JPH11266870A - New protein and its dna - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a DNA encoding a new protein having homology with xylulokinase and useful as a hypoglycemic agent used for preventing diabetes and scarcely having a side effect and further as a genetic diagnosing agent for diseases such as hypoglycemia and diabetes. SOLUTION: This DNA encodes a protein having the same or substantially the same amino acid sequence as an amino acid sequence of the formula. The DNA can be obtained by cloning the DNA, for example, by amplifying the objective DNA from a genome DNA library, etc., by a PCR method with a synthetic DNA primer having the partial base sequence of a DNA encoding the protein.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a novel protein having homology to a sugar metabolizing enzyme such as xylulokinase and a DNA encoding the same.

[0002]

2. Description of the Related Art Diabetes has been increasing in the number of patients in recent years and is attracting attention as one of adult diseases. Non-insulin-dependent diabetes mellitus (NIDDM) is a type of diabetes that is common in Japan, and early detection and early treatment are important from the viewpoint of its prognosis. However, NIDDM has a variety of causes, and little is known about possible causes. NI
Causes of insufficient insulin action in DDM include abnormalities in the insulin sensitivity mechanism and decreased insulin secretion. In Europe and the United States, the former is the main feature, namely insulin resistance, but in Japan, insulin secretion deficiency is often the main feature. Recently, knowledge of the insulin sensitivity mechanism has been accumulated due to rapid progress of molecular biology. Beginning to elucidate the structure of the insulin receptor, the signal transduction mechanism after the receptor has also been gradually elucidated. In the last 10 years, sugar transporter genes have been cloned, and the relationship between mutations in these genes and the onset of diabetes has been studied. However, even if the abnormalities of insulin, glucokinase, and mitochondrial genes that have been identified so far are less than 1% of NIDDM, other genetic abnormalities need to be identified in the future.

At present, the following 9 mechanisms are known as the mechanism of action of antidiabetic drugs having the function of improving insulin resistance.
Items are considered. Activation of insulin receptor kinase, translocation of sugar transporter to cell membrane, action of rate-limiting enzyme in glucose metabolism, correction of abnormal glucose metabolism, suppression of hepatic gluconeogenesis,
These include promotion of glucose uptake by the liver, increased hepatic glycogen production, decreased blood lipids, decreased hepatic gluconeogenesis associated with decreased blood lipids, and increased insulin sensitivity associated with decreased blood lipids.

[0004] Xylulokinase is an important enzyme that catalyzes the reaction of xylulose to xylulose-5-phosphate. Xylulose-5-phosphate produced by the catalytic reaction is metabolized via the Emdenmeyer-Hoff pathway and the pentose phosphate pathway [Biochemical Journal, 19
3, 512 (1981)]. Regarding the xylulokinase gene, a xylulokinase gene derived from Escherichia coli [Applied and Environmental Microbiology, Applied and Environmental Microbiology,
47, 15 (1984)], Bacillus subtilis-derived xylulokinase gene [Archives of Microbiology, 55, 535 (1991)
Year)], and a yeast-derived xylulokinase gene [Applied Biochemistry and Biotechnology, Appl.
17, 313 (1988)].

[0005]

The isolation of a new protein involved in glucose metabolism enables a more detailed study of the elucidation of the mechanism of the glucose metabolism system, and a new protein useful for the prevention and treatment of diabetic diseases with few side effects. The development of hypoglycemic drugs and prophylactic / therapeutic drugs for hypoglycemia, which have various action mechanisms, can be expected.

[0006]

Means for Solving the Problems As a result of intensive studies, the present inventors have determined to clone a cDNA encoding a novel protein having homology to xylulokinase from a cDNA library derived from human liver. Successful. The present inventors have further studied based on these findings, and as a result, have completed the present invention.

That is, the present invention relates to (1) a protein having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1 or a salt thereof, and (2) a protein having the xylulokinase activity. (3) a partial peptide of the protein of (1) or a salt thereof; (4) a DNA having a base sequence encoding the protein of (1) or the partial peptide of (3); DNA containing, (5) SEQ ID NO: 2
The DN according to the above (4), which has a base sequence represented by:
A, (6) a recombinant vector containing the DNA of (4), (7) a transformant transformed with the recombinant vector of (6), (8) a transformant of (7) Culturing the transformant to produce and accumulate the protein or salt thereof according to (1) above, and collecting the protein or salt thereof, wherein the protein or salt thereof or partial peptide of (3) above is collected. Or a method for producing a salt thereof, (9) a drug comprising the protein of (1), the partial peptide of (3) or a salt thereof, and (10) a therapeutic or prophylactic agent for diabetes. 9) the medicine according to the above, (11) the medicine containing the DNA according to the above (4), (12) the medicine according to the above (11) which is a therapeutic / prophylactic agent for diabetes, or (13) the above (1). The protein according to (3) above Min peptides or antibodies against their salts, (14) (1) above, wherein the protein,
(15) a method for screening a compound or a salt thereof which inhibits or activates the enzymatic activity of the protein or a salt thereof according to the above (1), wherein the partial peptide or a salt thereof according to the above (3) is used; A kit for screening a compound or a salt thereof that inhibits or activates the enzymatic activity of the protein or a salt thereof according to the above (1), comprising the protein according to (1), the partial peptide according to (3) or a salt thereof; And (16) the screening method according to (14) or (1)
5) Obtained by using the screening kit according to the above,
A compound or salt thereof that inhibits or activates the enzyme activity of the protein or salt thereof according to the above (1).

Further, the present invention relates to (17) SEQ ID NO: 2.
A DNA containing a DNA having a nucleotide sequence that hybridizes under high stringent conditions with the nucleotide sequence represented by the following formula (18): a recombinant vector containing the DNA according to the above (17); (20) culturing the transformant transformed with the recombinant vector according to the above (19), producing and accumulating the protein encoded by the DNA according to the above (17); A method for producing a protein encoded by the DNA according to the above (17) or a salt thereof, which is obtained by collecting the DNA according to the above (17), which is produced by the production method according to the above (20). An encoded protein or a salt thereof, (22) the antibody of (13),
The test solution and the labeled protein of the above (1), the partial peptide of the above (3) or a salt thereof are allowed to competitively react with each other, and the labeled liquid of the above (1) is bound to the antibody. Measuring the ratio of the protein of the above, the partial peptide of the above (3) or the salt thereof, the protein of the above (1) in the test liquid,
The method for quantifying the partial peptide or a salt thereof described in (2)
3) After reacting the test solution with the antibody of (13) insolubilized on the carrier and another labeled antibody of (13) simultaneously or continuously, the labeling agent on the insolubilized carrier is reacted. Quantifying the protein described in (1) above, the partial peptide described in (3) above, or a salt thereof in a test solution, wherein (24) the above (13)
(25) a medicament comprising the antibody of the above (preferably an antibody having an activity of neutralizing the activity of the protein of the above (1));
(4) the medicine according to (26) (i) the protein according to (1) above, the partial peptide according to (3) or a salt thereof when a substrate is contacted, and (ii) the protein according to (1) above. Measuring the enzymatic activity of the protein of (1), the partial peptide of (3), or a salt thereof when a substrate and a test compound are brought into contact with the partial peptide of (3) or a salt thereof. And comparing the protein or the salt thereof according to the above (1) (eg, xylulokinase activity).
(27) a method of screening for a compound or a salt thereof that inhibits or activates DNA, having (27) a nucleotide sequence complementary or substantially complementary to the DNA of (1) or (17), and expressing the DNA; (28) The above (1) or the above (17)
A base sequence substantially complementary to the DNA described above,
A base sequence having about 70% or more (preferably about 80% or more, more preferably about 90% or more, and most preferably about 95% or more) homology with the entire base sequence or partial base sequence of the base sequence complementary to (29) The antisense DNA according to (27) or (2)
8) a medicine comprising the antisense DNA according to the above, and
9) The medicine according to the above is provided.

The protein of the present invention is a protein containing the amino acid sequence represented by SEQ ID NO: 1 or an amino acid sequence substantially identical thereto. The protein of the present invention can be used, for example, in all cells of humans and warm-blooded animals (eg, guinea pigs, rats, mice, chickens, rabbits, pigs, sheep, cows, monkeys, etc.) (eg, spleen cells, nerve cells, glial cells, Pancreatic β cells, bone marrow cells, mesangial cells, Langerhans cells, epidermal cells, epithelial cells, endothelial cells, fibroblasts, fiber cells, muscle cells, adipocytes, immune cells (eg, macrophages, T cells, B cells, natural killers) Cells, mast cells, neutrophils, basophils, eosinophils, monocytes), megakaryocytes, synovial cells, chondrocytes, osteocytes, osteoblasts, osteoclasts, mammary cells, hepatocytes or stroma Cells, or their precursors, stem cells, or cancer cells), or any tissue in which those cells are present, such as the brain, parts of the brain (eg, olfactory bulb, amygdala, basal cerebrum) , Hippocampus, thalamus, hypothalamus, cerebral cortex, medulla, cerebellum, occipital lobe, frontal lobe, temporal lobe, putamen, caudate nucleus, brain stain, substantia nigra), spinal cord, pituitary, stomach, pancreas, kidney, liver , Gonads, thyroid, gall bladder, bone marrow, adrenal gland, skin, muscle, lungs,
Digestive tract (eg, large intestine, small intestine), blood vessels, heart, thymus, spleen,
Submandibular gland, peripheral blood, prostate, testicle, ovary, placenta, uterus,
It may be a protein derived from bone, joint, skeletal muscle, or the like, or may be a synthetic protein.

The amino acid sequence substantially identical to SEQ ID NO: 1 is, for example, about 80% or more, preferably about 85% or more, more preferably about 90% or more as compared with the amino acid sequence represented by SEQ ID NO: 1. Most preferably about 95%
Amino acid sequences having the above homology are exemplified.
The protein having an amino acid sequence substantially identical to SEQ ID NO: 1 of the present invention includes an amino acid sequence substantially identical to SEQ ID NO: 1 and represented by SEQ ID NO: 1. A protein having substantially the same activity as that of the contained protein is used. Examples of substantially the same activity include the activity of an enzyme (preferably xylulokinase) involved in sugar metabolism such as xylulokinase activity. Substantially the same means that their activities are qualitatively (eg, physiochemically or pharmacologically) the same. Therefore, for example, activities such as xylulokinase activity are the same (eg, about 0.01 to 1).
(Preferably about 0.5 to 20 times, and more preferably about 0.5 to 2 times), but the quantitative factors such as the degree of activity and the molecular weight of the protein are different. Is also good. The measurement of xylulokinase activity can be performed according to a method known per se. For example, it can be measured according to the method for screening a drug candidate compound described below. The protein of the present invention includes one or more (preferably about 1 to 30, more preferably about 1 to 20, and still more preferably 1 to 10) amino acids in the amino acid sequence represented by SEQ ID NO: 1. Degree, most preferably several (eg, 1 to 5) amino acids are deleted, and the amino acid sequence represented by SEQ ID NO: 1 or 2 or more (preferably 1 to 30)
, More preferably about 1 to 20, more preferably about 1 to 10, most preferably several (eg, 1 to 5
)), One or more (preferably about 1 to 30, more preferably 1 to 20) in the amino acid sequence represented by SEQ ID NO: 1
An amino acid sequence in which about 1, more preferably about 1 to 10, and most preferably several (eg, 1 to 5) amino acids have been substituted with another amino acid, or a protein containing an amino acid obtained by combining them. Is also used.

The protein of the present invention may comprise one or more (preferably about 1 to 30, more preferably 1 to 30) amino acids in the amino acid sequence represented by SEQ ID NO: 3.
An amino acid sequence in which about 20 amino acids have been deleted, more preferably about 1 to 10 amino acids, and most preferably several amino acids (eg, 1 to 5 amino acids); Or more (preferably about 1 to 30, more preferably about 1 to 20, more preferably 1 to 1
An amino acid sequence to which about 0, most preferably several (eg, 1 to 5) amino acids have been added, 1 or 2 or more (preferably about 1 to 30) in the amino acid sequence represented by SEQ ID NO: 3 More preferably about 1 to 20, more preferably about 1 to 10, most preferably several (eg, 1 to 5) amino acids substituted with another amino acid, or a combination thereof. A protein containing a modified amino acid is also used.

In the present specification, the protein has a N-terminus (amino terminus) at the left end and a C-terminus (carboxyl terminus) at the right end in accordance with the convention of peptide labeling. The protein of the present invention, including the protein containing the amino acid sequence represented by SEQ ID NO: 1, usually has a carboxyl group (-COOH) or a carboxylate (-CO
O ⁻ ), but the C-terminal may be an amide (—CONH ₂ ) or an ester (—COOR). As R in the ester, for example, a C _1-6 alkyl group such as methyl, ethyl, n-propyl, isopropyl or n-butyl, for example, a C _3-8 cycloalkyl group such as cyclopentyl and cyclohexyl, for example, phenyl, α-
C _6-12 aryl groups such as naphthyl, for example benzyl,
Pivaloyloxy widely used as an oral ester, in addition to a C _7-14 aralkyl group such as a phenyl-C _1-2 alkyl group such as phenethyl or an α-naphthyl-C _1-2 alkyl group such as α-naphthylmethyl A methyl group or the like is used. When the protein of the present invention has a carboxyl group (or carboxylate) other than the C-terminus, the protein of the present invention includes a carboxyl group amidated or esterified. As the ester in this case, for example, the above-mentioned C-terminal ester and the like are used. Furthermore, in the protein of the present invention, the amino group of the N-terminal amino acid residue (eg, a methionine residue) has a protecting group (eg, a C _1-6 acyl such as a C _1-6 alkanoyl such as a formyl group and an acetyl group). Group), a glutamyl group formed by cleavage of the N-terminal side in vivo and a pyroglutamyl group formed, a substituent on the side chain of an amino acid in the molecule (for example, -OH, -SH, amino group). Groups, imidazole groups, indole groups, guanidino groups, etc.) are suitable protecting groups (for example, C _1-6 such as formyl group, acetyl group, etc.).
Protected by a C _1-6 acyl group such as alkanoyl) or a complex protein such as a so-called glycoprotein having a sugar chain bonded thereto. Specific examples of the protein of the present invention include, for example, a human-derived protein having the amino acid sequence represented by SEQ ID NO: 1.

The partial peptide of the protein of the present invention may be any peptide as long as it is a partial peptide of the protein of the present invention described above. For example, at least 10 of the constituent amino acid sequences of the protein of the present invention may be used. As described above, a peptide having an amino acid sequence of preferably 50 or more, more preferably 100 or more, and preferably having an activity of an enzyme involved in sugar metabolism such as xylulokinase activity. In addition, as the partial peptide of the present invention, one or two or more (for example, about 1 to 20, preferably about 1 to 10, more preferably several (for example) in the amino acid sequence represented by SEQ ID NO: 1
1 to 5) of the amino acid sequence represented by SEQ ID NO: 7, SEQ ID NO: 8 or SEQ ID NO: 9;
, Preferably about 1 to 10, more preferably several (eg, 1 to 5) amino acids, SEQ ID NO: 7, SEQ ID NO: 8 or SEQ ID NO: 9
Wherein one or more (eg, about 1 to 20, preferably about 1 to 10, more preferably several (eg, 1 to 5)) amino acids in the amino acid sequence represented by Amino acid sequences, or partial peptides containing amino acids obtained by combining them are also used. In the partial peptide of the present invention, the C-terminus usually has a carboxyl group (-COOH) or a carboxylate (-
COO ⁻ ), but the C-terminal may be an amide (—CONH ₂ ) or an ester (—COOR) as in the protein of the present invention described above (the definition of R is as defined above). Furthermore, the partial peptide of the present invention has a structure in which the amino group of the N-terminal amino acid residue (eg, methionine residue) is protected by a protecting group, and Pyroglutamylation of glutamyl groups formed by cleavage in the body, those in which the substituents on the side chains of the amino acids in the molecule are protected with appropriate protecting groups, or complexes of so-called glycopeptides with attached sugar chains Peptides are also included. Since the partial peptide of the present invention can be used as an antigen for preparing an antibody,
It is not necessary to have the activity of an enzyme (preferably xylulokinase) involved in sugar metabolism such as xylulokinase activity.

As the salt of the protein or partial peptide of the present invention, salts with physiologically acceptable acids (eg, inorganic acids, organic acids) and bases (eg, alkali metals) are used. Are preferred. Such salts include, for example, salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) or organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid) Acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid) and the like are used. The protein, partial peptide or a salt thereof of the present invention can be produced from the above-mentioned method of purifying a protein or peptide from human or warm-blooded animal cells or tissues, or can encode the protein or partial peptide described below. DN
It can also be produced by culturing a transformant containing A. Further, it can be produced according to the peptide synthesis method described below or a method analogous thereto. When the protein, partial peptide or a salt thereof of the present invention is produced from human or warm-blooded animal tissues or cells, the human or warm-blooded animal tissues or cells are homogenized and then extracted with an acid or the like, and the extract is extracted. Using methods such as salting-out or solvent precipitation, which utilize solubility, dialysis, ultrafiltration, gel filtration, SDS-polyacrylamide gel electrophoresis, etc. A method that utilizes the difference in charge such as chromatography,
Methods that utilize specific affinity such as affinity chromatography, methods that use differences in hydrophobicity such as reversed-phase high-performance liquid chromatography, and methods that use differences in isoelectric points such as isoelectric focusing Purification and isolation can be performed by combining them. For the synthesis of the protein, partial peptide or salt thereof, or amide thereof of the present invention, a commercially available resin for protein synthesis can be usually used. Examples of such a resin include chloromethyl resin, hydroxymethyl resin, benzhydrylamine resin, aminomethyl resin, 4-benzyloxybenzyl alcohol resin, 4-methylbenzhydrylamine resin, PAM resin, and 4-hydroxymethylmethylphenyl. Acetamidomethyl resin, polyacrylamide resin,
4- (2 ', 4'-dimethoxyphenyl-hydroxymethyl)
Phenoxy resin, 4- (2 ′, 4′-dimethoxyphenyl-Fm
ocaminoethyl) phenoxy resin and the like. Using such a resin, an amino acid having an α-amino group and a side chain functional group appropriately protected is condensed on the resin in accordance with the sequence of the target protein or partial peptide according to various known condensation methods. At the end of the reaction, the protein or partial peptide is cleaved from the resin, and at the same time, various protecting groups are removed.In addition, an intramolecular disulfide bond formation reaction is performed in a highly diluted solution to obtain the target protein, partial peptide or their amide. I do.

With regard to the condensation of the protected amino acids described above,
Various activating reagents that can be used for protein synthesis can be used, and carbodiimides are particularly preferable. Carbodiimides include DCC, N, N'-diisopropylcarbodiimide, N-ethyl-N '-(3-dimethylaminoprolyl)
Carbodiimide and the like are used. For activation by these, the protected amino acid is directly added to the resin together with a racemization inhibitor (eg, HOBt, HOOBt), or the protected amino acid is previously activated as a symmetric acid anhydride or HOBt ester or HOOBt ester. After
It can be added to the resin. The solvent used for activating the protected amino acid or condensing with the resin can be appropriately selected from solvents known to be usable for the protein condensation reaction. For example, N, N-dimethylformamide,
Acid amides such as N, N-dimethylacetamide and N-methylpyrrolidone; halogenated hydrocarbons such as methylene chloride and chloroform; alcohols such as trifluoroethanol; sulfoxides such as dimethyl sulfoxide; DMF; pyridine; dioxane; Ethers, such as acetonitrile and propionitrile, and esters such as methyl acetate and ethyl acetate, or an appropriate mixture thereof. The reaction temperature is appropriately selected from the range that can be used for the protein bond formation reaction, and is usually about-
It is appropriately selected from the range of 20 ° C to 50 ° C. The activated amino acid derivative is usually used in a 1.5 to 4-fold excess. As a result of the test using the ninhydrin reaction, if the condensation is insufficient, sufficient condensation can be performed by repeating the condensation reaction without removing the protecting group.
When sufficient condensation cannot be obtained even by repeating the reaction,
Unreacted amino acids can be acetylated using acetic anhydride or acetylimidazole so as not to affect subsequent reactions.

Examples of the protecting group for the amino group of the starting material include Z, Boc, t-pentyloxycarbonyl, isobornyloxycarbonyl, 4-methoxybenzyloxycarbonyl, Cl-Z, Br-Z, adamantyloxycarbonyl, Trifluoroacetyl, phthaloyl, formyl, 2
-Nitrophenylsulfenyl, diphenylphosphinothioyl, Fmoc and the like are used. The carboxyl group is
For example, alkyl esterification (eg, methyl, ethyl,
Linear, branched or cyclic alkyl esterification of propyl, butyl, t-butyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, 2-adamantyl, etc., aralkyl esterification (for example, benzyl ester, 4-nitrobenzyl) Ester, 4-methoxybenzyl ester, 4-chlorobenzyl ester, benzhydryl esterification), phenacyl esterification, benzyloxycarbonyl hydrazide, t-butoxycarbonyl hydrazide, trityl hydrazide and the like. The hydroxyl group of serine can be protected, for example, by esterification or etherification. As a group suitable for this esterification, for example, a lower alkanoyl group such as an acetyl group, an aroyl group such as a benzoyl group, a group derived from carbonic acid such as a benzyloxycarbonyl group and an ethoxycarbonyl group, and the like are used. Examples of a group suitable for etherification include a benzyl group, a tetrahydropyranyl group, and a t-butyl group. As the protecting group for the phenolic hydroxyl group of tyrosine, for example, Bzl, Cl2-Bzl, 2-nitrobenzyl, Br-Z, t-butyl and the like are used. The protecting groups for imidazole of histidine include Tos, 4-methoxy-2,
3,6-Trimethylbenzenesulfonyl, DNP, benzyloxymethyl, Bum, Boc, Trt, Fmoc and the like are used.

Examples of the activated carboxyl group of the raw material include, for example, a corresponding acid anhydride, azide, active ester [alcohol (eg, pentachlorophenol, 2,4,5-trichlorophenol, 2,4- Dinitrophenol, cyanomethyl alcohol, para-nitrophenol, HONB, N-hydroxysuccinimide, N-hydroxyphthalimide, and esters with HOBt). As the activated amino group of the raw material, for example, a corresponding phosphoric amide is used. As a method for removing (eliminating) the protecting group, for example, catalytic reduction in a hydrogen stream in the presence of a catalyst such as Pd black or Pd-carbon,
Acid treatment with anhydrous hydrogen fluoride, methanesulfonic acid, trifluoromethanesulfonic acid, trifluoroacetic acid or a mixture thereof, diisopropylethylamine,
Base treatment with triethylamine, piperidine, piperazine, or the like, reduction with sodium in liquid ammonia, and the like are also used. The elimination reaction by the above acid treatment is generally performed at a temperature of about -20 ° C to 40 ° C. In the acid treatment, anisole, phenol, thioanisole, metacresol, paracresol, dimethylsulfide, 1,1,
The addition of a cation scavenger such as 4-butanedithiol or 1,2-ethanedithiol is effective. In addition, the 2,4-dinitrophenyl group used as the imidazole protecting group of histidine is removed by thiophenol treatment, and the formyl group used as the indole protecting group of tryptophan is 1,2-ethanedithiol, 1,4-butane described above. In addition to deprotection by acid treatment in the presence of dithiol or the like, it is also removed by alkali treatment with dilute sodium hydroxide solution, dilute ammonia or the like.

The protection and protection of functional groups that should not be involved in the reaction of the starting materials, the elimination of the protective groups, the activation of the functional groups involved in the reaction, and the like can be appropriately selected from known groups or known means. . As another method for obtaining the amide form of the protein of the present invention or its partial peptide, first, after protecting the α-carboxyl group of the carboxy terminal amino acid by amidation, a peptide chain (protein chain) on the amino group side is desired. After extending the length of the peptide chain, a protein was prepared by removing only the protecting group of the N-terminal α-amino group of the peptide chain, and a protein was obtained by removing only the protecting group of the C-terminal carboxyl group. The condensation is carried out in a mixed solvent as described above. Details of the condensation reaction are the same as described above. After purifying the protected protein obtained by the condensation, all the protecting groups are removed by the above-mentioned method, and a desired crude protein can be obtained. This crude protein is purified by various known purification means, and the main fraction is lyophilized to obtain an amide of the desired protein or its partial peptide. To obtain an ester of the protein of the present invention or its partial peptide, after condensing the α-carboxyl group of the carboxy terminal amino acid with a desired alcohol to form an amino acid ester, in the same manner as the amide of the protein or partial peptide, An ester of the desired protein or a partial peptide thereof can be obtained.

The partial peptide of the present invention or a salt thereof can be produced according to a peptide synthesis method known per se, or by cleaving the protein of the present invention with an appropriate peptidase. As a method for peptide synthesis,
For example, any of a solid phase synthesis method and a liquid phase synthesis method may be used. That is, the target peptide can be produced by condensing a partial peptide or amino acid capable of constituting the target peptide with the remaining portion, and removing the protective group when the product has a protective group. Known methods for condensation and elimination of protecting groups include, for example, the methods described in (1) to (4) below. M. Bodanszky and MA Ondetti, Peptide Synthesis, Interscience Publisher
s, New York (1966) Schroeder and Luebke, The Peptid
e), Academic Press, NewYork (1965) Nobuo Izumiya et al., Fundamentals and experiments of peptide synthesis, Maruzen Co., Ltd.
(1975) Haruaki Yajima and Shunpei Sakakibara, Laboratory for Biochemistry 1, Protein Chemistry IV, 205, (1977) Supervised by Haruaki Yajima, Development of Continuing Pharmaceuticals Volume 14 Peptide Synthesis, Hirokawa Shoten The target peptide can be purified and isolated by a combination of ordinary purification methods such as solvent extraction, distillation, column chromatography, liquid chromatography, and recrystallization. When the peptide obtained by the above method is a free form, it can be converted to an appropriate salt by a known method or a method analogous thereto, and conversely, when the peptide is obtained as a salt, a known method or analogous method To the free form or other salts.

The DNA encoding the protein of the present invention may be any DNA containing the above-described nucleotide sequence encoding the protein of the present invention. Genomic DNA, genomic DNA library,
Any of the above-described cell / tissue-derived cDNA, the above-described cell / tissue-derived cDNA library, and synthetic DNA may be used. The vector used for the library may be any of bacteriophage, plasmid, cosmid, phagemid and the like. In addition, from the cells and tissues described above,
Reverse Transcriptase Polymerase Chain React directly using prepared total RNA or mRNA fraction
It can also be amplified by ion (hereinafter abbreviated as RT-PCR method). As the DNA encoding the protein having the amino acid sequence represented by SEQ ID NO: 1 of the present invention, specifically, for example, DNA having the base sequence represented by SEQ ID NO: 2 or the base sequence represented by SEQ ID NO: 2 Any DNA may be used as long as it contains a base sequence that hybridizes under highly stringent conditions. D capable of hybridizing with the base sequence represented by SEQ ID NO: 2 under high stringency conditions
As the NA, for example, a nucleotide sequence having about 80% or more, preferably about 85% or more, more preferably about 90% or more, and most preferably about 95% or more homology with the nucleotide sequence represented by SEQ ID NO: 2. And the like.

Hybridization is carried out by a method known per se or a method analogous thereto, for example, molecular
Cloning (Molecular Cloning) 2nd (J. Sambrook
et al., Cold Spring Harbor Lab. Press, 1989). When a commercially available cDNA library or mRNA library or kit is used, the method can be performed according to the method described in the instruction manual attached thereto. More preferably, it can be performed under high stringent conditions. High stringency conditions include, for example, a sodium concentration of about 19 to 40 mM, preferably about 19 to 40 mM.
At 20 mM, the temperature is about 50-70 ° C., preferably about 60 ° C.
The condition of ~ 65 ° C is shown. In particular, when the sodium concentration is about 19
Most preferably, the temperature is about 65 ° C. in mM. Specific examples of the DNA encoding the protein containing the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 2,
A DNA containing the DNA having the nucleotide sequence represented by SEQ ID NO: 3 or SEQ ID NO: 4 or the like (preferably, a DNA containing the DNA having the nucleotide sequence represented by SEQ ID NO: 2) is used.

DNA encoding the partial peptide of the present invention
May be any as long as it contains a base sequence encoding the above-described partial peptide of the present invention. In addition, any of genomic DNA, genomic DNA library, cDNA derived from the above-mentioned cells / tissues, cDNA library derived from the aforementioned cells / tissues, and synthetic DNA may be used. The vector used for the library may be any of bacteriophage, plasmid, cosmid, phagemid and the like. Alternatively, it can be directly amplified by RT-PCR using a total RNA or mRNA fraction prepared from the cells and tissues described above.

[0023]

BEST MODE FOR CARRYING OUT THE INVENTION The means for cloning DNA encoding the protein of the present invention or a partial peptide thereof (hereinafter sometimes abbreviated as the protein of the present invention) includes (1) encoding the protein of the present invention. Using a synthetic DNA primer having a partial base sequence of DNA,
The target DNA is amplified from the DNA library or the like by the PCR method, or (2) a DNA incorporated into an appropriate vector, a DNA fragment or a synthetic DNA encoding a part or the whole region of the protein of the present invention.
And screening by hybridization with a labeled product (probe). Hybridization methods are described, for example, in Molecular Cloning 2nd (J. Sambrook et al.).
al., Cold Spring Harbor Lab. Press, 1989). When a commercially available library or kit is used, it can be performed according to the method described in the attached instruction manual. The DNA encoding the partial peptide of the present invention can also be produced according to a known oligonucleotide synthesis method. Conversion (deletion / addition / substitution) of the base sequence of DNA can be performed by a known kit, for example, MutanTM-G (Takara Shuzo) or MutanTM-K (Takara Shuzo) using the Gapped duplex method or the like. Kunkel
The method can be carried out according to a method known per se such as a method or a method analogous thereto. The cloned DNA encoding the protein of the present invention can be used as it is, or digested with a restriction enzyme, or added with a linker, if desired. The DNA has an ATG as a translation initiation codon at its 5 'end,
TAA and T as translation termination codons are located at the 3 'end.
It may have GA or TAG. These translation initiation codon and translation termination codon can also be added using a suitable synthetic DNA adapter. An expression vector for a DNA encoding the protein of the present invention includes, for example,
(A) A target DNA fragment is cut out from the DNA encoding the protein of the present invention, and (b) the DNA fragment is ligated downstream of a promoter in an appropriate expression vector.

As a vector, a plasmid derived from Escherichia coli (eg, pBR322, pBR325, pUC12, pUC12) is used.
UC13), a plasmid derived from Bacillus subtilis (eg, pUB11)
0, pTP5, pC194), yeast-derived plasmids (eg, pSH19, pSH15), bacteriophages such as λ phage, animal viruses such as retrovirus, vaccinia virus, baculovirus, etc.
A1-11, pXT1, pRc / CMV, pRc / RS
V, pcDNAI / Neo, etc. are used. The promoter used in the present invention may be any promoter as long as it is appropriate for the host used for gene expression. For example, when animal cells are used as hosts, the SRα promoter, SV40 promoter, L
TR promoter, CMV (cytomegalovirus) promoter, HSV-TK promoter and the like can be mentioned. Among them, it is preferable to use the CMV promoter, SRα promoter and the like. When the host is a bacterium belonging to the genus Escherichia, a trp promoter, a lac promoter, a recA promoter, a λPL promoter,
When the host is a bacterium of the genus Bacillus, the SPO1 promoter, the S7 promoter,
When the host is yeast, such as a PO2 promoter and a penP promoter, a PHO5 promoter, a PGK promoter, a GAP promoter, an ADH promoter, an AOX1 promoter and the like are preferable. When the host is an insect cell, the polyhedrin promoter, P10
Promoters and the like are preferred.

[0025] In addition to the above, an expression vector optionally containing an enhancer, a splicing signal, a poly-A addition signal, a selection marker, an SV40 replication origin (hereinafter sometimes abbreviated as SV40 ori) and the like may be used. Can be used. As a selection marker, for example, dihydrofolate reductase (hereinafter, dhfr)
Gene (sometimes abbreviated as “methotrexate (M
TX) resistance], an ampicillin resistance gene (hereinafter referred to as Amp
r), neomycin resistance gene (hereinafter sometimes abbreviated as Neo, G418 resistance)
And the like. In particular, when the dhfr gene is used as a selection marker by using dhfr gene-deficient Chinese hamster cells CHO, cells transformed with the target gene can be selected using a thymidine-free medium. If necessary, a signal sequence suitable for the host is added to the N-terminal side of the protein. When the host is Escherichia, an alkaline phosphatase signal sequence, an OmpA signal sequence, and the like are used. When the host is Bacillus, an α-amylase signal sequence, a subtilisin signal sequence, and the like are used. When the host is an animal cell, for example, an insulin signal sequence, an α-interferon signal sequence, an antibody molecule / signal sequence, etc. can be used. A transformant can be produced by introducing a vector containing the DNA encoding the protein of the present invention thus constructed into a cell.

As the host, for example, Escherichia, Bacillus, yeast, insect cells, insects, animal cells and the like are used. Specific examples of Escherichia bacteria include
Escherichia coli K12 DH
1 [Processings of the National Academy of Sciences of the USA (Proc. Natl. Acad. Sci. USA), 60, 160]
(1968)], JM103 [Nukuilec Acids
Research, (Nucleic Acids Research), 9, 309
(1981)], JA221 [Journal of Molecular Biology (J. Mol. Biol.)], 120
Volume, 517 (1978)], HB101 [Journal of Molecular Biology (J. Mol. Biol.),
41, 459 (1969)], C600 [Genetics, 39, 440 (1954)] and the like. Examples of Bacillus genus bacteria include Bacillus subtilis MI114 [Gene, 24, 255 (1983)], 207-21.
[Journal of Biochemistry
Biochemistry), 95, 87 (1984)]. As yeast, for example, Saccharomyces
Saccharomyces cerevisiae AH22, A
H22R-, NA87-11A, DKD-5D, 20B
-12, Schizosacchamyces pombe
romyces pombe) NCYC1913, NCYC203
6. Pichia pastoris KM71
Are used.

As insect cells, for example, virus is A
In the case of cNPV, a cell line derived from night larvae of moth (Spodop
tera frugiperda cell (Sf cell), Trichoplusia ni
MG1 cells from the midgut, H from the eggs of Trichoplusia ni
igh FiveTM cells, cells derived from Mamestrabrassicae, cells derived from Estigmena acrea, and the like are used. When the virus is BmNPV, a silkworm-derived cell line (Bombyx m
ori N; BmN cells). Examples of the Sf cell include Sf9 cell (ATCC CRL1711), Sf2
One cell (Vaughn, JL et al., In Viv
o), Vol. 13, 213-217 (1977)). As insects, for example, silkworm larvae are used [Maeda et al., Nature, Vol.
92 (1985)]. Examples of animal cells include monkey cells COS-7, Vero cells, Chinese hamster cells CHO (hereinafter abbreviated as CHO cells), and dhfr gene-deficient Chinese hamster cells CHO (hereinafter CH).
O (dhfr ^-) cell), mouse L cells, mouse AtT-20, mouse myeloma cells, mouse myeloma cell, rat GH
3 cells, human FL cells, 293 cells, C127 cells, B
ALB / 3T3 cells, Sp-2 cells and the like are used.
Among these, CHO cells, CHO (dhfr ⁻ ) cells, 293 cells and the like are preferable.

For transforming Escherichia sp., For example, Processing of the National Academy of Sciences of the USA (Proc. Natl. Acad. Sci. USA), Vol. 69 , 21
10 (1972) and Gene, 17, 107 (1)
982). In order to transform Bacillus sp., For example, Molecular and General Genetics (Mole
cular & General Genetics), 168, 111 (19
79) and the like.
To transform yeast, see, for example, Methods in Enzymology, 194.
Vol. 182-187 (1991).
Proc. Natl. Acad. Sc of the National Academy of Sciences of the USA
USA), Vol. 75, 1929 (1978). Transformation of insect cells or insects is performed according to the method described in, for example, Bio / Technology, 6, 47-55 (1988). To transform animal cells,
For example, Cell Engineering Separate Volume 8, New Cell Engineering Experiment Protocol. 263-267 (1995) (published by Shujunsha) and Virology, Vol. 52, 456 (1973). As a method for introducing an expression vector into cells, for example, the calcium phosphate method [Graham, FL and van der Eb, AJ Virology 52, 456-467 (1973)], electroporation [Nuemann, E. et al. EMBO J.
1,841-845 (1982)]. Thus, a transformant transformed with the expression vector containing the DNA encoding the protein of the present invention is obtained.

As a method for stably expressing the protein of the present invention using animal cells, there is a method of selecting cells in which the expression vector introduced into the above animal cells has been integrated into the chromosome by clone selection. . Specifically, a transformant is selected using the above-mentioned selection marker as an index. Furthermore, a stable animal cell line having a high expression ability of the protein of the present invention can be obtained by repeatedly performing clonal selection on the animal cells obtained using the selection marker. When the dhfr gene was used as a selection marker, cultivation was carried out while gradually increasing the MTX concentration, and the dhfr gene was selected by selecting resistant strains.
DN encoding the protein of the present invention together with the gene
A can be amplified intracellularly to obtain a more highly expressed animal cell line. The above transformant is cultured under conditions in which a DNA encoding the protein of the present invention can be expressed,
By producing and accumulating the protein of the present invention, the protein of the present invention or a salt thereof can be produced. When culturing a transformant whose host is a genus Escherichia or Bacillus, a liquid medium is suitable as a medium used for the cultivation. Nitrogen sources, inorganic substances, etc. are contained. As a carbon source, for example, glucose, dextrin, soluble starch, sucrose, etc., as a nitrogen source, for example, ammonium salts, nitrates, corn steep liquor, peptone, casein, meat extract, soybean meal, potato extract and the like Alternatively, examples of the organic substance and the inorganic substance include calcium chloride, sodium dihydrogen phosphate, and magnesium chloride. In addition, yeast extract, vitamins, growth promoting factors and the like may be added. Medium p
H is preferably about 5 to 8.

As a medium for culturing the genus Escherichia, for example, an M9 medium containing glucose and casamino acid [Miller, Journal of Experiments in Molecular Genetics (Journa)
l of Experiments in Molecular Genetics), 431-
433, Cold Spring Harbor Laboratory, New York 1
972] is preferred. If necessary, an agent such as 3β-indolylacrylic acid can be added in order to make the promoter work efficiently. When the host is a bacterium belonging to the genus Escherichia, the cultivation is usually performed at about 15 to 43 ° C. for about 3 to 24 hours, and if necessary, aeration and stirring may be added. When the host is a bacterium belonging to the genus Bacillus, culturing is usually performed in about 3
The reaction is carried out at 0 to 40 ° C. for about 6 to 24 hours, and if necessary, ventilation or stirring may be added. When culturing a transformant in which the host is yeast, as a medium, for example, Burkholder's minimal medium [Bostian, KL et al., Processings of the National Academy.
Of Sciences of the USA (Pro
Natl. Acad. Sci. USA), 77, 4505 (1
980)] or an SD medium containing 0.5% casamino acid [Bi
tter, GA et al., The Prossings of the National Academy of Sciences of the
USA (Proc. Natl. Acad. Sci. USA), 8
1, 5330 (1984)]. Medium p
H is preferably adjusted to about 5 to 8. Culture is usually about 2
Perform at 0 ° C. to 35 ° C. for about 24 to 72 hours, adding aeration and stirring as needed.

When culturing an insect cell or a transformant whose host is an insect, for example, Grace's Inse
ct Medium (Grace, TCC, Nature, 195,
788 (1962)) to which an additive such as 10% bovine serum immobilized is appropriately added. The pH of the medium is about 6.
It is preferable to adjust to 2 to 6.4. Culture is usually about 27
C. for about 3-5 days, adding aeration and agitation as needed. When culturing a transformant whose host is an animal cell,
As the medium, for example, a MEM medium containing about 5 to 20% fetal bovine serum [Science, 122, 5
01 (1952)], DMEM medium [Virology (Viro
logy), 8, 396 (1959)], RPMI 164
0 medium [Journal of the American Medical Association (J. Amer. Med. Ass.) 199
Vol. 519 (1967)], 199 medium [Proc. Of the Society for the Biological Medicine (Proc. Soc. Biol. Med.), Vol. 73,
1 (1950)]. Preferably, the pH is between about 6-8. Culture is usually performed at about 30 ° C to 40 ° C for about 15 minutes.
Run for ~ 72 hours, adding aeration and agitation as needed.
In particular, when CHO (dhfr-) cells and the dhfr gene are used as selection markers, it is preferable to use a DMEM medium containing dialyzed fetal bovine serum containing almost no thymidine. As described above, the protein of the present invention can be produced in a transformant.

The protein of the present invention can be separated and purified from the above culture by, for example, the following method. When extracting the protein of the present invention from the cultured cells or cells, after the culture, the cells or cells are collected by a known method, suspended in an appropriate buffer, and subjected to ultrasound,
After the cells or cells are destroyed by lysozyme and / or freeze-thawing, a method of obtaining a crude extract of the protein of the present invention by centrifugation or filtration may be appropriately used. The buffer may contain a protein denaturant such as urea or guanidine hydrochloride, or a surfactant such as Triton X-100TM. When the protein is secreted into the culture solution, after completion of the culture, the supernatant is separated from the cells or cells by a method known per se, and the supernatant is collected. The protein of the present invention contained in the thus obtained culture supernatant or extract can be purified by appropriately combining known separation and purification methods. These known separation and purification methods include methods utilizing solubility such as salting out and solvent precipitation, dialysis, ultrafiltration, gel filtration, and SDS-polyacrylamide gel electrophoresis, and the like. Method using difference in charge, method using charge difference such as ion exchange chromatography, method using specific affinity such as affinity chromatography, and use of difference in hydrophobicity such as reverse phase high performance liquid chromatography A method utilizing a difference between isoelectric points, such as an isoelectric focusing method, is used. When the thus obtained protein of the present invention is obtained in a free form, it can be converted to a salt by a method known per se or a method analogous thereto, and conversely, when the protein of the present invention is obtained in a salt, It can be converted to a free form or another salt by a method analogous thereto. The protein of the present invention produced by the recombinant can be arbitrarily modified or the polypeptide can be partially removed by applying an appropriate protein modifying enzyme before or after purification. Examples of protein modifying enzymes include trypsin, chymotrypsin, arginyl endopeptidase,
Protein kinases, glycosidases and the like are used. The presence or activity of the protein of the present invention thus produced can be detected or measured by an enzyme immunoassay using a specific antibody or the like.

An antibody against the protein of the present invention, its partial peptide or a salt thereof (hereinafter, abbreviated as the protein of the present invention) is an antibody capable of recognizing the protein of the present invention, its partial peptide or a salt thereof. Any of a polyclonal antibody and a monoclonal antibody may be used. Furthermore, antibodies against the protein or the like of the present invention may have an activity of neutralizing the activity of the protein or the like of the present invention. An antibody against the protein or the like of the present invention can be produced by using the protein or the like of the present invention as an antigen according to a method for producing an antibody or antiserum known per se. [Preparation of Monoclonal Antibody] (a) Preparation of Monoclonal Antibody-Producing Cell The protein or the like of the present invention is administered to a warm-blooded animal at a site capable of producing an antibody by administration, itself or together with a carrier and a diluent. Complete Freund's adjuvant or incomplete Freund's adjuvant may be administered in order to enhance the antibody-producing ability upon administration. Administration is usually performed once every 2 to 6 weeks, for a total of about 2 to 10 times. Examples of the warm-blooded animal used include monkeys, rabbits, dogs, guinea pigs, mice, rats, sheep, goats, and chickens, and mice and rats are preferably used. When preparing monoclonal antibody-producing cells, a warm-blooded animal immunized with an antigen, for example, an individual having an antibody titer is selected from a mouse, and the spleen or lymph node is collected 2 to 5 days after the final immunization. By fusing the contained antibody-producing cells with myeloma cells, a monoclonal antibody-producing hybridoma can be prepared. The antibody titer in the antiserum can be measured, for example, by reacting a labeled protein or the like described below with the antiserum, and then measuring the activity of a labeling agent bound to the antibody. The fusion operation can be performed according to a known method, for example, the method of Kohler and Milstein [Nature, 256, 495 (1975)]. As a fusion promoter, for example,
Polyethylene glycol (PEG), Sendai virus and the like can be mentioned, but PEG is preferably used.
Examples of myeloma cells include NS-1, P3U1, S
Examples include myeloma cells of warm-blooded animals such as P2 / 0 and AP-1, and P3U1 is preferably used. The preferred ratio between the number of antibody-producing cells (spleen cells) and the number of myeloma cells used is about 1: 1 to 20: 1, and PEG (preferably PEG1000 to PEG6000) is about 10%.
Cell fusion can be performed efficiently by adding at a concentration of about 80% and incubating at about 20 to 40 ° C, preferably about 30 to 37 ° C for 1 to 10 minutes.

Various methods can be used for screening a monoclonal antibody-producing hybridoma. For example, a hybridoma culture supernatant is added to a solid phase (eg, a microplate) on which an antigen such as a protein is directly or adsorbed together with a carrier, and Then, an anti-immunoglobulin antibody (anti-mouse immunoglobulin antibody is used if the cell used for cell fusion is a mouse) or protein A labeled with a radioactive substance or enzyme is added, and the monoclonal antibody bound to the solid phase is detected. A method of adding a hybridoma culture supernatant to a solid phase to which an anti-immunoglobulin antibody or protein A has been adsorbed, adding a protein or the like labeled with a radioactive substance or an enzyme, and detecting a monoclonal antibody bound to the solid phase. Is mentioned. The selection of the monoclonal antibody can be carried out according to a method known per se or a method analogous thereto. Usually, it can be carried out in a medium for animal cells supplemented with HAT (hypoxanthine, aminopterin, thymidine). As a selection and breeding medium, any medium can be used as long as a hybridoma can grow. For example, RPMI 1640 medium containing 1 to 20%, preferably 10 to 20% fetal bovine serum, GIT medium (Wako Pure Chemical Industries, Ltd.) containing 1 to 10% fetal bovine serum, or serum-free medium for hybridoma culture (SFM-101, Nissui Pharmaceutical Co., Ltd.) or the like can be used. The culturing temperature is usually 20 to 40 ° C, preferably about 37 ° C. The culturing time is usually 5 days to 3 weeks, preferably 1 week to 2 weeks. The culture can be usually performed under 5% carbon dioxide. The antibody titer of the hybridoma culture supernatant can be measured in the same manner as the measurement of the antibody titer in the antiserum described above.

(B) Purification of Monoclonal Antibody Separation and purification of monoclonal antibodies can be carried out in the same manner as in the separation and purification of normal polyclonal antibodies. Electrophoresis, adsorption / desorption using an ion exchanger (eg, DEAE), ultracentrifugation, gel filtration, antigen-bound solid phase or active antibody such as protein A or protein G to collect only antibodies and dissociate the bond Specific purification method for obtaining antibodies).

[Preparation of Polyclonal Antibody] The polyclonal antibody of the present invention can be produced by a method known per se or a method analogous thereto. For example, a complex of an immunizing antigen (an antigen such as a protein) and a carrier protein is formed, and a warm-blooded animal is immunized in the same manner as in the above-described method for producing a monoclonal antibody. It can be produced by collecting a substance and separating and purifying the antibody. With respect to the complex of the immunizing antigen and the carrier protein used for immunizing a warm-blooded animal, the type of the carrier protein and the mixing ratio of the carrier and the hapten are such that the antibody is efficiently cross-linked to the hapten immunized by crosslinking the carrier. If possible, any material may be cross-linked at any ratio. For example, bovine serum albumin, bovine thyroglobulin, hemocyanin, etc. may be used in a weight ratio of about 0.1 to 2 with respect to 1 hapten.
A method of coupling at a ratio of 0, preferably about 1 to 5 is used. Various coupling agents can be used for coupling the hapten and the carrier. For example, glutaraldehyde, carbodiimide, a maleimide active ester, an active ester reagent containing a thiol group or a dithiopyridyl group, or the like is used. Condensation product is itself or a carrier at a site where antibody production is possible for a warm-blooded animal,
Administered with diluent. Complete Freund's adjuvant or incomplete Freund's adjuvant may be administered in order to enhance the antibody-producing ability upon administration. The administration is usually performed once every about 2 to 6 weeks, about 3 to 10 times in total. The polyclonal antibody can be collected from the blood, ascites, etc., preferably from the blood of a warm-blooded animal immunized by the above method. The polyclonal antibody titer in the antiserum can be measured in the same manner as the above-described antibody titer of the hybridoma culture supernatant. Separation and purification of polyclonal antibodies
The immunoglobulin separation and purification can be carried out in the same manner as the above-mentioned monoclonal antibody separation and purification.

DNA or mRN containing a base sequence encoding the protein of the present invention or a partial peptide thereof
A (hereinafter abbreviated as DNA or mRNA of the present invention)
The antisense DNA having a nucleotide sequence complementary to or substantially complementary to
Any antisense DNA may be used as long as it has a nucleotide sequence complementary or substantially complementary to RNA and has an action capable of suppressing the expression of the protein of the present invention or a derivative thereof. Good. D of the present invention
The nucleotide sequence substantially complementary to NA or mRNA is
For example, about 80% or more, preferably about 85% or more, more preferably about 80% or more of the entire base sequence or partial base sequence of the base sequence complementary to the DNA or mRNA of the present invention (ie, the complementary strand of the DNA of the present invention). A nucleotide sequence having a homology of 90% or more, most preferably about 95% or more, may be mentioned. In particular, of the entire base sequence of the complementary strand of the DNA or mRNA of the present invention, the complementary sequence of the base sequence of the portion encoding the N-terminal site of the protein or the like of the present invention (for example, the base sequence near the start codon) is about 80%. %, Preferably about 85% or more, more preferably about 90% or more, most preferably about 95% or more homology.
A is preferred. These antisense DNAs can be produced using a known DNA synthesizer or the like.

The protein of the present invention has homology in its amino acid sequence to an enzyme involved in sugar metabolism such as xylulokinase. Therefore, the protein of the present invention, its partial peptide, or a salt thereof may have an enzymatic activity involved in sugar metabolism such as xylulokinase. Xylulokinase has an activity of catalyzing a reaction from xylulose to xylulose-5-phosphate, and xylulose-5-phosphate produced by the catalyzed reaction passes through the Emdenmeyer-Hoff pathway and the pentose phosphate pathway. Metabolized. Therefore, the glucose metabolism pathway can be activated by increasing the amount of an enzyme such as (1) xylulokinase or (2) enhancing the activity of an enzyme such as xylulokinase in a living body, thereby increasing blood glucose. It is believed that the value can be reduced. On the other hand, by reducing the amount of an enzyme such as (3) xylulokinase or (2) inhibiting the activity of an enzyme such as xylulokinase, the sugar metabolic pathway can be suppressed,
Thereby, the blood sugar level can be increased. Hereinafter, the protein of the present invention, its partial peptide or a salt thereof (hereinafter abbreviated as the protein of the present invention), a DNA encoding the protein or the like of the present invention (hereinafter abbreviated as the DNA of the present invention), The use of an antibody against the protein or the like of the present invention (hereinafter abbreviated as the antibody of the present invention) and antisense DNA will be described.

(1) Medicine The protein of the present invention or the DNA of the present invention is, for example, deficient in a gene encoding an enzyme involved in sugar metabolism such as xylulokinase, a disease caused by the deficiency, or a decrease in enzyme activity thereof. It is useful as a medicament such as an agent for treating or preventing a disease caused by the disease (eg, diabetes, etc.).
For example, when there is a patient in which the enzyme involved in sugar metabolism such as xylulokinase is reduced or deficient in a living body and the enzyme activity in cells is not sufficiently or normally exerted, (a) By administering the DNA of the present invention to the patient and expressing the protein or the like of the present invention in vivo, (b) inserting the DNA of the present invention into cells and expressing the protein or the like of the present invention, By transplanting the cells into a patient, (c) by administering the protein or the like of the present invention to the patient, the role of the protein or the like of the present invention in the patient can be sufficiently or normally exerted. When the protein or the like of the present invention is used as the above medicine, for example, tablets, capsules, elixirs, microcapsules and the like, if necessary, which are sugar-coated, or water or other pharmaceuticals It can be used parenterally in the form of injections, such as sterile solutions or suspensions in liquids that are acceptable. For example, the protein or the like of the present invention is mixed with physiologically acceptable carriers, flavors, excipients, vehicles, preservatives, stabilizers, binders, and the like in the unit dosage form generally required for the practice of the formulation. Can be manufactured. The amount of the active ingredient in these preparations is such that an appropriate dose in the specified range can be obtained. When the DNA of the present invention is used, the DNA can be used alone or after being inserted into an appropriate vector such as a retrovirus vector, an adenovirus vector, an adenovirus associated virus vector, and the like, followed by a conventional method. The DNA of the present invention can be administered as it is or in the form of a formulation together with a physiologically acceptable carrier such as an adjuvant for promoting uptake, and then administered with a gene gun or a catheter such as a hydrogel catheter. When the protein or the like of the present invention is used as the above-mentioned therapeutic / prophylactic agent, at least 90%, preferably 95%
Or more, preferably 98% or more, and more preferably 99% or more.
% Or more is preferably used.

Examples of additives that can be mixed with tablets, capsules and the like include binders such as gelatin, corn starch, tragacanth and gum arabic, excipients such as crystalline cellulose, corn starch, gelatin, alginic acid. For example, a leavening agent such as sucrose, a lubricant such as magnesium stearate, a sweetening agent such as sucrose, lactose or saccharin, a flavoring agent such as peppermint, reddish oil or cherry and the like are used. When the preparation unit form is a capsule, a liquid carrier such as oil and fat can be further contained in the above-mentioned type of material. Sterile compositions for injection can be formulated according to normal pharmaceutical practice such as dissolving or suspending the active substance in vehicles such as water for injection, and naturally occurring vegetable oils such as sesame oil, coconut oil and the like. . Examples of aqueous liquids for injection include physiological saline, isotonic solutions containing glucose and other adjuvants (eg, D-sorbitol, D-mannitol,
For example, alcohols (eg, ethanol), polyalcohols (eg, propylene glycol, polyethylene glycol), nonionic surfactants (eg, polysorbate 80TM, HCO-). 50) and the like. As the oily liquid, for example, sesame oil, soybean oil and the like are used,
It may be used in combination with solubilizers such as benzyl benzoate and benzyl alcohol. In addition, the above-mentioned therapeutic / prophylactic agents include, for example, buffers (eg, phosphate buffer, sodium acetate buffer), soothing agents (eg, benzalkonium chloride, procaine hydrochloride, etc.), stabilizers (eg, , Human serum albumin, polyethylene glycol, etc.), preservatives (eg, benzyl alcohol, phenol, etc.),
You may mix | blend with an antioxidant etc. The prepared pharmaceutical composition such as an injection solution is usually filled in a suitable ampoule. The vector into which the DNA of the present invention has been inserted is also formulated in the same manner as described above, and is usually used parenterally.

The preparations thus obtained are safe and have low toxicity, and are therefore useful, for example, in mammals (eg, human, rat, mouse, guinea pig, rabbit, sheep, pig, cow, horse, cat, dog, monkey). Etc.). The dose of the protein or the like of the present invention may vary depending on the target disease, the subject of administration, the administration route, and the like. )), About 0.1 mg to 10 mg of the protein per day
0 mg, preferably about 1.0 to 50 mg, more preferably about 1.0 to 20 mg. When administered parenterally, the single dose of the protein or the like varies depending on the administration subject, target disease, and the like. For example, the protein or the like of the present invention is injected into an adult (body weight) for the purpose of treating diabetes. 60
kg), about 0.01 to 30 mg, preferably about 0.1 to 30 mg of the protein or the like per day.
It is convenient to administer about 20 mg, more preferably about 0.1 to 10 mg, by injecting into the affected area. In the case of other animals, the dose can be administered in terms of 60 kg. The DNA of the present invention can be used in the same manner as described above.

(2) Genetic Diagnostic Agent The DNA of the present invention can be used as a probe in mammals (eg, human, rat, mouse, guinea pig, rabbit, sheep, pig, cow, horse, cat, dog, monkey). And the like, the DNA or mRNA encoding the protein or the like of the present invention (hereinafter abbreviated as DNA or mRNA of the present invention) can be detected.
A damage, deletion, mutation or reduced expression of A
It is useful as a gene diagnostic agent for detecting an increase or excessive expression of A or mRNA. The DN of the present invention
The above-mentioned genetic diagnosis using A can be performed, for example, by Northern hybridization or PCR-SSCP method (Genomics, Vol. 5, 874-879) known per se.
(1989), Procesings of the National Academy of Sciences of USA (Proc. Natl. Acad. Sci. USA), Vol. 86, 2
766-2770 (1989)). For example, when a decrease in the expression of the mRNA is detected by Northern hybridization, it can be diagnosed that the disease is, for example, a disease such as diabetes, or that the disease is likely to be caused in the future. On the other hand, when excessive expression of the mRNA is detected by Northern hybridization, it can be diagnosed as a disease such as hypoglycemia or a high possibility of suffering from the disease in the future. When a DNA mutation is detected by the PCR-SSCP method, for example, it can be diagnosed as a disease such as hypoglycemia, diabetes, or the likelihood of future disease.

(3) Quantification of the protein of the present invention, its partial peptide or a salt thereof The antibody against the protein of the present invention, its partial peptide or a salt thereof can be used as an antibody against the protein of the present invention, its partial peptide or a salt thereof (hereinafter, referred to as the following). , Abbreviated as the protein of the present invention) can be used for the quantification of the protein of the present invention in a test solution, particularly for quantification by sandwich immunoassay. That is, the present invention provides (i) a method of competitively reacting an antibody against the protein or the like of the present invention with a test solution and a labeled protein or the like of the present invention, and binding the labeled present invention to the antibody. A method for quantifying a protein or the like of the present invention in a test solution, which comprises measuring the proportion of the protein or the like of the present invention; and (ii) an antibody of the present invention insolubilized on a test solution and a carrier and a labeled reagent. And measuring the activity of the labeling agent on the insolubilized carrier after the simultaneous or continuous reaction with the antibody of the present invention. In the quantification method (ii), one antibody may be an antibody that recognizes the N-terminal of the protein of the present invention, and the other antibody may be an antibody that reacts with the C-terminal of the protein of the present invention. desirable.

In addition to quantification of the protein of the present invention using a monoclonal antibody against the protein of the present invention (hereinafter sometimes referred to as anti-protein antibody), detection by tissue staining or the like can be performed. .
For these purposes, the antibody molecule itself may be used,
In addition, F (ab ′) ₂ , Fab ′, or Fa
The fraction b may be used. The method for quantifying the protein or the like of the present invention using the antibody of the present invention is not particularly limited.
If the measurement method is to detect the amount of the antibody, antigen or antibody-antigen complex corresponding to the above by chemical or physical means and calculate this from a standard curve prepared using a standard solution containing a known amount of antigen, Any of the measurement methods may be used. For example, nephelometry, competition method, immunometric method and sandwich method are preferably used, but in terms of sensitivity and specificity, it is particularly preferable to use the sandwich method described later. As a labeling agent used in a measurement method using a labeling substance, for example, a radioisotope, an enzyme, a fluorescent substance, a luminescent substance and the like are used. As the radioisotope, for example, ¹²⁵ I, ¹³¹ I, ³ H or ¹⁴ C is used. As the above enzyme, a stable enzyme having a large specific activity is preferable. For example, β-galactosidase, β-glucosidase, alkaline phosphatase, peroxidase, malate dehydrogenase and the like are used. As the fluorescent substance, for example, fluorescamine, fluorescein isothiocyanate and the like are used. As the luminescent substance, for example, luminol, a luminol derivative, luciferin, lucigenin and the like are used. Further, a biotin-avidin system can be used for binding the antibody or antigen to the labeling agent.

For the insolubilization of the antigen or antibody, physical adsorption may be used, or a method using a chemical bond usually used for insolubilizing and immobilizing proteins or enzymes may be used. As the carrier, for example, insoluble polysaccharides such as agarose, dextran, and cellulose, synthetic resins such as polystyrene, polyacrylamide, and silicon, and glass are used. In the sandwich method, the test solution is reacted with the insolubilized monoclonal antibody of the present invention (primary reaction), and further reacted with another labeled monoclonal antibody of the present invention (secondary reaction).
By measuring the activity of the labeling agent on the insolubilized carrier, the amount of the protein of the present invention in the test solution can be quantified. The primary and secondary reactions can be performed in reverse order,
It may be performed simultaneously or at a different time. The labeling agent and the method of insolubilization can be in accordance with those described above. In the immunoassay by the sandwich method, the antibody used for the solid phase antibody or the labeling antibody is not necessarily one kind, and a mixture of two or more kinds of antibodies is used for the purpose of improving measurement sensitivity and the like. You may. In the method for measuring the protein or the like of the present invention by the sandwich method of the present invention, as the monoclonal antibody used in the primary reaction and the secondary reaction, an antibody having a different binding site to the protein or the like of the present invention is preferably used.
That is, the antibody used in the primary reaction and the secondary reaction are preferably used, for example, when the antibody used in the secondary reaction recognizes the C-terminal of the protein or the like of the present invention. Is an antibody that recognizes other than the C-terminal, for example, the N-terminal.

The monoclonal antibody of the present invention can be used in a measurement system other than the sandwich method, for example, a competition method, an immunometric method, or a nephrometry. In the competition method, after the antigen in the test solution and the labeled antigen are allowed to react competitively with the antibody, the unreacted labeled antigen (F) and the labeled antigen (B) bound to the antibody are separated ( B
/ F separation), and the amount of antigen in the test solution is determined by measuring the amount of labeling of either B or F. In this reaction method, a soluble antibody is used as an antibody, and polyethylene glycol is used for B / F separation. In addition, a liquid phase method using a second antibody or the like to the antibody is used, and further, a solid phase is used as a first antibody. An immobilization method using an antibody or an immobilization method using a soluble antibody as the first antibody and using an immobilized antibody as the second antibody may be used. In the immunometric method, an antigen in a test solution and a solid-phased antigen are subjected to a competitive reaction with a fixed amount of a labeled antibody, and then the solid phase and the liquid phase are separated. And an excess amount of labeled antibody, and then immobilized antigen is added to bind unreacted labeled antibody to the solid phase.The solid phase and the liquid phase are separated, and labeling of either phase is performed. The amount is measured and the amount of antigen in the test solution is determined. In nephelometry, the amount of insoluble precipitates generated as a result of an antigen-antibody reaction in a gel or in a solution is measured. Even when the amount of antigen in the test solution is small and only a small amount of sediment is obtained, laser nephrometry utilizing laser scattering is preferably used.

In applying these individual immunoassays to the quantification method of the present invention, no special conditions, operations, and the like need to be set. What is necessary is just to construct the measuring system of the protein etc. of the present invention by adding ordinary technical considerations of those skilled in the art to ordinary conditions and operation methods in each method. For details of these general technical means, it is possible to refer to reviews, books, and the like [for example, "Radio Immunoassay" edited by Hiro Irie (published in Kodansha, 1974), "Radio Immunoassay" edited by Hiro Irie. (Kodansha, published in 1979), “Enzyme Immunoassay” edited by Eiji Ishikawa et al. (Medical Publishing, published in 1978), “Enzyme Immunoassay” edited by Eiji Ishikawa et al. (2nd edition) (Medical Publishing, Showa 57) Ed. Ishikawa et al., “Enzyme Immunoassay” (Third Edition) (Medical Publishing, published in 1987), “Methods in Enzymology” Vol. 70 (Immunoche)
mical Techniques (Part A)), ibid.Vol. 73 (Immunochem
ical Techniques (Part B)), ibid.Vol. 74 (Immunochem
ical Techniques (Part C)), ibid.Vol. 84 (Immunochem
ical Techniques (Part D: Selected Immunoassays)),
Ibid.Vol. 92 (Immunochemical Techniques (Part E: Mono
clonal Antibodies and General Immunoassay Method
s)), ibid.Vol. 121 (Immunochemical Techniques (Part
I: Hybridoma Technology and Monoclonal Antibodie
s)) (see Academic Press). As described above, the protein and the like of the present invention can be quantified with high sensitivity by using the protein antibody of the present invention. Furthermore, by quantifying the concentration of the protein or the like of the present invention using the antibody of the present invention, various diseases involving the protein or the like of the present invention can be diagnosed. Specifically, when an increase in the concentration of the protein or the like of the present invention is detected, for example, it can be diagnosed that the possibility of a disease such as hypoglycemia is high. On the other hand, when a decrease in the concentration of the protein or the like of the present invention is detected, it can be diagnosed that the possibility of a disease such as diabetes is high. Thus, the antibodies of the present invention are useful as diagnostic agents for the above diseases. Further, the antibody of the present invention can be used for detecting the protein of the present invention or the like present in a subject such as a body fluid or a tissue. Further, it can be used to prepare an antibody column used for purifying the protein or the like of the present invention and to detect the protein or the like of the present invention in each fraction at the time of purification.

(4) Pharmaceuticals Containing Antibody of the Present Invention Among the antibodies of the present invention, the antibodies of the present invention bind to the protein of the present invention and neutralize the enzymatic activities involved in sugar metabolism such as xylulokinase of the protein of the present invention. An antibody that can inhibit the activity of the enzyme such as the protein of the present invention can be used as a medicament such as an agent for treating or preventing a disease such as hypoglycemia. The therapeutic / prophylactic agent for the above-mentioned diseases containing the antibody of the present invention, as it is as a liquid,
Or, as a pharmaceutical composition in an appropriate dosage form, a mammal (eg,
To humans, rats, rabbits, sheep, pigs, cows, cats, dogs, monkeys, etc.) orally or parenterally. The dosage varies depending on the administration target, target disease, symptoms, administration route, and the like.For example, when used for the treatment or prevention of diabetes in adults, sugars such as xylulokinase such as the protein of the present invention are used. A single dose of an antibody that neutralizes the activity of an enzyme involved in metabolism is usually used as a single dose.
About 01-20 mg / kg body weight, preferably 0.1-1
0 mg / kg body weight, more preferably 0.1 to 5 m
g / kg body weight about 1 to 5 times a day, preferably 1
It is convenient to administer by intravenous injection about 1 to 3 times a day. In the case of other parenteral administration and oral administration, an equivalent amount can be administered. If the symptoms are particularly severe, the dose may be increased according to the symptoms. The antibody of the present invention, which neutralizes the activity of an enzyme involved in sugar metabolism such as xylulokinase such as the protein of the present invention, can be administered by itself or as a suitable pharmaceutical composition. The pharmaceutical composition used for the above administration contains the above or a salt thereof and a pharmacologically acceptable carrier, diluent or excipient. Such compositions are provided in dosage forms suitable for oral or parenteral administration. That is, for example, compositions for oral administration include solid or liquid dosage forms, specifically tablets (including sugar-coated tablets and film-coated tablets), pills, granules, powders, capsules (soft capsules and the like). Syrup, emulsion, suspension and the like. Such a composition is produced by a method known per se and contains a carrier, diluent or excipient commonly used in the field of pharmaceuticals. For example, carriers and excipients for tablets include lactose, starch, sucrose, magnesium stearate and the like.

As a composition for parenteral administration, for example, injections, suppositories, etc. are used. Injections are intravenous injections, subcutaneous injections, intradermal injections, intramuscular injections, drip injections, etc. In the dosage form. Such injections are prepared according to a method known per se, for example, by dissolving, suspending or emulsifying the antibody or a salt thereof in a sterile aqueous or oily liquid commonly used for injections. As an aqueous liquid for injection, for example, physiological saline, isotonic solution containing glucose and other auxiliary agents and the like are used, and a suitable solubilizing agent,
For example, alcohol (eg, ethanol), polyalcohol (eg, propylene glycol, polyethylene glycol), nonionic surfactant [eg, polysorbate 80,
HCO-50 (polyoxyethylene (50mol) adduct of
hydrogenated castor oil)].
As the oily liquid, for example, sesame oil, soybean oil, and the like are used, and benzyl benzoate, benzyl alcohol, and the like may be used in combination as a solubilizing agent. The prepared injection is usually filled in an appropriate ampoule. Suppositories to be used for rectal administration are prepared by mixing the above antibody or a salt thereof with a conventional suppository base. The above-mentioned oral or parenteral pharmaceutical compositions are conveniently prepared in dosage unit form so as to be compatible with the dosage of the active ingredient.
Examples of such dosage unit dosage forms include tablets, pills, capsules, injections (ampoules), suppositories and the like, and usually 5 to 500 mg, especially 5 to 100 mg for each dosage unit, 10-2 for other dosage forms
Preferably, it contains 50 mg of the above antibody.
Each of the above-mentioned compositions may contain another active ingredient as long as the composition does not cause an undesirable interaction with the above-mentioned antibody.

(5) Screening of Candidate Drugs for Various Diseases Compounds or salts thereof that promote the enzymatic activity of the protein of the present invention (eg, the activity of enzymes involved in sugar metabolism such as xylulokinase) include, for example, diabetes and the like. As a medicament such as an agent for treating or preventing various diseases. On the other hand, the compound or its salt that inhibits the enzyme activity of the protein of the present invention can be used as a medicament such as an agent for treating or preventing various diseases such as hypoglycemia. Therefore, the protein or the like of the present invention is useful as a reagent for screening a compound or a salt thereof that promotes or inhibits the enzymatic activity of the protein of the present invention. That is, the present invention provides (1) an enzyme activity of a protein or the like of the present invention characterized by using the protein or the like of the present invention (eg, an activity of an enzyme involved in sugar metabolism such as xylulokinase: XYL activity) And a salt thereof (hereinafter sometimes abbreviated as XYL promoter or XYL inhibitor), and more specifically, for example, (2) XYL accelerator or XYL characterized by comparing (i) the case where a substrate or the like of the present invention is brought into contact with a substrate and (ii) the case where a substrate or a test compound is brought into contact with a protein or the like of the present invention or the like. Methods for screening for inhibitors are provided. Specifically, the above-mentioned screening method is characterized by, for example, measuring and comparing the XYL activity and the like of the protein of the present invention in the cases (i) and (ii).

The substrate may be any substrate as long as it can serve as a substrate for the protein of the present invention.
Xylulose and ATP are used. As xylulose, it is preferable to use radiolabeled (eg, ¹⁴ C, ³ H) xylulose. Test compounds include, for example, peptides, proteins, non-peptidic compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, plasma, etc., and these compounds are novel compounds. Or a known compound. To carry out the above-mentioned screening method, a sample such as the protein of the present invention is prepared by suspending the protein or the like of the present invention in a buffer suitable for screening. The buffer has a pH of about 4-10.
Any buffer may be used as long as it does not inhibit the binding between the protein and the like of the present invention and the substrate, such as a phosphate buffer (preferably about 6 to 8) and a Tris-HCl buffer. The XYL activity of the protein or the like of the present invention may be determined by a known method (for example, the method described in J. Biol. Chem., 218, pp. 753-768 (1956)) to determine the decrease in xylulose. For example, when the XYL activity in the case (ii) promotes about 20% or more, preferably about 30% or more, more preferably about 50% or more as compared with the case (i), the test compound XY such as the protein of the present invention
It can be selected as a compound that promotes L activity.
On the other hand, for example, when the XYL activity in the case (ii) is inhibited by about 20% or more, preferably about 30% or more, more preferably about 50% or more compared to the case of the above (i), The test compound is XY such as the protein of the invention.
It can be selected as a compound that inhibits L activity.

The screening kit of the present invention contains the protein and the like of the present invention. Examples of the screening kit of the present invention include the following. [Screening reagent] Measurement buffer 0.2 M phosphate buffer (pH 8.0) Protein preparation Protein of the present invention or its salt Substrate Xylulose, ATP detection The absorbance at 670 nm is measured. [Measurement Method] A test compound is added to 3 mL of a reaction solution containing 1 mM xylose, 1 mM ATP, the protein of the present invention or a salt thereof, and 0.2 M phosphate buffer (pH 8.0), and then incubated at 25 ° C. for 30 minutes. . to this,
3 mL of 0.1% iron (III) chloride / concentrated hydrochloric acid and 0.3 mL of 0.
Add 1% orcinol / 95% ethanol solution, heat in a boiling water bath (100 ° C) for 25 minutes, cool to room temperature (about 20 ° C), and measure the absorbance at 670 nm.

The compound obtained by using the screening method or the screening kit of the present invention or a salt thereof may be a test compound (eg, peptide, protein, non-peptide compound, synthetic compound, fermentation product, cell extract, Plant extract, animal tissue extract, etc.), which promote or inhibit the enzyme activity (eg, XYL activity) of the protein or the like of the present invention. The compound may be a novel compound or a known compound. As the salt of the compound, a salt with a physiologically acceptable acid (eg, an inorganic acid, an organic acid) or a base (eg, an alkali metal) is used, and particularly, a physiologically acceptable acid addition salt is used. preferable. Examples of such salts include salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) and organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid) acid,
Salts with tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid) and the like are used. The compound or its salt that inhibits the enzyme activity such as the protein of the present invention is useful as a drug such as a safe and low-toxic therapeutic or prophylactic agent for various diseases such as hypoglycemia. The compound of the present invention which promotes the activity of an enzyme such as a protein or a salt thereof is useful as a drug such as a safe and low toxic therapeutic / prophylactic agent for various diseases such as diabetes.

When a compound obtained by using the screening method or the screening kit of the present invention is used as the above-mentioned medicament, it can be carried out in a conventional manner. For example, tablets, capsules, elixirs, microcapsules, sterile solutions, suspensions and the like can be prepared in the same manner as in the above-mentioned medicine containing the protein of the present invention. Since the preparation obtained in this way is safe and has low toxicity, it can be used, for example, in mammals (eg, humans, mice, rats, rabbits, sheep, pigs, cows, horses, cats, dogs, monkeys, chimpanzees, etc.). Can be administered. The dose of the compound or a salt thereof varies depending on the target disease, the administration subject, the administration route, and the like.For example, when a compound that inhibits the enzyme activity of the protein of the present invention for the purpose of treating hypoglycemia is orally administered. ,
Generally, in an adult (assuming a body weight of 60 kg), the compound is used in an amount of about 0.1 to 100 mg, preferably about 1.0 to 50 mg, more preferably about 1.0 to 20 mg per day.
Administer. When administered parenterally, the single dose of the compound varies depending on the administration subject, target disease, and the like.
For example, a compound that inhibits the enzymatic activity of the protein of the present invention for the purpose of treating hypoglycemia is usually administered in the form of an injection to an adult (60%).
kg)), the compound is administered in an amount of about 0.01 to 30 mg, preferably about 0.1 to 20 mg per day.
Conveniently, about g, more preferably about 0.1 to 10 mg, will be administered by intravenous injection. In the case of other animals, the dose can be administered in terms of 60 kg. On the other hand, when a compound that promotes the enzymatic activity of the protein of the present invention is orally administered for the purpose of treating diabetes, generally, in an adult (assuming a body weight of 60 kg), about 0.1 to 100 mg of the compound per day is preferable. Is about 1.0-
The dose is 50 mg, more preferably about 1.0 to 20 mg. When administered parenterally, the single dose of the compound varies depending on the administration subject, the target disease, and the like. For example, a compound that promotes the enzyme activity of the protein of the present invention for the purpose of treating diabetes may be used as an injection. When administered to a normal adult (as 60 kg) in the form, the compound is administered in an amount of about 0.0
It is convenient to administer about 1 to 30 mg, preferably about 0.1 to 20 mg, more preferably about 0.1 to 10 mg by intravenous injection. For other animals,
The amount converted per 60 kg can be administered.

(6) Pharmaceuticals Containing Antisense DNA The antisense DNA complementary to the DNA or mRNA encoding the protein of the present invention and capable of suppressing the expression of the protein of the present invention, etc. The function of the protein of the present invention that exerts an action can be suppressed. Therefore, the antisense DNA is
For example, it can be used as a medicament such as a therapeutic / prophylactic agent for diseases such as hypoglycemia. When the antisense DNA is used as the above medicine, the above-described DN of the present invention is used.
It can be manufactured and administered to mammals in the same manner as the therapeutic / prophylactic agent for various diseases containing A. For example, when the antisense DNA is used, the method can be carried out according to a conventional method after inserting the antisense DNA alone or into an appropriate vector such as a retrovirus vector, an adenovirus vector, and an adenovirus associated virus vector. The antisense DNA
Can be administered as it is or in the form of a formulation together with a physiologically acceptable carrier such as an adjuvant for promoting uptake, and can be administered using a gene gun or a catheter such as a hydrogel catheter. Furthermore, the antisense DNA can also be used as a diagnostic oligonucleotide probe for examining the presence or expression of the DNA of the present invention in tissues or cells.

(7) DNA-Transferred Animal The present invention relates to a DNA encoding the exogenous protein of the present invention (hereinafter abbreviated as the exogenous DNA of the present invention) or a mutant DNA thereof (the exogenous mutant DNA of the present invention) Which may be abbreviated as such). That is, the present invention provides (1) a non-human mammal having the exogenous DNA of the present invention or a mutant DNA thereof, (2) the animal according to (1), wherein the non-human mammal is a rodent, (3) No. 2 wherein the rodent is a mouse or rat
And (4) a recombinant vector containing the exogenous DNA of the present invention or its mutant DNA and capable of being expressed in mammals. Non-human mammals having the exogenous DNA of the present invention or the mutant DNA thereof (hereinafter abbreviated as the DNA-transferred animal of the present invention) can be used for non-fertilized eggs, fertilized eggs, germ cells including sperm and their progenitor cells, and the like. Preferably, at the stage of embryonic development in non-human mammal development (more preferably, at the stage of single cells or fertilized eggs and generally before the 8-cell stage), calcium phosphate method, electric pulse method, lipofection method, agglutination method, It can be produced by transferring a target DNA by a microinjection method, a particle gun method, a DEAE-dextran method, or the like. In addition, somatic cells,
The exogenous DNA of the present invention can be transferred to living organs, tissue cells, and the like, and used for cell culture, tissue culture, and the like. Furthermore, these cells can be used in a cell fusion method known per se with the above-described germ cells. Thus, the DNA-transferred animal of the present invention can also be produced by fusing the DNA.

Non-human mammals include, for example, bovine,
Pigs, sheep, goats, rabbits, dogs, cats, guinea pigs, hamsters, mice, rats and the like are used. Above all, rodents, which are relatively short in ontogeny and biological cycle in terms of preparation of diseased animal model systems, and are easy to breed, especially mice (for example, C57 as a pure strain)
As a hybrid line such as BL / 6 line and DBA2 line, B6 line
C3F1 system, BDF1 system, B6D2F1 system, BA
LB / c strain, ICR strain, etc.) or rat (eg, Wistar, SD etc.) are preferred. "Mammals" in a recombinant vector that can be expressed in mammals include humans in addition to the above-mentioned non-human mammals. The exogenous DNA of the present invention refers to the DNA of the present invention once isolated and extracted from a mammal, not the DNA of the present invention originally possessed by a non-human mammal.
As the mutant DNA of the present invention, those having a mutation (for example, mutation) in the base sequence of the original DNA of the present invention,
Specifically, DNA in which addition or deletion of a base, substitution with another base, or the like has occurred is used, and abnormal DNA is also included. The abnormal DNA refers to a DNA that expresses an abnormal protein of the present invention, and for example, a DNA that expresses a protein that suppresses the function of the normal protein of the present invention is used. The exogenous DNA of the present invention comprises:
It may be derived from a mammal of the same species or a different species as the target animal. In transferring the DNA of the present invention to a target animal, it is generally advantageous to use the DNA as a DNA construct linked downstream of a promoter capable of being expressed in animal cells. For example, when transferring the human DNA of the present invention, DNAs derived from various mammals (eg, rabbits, dogs, cats, guinea pigs, hamsters, rats, mice, etc.) having the DNA of the present invention having high homology thereto are expressed. Highly expressing the DNA of the present invention by microinjecting a DNA construct (eg, vector, etc.) in which the human DNA of the present invention is bound downstream of various promoters that can be made into a fertilized egg of a target mammal, for example, a mouse fertilized egg. DNA-transferring mammals can be created.

Examples of expression vectors for the protein of the present invention include plasmids derived from Escherichia coli, plasmids derived from Bacillus subtilis, plasmids derived from yeast, bacteriophages such as λ phage, retroviruses such as Moloney leukemia virus, vaccinia viruses and baculoviruses. Animal viruses and the like are used. Among them, a plasmid derived from Escherichia coli, a plasmid derived from Bacillus subtilis or a plasmid derived from yeast is preferably used. The above DN
Examples of promoters that regulate A expression include, for example,
Promoters of DNAs derived from viruses (eg, Simian virus, cytomegalovirus, Moloney leukemia virus, JC virus, breast cancer virus, poliovirus, etc.), various mammals (human, rabbit, dog, cat,
Promoters from guinea pigs, hamsters, rats, mice, etc.) and birds (such as chickens) such as albumin, insulin II, uroplakin II, elastase, erythropoietin, endothelin, muscle creatine kinase, glial fibrillary acidic protein, glutathione S-transferase, Platelet-derived growth factor β, keratins K1, K10 and K14, collagen types I and II, cyclic AMP-dependent protein kinase β I subunit, dystrophin, tartrate-resistant alkaline phosphatase, atrial natriuretic factor, endothelial receptor tyrosine kinase (generally Tie2), sodium potassium adenosine 3 kinase (Na, K-ATPase), neurofilament light chain, metallothioney I and IIA, metalloproteinase tissue inhibitor 1, MHC class I antigen (H-
2L), H-ras, renin, dopamine β-hydroxylase, thyroid peroxidase (TPO), polypeptide chain elongation factor 1α (EF-1α), β actin, α and β myosin heavy chains, myosin light chains 1 and 2 , Myelin basic protein, thyroglobulin, Thy-1, immunoglobulin, heavy chain variable region (VNP), serum amyloid P component, myoglobin, troponin C, smooth muscle α-actin, promoter such as preproenkephalin A, vasopressin and the like are used. . Among them, a cytomegalovirus promoter capable of high expression throughout the whole body, a human polypeptide chain elongation factor 1α (EF-1α) promoter, a human and chicken β-actin promoter and the like are preferable.

The vector preferably has a sequence (generally called a terminator) that terminates the transcription of the target mRNA in a DNA-transferred mammal. For example, each vector may be derived from a virus, a mammal, or a bird. DNA sequences can be used, preferably
Simian virus SV40 terminator and the like are used. In addition, a splicing signal of each DNA, an enhancer region, a part of an intron of a eukaryotic DNA, and the like may be added 5 ′ upstream of the promoter region, between the promoter region and the translation region, or for the purpose of further expressing the desired foreign DNA. It is also possible to link 3 ′ downstream of the translation region depending on the purpose. The normal translation region of the protein of the present invention may be human or various mammals (for example,
Rabbits, dogs, cats, cats, guinea pigs, hamsters, rats, mice, etc.) derived liver, kidney, thyroid cells, fibroblast-derived DNA, and all or part of genomic DNA from various commercially available genomic DNA libraries, or liver, MRNA from kidney, thyroid cells, fibroblasts
Complementary DNA prepared by a known method can be obtained as a raw material. In addition, extraneous abnormal DNA
Can produce a translation region obtained by mutating the translation region of a normal protein obtained from the above cells or tissues by point mutagenesis. The translation region can be prepared as a DNA construct that can be expressed in a transgenic animal by a conventional genetic engineering technique in which it is ligated downstream of the above promoter and, if desired, upstream of the transcription termination site. Exogenous D of the invention at the fertilized egg cell stage
The transfer of NA is ensured such that the exogenous DNA of the present invention is present in all germ cells and somatic cells of the target mammal. The presence of the exogenous DNA of the present invention in the germinal cells of the produced animal after the DNA transfer means that all the progeny of the produced animal retain the exogenous DNA of the present invention in all of the germ cells and somatic cells. means. The progeny of such animals that have inherited the foreign DNA of the present invention have the foreign DNA of the present invention in all of their germinal and somatic cells.

The non-human mammal to which the exogenous normal DNA of the present invention has been transferred is confirmed to stably maintain the exogenous DNA by mating, and is subcultured as an animal having the DNA in a normal breeding environment. I can do it. The transfer of the exogenous DNA of the present invention at the fertilized egg cell stage results in excessive addition of the exogenous D
NA is ensured to be present. Excessive presence of the exogenous DNA of the present invention in germ cells of a produced animal after DNA transfer means that all offspring of the produced animal have an excessive amount of the exogenous DNA of the present invention in all of their germ cells and somatic cells. Means The progeny of such animals that have inherited the exogenous DNA of the present invention have an excess of the exogenous DNA of the present invention in all of their germinal and somatic cells. Obtain a homozygous animal having the introduced DNA on both homologous chromosomes,
By breeding the male and female animals, all offspring can be propagated and passaged so as to have the DNA in excess. In the non-human mammal having the exogenous normal DNA of the present invention, the normal DNA of the present invention is highly expressed, and the function of the protein of the present invention is finally enhanced by promoting the function of the endogenous normal DNA. May develop symptoms,
It can be used as a disease model animal. For example, using the normal DNA-transferred animal of the present invention, it is possible to elucidate the pathological mechanism of hyperactivity of the protein of the present invention and diseases associated with the protein of the present invention, and to examine a method for treating these diseases. It is possible. In addition, since the mammal to which the exogenous normal DNA of the present invention has been transferred has an increased symptom of the released protein of the present invention, it can be used for a screening test for a therapeutic drug for a disease associated with the protein of the present invention. .

On the other hand, the non-human mammal having the extraneous abnormal DNA of the present invention should be subcultured in a normal breeding environment as an animal having the DNA after confirming that the exogenous DNA is stably retained by mating. Can be done. Further, the desired exogenous DNA can be incorporated into the above-mentioned plasmid and used as a source material. A DNA construct with a promoter can be prepared by a usual genetic engineering technique. Transfer of the abnormal DNA of the present invention at the fertilized egg cell stage is ensured such that the abnormal DNA of the present invention is present in all germ cells and somatic cells of the target mammal. The presence of the abnormal DNA of the present invention in the germinal cells of the produced animal after DNA transfer indicates that all of the offspring of the produced animal have the abnormal DNA of the present invention in all of their germ cells and somatic cells.
Has the following meaning. The offspring of such animals that have inherited the exogenous DNA of the present invention have the abnormal DNA of the present invention in all of their germinal and somatic cells. Obtain a homozygous animal having the introduced DNA on both homologous chromosomes,
By breeding the male and female animals, it is possible to breed the cells so that all offspring have the DNA. In the non-human mammal having the foreign abnormal DNA of the present invention, the abnormal DNA of the present invention is highly expressed, and the function of the protein of the present invention is finally impaired by inhibiting the function of endogenous normal DNA. It may be active refractory and can be used as a disease model animal. For example,
Using the abnormal DNA-transferred animal of the present invention, it is possible to elucidate the pathological mechanism of function-inactive refractory of the protein of the present invention and to examine a method for treating this disease. Further, as a specific possibility, the animal with high expression of the extraneous abnormal DNA of the present invention is characterized in that the abnormal protein of the present invention inhibits the function of a normal protein (dominant negative action) in the inactive refractory disease of the protein of the present invention. ). In addition, since the mammal into which the exogenous abnormal DNA of the present invention has been transferred has an increased symptom of the released protein of the present invention, it is also used for a therapeutic drug screening test for a functionally inactive refractory disease of the protein of the present invention. It is possible.

Other possible uses of the above two kinds of the DNA-transferred animals of the present invention include, for example, use as a cell source for tissue culture, and DNA or R in the tissues of the DNA-transferred animals of the present invention.
Analysis of the relationship with proteins specifically expressed or activated by the protein of the present invention by directly analyzing NA or analyzing proteins in the tissue, cells from a tissue having the DNA of the present invention The use of these cells, in cases where they can be cultured by standard tissue culture techniques, generally studies the function of cells from difficult-to-cultivate tissues. Screening of a drug that enhances the function, isolation and purification of the mutant protein of the present invention, and production of its antibody can be considered. Furthermore, using the DNA-transferred animal of the present invention, it is possible to examine clinical symptoms of a disease related to the protein of the present invention, including a functionally inactive refractory disease of the protein of the present invention, etc. More detailed pathological findings in each organ of a disease model related to the disease can be obtained, which can contribute to the development of a new treatment method, and further to the research and treatment of a secondary disease caused by the disease. In addition, it is possible to take out each organ from the DNA-transferred animal of the present invention, cut it into small pieces, and then use a proteolytic enzyme such as trypsin to obtain the released DNA-transferred cells, culture them, or establish the cultured cells. Furthermore, the protein-producing cell of the present invention can be specified, the function of regulating glucose metabolism can be examined, and their abnormalities can be examined. The protein can be an effective research material for elucidating the protein of the present invention and its action. Furthermore, using the DNA-transferred animal of the present invention, the protein of the present invention includes a functionally inactive refractory disease,
In order to develop therapeutic agents for diseases related to the protein of the present invention, using the above-described test methods and quantitative methods,
It is possible to provide an effective and rapid screening method for the therapeutic agent for the disease. Further, using the transgenic animal of the present invention or the exogenous DNA expression vector of the present invention, a method for treating a DNA associated with the protein of the present invention was investigated.
It is possible to develop.

(8) Knockout Animal The present invention provides a non-human mammalian embryonic stem cell in which the DNA of the present invention has been inactivated and a non-human mammal deficient in expression of the DNA of the present invention. That is, the present invention relates to (i) a non-human mammalian embryonic stem cell in which the DNA of the present invention has been inactivated;
i) The DNA is a reporter gene (eg, β
-(Galactosidase gene), (iii) the embryonic stem cell according to (i), which is resistant to neomycin, and (iv) the non-human mammal is inactivated. (V) embryonic stem cells according to (ii), wherein the rodent is a mouse; and (vi) expression of the DNA in which the DNA of the present invention is inactivated. Deficient non-human mammal, (vii) the DNA is inactivated by introducing a reporter gene (eg, a β-galactosidase gene derived from Escherichia coli), and the reporter gene is expressed under the control of a promoter for the DNA of the present invention. A non-human mammal according to item (vi),
(Viii) the non-human mammal according to (vi), wherein the non-human mammal is a rodent, (ix) the non-human mammal according to (viii), wherein the rodent is a mouse, and (x ) A method for screening for a compound or a salt thereof that promotes or inhibits the promoter activity of the DNA of the present invention, which comprises administering a test compound to the animal described in (vii) and detecting the expression of a reporter gene. I do.

A non-human mammalian embryonic stem cell in which the DNA of the present invention has been inactivated is a DNA which is obtained by artificially mutating the DNA of the present invention possessed by the non-human mammal to suppress the expression ability of the DNA. Alternatively, the DNA substantially does not have the ability to express the protein of the present invention by substantially losing the activity of the protein of the present invention encoded by the DNA (hereinafter referred to as the knockout DNA of the present invention). Embryonic stem cells (hereinafter sometimes referred to as ES) of a non-human mammal.
(Abbreviated as cell). As the non-human mammal, the same one as described above is used. As a method for artificially mutating the DNA of the present invention, for example, deletion of a part or all of the DNA sequence by genetic engineering techniques,
By inserting or substituting With these mutations, for example, the knockout DNA of the present invention may be prepared by shifting the codon reading frame or disrupting the function of the promoter or exon. Specific examples of the non-human mammalian embryonic stem cells in which the DNA of the present invention has been inactivated (hereinafter abbreviated as the DNA-inactivated ES cells of the present invention or the knockout ES cells of the present invention) include, for example, The DNA of the present invention possessed by a non-human mammal is isolated and its exon portion is a drug resistance gene typified by a neomycin resistance gene, a hygromycin resistance gene, or lacZ (β-galactosidase gene), cat (chloramphenicol acetyl). A DNA sequence (eg, poly) which disrupts the function of exons by inserting a reporter gene or the like represented by a transferase gene) or terminates transcription of the gene in an intron between exons.
A additional signal (such as A targeting signal) is inserted into a DNA strand (hereinafter abbreviated as a targeting vector) having a DNA sequence constructed so as to disrupt the gene by inserting a complete mRNA. The DNA of the present invention is introduced into the chromosome of the animal by recombination, and the obtained ES cells are subjected to DNA on or near the DNA of the present invention.
DNA of the present invention used for Southern hybridization analysis using a sequence as a probe or for preparing a targeting vector and a DNA sequence on the targeting vector
PC with primers of DNA sequences in neighboring regions other than A
It can be obtained by analyzing by the R method and selecting the knockout ES cells of the present invention.

Further, the DN of the present invention may be
As the original ES cells for inactivating A, for example, those already established as described above may be used, or newly established ES cells according to the known Evans and Kaufma method may be used. For example, in the case of mouse ES cells, currently, 129 line ES cells are generally used. However, since the immunological background is not clear, a pure line instead of this is used as an immunological genetic background. For example, C57BL / 6 mouse or C57B
Those established using BDF1 mice (F1 of C57BL / 6 and DBA / 2) whose L / 6 egg collection rate has been reduced by crossing with DBA / 2 can also be used favorably.
The BDF1 mouse has the advantage that the number of eggs collected is large and the eggs are robust. In addition, since the C57BL / 6 mouse is used as a background, the ES cells obtained using the mouse can be used to produce a disease model mouse. It can be used advantageously in that it is possible to replace the genetic background with C57BL / 6 mice by backcrossing with C57BL / 6 mice. Also, E
When S cells are established, blastocysts 3.5 days after fertilization are generally used. In addition, a large number of initial cells can be efficiently obtained by collecting an 8-cell stage embryo and culturing the blastocysts until use. Embryos can be obtained. Either male or female ES cells may be used, but generally male ES cells are more convenient for producing a germline chimera. It is also desirable to discriminate between males and females as soon as possible in order to reduce cumbersome culture labor. As a method for determining the sex of ES cells, for example, a method of amplifying and detecting a gene in the sex-determining region on the Y chromosome by PCR can be mentioned. By using this method, the number of ES cells of about 1 colony (about 50 cells) is sufficient, whereas the conventional method required about 10 ⁶ cells for karyotype analysis. The primary selection of ES cells in the early stage can be performed by discriminating between male and female, and by enabling selection of male cells at an early stage, labor in the initial stage of culture can be greatly reduced.

The secondary selection can be performed, for example, by confirming the number of chromosomes by the G-banding method. The number of chromosomes in the obtained ES cells is desirably 100% of the normal number. However, when it is difficult due to physical operations or the like at the time of establishment, after knocking out the gene of the ES cells, the cells can be knocked out of normal cells (for example, chromosome in mice). Number is 2n
= Cells). The embryonic stem cell line obtained in this way usually has very good growth properties, but must be carefully subcultured because it tends to lose its ontogenetic ability. For example, on a suitable feeder cell such as STO fibroblast in the presence of LIF (1-10000 U / ml) in a carbon dioxide incubator (preferably 5% carbon dioxide, 95% air, or 5% oxygen, The cells are cultured by a method such as culturing at about 37 ° C. in 5% carbon dioxide gas and 90% air. At the time of subculture, for example, a trypsin / EDTA solution (usually 0.001-0.5% trypsin / 0.1-5 mM) is used. EDTA, preferably about 0.1
% Trypsin / 1 mM EDTA), and the cells are seeded on freshly prepared feeder cells. Such passage is usually performed every 1 to 3 days. At this time, it is desirable to observe the cells and, if any morphologically abnormal cells are found, discard the cultured cells. ES cells are differentiated into various types of cells, such as parietal, visceral, and cardiac muscles, by monolayer culture up to high density or suspension culture until cell clumps are formed under appropriate conditions. [MJ Evans and MH Kaufman, Nature
e) Volume 292, 154 (1981); GR Martin
Proceedings of National Academy
Of Science USA (Proc. Natl. Acad.
Sci. USA) Vol. 78, 7634 (1981); TC Do
etschman et al., Journal of Embryology
And Experimental Morphology (Journa
87, 27 (1985)], and the DNA-deficient cell of the present invention obtained by differentiating the ES cell of the present invention is useful for examining the importance in vitro. . The non-human mammal deficient in expression of DNA of the present invention comprises the mRNA of the animal.
By measuring the amount using a known method and indirectly comparing the expression amount, the expression can be distinguished from normal animals. As the non-human mammal, those similar to the aforementioned can be used.

In the non-human mammal deficient in expression of the DNA of the present invention, for example, the targeting vector prepared as described above is introduced into mouse embryonic stem cells or mouse egg cells, and the DNA of the present invention in the targeting vector becomes inactive by the introduction. The DNA sequence of the present invention is replaced by the DNA of the present invention on the chromosome of a mouse embryonic stem cell or mouse egg cell by homologous recombination of the gene.
The NA can be knocked out. The DN of the present invention
Cells in which A was knocked out were subjected to Southern hybridization analysis using a DNA sequence on or near the DNA of the present invention as a probe or a DNA sequence on a targeting vector, and DNA other than the mouse-derived DNA of the present invention used for the targeting vector. Neighboring DNA
The sequence can be determined by PCR analysis using the primers. When a non-human mammalian embryonic stem cell is used, a cell line in which the DNA of the present invention has been inactivated by gene homologous recombination is cloned, and the cell is cultured at an appropriate time, for example, at the 8-cell stage of a non-human mammalian stem cell. The chimeric embryo is injected into an animal embryo or a blastocyst, and the produced chimeric embryo is transplanted into the uterus of the pseudopregnant non-human mammal. The produced animal is a cell having a normal DNA locus of the present invention and an artificially mutated D of the present invention.
It is a chimeric animal composed of both cells having the NA locus. When a part of the germ cells of the chimeric animal has a mutated DNA locus of the present invention, all tissues are artificially mutated from a population obtained by crossing such a chimeric individual with a normal individual. It can be obtained by selecting individuals composed of cells having the added DNA locus of the present invention, for example, by judging coat color. The individual thus obtained is usually an individual heterozygously deficient in expression of the protein of the present invention, mated with an individual deficient in heteroexpression of the protein of the present invention, and homozygously expressing the protein of the present invention from their offspring. Defective individuals can be obtained. When using an egg cell, for example, a transgenic non-human mammal having a targeting vector introduced into a chromosome can be obtained by injecting a DNA solution into a nucleus of an egg cell by a microinjection method, and these transgenic non-human mammals can be obtained. Mammals can be obtained by selecting those having a mutation in the DNA locus of the present invention by homologous recombination.

The individual in which the DNA of the present invention has been knocked out in the manner described above should be bred in an ordinary breeding environment after confirming that the DNA of the animal obtained by the cross has been knocked out. Can be. further,
The germline can be obtained and maintained in accordance with a conventional method. That is, by mating male and female animals having the inactivated DNA, homozygous animals having the inactivated DNA on both homologous chromosomes can be obtained. The obtained homozygous animals were compared to normal animals 1
It can be obtained efficiently by breeding in a state where there are a plurality of homozygotes. By mating male and female heterozygous animals, homozygous and heterozygous animals having the inactivated DNA are bred and subcultured. The non-human mammalian embryonic stem cells in which the DNA of the present invention has been inactivated are extremely useful for producing a non-human mammal deficient in expressing the DNA of the present invention. In addition, the DN of the present invention
Since non-human mammals deficient in A expression lack various biological activities that can be induced by the protein of the present invention, they can serve as models for diseases caused by inactivation of the biological activity of the protein of the present invention. It is useful for investigating the cause of disease and examining treatment methods.

(8a) A method for screening a compound having a therapeutic / preventive effect against diseases caused by DNA deficiency or damage of the present invention The non-human mammal deficient in expression of the DNA of the present invention is deficient in the DNA of the present invention It can be used for screening for a compound having a therapeutic / preventive effect on diseases (eg, diabetes, etc.) caused by damage or damage. That is, the present invention is characterized by administering a test compound to a non-human mammal deficient in expressing the DNA of the present invention, and observing and measuring changes in the animal. Provided is a method for screening a compound or a salt thereof having a therapeutic / prophylactic effect against a disease. Examples of the non-human mammal deficient in expressing DNA of the present invention used in the screening method include the same ones as described above. Test compounds include, for example, peptides, proteins, non-peptidic compounds, synthetic compounds, fermentation products,
Examples thereof include cell extracts, plant extracts, animal tissue extracts, and plasma. These compounds may be novel compounds or known compounds. Specifically, a non-human mammal deficient in expression of the DNA of the present invention is treated with a test compound, compared with a non-treated control animal, and tested using changes in each organ, tissue, disease symptoms, etc. of the animal as an index. The therapeutic / preventive effects of the compounds can be tested. As a method of treating a test animal with a test compound, for example, oral administration, intravenous injection and the like are used, and it can be appropriately selected according to the symptoms of the test animal, properties of the test compound, and the like. Also,
The dose of the test compound can be appropriately selected according to the administration method, the properties of the test compound, and the like. For example, when screening for a compound having a therapeutic / preventive effect on diabetes, a non-human mammal deficient in expressing DNA of the present invention is subjected to glucose tolerance treatment, and a test compound is administered before or after glucose tolerance treatment, and The blood glucose level and changes in body weight are measured over time. In the screening method,
When a test compound is administered to a test animal, if the blood glucose level of the test animal increases by about 10% or more, preferably about 30% or more, and more preferably about 50% or more, the test compound is treated against hypoglycemia. It can be selected as a compound having a therapeutic / preventive effect.

The compound obtained by using the screening method of the present invention is a compound selected from the test compounds described above, and is used for diseases (eg, diabetes, etc.) caused by deficiency or damage of the protein, etc. of the present invention. Therefore, it can be used as a medicament such as a safe and low toxic therapeutic / prophylactic agent for the disease. Furthermore, compounds derived from the compounds obtained by the above screening can be used in the same manner. The compound obtained by the screening method may form a salt, and the salt of the compound may include a physiologically acceptable acid (eg, an inorganic acid, an organic acid) and a base (eg, an alkali metal). And particularly preferably a physiologically acceptable acid addition salt. Examples of such salts include salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid),
Alternatively, organic acids (eg, acetic acid, formic acid, propionic acid,
Fumaric acid, maleic acid, succinic acid, tartaric acid, citric acid,
For example, salts with malic acid, oxalic acid, benzoic acid, methanesulfonic acid, and benzenesulfonic acid) are used. A drug containing the compound or a salt thereof obtained by the screening method can be produced in the same manner as the above-mentioned drug containing the protein of the present invention. The preparation obtained in this way is safe and has low toxicity, and thus can be used in mammals (eg, human, rat, mouse, guinea pig, rabbit, sheep, pig, cow, horse, cat, dog, monkey, etc.). Can be administered. The dose of the compound or a salt thereof varies depending on the target disease, the administration subject, the administration route, and the like. For example, when the compound is orally administered for the purpose of treating diabetes, it is generally required for an adult (body weight 60 kg).
)), The compound is used in an amount of about 0.1 to about 0.1 per day.
Administer 100 mg, preferably about 1.0-50 mg, more preferably about 1.0-20 mg. When administered parenterally, the single dose of the compound varies depending on the administration subject, target disease, and the like. For example, the compound is usually administered to adults (as 60 kg) in the form of an injection for the purpose of treating diabetes. When administered, the compound is administered in an amount of from about 0.01 to 30 per day.
It is convenient to administer about mg, preferably about 0.1 to 20 mg, more preferably about 0.1 to 10 mg by intravenous injection. In the case of other animals, the dose can be administered in terms of 60 kg.

(8b) Method for Screening for a Compound That Promotes or Inhibits the Activity of the Promoter for the DNA of the Present Invention The present invention provides a method for administering a test compound to a non-human mammal deficient in expressing the DNA of the present invention, and expressing the reporter gene. The present invention provides a method for screening a compound or a salt thereof which promotes or inhibits the activity of a promoter for DNA of the present invention, which is characterized by detection. In the above-mentioned screening method, the non-human mammal deficient in expression of DNA of the present invention may be a non-human mammal deficient in expressing DNA of the present invention in which the DNA of the present invention is inactivated by introducing a reporter gene, A reporter gene that can be expressed under the control of a promoter for the DNA of the present invention is used. Examples of the test compound include the same compounds as described above. As a reporter gene,
The same one as described above is used, and the β-galactosidase gene (lacZ) is preferable. In a non-human mammal deficient in expression of the DNA of the present invention in which the DNA of the present invention is replaced with a reporter gene, the expression of the protein encoded by the reporter gene is traced since the reporter gene is under the control of the promoter for the DNA of the present invention. By doing so, the activity of the promoter can be detected.

For example, when a part of the DNA region encoding the protein of the present invention is replaced with a β-galactosidase gene (lacZ) derived from Escherichia coli, a tissue expressing the protein of the present invention originally Β-galactosidase is expressed instead of protein. Thus, for example, 5-bromo-4-chloro-3-indolyl-β-
By staining with a reagent serving as a substrate for β-galactosidase such as galactopyranoside (X-gal), the expression state of the protein of the present invention in an animal body can be easily observed. Specifically, the protein-deficient mouse of the present invention or a tissue section thereof is fixed with glutaraldehyde or the like, washed with Dulbecco's phosphate buffered saline (PBS), and then stained with X-gal at room temperature or at 7 ° C. After reacting for about 30 minutes to 1 hour in the vicinity, the β-galactosidase reaction may be stopped by washing the tissue specimen with a 1 mM EDTA / PBS solution, and the coloration may be observed. Also, according to the usual method, lac
The mRNA encoding Z may be detected.

The compound or a salt thereof obtained by the above-mentioned screening method is a compound selected from the above-mentioned test compounds, and is a compound that promotes or inhibits the promoter activity for the DNA of the present invention. The compound obtained by the screening method may form a salt,
Salts of the compound include physiologically acceptable acids (eg,
Salts with inorganic acids, organic acids) and bases (eg, alkali metals) are used, and physiologically acceptable acid addition salts are particularly preferable. Such salts include, for example, salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) or organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid) Acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid) and the like are used. The compound or a salt thereof that promotes the promoter activity for the DNA of the present invention can promote the expression of the protein of the present invention and promote the function of the protein, and thus has a safe and low toxicity against diseases such as diabetes. It is useful as a medicine such as a therapeutic / prophylactic agent. On the other hand, a compound or a salt thereof that inhibits the promoter activity of the DNA of the present invention inhibits the expression of the protein of the present invention and can inhibit the function of the protein, and thus, for example, is safe against diseases such as hypoglycemia. It is useful as a medicament such as a low-toxic therapeutic / prophylactic agent. Furthermore, compounds derived from the compounds obtained by the above screening can be used in the same manner.

A drug containing the compound or a salt thereof obtained by the screening method can be produced in the same manner as the above-mentioned drug containing the protein of the present invention or a salt thereof. The preparations obtained in this way are safe and low toxic, and thus, for example, mammals (eg, humans,
Rats, mice, guinea pigs, rabbits, sheep, pigs,
Cattle, horses, cats, dogs, monkeys, etc.). The dose of the compound or a salt thereof varies depending on the target disease, the administration subject, the administration route, and the like.
For example, when orally administering a compound of the present invention that inhibits the promoter activity to DNA for the purpose of treating hypoglycemia, generally in adults (with a body weight of 60 kg),
About 0.1 to 100 mg, preferably about 1.0 to 50 mg, more preferably about 1.0 to 20 mg of the compound per day
mg. When administered parenterally, a single dose of the compound varies depending on the administration subject, target disease, and the like. For example, a compound that inhibits the promoter activity of the DNA of the present invention for the purpose of treating hypoglycemia is injected. When administered to a normal adult (as 60 kg) in the form of a preparation, the compound is administered in an amount of about 0.01 to 30 mg, preferably about 0.1 to 20 mg, more preferably about 0.1 to 10 mg per day.
Conveniently, about mg is administered by intravenous injection.
In the case of other animals, the dose can be administered in terms of 60 kg. On the other hand, for example, when a compound that promotes the promoter activity of the DNA of the present invention is orally administered for the purpose of treating diabetes, it is generally used for an adult (body weight 60 kg).
)), The compound is used in an amount of about 0.1 to about 0.1 per day.
Administer 100 mg, preferably about 1.0-50 mg, more preferably about 1.0-20 mg. When administered parenterally, the single dose of the compound varies depending on the administration subject, target disease, and the like. For example, a compound that promotes the promoter activity of the DNA of the present invention for the purpose of treating diabetes may be used as an injection. When administered to a normal adult (as 60 kg) in the form, about 0.01 to 30 mg of the compound per day
It is convenient to administer intravenously, preferably about 0.1 to 20 mg, more preferably about 0.1 to 10 mg. In the case of other animals, the dose can be administered in terms of 60 kg. As described above, the non-human mammal deficient in expressing DNA of the present invention comprises the DN of the present invention.
It is extremely useful in screening for compounds or salts thereof that promote or inhibit the activity of the promoter for A, and greatly contribute to the investigation of the causes of various diseases caused by DNA expression deficiency of the present invention or the development of preventive / therapeutic agents. Can be.

In the present specification and drawings, when bases, amino acids and the like are represented by abbreviations, IUPAC-IUB
It is based on the abbreviation by the Commission on Biochemical Nomenclature or the abbreviation commonly used in the relevant field. When an amino acid can have an optical isomer, the L-form is indicated unless otherwise specified. DNA: deoxyribonucleic acid cDNA: complementary deoxyribonucleic acid A: adenine T: thymine G: guanine C: cytosine Y: thymine or cytosine N: thymine, cytosine, adenine or guanine R: adenine or guanine M: cytosine or adenine W: thymine or adenine Adenine S: cytosine or guanine RNA: ribonucleic acid mRNA: messenger ribonucleic acid dATP: deoxyadenosine triphosphate dTTP: deoxythymidine triphosphate dGTP: deoxyguanosine triphosphate dCTP: deoxycytidine triphosphate ATP: adenosine triphosphate EDTA : Ethylenediaminetetraacetic acid SDS: Sodium dodecyl sulfate EIA: Enzyme immunoassay

Gly or G: Glycine Ala or A: Alanine Val or V: Valine Leu or L: Leucine Ile or I: Isoleucine Ser or S: Serine Thr or T: Threonine Cys or C: Cysteine Met or M: Methionine Glu or E: Glutamic acid Asp or D: Aspartic acid Lys or K: Lysine Arg or R: Arginine His or H: Histidine Phe or F: Phenylalanine Tyr or Y: Tyrosine Trp or W: Tryptophan Pro or P: Proline Asn or N: N Or Q: glutamine pGlu: pyroglutamic acid Xaa: unidentified amino acid

The substituents, protecting groups and reagents frequently used in the present specification are represented by the following symbols. Me: methyl group Et: ethyl group Bu: butyl group Ph: phenyl group TC: thiazolidine -4 (R) - carboxamide group Tos: p-toluenesulfonyl CHO: formyl Bzl: benzyl Cl ₂ Bzl: 2,6-dichlorobenzyl Bom : Benzyloxymethyl Z: benzyloxycarbonyl Cl-Z: 2-chlorobenzyloxycarbonyl Br-Z: 2-bromobenzyloxycarbonyl Boc: t-butyloxycarbonyl DNP: dinitrophenol Trt: trityl Bum: t-butoxymethyl Fmoc : N-9-fluorenylmethoxycarbonyl HOBt: 1-hydroxybenztriazole HOOBT: 3,4-dihydro-3-hydroxy-4-oxo-1,2,3-benzotriazine HONB: 1-hydro Xy-5-norbornene-2,3-dicarboximide DCC: N, N'-dicyclohexylcarbodiimide TFA: trifluoroacetic acid DIEA: diisopropylethylamine

The sequence numbers in the sequence listing in the present specification indicate the following sequences. [SEQ ID NO: 1] This shows the amino acid sequence of the protein of the present invention. [SEQ ID NO: 2] Nucleotide sequence of cDNA encoding the protein of the present invention represented by SEQ ID NO: 1 (ORF only, 1584b
p). [SEQ ID NO: 3] This shows the base sequence (1963 bp, including before and after ORF) of the cDNA encoding the protein of the present invention represented by SEQ ID NO: 1. [SEQ ID NO: 4] This shows the base sequence (1850 bp) of the DNA fragment inserted into pT7 Blue described in Example 2. [SEQ ID NO: 5] This shows the base sequence of primer 1 used in EXAMPLE 2. [SEQ ID NO: 6] This shows the base sequence of primer 2 used in EXAMPLE 2. [SEQ ID NO: 7] This shows the base sequence of primer 3 used in EXAMPLE 2. [SEQ ID NO: 8] This shows the base sequence of primer 4 used in EXAMPLE 2. [SEQ ID NO: 9] This shows the base sequence of primer 5 used in EXAMPLE 2. [SEQ ID NO: 10] This shows the base sequence of primer 6 used in EXAMPLE 2. [SEQ ID NO: 11] This shows the base sequence of primer 7 used in EXAMPLE 2. [SEQ ID NO: 12] This shows the base sequence of primer 8 used in EXAMPLE 2. [SEQ ID NO: 13] This shows the base sequence of primer 9 used in EXAMPLE 2. [SEQ ID NO: 14] This shows the base sequence of primer 10 used in EXAMPLE 2. [SEQ ID NO: 15] This shows the base sequence of primer 11 used in EXAMPLE 2. [SEQ ID NO: 16] This shows the base sequence of primer 12 used in EXAMPLE 2.

The YAC (Yeast) used in Example 1 described later
Artificial Chromosome vector insert genome D
NA library) Clone Y936C1 can be obtained from, for example, RIKEN / DNA Development Bank (3 Takanodai, Tsukuba City)
-1-1) and the like. The transformant Escherichia coli XL obtained in Example 2 described later.
1 BlueMRF / pTV-HXYL has been in operation since March 24, 1998 at the National Institute of Advanced Industrial Science and Technology
H) has been deposited under accession number FERM BP-6305.

[0080]

EXAMPLES The present invention will be described in more detail with reference to the following Examples, but it should not be construed that the invention is limited thereto. Gene manipulation methods such as cloning methods and nucleotide sequence determination methods are known methods [for example, Molecula
r cloning, 2nd, J. Sambrook et al., Cold Spring H
Method described in arbor Lab. Press (1989) and the like].

[0081]

[Example 1] Cosmid (contig 536, 483, 508, 459)
Using the YAC clone Y936C1, a cosmid vector was introduced into the cosmid vector pWE15 (STRATAGENE) by a known method to prepare a cosmid library, and the resulting four cosmids (contig 536, 483, 508, 459) were prepared. ) Was determined (FIG. 1). First, cosmid DNA 10μ
g of TE buffer (10 mM Tris-HCl, 1 mM EDT
A, pH 7.6) dissolved in 400 μL, sonicator (ULTRASON
Ultrasonic processing (OUTPUT using IC DISRUPTOR; TOMY)
1.5, DUTY 0.1 second oscillation, 0.9 second pause) twice to fragment into the size of about 1.5-6.0 kb.
After blunt treatment with T4 DNA Polymerase (TAKARA SHUZO Corporation), pBluescript IISK (-) cloning vector (STRA
TAGENE) was inserted into the part where the terminus was blunted with the restriction enzyme EcoRV to obtain a plasmid. These plasmids D
NA was introduced into Escherichia coli XL1BlueMRF using an electroporation apparatus (Biorad) to obtain a transformant (clone). 300 randomly from the obtained transformant
Clones were selected, the resulting plasmid was digested with the restriction enzymes EcoRI and XhoI, and then hybridized with the cosmid vector pWE15 (STRATAGENE) labeled with ³² P-dCTP to exclude the vector-only clone. Then, a clone having the insert was selected. Plasmids obtained from clones having these inserts were purified and sequenced (Applied Bios
The nucleotide sequence of the insert was determined using ystem (ABI377). The obtained nucleotide sequence was analyzed using computer software (Applied Biosystem; Assembler), and the entire nucleotide sequence (Genomic sequence) of the four cosmids (contig 536, 483, 508, 459) was determined.

[0082]

Example 2 Isolation of a novel HXYL gene Computer software (GRAIL grail @ ornl, gov; Oak R
idge National Laboratory), the result of estimating the exon site in the entire base sequence (Genomic sequence) of the four cosmids (contig 536, 483, 508, 459) obtained in Example 1 is shown in FIG. As shown, cosmids 536,483,
Three, two, seven and two candidate exon sites were found in 508 and 459, respectively. Using two kinds of primers (primer1 and primer2) synthesized with reference to the base sequence of cosmid 508, human liver mRNA (Clontech)
RT-PCR reaction was performed using the cDNA prepared from the above as a template to obtain a 258 bp PCR fragment. Using this PCR fragment as a probe, Multi Tissue Northern blot Kit (Clon
tech) and performed a Northern blot.
A 2.3 kb DNA fragment was detected. With reference to the nucleotide sequences of cosmids 536 and 459, two more primers (primer3 and primer4) were synthesized. primer1 and
An RT-PCR reaction was performed in the same manner as described above using primer4, primer2 and primer3,
A 902 bp PCR fragment was obtained. In addition, Marathon cDNA Amp
5 'RACE using lification Kit (Clontech)
5 ′ and 3 ′ were extended by the method and 3′RACE method. The extension reaction was performed using human kidney mRNA (Clontech).
Co., Ltd.), Marathon cDNA AmplificationKit (Clontech
Was used as a template. 5 '
In the RACE method, a first PCR reaction is performed using primer 5 and primer AP1 (supplied with the above-mentioned Marathon cDNA Amplification Kit), and a second PCR reaction is performed using primer 6 and primer AP2 (supplied with the above-mentioned Marathon cDNA Amplification Kit). The 182 bp cDNA was elongated on the 'side. In the 3′RACE method, primer7 and
A 1st PCR reaction is performed using primer AP1 (same as above), and 2n PCR using primer8 and primer AP2 (same as above).
A dPCR reaction was performed to extend a 199 bp cDNA to the 3 ′ side. As a result, a cD having a total 1963 bp nucleotide sequence
An NA fragment was obtained. In this 1963 bp cDNA sequence, a 1584 bp ORF encoding a 527 amino acid sequence
(Open Reading Frame) was found (Fig. 2). When the homology search of the amino acid sequence was performed, the amino acid sequence was found to be Escherichia coli-derived xylulokinase.
Approximately 20% homology was observed [FIG. 3]. Got 1
CD having a 1584 bp ORF in the 963 bp base sequence
The NA fragment was cloned into E. coli by the following procedure to obtain a transformant Escherichia coli DH10B / pTV-HXYL.
First, four nucleotides complementary to the aforementioned 1963 bp nucleotide sequence, respectively.
Kinds of synthetic primers (primer 9, primer 10, primer
11 and primer 12) were synthesized by known methods.
(1) primer 9 and primer 10, (2) primer 11 and p
rimer 12 and human liver mRNA (Clont
ech) as a template and RT-PC
An R reaction was performed to obtain PCR-amplified DNA fragments (1) and (2). The obtained DNA fragments (1) and (2) were respectively
CIAP (Phosphatase, alkaline from calf intesti
e; BOEHRINGER MANNHEIM) to perform a known dephosphorylation treatment (37 ° C., 1 hour) to dephosphorylate the terminal. The dephosphorylated DNA fragments (1) and (2) were each digested with the restriction enzyme PstI (TAKARA SHUZO Corporation) (37 ° C., 3 hours). DNA fragments (1) and (2) after PstI treatment were converted to T4 DNA Ligase (TOYOBO, Inc.)
After binding to one DNA fragment by treatment,
The 5 ′ end of the DNA fragment was phosphorylated with tide Kinase (TOYOBO). This 5′-terminal phosphorylated DN
The A fragment was converted to the plasmid vector pT7 Blue T (Novagen
Was inserted into the part where the end was blunted with EcoRV to obtain plasmid pTV-HXYL. Plasmid pTV-HXYL thus obtained was transformed into Escherichia coli X
Transformant Escherichia coli introduced into L1 Blue MRF
XL1 Blue MRF / pTV-HXYL was obtained.

[0083]

Industrial Applicability The protein, its partial peptide or a salt thereof of the present invention has an enzymatic activity of catalyzing sugar metabolism such as xylulokinase. The protein of the present invention, a partial peptide thereof or a salt thereof, and a DNA encoding the protein of the present invention or a part thereof
Is useful as a medicament such as a therapeutic / prophylactic agent for diseases such as hypoglycemia and diabetes. Further, the DN of the present invention
A is useful as a gene diagnostic agent for diseases such as hypoglycemia and diabetes because it can detect abnormal expression of the DNA of the present invention. Since an antibody against the protein of the present invention, its partial peptide or a salt thereof can specifically recognize the protein of the present invention, its partial peptide or a salt thereof, the antibody such as the protein of the present invention in a test solution may be used. It can be used for quantification and the like. Further, the protein of the present invention, its partial peptide or a salt thereof,
It is useful as a reagent for screening a compound or a salt thereof that promotes or inhibits the activity of the protein of the present invention.

[0084]

[Sequence list]

[SEQ ID NO: 1] Sequence length: 527 Sequence type: amino acid Topology: linear Sequence type: protein sequence Met Ala Glu His Ala Pro Arg Arg Cys Cys Leu Gly Trp Asp Phe Ser 1 5 10 15 Thr Gln Gln Val Lys Val Val Ala Val Asp Ala Glu Leu Asn Val Phe 20 25 30 Tyr Glu Glu Ser Val His Phe Asp Arg Asp leu Pro Glu Phe Gly His 35 40 45 Val Leu Asp Val His Gly Val His Val His Lys Asp Gly Leu Thr Val 50 55 60 Thr Ser Pro Val Leu Met Trp Val Gln Ala Leu Asp Ile Ile Leu Glu 65 70 75 80 Lys Met Lys Ala Ser Gly Phe Glu Phe Ser Gln Val Leu Ala Leu Ser 85 90 95 Gly Ala Gly Gln Gln His Gly Ser Ile Tyr Trp Lys Ala Gly Ala Gln 100 105 110 Gln Ala Leu Thr Ser Leu Ser Pro Asp Leu Arg Leu His Gln Gln Leu 115 120 125 Gln Asp Cys Phe Ser Ile Ser Asp Cys Pro Val Trp Met Asp Ser Ser 130 135 140 Thr Thr Ala Gln Cys Arg Gln Leu Glu Ala Ala Val Gly Gly Ala Gln 145 150 155 160 Ala Leu Ser Cys Leu Thr Gly Ser Arg Ala Tyr Glu Arg Phe Thr Gly 165 170 175 Asn Gln Ile Ala Lys Ile Tyr Gln Gln Asn Pro Glu Ala Tyr Ser His 180 185 190 Thr Glu Arg Ile Ser Leu Val Ser Ser Phe Ala Ala Ser Leu Phe Leu 195 200 205 Gly Ser Tyr Ser Pro Ile Asp Tyr Ser Asp Gly Ser Gly Met Asn Leu 210 215 220 Leu Gln Ile Gln Asp Lys Val Trp Ser Gln Ala Cys Leu Gly Ala Cys 225 230 235 240 Ala Pro His Leu Glu Glu Lys Leu Ser Pro Pro Val Pro Ser Cys Ser 245 250 255 Val Val Gly Ala Ile Ser Ser Tyr Asn Val Gln Arg Tyr Gly Phe Pro 260 265 270 Pro Gly Cys Lys Val Val Ala Phe Thr Gly Asp Asn Pro Ala Ser Leu 275 280 285 Ala Gly Met Arg Leu Glu Glu Gly Asp Ile Ala Val Ser Leu Gly Thr 290 295 300 Ser Asp Thr Leu Phe Leu Trp Leu Gln Glu Pro Met Pro Ala Leu Glu 305 310 315 320 Gly His Ile Phe Cys Asn Pro Val Asp Ser Gln His Tyr Met Ala Leu 325 330 335 Leu Cys Phe Lys Asn Gly Ser Leu Met Arg Glu Lys Ile Arg Asn Glu 340 345 350 Ser Val Ser Arg Ser Trp Ser Asp Phe Ser Lys Ala Leu Gln Ser Thr 355 360 365 Glu Met Gly Asn Gly Gly Asn Leu Gly Phe Tyr Phe Asp Val Met Glu 370 375 380 Ile Thr Pro Glu Ile Ile GlyArg His Arg Phe Asn Thr Glu Asn His 385 390 395 400 400 Lys Val Ala Ala Phe Pro Gly Asp Val Glu Val Arg Ala Leu Ile Glu 405 410 415 Gly Gln Phe Met Ala Lys Arg Ile His Ala Glu Gly Leu Gly Tyr Arg 420 425 430 Val Met Ser Lys Thr Lys Ile Leu Ala Thr Gly Gly Ala Ser His Asn 435 440 445 Arg Glu Ile Leu Gln Val Leu Ala Asp Val Phe Asp Ala Pro Val Tyr 450 455 460 Val Ile Asp Thr Ala Asn Ser Ala Cys Val Gly Ser Ala Tyr Arg Ala 465 470 475 480 Phe His Gly Leu Ala Gly Gly Thr Asp Val Pro Phe Ser Glu Val Val 485 490 495 Lys Leu Ala Pro Asn Pro Arg Leu Ala Ala Thr Pro Ser Pro Gly Ala 500 505 510 Ser Gln Val Arg Asp His Xaa Asn Leu Phe Val Ala Phe Ala Leu 515 520 525

[0085]

[SEQ ID NO: 2] Sequence length: 1584 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA sequence ATGGCGGAGC ACGCCCCTCG CCGCTGCTGC CTGGGCTGGG ACTTCAGCAC GCAGCAGGTA 60 AAGGTTGTTG CTGTTGATGC AGAGTTGAAT GTCTTCTATGAGGATCAG CAGAATTTGG GCATGTACTT GATGTGCATG GTGTTCATGT GCACAAGGAT 180 GGGCTGACGG TCACTTCTCC AGTACTAATG TGGGTCCAGG CACTGGATAT CATCTTGGAG 240 AAGATGAAGG CTTCGGGCTT CGAATTCTCT CAAGTCCTAG CCTTGTCCGG GGCGGGCCAG 300 CAACACGGAA GTATATACTG GAAGGCTGGA GCCCAGCAGG CACTGACAAG CTTATCACCA 360 GACCTCCGGC TACACCAGCA GCTTCAGGAC TGTTTCTCCA TCAGCGACTG CCCGGTGTGG 420 ATGGACTCCA GCACCACAGC CCAGTGCCGC CAGCTGGAGG CTGCTGTGGG TGGTGCTCAG 480 GCTCTCAGCT GCCTCACGGG GTCCCGTGCC TATGAGCGTT TTACAGGGAA CCAAATTGCA 540 AAAATTTACC AGCAGAACCC CGAGGCCTAC TCACATACAG AGAGAATTTC TTTGGTCAGT 600 AGCTTTGCTG CTTCCCTGTT CCTTGGCTCT TACTCCCCTA TTGACTACAG TGATGGTTCT 660 GGAATGAATT TGTTGCAGAT ACAGGATAAA GTCTGGTCCC AGGCTTGCCT TGGTGCCTGT 720 GCACCTCATT TAGAGGAGAA GCTTAGCCCA CCAGTACCAT CATGCTCAGT TGTGGGAGCC 780 ATTTCTTCCT ACAACGTCCA GCGCTACGGA TTTCCTCCAG GATGCAAAGT GGTGGCCTTC 840 ACTGGGGACA ACCCAGCGTC GCTGGCAGGC ATGAGACTGG AGGAAGGTGA CATTGCGGTC 900 AGCCTGGGCA CCAGTGACAC CCTGTTTCTC TGGCTCCAAG AGCCCATGCC TGCCCTGGAA 960 GGCCACATCT TCTGCAACCC GGTTGACTCC CAGCACTACA TGGCACTCCT GTGCTTTAAA 1020 AATGGCTCCC TCATGAGAGA GAAGATCCGC AACGAGTCTG TATCCCGTTC CTGGAGCGAT 1080 TTCTCTAAGG CACTGCAGTC CACAGAGATG GGCAACGGTG GAAACCTGGG TTTTTATTTT 1140 GATGTAATGG AGATCACCCC TGAAATTATT GGACGTCATA GGTTTAACAC AGAAAACCAC 1200 AAGGTTGCAG CATTCCCTGG GGATGTGGAG GTTCGAGCAC TAATTGAAGG ACAATTCATG 1260 GCCAAGAGGA TTCACGCAGA AGGCCTGGGC TATCGAGTCA TGTCCAAGAC AAAGATTTTG 1320 GCCACAGGAG GAGCATCTCA CAATAGAGAA ATCTTACAGG TGCTTGCAGA TGTGTTTGAT 1380 GCCCCGGTGT ATGTTATAGA CACTGCCAAC TCGGCCTGTG TGGGTTCTGC ATACCGAGCT 1440 TTTCATGGTC TTGCAGGTGG AACAGATGTG CCCTTTTCAG AGGTTGTGAA GTTAGCTCCA 1500 AATCCCAGAC TAGCTGCTAC CCCAAGCCCG GGAGCTTCTC AGGTGAGAGA CCATCRGAAT 1560 TTGTT TGTAG CATTTGCATT ATGA 1584

[0086]

[SEQ ID NO: 3] Sequence length: 1963 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA sequence CAGTCCGGCC GGGCGGAGCT AGGGGCGGGC CCC
TGCGCTCT CTGGGCGCTG GAGCCGCGCG 60 ACTATCACGC CGCGTGGCGG ACGGACGGAC TGA
CGGACGC GCAGCCTTAC CCGAAAGGCC 120 ATGGCGGAGC ACGCCCCTCG CCGCTGCTGC CTG
GGCTGGGG ACTCAGGCAC GCAGCAGGTA 180 AAGGTTGTTTG CTGTTGATGC AGAGTTGAAT GTC
TTCTATG AGGAAAGTGT GCATTTTGAC 240 AGAGATCTTC CAGAATTTGG GCATGTACTTT GAT
GTGCATG GGTTTCATGT GCACAGAGAT 300 GGGCTGACGG TCACTTCTCC AGTACTAATG TGG
GTCCAGG CACTGGATAT CATCTTGGAG 360 AAGATGAAGG CTTCGGGGCTT CGAATTCTCT CAA
GTCCTAG CCTTGTCCGG GGCGGGGCAG 420 CAACACGGAA GTATATACTG GAAGGCTGGA GCC
CAGCAGGG CACTGACAAG CTTATCACCA 480 GACCTCCCGGC TACACCAGCA GCCTCAGGAC TGT
TTCTCCA TCAGCGACTG CCCGGTGTGG540 540 ATGACTCCCA GCACCACAGC CCAGTGCCGC CAG
CTGGAGGG CTGCTGTGGG TGGTGCTCAG 600 GCTCTCAGCT GCCTCACGGG GTCCCGTGCC TAT
GAGCGTTT TTACAGGGAA CCAAATTGCA 660 AAAATTTACC AGCAGAACCC CGAGGCCTAC TCA
CATACAG AGAGATTTC TTTGGTCAGT 720 AGCTTTGCTG CTTCCCTGTT CCTTGGCTCT TAC
TCCCCTA TTGACTACAG TGATGGTTCT 780 GGAATGAATT TGTTGCAGAT ACAGGATAAA GTC
TGGTCCC AGGCTTGCCT TGGTGCCTGT 840 GCACCCTATT TAGAGGGAGAA GCTTAGCCCA CCA
GTACCAT CATGCTCAGT TGTGGGAGCC 900 ATTTCTTCCT ACAACGTCCA GCGCTACGGA TTT
CCTCCAG GATGCAAAGT GGTGGCCTTC 960 ACTGGGGACA ACCCAGCGTC GCTGGCAGGC ATG
AGACTGG AGGAAGGTGA CATTGCGGGTC 1020 AGCCTGGGCA CCAGTGGAC CCTGTTTCTCTCGG
CTCCAAG AGCCATCATC TGCCCTGGAA 1080 GGCCACATCT TCTGCAACCC GGTTGACTCC CAG
CACTACA TGGCACTCCT GTGCTTTAAA 1140 AATGGCTCCC TCATGAGAGA GAAGATCCGC AAC
GAGTCCTG TATCCCGTTC CTGGAGCGAT 1200 TTCTCTAAGG CACTGCAGTC CACAGAGATGGGC
AACGGTG GAAACCTGGG TTTTTATTTTT 1260 GATGTAATGG AGATCACCCC TGAAATTATT GGA
CGTCATA GGTTTAACAC AGAAACCAC 1320 AAGGTTGCAG CATCCCTGG GGATGTGGGAG GTT
CGAGCAC TAATTGAAGG ACAATTCATG 1380 GCCAAGAGGA TTCACGCAGAAGGCCTGGGC TAT
CGAGTCA TGTCCAAGAC AAAGATTTTTG 1440 GCCACAGGAG GAGCATCTCA CAATAGAGAA ATC
TTACAGGG TGCTTGCAGA TGGTTTTTGAT 1500 GCCCCGGTGT ATGTTATAGA CACTGCCAAC TCG
GCCTTGTG TGGGTTCTGC ATACCGAGCT 1560 TTTCATGGTC TTGCAGGTGGG AACAGATTGTG CCC
TTTTCAG AGGTTGTGAA GTTAGTCCCA 1620 AATCCCAGAC TAGCTGCTAC CCCAAGCCCG GGA
GCTTTCTC AGGTGAGAGA CCATCRGAAT 1680 TTGTTTGTAG CATTTGCATT ATGAAAGCCC GCT
AGGGTTT TTTCCCCCAC CAAAAGGTCA 1740 CCTACATTGA ACGTGATGTG CTCAACTAAAA GGA
GAAATTC TGCTTTATTG AAAATTATCAA 1800 GAAAATGGAG CTAAAGGGCC ATGTTGTCAG CTG
CAAGTCA CAGATACTGC TGATTTTACA 1860 GCCAGGGTCA GATGGATTGC TGGGCATATT TGT
ATTGCTT CTTATGCCTC ACGGTGGGCC 1920 CTTCCATGTC ACTGGGCTAT AAAAGCTACT GAA
AGGATCC ATC 1963

[0087]

[SEQ ID NO: 4] Sequence length: 1850 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA sequence TGACGGACGCGCAGCCCTTAC CCGAAAGGCC ATG
GCCGGAGC ACGCCCCTCG CCGCTGCTGC 60 CTGGGCTGGG ACTTCAGCAC GCAGCAGGTA AAG
GTTGTTG CTGTTGATGC AGAGTTGAAT 120 GTCTTCTATG AGGAAAGTGT GCATTTTGAC AGA
GATCTCTC GAGAATTTG GCATGTACTTT 180 GATGTGCATG GTGTTTCATGT GCACAGAGAT GGG
CTGACGG TCACTTCTCC AGTACTAATG 240 TGGGTCCAGG CACTGGATAT CATCTTGGAG AAG
ATGAAGG CTTCGGGCTT CGAATTCTCT 300 CAAGTCCTAG CCTTGTCCGG GGCGGGCCAG CAA
CACGGAA GTATATACTG GAAGGCTGGA 360 GCCCAGCAGGG CACTGACAAG CTTATACCCA GAC
CTCCGGC TACACCAGCA GCTTCAGGAC 420 TGTTTCTCCA TCAGCGACTG CCCGGTGTGG ATG
GACTCCA GCACCACAGC CCAGTGCCGC 480 CAGCTGGAGG CTGCTGTGGGGGTGGTGCTCAG GCT
CTCAGCT GCCTCACGGG GTCCCGTGCC 540 TATGAGCGTT TTACAGGGAA CCAAATTGCA AAA
ATTTACC AGCAGAACCC CGAGCCTAC 600 TCCATACAG AGAGAATTTC TTTGGTCAGT AGC
TTTGCTG CTTCCCTGTTT CCTTGGCTCT 660 TACTCCCCTA TTGACTACAG TGATGGTTTCT GGA
ATGAATT TGTTGCAGAT ACAGGATAAA 720 GTCTGGTCCC AGGCTTGCCT TGGTGCCTGT GCA
CCCTATT TAGAGGAGAA GCTTAGCCCA 780 CCAGTACCAT CATGCTCAGT TGTGGGGAGCC ATT
TCTTCCT ACAACGTCCA GCGCTACCGGA 840 TTTCCTCAG GATGCAAAGT GGTGGCCCTCTC ACT
GGGGACA ACCCAGCGTC GCTGGCAGGC 900 ATGAGACTGG AGGAAGGTGA CATTGCGGGTC AGC
CTGGGGCA CCAGTGACAC CCTGTTTCTC 960 TGGCTCCAAAG AGCCCATGCC TGCCCTGGAA GGC
CACATCT TCTGCAACCC GGTTGACTCC 1020 CAGCACTACA TGGCACTCCT GTGCTTTAAA AAT
GGCTCCC TCATGAGAGA GAAGATCCGC 1080 AACGAGTTCTG TATCCCGTTC CTGGAGCGAT TTC
TCTAAGG CACTGCAGTC CACAGAGATG 1140 GGCAACGGTG GAAACCTGGG TTTTTTATTTT GAT
GTAATGG AGATCACCCC TGAAATTATT 1200 GGACGTCATA GGTTTAACAC AGAAACCAC AAG
GTTGCAG CATCCCTGG GGATGTGGAG 1260 GTTCGAGCAC TAATTGAAGG ACAATTCATG GCC
AAGAGGA TTCACGCAGAGGCCTGGGC 1320 TATCGAGTCA TGTCCAAGAC AAAGAATTTTTG GCC
ACAGGAG GAGCATCTCA CAATAGAGAA 1380 ATCTTACAGGG TGCTTGCAGA TGGTTTTGAT GCC
CCGGGTGT ATGTTATAGA CACTGCCAAC 1440 TCGGCCTGTG TGGGTTCTGC ATACCGAGCT TTT
CATGGTC TTGCAGGTGGG AACAGATTGTG 1500 CCCTTTTCAG AGGTTGTGAA GTTAGCTCCA AAT
CCCAGAC TAGCTGCTAC CCCAAGCCCG 1560 GGAGCTTCTC AGGTGAGAGA CCATCRGAAT TTG
TTTGTAG CATTGCATT ATGAAAGCCC 1620 GCTAGGGTTTTTTTCCCCCAC CAAAAGGTCA CCT
ACATTGA ACGTGATGTG CTCAACTAAA 1680 GGAGAAATTC TGCTTTATTG AAAATTATCAA GAA
AATGGAG CTAAAGGGCC ATGTTGTCAG 1740 CTGCAAGTCA CAGATACTGC TGATTTTTACA GCC
AGGGTCA GATGGATTGC TGGGCATATT 1800 TGTATTGCTT CTTATGCCTC ACGGTGGGCC CTT
CCATGTC ACTGGGCTAT 1850

[0088]

[SEQ ID NO: 5] Sequence length: 20 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: synthetic DNA sequence TTCTTCCTAC AACGTCCAGC 20

[0089]

[SEQ ID NO: 6] Sequence length: 20 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: synthetic DNA sequence TCTCTCATGA GGGAGCCATT 20

[0090]

[SEQ ID NO: 7] Sequence length: 20 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: synthetic DNA sequence GGTTGTTGCT GTTTGATCAG 20

[0091]

[SEQ ID NO: 8] Sequence length: 21 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: synthetic DNA sequence TGAGCACATC ACGTTCAATG T 21

[0092]

[SEQ ID NO: 9] Sequence length: 20 Sequence type: nucleic acid Number of strands: single strand Topology: linear Sequence type: synthetic DNA sequence GACAAGGCTA GGACTTGGAGA 20

[0093]

[SEQ ID NO: 10] Sequence length: 20 Sequence type: nucleic acid Number of strands: single strand Topology: linear Sequence type: synthetic DNA sequence CGAAGCCTTC ATCTTCTCCA 20

[0094]

[SEQ ID NO: 11] Sequence length: 20 Sequence type: nucleic acid Number of strands: single strand Topology: linear Sequence type: synthetic DNA sequence GTGCCCTTTT CAGAGGTTGT 20

[0095]

[SEQ ID NO: 12] Sequence length: 20 Sequence type: nucleic acid Number of strands: single strand Topology: linear Sequence type: synthetic DNA sequence AATCCCAGAC TAGCTGCTAC 20

[0096]

[SEQ ID NO: 13] Sequence length: 19 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: synthetic DNA sequence TGACGGACGCGCAGCCTTTA 19

[0097]

[SEQ ID NO: 14] Sequence length: 19 Sequence type: nucleic acid Number of strands: single strand Topology: linear Sequence type: synthetic DNA sequence AGGTTTCCAC CGTTGCCCA 19

[0098]

[SEQ ID NO: 15] Sequence length: 20 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: synthetic DNA sequence AAGATCCGCA ACGAGTCTGT 20

[0099]

[SEQ ID NO: 16] Sequence length: 20 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: synthetic DNA sequence ATAGCCCAGT GACATGGAAG 20

[0100]

[Brief description of the drawings]

FIG. 1 shows four cosmids (contig 5) obtained in Example 1.
36, 483, 508, 459) and predicted exon sites.

FIG. 2 shows the nucleotide sequence of the DNA encoding the protein of the present invention obtained in Example 2 and the amino acid sequence encoded thereby.

FIG. 3 shows a comparison of the homology of the protein of the present invention obtained in Example 2 with the amino acid sequences of xylulokinase.

Continued on the front page (51) Int.Cl. ⁶ Identification symbol FI C12N 9/12 C12Q 1/48 Z C12Q 1/48 G01N 33/53 D G01N 33/53 A01K 67/027 // A01K 67/027 A61K 37 / 52 ADP (C12N 1/21 C12R 1:19) (C12N 9/12 C12R 1:19) (72) Inventor Yusuke Nakamura 1-17-33 Azamino, Aoba-ku, Yokohama-shi, Kanagawa Prefecture (72) Mayumi Tamari Tokyo 2-31-39, Nishi 2-chome, Tokyo Kunitachi City

Claims (16)

[Claims] 1. A protein having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, or a salt thereof. 2. The protein according to claim 1, which has xylulokinase activity. 3. A partial peptide of the protein according to claim 1, or a salt thereof. 4. The protein according to claim 1 or claim 3.
Having a nucleotide sequence encoding the partial peptide described in the above.
DNA containing A. 5. The DNA according to claim 4, which has the nucleotide sequence represented by SEQ ID NO: 2. 6. A recombinant vector containing the DNA according to claim 4. [7] A transformant transformed with the recombinant vector according to [6]. 8. A protein or a salt thereof according to claim 1, wherein the transformant according to claim 7 is cultured to produce and accumulate the protein or a salt thereof according to claim 1, and collected. Alternatively, the method for producing the partial peptide according to claim 3 or a salt thereof. 9. A medicament comprising the protein according to claim 1, the partial peptide according to claim 3, or a salt thereof. 10. The medicament according to claim 9, which is a therapeutic / prophylactic agent for diabetes. [11] A pharmaceutical comprising the DNA according to [4]. (12) a therapeutic or prophylactic agent for diabetes.
The medicament according to claim. 13. An antibody against the protein according to claim 1, the partial peptide according to claim 3, or a salt thereof. 14. A compound which inhibits or activates the enzymatic activity of the protein or its salt according to claim 1, wherein the protein according to claim 1 or the partial peptide according to claim 3 or a salt thereof is used. A method for screening the salt. (15) The method according to the above (1), comprising the protein according to the above (1), the partial peptide according to the above (3) or a salt thereof.
A screening kit for a compound or a salt thereof, which inhibits or activates the enzyme activity of the protein or a salt thereof described above. 16. A compound or a salt thereof which is obtained by using the screening method according to claim 14 or the screening kit according to claim 15 for inhibiting or activating the enzyme activity of the protein or salt thereof according to claim 1.