blood, Fetal Hea
rt for fetal heart, Fetal Brain for fetal brain, Fetal Lung
Is fetal lung, Fetal Liver is fetal liver, Fetal Kidney
Indicates a fetal kidney. The number (kb) on the left indicates the size of the RNA molecular weight marker.

FIG. 7 shows the results of examining the expression level of mRNA encoding the rat ependymin-like protein of the present invention in rat tissues by Northern hybridization (electrophoresis photograph). Brain is the brain, Spinal cord is the spinal cord, Heart
Is the heart, Lung is the lungs, Liver is the liver, Pancreas is the pancreas, Stomach is the stomach, Small Intestine is the small intestine, Te
stis indicates the testis, Ovary indicates the ovary, and Placenta indicates the placenta. The number (kb) on the left indicates the size of the RNA molecular weight marker.

FIG. 8 shows the results of Northern hybridization analysis of the expression level of mRNA encoding the mouse ependymin-like protein of the present invention in each mouse tissue (electrophoresis photograph). Brain refers to the brain, Spinal cord refers to the spinal cord, Lung refers to the lungs, and Liver refers to the liver. The number (kb) on the left is RN
Shows the size of the A molecular weight marker.

FIG. 9 shows the results of examining the expression level of mRNA encoding the human ependymin-like protein of the present invention in various parts of the human central nervous system by Northern hybridization (electrophoresis photograph). Cerebellum cerebellum, Cerebral cortex
Is the cerebral cortex, Medulla is the medulla oblongata, Spinal cord is the spinal cord, Occipital pole is the posterior lobe, Frontal lobe is the anterior lobe, Temporal lobe is the lateral lobe, Putamen is the putamen, and Amyg
dala for the amygdala, Caudate nucleus for the caudate nucleus, Corpus
callosum the corpus callosum, Hippocampus the hippocampus, whole brain
Is the whole brain, Substantia nigra is the substantia nigra, Subthal
Amic nucleus is the Thalamu
s indicates the thalamus. G3PDH indicates the expression level of mRNA encoding glyceraldehyde-3-phosphate dehydrogenase used as an internal marker. The number on the left (k
b) shows the size of the RNA molecular weight marker.

FIG. 10 shows the results obtained by examining the expression level of mRNA encoding human ependymin-like protein of the present invention in cultured human neurons by Northern hybridization (electrophoresis photograph).

FIG. 11 shows the results of Southern hybridization performed using a cDNA fragment encoding the human ependymin-like protein of the present invention and a DNA fragment obtained by cutting human genomic DNA with various restriction enzymes (electrophoresis photograph). B
amHI, HindIII, BglII and SacI are restriction enzymes that cut human genomic DNA. Numbers on the left (kbp) indicate the size of the DNA molecular weight marker.

FIG. 12 shows the result of examining the chromosome number of the gene encoding the human ependymin-like protein of the present invention (electrophoresis photograph). Lanes 1 to 28 are male human genome D, respectively.
NA, female human genomic DNA, mouse genomic DNA, hamster genomic DNA, chromosome 1, chromosome 2, chromosome 4, chromosome 5, chromosome 6, chromosome 7, chromosome 8, chromosome 9, Chromosome 10, chromosome 11, chromosome 12, chromosome 13, chromosome 14,
Chromosome 15, Chromosome 16, Chromosome 17, Chromosome 18, Chromosome 19, Chromosome 20, Chromosome 21, 2
Chromosome 2, X and Y chromosomes are shown. Numbers on the left (kbp) indicate the size of the DNA molecular weight marker.

────────────────────────────────────────────────── ───

[Procedure amendment]

[Submission date] November 10, 1997

[Procedure amendment 1]

[Document name to be amended] Statement

[Correction target item name] Brief description of drawings

[Correction method] Change

[Correction contents]

[Brief description of the drawings]

FIG. 1-1: Human ependymi of the present invention obtained in Example 1
The nucleotide sequence (1st to 576th) of the DNA encoding the n-like protein and the amino acid sequence encoded thereby are shown. Arrows indicate signal peptide cleavage sites. The site surrounded by a square indicates an N-glycosylation site.
Underlines indicate the ATTTA sequence and poly (A) ⁺ additional signal, respectively, involved in mRNA instability.

FIG. 1-2: Human ependymi of the present invention obtained in Example 1
The nucleotide sequence of the DNA encoding the n-like protein (No. 57)
7th to 1080th) and the amino acid sequence encoded thereby. Arrows indicate signal peptide cleavage sites. The site surrounded by a square indicates an N-glycosylation site. Underlines indicate the ATTTA sequence and poly (A) ⁺ additional signal, respectively, involved in mRNA instability.

FIG. 1-3: Human ependymi of the present invention obtained in Example 1
The nucleotide sequence of the DNA encoding the n-like protein (No. 10)
81 to 2268) and the amino acid sequence encoded thereby. Arrows indicate signal peptide cleavage sites. The site surrounded by a square indicates an N-glycosylation site. Underlined ATTTA involved in mRNA instability
The sequence and poly (A) ⁺ additional signal are shown, respectively.

FIG. 1-4: Human ependymi of the present invention obtained in Example 1.
The nucleotide sequence of the DNA encoding the n-like protein (No. 22)
69th to 2507) and the amino acid sequence encoded thereby. Arrows indicate signal peptide cleavage sites. The site surrounded by a square indicates an N-glycosylation site. Underlined ATTTA involved in mRNA instability
The sequence and poly (A) ⁺ additional signal are shown, respectively.

FIG. 2-1 is a rat ependy of the present invention obtained in Example 3.
The nucleotide sequence of the DNA encoding the min-like protein (No. 1)
540th) and the amino acid sequence encoded thereby. Arrows indicate signal peptide cleavage sites. The site surrounded by a square indicates an N-glycosylation site.
Underlines indicate poly (A) ⁺ additional signals.

FIG. 2-2. Rat ependy of the present invention obtained in Example 3.
The nucleotide sequence of the DNA encoding the min-like protein (No. 5)
41st to 1116th) and the amino acid sequence encoded thereby. Arrows indicate signal peptide cleavage sites. The site surrounded by a square indicates an N-glycosylation site. Underlines indicate poly (A) ⁺ additional signals.

FIG. 2-3: Rat ependy of the present invention obtained in Example 3
The nucleotide sequence of the DNA encoding the min-like protein (No. 1)
117-2202) and the amino acid sequence encoded thereby. Arrows indicate signal peptide cleavage sites. The site surrounded by a square indicates an N-glycosylation site. Underlines indicate poly (A) ⁺ additional signals.

FIG. 3-1 shows the mouse ependy of the present invention obtained in Example 5.
The nucleotide sequence of the DNA encoding the min-like protein (No. 1)
576th) and the amino acid sequence encoded thereby. Arrows indicate signal peptide cleavage sites. The site surrounded by a square indicates an N-glycosylation site.
Underlines indicate poly (A) ⁺ additional signals.

FIG. 3-2: Mouse ependy of the present invention obtained in Example 5
The nucleotide sequence of the DNA encoding the min-like protein (No. 5)
77 to 1152) and the amino acid sequence encoded thereby. Arrows indicate signal peptide cleavage sites. The site surrounded by a square indicates an N-glycosylation site. Underlines indicate poly (A) ⁺ additional signals.

FIG. 3-3: Mouse ependy of the present invention obtained in Example 5
The nucleotide sequence of the DNA encoding the min-like protein (No. 1)
153rd to 2340th) and the amino acid sequence encoded thereby. Arrows indicate signal peptide cleavage sites. The site surrounded by a square indicates an N-glycosylation site. Underlines indicate poly (A) ⁺ additional signals.

FIG. 3-4: Mouse ependy of the present invention obtained in Example 5
The nucleotide sequence of the DNA encoding the min-like protein (second
341 to 2403) and the amino acid sequence encoded thereby. Arrows indicate signal peptide cleavage sites. The site surrounded by a square indicates an N-glycosylation site. Underlines indicate poly (A) ⁺ additional signals.

FIG. 4 shows the amino acid sequence of the human ependymin-like protein of the present invention obtained in Example 1, the amino acid sequence of the rat ependymin-like protein of the present invention obtained in Example 3, and the present invention obtained in Example 5. FIG. 2 shows a diagram comparing the amino acid sequences of mouse ependymin-like proteins. hEpendymin is the amino acid sequence of the human ependymin-like protein of the present invention,
endymin indicates the amino acid sequence of the rat ependymin-like protein of the present invention, and mEpendymin indicates the amino acid sequence of the mouse ependymin-like protein of the present invention. The shaded area is
Amino acid sequence of human ependymin-like protein, rat epe
1 shows amino acid residues homologous to the amino acid sequences of ndymin-like protein and mouse ependymin-like protein.

FIG. 5 shows a comparison of the amino acid sequence of the human ependymin-like protein of the present invention obtained in Example 1 with the amino acid sequence of the rat ependymin-like protein of the present invention obtained in Example 3. Human is the amino acid sequence of the human ependymin-like protein of the present invention, and Rat is the rat ependymin-like protein of the present invention.
1 shows the amino acid sequence of the protein. Shaded portions indicate amino acid residues homologous to the amino acid sequence of human ependymin-like protein and the amino acid sequence of rat ependymin-like protein.

FIG. 6 shows the results obtained by examining the expression level of mRNA encoding the human ependymin-like protein of the present invention in human tissues by Northern hybridization (electrophoresis photograph). Heart is the heart, Brain is the brain, Placenta is the placenta, Lung is the lungs, Liver is the liver, Skeletal Muscle is the skeletal muscle, Kidney is the kidney, Pancreas is the pancreas, Spleen is the spleen, and Thymus is the thymus Prostate, Prostate, Testis
Is testis, Ovary is ovary, Small Intestine is small intestine, Co
lon for colon, Peripheral Blood for peripheral blood, Fetal Hea
rt for fetal heart, Fetal Brain for fetal brain, Fetal Lung
Is fetal lung, Fetal Liver is fetal liver, Fetal Kidney
Indicates a fetal kidney. The number (kb) on the left indicates the size of the RNA molecular weight marker.

FIG. 7 shows the results of examining the expression level of mRNA encoding the rat ependymin-like protein of the present invention in rat tissues by Northern hybridization (electrophoresis photograph). Brain is the brain, Spinal cord is the spinal cord, Heart
Is the heart, Lung is the lungs, Liver is the liver, Pancreas is the pancreas, Stomach is the stomach, Small Intestine is the small intestine, Te
stis indicates the testis, Ovary indicates the ovary, and Placenta indicates the placenta. The number (kb) on the left indicates the size of the RNA molecular weight marker.

FIG. 8 shows the results of Northern hybridization analysis of the expression level of mRNA encoding the mouse ependymin-like protein of the present invention in each mouse tissue (electrophoresis photograph). Brain refers to the brain, Spinal cord refers to the spinal cord, Lung refers to the lungs, and Liver refers to the liver. The number (kb) on the left is RN
Shows the size of the A molecular weight marker.

FIG. 9 shows the results of examining the expression level of mRNA encoding the human ependymin-like protein of the present invention in various parts of the human central nervous system by Northern hybridization (electrophoresis photograph). Cerebellum cerebellum, Cerebral cortex
Is the cerebral cortex, Medulla is the medulla oblongata, Spinal cord is the spinal cord, Occipital pole is the posterior lobe, Frontal lobe is the anterior lobe, Temporal lobe is the lateral lobe, Putamen is the putamen, and Amyg
dala for the amygdala, Caudate nucleus for the caudate nucleus, Corpus
callosum the corpus callosum, Hippocampus the hippocampus, whole brain
Is the whole brain, Substantia nigra is the substantia nigra, Subthalamic nu
cles indicates the hypothalamus nucleus and Thalamus indicates the thalamus. G3PDH
Is glyceraldehyde-3- used as an internal marker
3 shows the expression level of mRNA encoding phosphate dehydrogenase. The number (kb) on the left indicates the size of the RNA molecular weight marker.

FIG. 10 shows the results obtained by examining the expression level of mRNA encoding human ependymin-like protein of the present invention in cultured human neurons by Northern hybridization (electrophoresis photograph).

FIG. 11 shows the results of Southern hybridization performed using a cDNA fragment encoding the human ependymin-like protein of the present invention and a DNA fragment obtained by cutting human genomic DNA with various restriction enzymes (electrophoresis photograph). B
amHI, HindIII, BglII and SacI are restriction enzymes that cut human genomic DNA. Numbers on the left (kbp) indicate the size of the DNA molecular weight marker.

FIG. 12 shows the result of examining the chromosome number of the gene encoding the human ependymin-like protein of the present invention (electrophoresis photograph). Lanes 1 to 28 are male human genome D, respectively.
NA, female human genomic DNA, mouse genomic DNA, hamster genomic DNA, chromosome 1, chromosome 2, chromosome 4, chromosome 5, chromosome 6, chromosome 7, chromosome 8, chromosome 9, Chromosome 10, chromosome 11, chromosome 12, chromosome 13, chromosome 14,
Chromosome 15, Chromosome 16, Chromosome 17, Chromosome 18, Chromosome 19, Chromosome 20, Chromosome 21, 2
Chromosome 2, X and Y chromosomes are shown. Numbers on the left (kbp) indicate the size of the DNA molecular weight marker.

──────────────────────────────────────────────────の Continued on the front page (51) Int.Cl. ⁶ Identification code FI C07K 16/18 C12N 1/21 C12N 1/21 C12P 21/02 H 15/09 ZNA G01N 33/53 D C12P 21/02 A61K 37 / 02 AAM G01N 33/53 C12N 15/00 ZNAA // (C12N 1/21 C12R 1:19) (C12P 21/02 C12R 1:19)

Claims (30)

[Claims] 1. A mammal-derived ependimin-like protein or a salt thereof. 2. A protein containing the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, or a protein or a salt thereof containing an amino acid sequence substantially identical thereto. 3. An amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, wherein SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 or ( 3. The protein according to claim 2, which is an amino acid sequence containing the amino acid sequence represented by SEQ ID NO: 7. An amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 is represented by SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3. 3. The protein according to claim 2, which is an amino acid sequence having about 95% or more homology with the amino acid sequence to be obtained. 5. The protein according to claim 2, which has a nerve elongation effect. 6. A partial peptide of the protein according to claim 1 or 2, or a salt thereof. 7. The partial peptide according to claim 6, which has an amino acid sequence represented by any one of SEQ ID NOs: 4 to 9. 8. The protein precursor according to claim 2, which has the amino acid sequence represented by SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13 or an amino acid sequence substantially identical thereto. Protein or salt thereof. 9. A signal peptide having an amino acid sequence represented by SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16 or SEQ ID NO: 17, or an amino acid sequence substantially identical thereto, or a salt thereof. 10. A DNA comprising a DNA having a base sequence encoding the protein according to claim 1 or 2. 11. The method according to claim 1, which has the nucleotide sequence represented by SEQ ID NO: 18, SEQ ID NO: 19 or SEQ ID NO: 20.
DNA according to claim 0. 12. A DNA comprising a DNA having a base sequence encoding the precursor protein according to claim 8. 13. The DNA according to claim 12, which has a base sequence represented by SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29 or SEQ ID NO: 30. 14. A DNA containing a DNA having a base sequence encoding the signal peptide according to claim 9. 15. The DNA according to claim 14, which has a base sequence represented by SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33 or SEQ ID NO: 34. 16. A recombinant vector containing the DNA according to claim 10. [17] A transformant transformed with the recombinant vector according to [16]. (18) culturing the transformant according to (17),
The method for producing the protein or the salt thereof according to claim 1 or 2, wherein the protein or the salt thereof according to claim 1 or 2 is produced, accumulated, and collected. (19) a medicine comprising the protein of (1) or (2), the partial peptide of (6) or a salt thereof; 20. The medicament according to claim 19, which is an agent for treating / preventing Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, dementia or cerebellar degeneration. 21. A pharmaceutical comprising the DNA according to claim 10. 22. The medicament according to claim 21, which is a therapeutic / prophylactic agent for Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, dementia or cerebellar degeneration. 23. An antibody against the protein according to claim 1 or 2, the partial peptide according to claim 6, the precursor protein according to claim 8, or a salt thereof. 24. The protein according to claim 1 or 2,
A screening for a compound or a salt thereof which promotes the function of the protein of claim 1 or 2, a partial peptide of claim 6, or a salt thereof, wherein the partial peptide of claim 6 or a salt thereof is used. Method. 25. The screening method according to claim 24, wherein the function is (i) a nerve elongation effect or a glial cell activation effect in the central nervous system or (ii) a memory formation effect in the brain. 26. The screening method according to claim 24, wherein the function is a nerve elongation effect. (27) the protein according to (1) or (2), which comprises the protein according to (1) or (2), the partial peptide according to (6), or a salt thereof;
A screening kit for a compound that promotes the function of the partial peptide according to claim 6 or a salt thereof or a salt thereof. 28. The function of the protein of claim 1 or 2, the partial peptide of claim 6, or a salt thereof obtained by using the screening method of claim 24 or the screening kit of claim 27. A compound that promotes or a salt thereof. (29) a compound which promotes the function of the protein of (1), the partial peptide of (6) or a salt thereof obtained by using the screening method of (24) or the screening kit of (27); Or a pharmaceutical comprising a salt thereof. 30. The medicament according to claim 29, which is a therapeutic / prophylactic agent for Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, dementia or cerebellar degeneration.