JPH1128100A - Carrier for hybrid formation and its preparation - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a carrier for hybrid formation that can simply and efficiently immobilize nucleic acid, hardly occurs nonspecific trapping of nucleic acid and can do high accuracy detection, isolation and purification of nucleic acid. SOLUTION: The carrier for hybrid formation is made of particles of an organic polymer which has nonporous surface with the particle sizes of 0.05-5 μm. On the surface of the organic particles, a single stranded polynucleotide is immobilized at the part of the nucleotide sequence having the nucleotide sequence containing 2 or more primary amino groups by the amide linkage formed by this primary amino group with the carboxyl group of the organic polymer particle (where the peptide bonds are excluded).

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a carrier for hybridization which is useful for detection, separation, purification, etc. of a nucleic acid and a method for preparing the same.

[0002]

2. Description of the Related Art A solid support having a nucleic acid immobilized on its surface is known to be useful for a technique for detecting, separating and purifying a nucleic acid having a specific base sequence of interest. This technique uses a method developed by researchers in the field of recombinant DNA technology to modify single-stranded DNA
Alternatively, the present invention utilizes a method in which an RNA nucleic acid forms a hybrid through hydrogen bonding between bases with another single-stranded nucleic acid containing a substantially complementary base sequence under appropriate conditions.

[0003] As a method for immobilizing single-stranded denatured nucleic acids on the surface of a solid support, conventionally, generally, a solid support made of a material such as nitrocellulose or nylon having a high affinity for nucleic acids has been used. In order to strengthen the immobilization after contacting the nucleic acid with the nucleic acid and trapping the nucleic acid on the support, a method of baking or ultraviolet irradiation is used. However, this method uses a solid support having a high affinity for nucleic acids, and therefore, a nucleic acid having no target specific base sequence or a nucleic acid probe for detection in a sample is formed on the surface of the support during hybridization. Has a problem that it is easily non-specifically captured. Therefore, in order to prevent non-specific trapping of nucleic acids, the surface of the support is coated with a polymer substance irrelevant to the specific base sequence of interest, and the operation of repeatedly washing the support after hybridization is indispensable and extremely complicated. It is.

[0004] In order to solve the above-mentioned disadvantages, various nucleic acid-immobilized supports and methods for producing the same have been proposed. In it, the sequence portion of the nucleotide constituting the nucleic acid is substituted with a carbon chain having 4 to 20 carbon atoms (a part of the carbon atoms may be substituted with a hetero atom such as O, N, S, etc., and is called an "arm"). Be done)
A support in which a nucleic acid is indirectly immobilized by interposing a nucleic acid is known, and the nucleic acid-immobilized support is obtained by previously activating a specific site of a base in a nucleotide serving as an immobilization site and providing the support. It is produced by reacting with a reactive group serving as an "arm" to form a covalent bond (Japanese Patent Application Laid-Open No. 61-13033).
No. 05). In addition, a method is known in which a nucleic acid is linked to a support on which nucleotides or oligonucleotides are immobilized by utilizing an enzymatic reaction (JP-A-61-24620).
No. 1).

[0005]

However, Japanese Patent Application Laid-Open No.
In the method described in JP-A-130305, when activating a specific site of a base, it is necessary to protect another reactive group in the nucleic acid with a protecting group in advance, and this protecting group fixes the nucleic acid to a support. It is necessary to completely remove it after conversion. Removal of this protecting group requires several conversions of the reaction solvent, recovery and purification of the reaction product, and also requires a reaction time of several hours to several days, which is a very complicated and time-consuming operation. is necessary. In the method described in JP-A-61-246201, it is necessary to link nucleic acids with a certain direction in order to increase the effective amount of immobilized nucleotides or oligonucleotides. A remarkably complicated operation similar to that of the method disclosed in Japanese Unexamined Patent Publication No. Sho 61-130305 is required. Further, it is considered that a large excess of expensive enzymes is required, which is economically disadvantageous. Therefore, the above two methods are not practical for daily use. Accordingly, an object of the present invention is to provide a hybrid-forming carrier that is simple, can immobilize nucleic acids efficiently, does not easily cause non-specific traps of nucleic acids, and enables high-precision nucleic acid detection, separation and purification. It is to provide a preparation method.

[0006]

SUMMARY OF THE INVENTION The present invention solves the above-mentioned problems of the prior art, in that the surface of a non-porous organic polymer particle having a particle size of 0.05 to 5 .mu.m is
The single-stranded polynucleotide comprises a first polynucleotide contained therein.
An amide bond (excluding a peptide bond) formed by the primary amino group and the carboxyl group of the organic polymer particle in the portion of the nucleotide sequence consisting of two or more consecutive nucleotides having a primary amino group. It is intended to provide an immobilized carrier for hybrid formation.

[0007]

BEST MODE FOR CARRYING OUT THE INVENTION Materials for organic polymer particles (hereinafter simply referred to as polymer particles) used for the carrier of the present invention include, for example, styrene, chlorostyrene, chloromethylstyrene, α-methylstyrene, divinylbenzene, Sodium styrene sulfonate, (meth) acrylic acid,
Methyl (meth) acrylate, ethyl (meth) acrylate, n-butyl (meth) acrylate, 2-hydroxyethyl (meth) acrylate, polyoxyethylene (meth) acrylate, glycidyl (meth) acrylate , Ethylene glycol-di- (meth) acrylate,
(Meth) acrylic acid tribromophenyl, (meth) acrylonitrile, (meth) acrolein, (meth) acrylamide, methylenebis (meth) acrylamide, butadiene, isoprene, vinyl acetate, vinylpyridine, N
Aromatic vinyl compounds such as vinylpyrrolidone, vinyl chloride and vinyl bromide, esters or amides of α, β-unsaturated carboxylic acids, α, β-unsaturated nitrile compounds,
Water-insoluble organic high molecular substances obtained by polymerizing one or more vinyl monomers composed of a vinyl halide compound, a conjugated diene compound, and a lower fatty acid vinyl ester or chemically modifying the organic high molecular substance Examples of the obtained water-insoluble and non-swellable organic polymer substance can be given. These polymer particles can be produced by a known method such as emulsion polymerization, suspension polymerization, and solution precipitation polymerization. In addition, the polymer particles can be obtained by dispersing the organic polymer solution in a non-solvent, crosslinking, or volatilizing the solvent, but the method for producing the polymer particles is not limited thereto. Not something. The polymer particles may contain a filler, for example, a magnetic powder or the like, if necessary.

The surface of the polymer particles used in the present invention must be non-porous. Here, that the surface of the polymer particle is “non-porous” means that the particle surface does not have pores having a major axis of 100 or more. If the surface of the polymer particles is not non-porous, that is, if a pore having a major axis of 100 nm or more is present on the surface of the particle, a labeled probe used in a nucleic acid detection method or the like described below is captured inside the particle. Depending on the cause, the sensitivity and accuracy of hybridization may decrease. Also, in the separation or purification of nucleic acids described later, substances other than the object of separation or purification are trapped inside the polymer particles, resulting in a decrease in separation efficiency or purification degree. As described above, the surface of the polymer particles needs to be non-porous, but closed cells or the like may exist inside the polymer particles.

The particle size of the polymer particles used in the present invention is 0.05 to 5 μm, preferably 0.2 to 1 μm. If the particle size is less than 0.05 μm, it takes a long time to centrifuge the particles after the hybridization, for example, from a sample solution, and if the particle size is more than 5 μm, the particles are formed before the hybridization is sufficiently performed. Is likely to settle in the sample solution. Since the particles used in the present invention are used in an aqueous medium, they need to be insoluble in water and non-swellable.

The single-stranded polynucleotide of the carrier of the present invention includes, for example, higher animals, higher plants, molds,
Structural alterations such as addition of one or more nucleotides to naturally occurring nucleic acids such as DNA, RNA, cloned DNA, and plasmids derived from bacteria, viruses, etc., fragments of these nucleic acids, and natural nucleic acids And synthetic polynucleotides. Where
A double-stranded polynucleotide such as DNA needs to be treated in advance to be single-stranded. In the single-stranded polynucleotide, a nucleotide having a primary amino group contained in the single-stranded polynucleotide is bonded to the polymer particles via an amide bond in a portion of a nucleotide sequence in which two or more, usually 2 to 15 consecutive nucleotides are contained. .

The single-stranded polynucleotide of the carrier of the present invention must be capable of forming a hybrid with another nucleic acid which is used for the purpose or means of detection, purification, separation, etc. It is necessary to include a nucleotide sequence that is substantially complementary, and the single-stranded polynucleotide is selected according to the specific nucleotide sequence contained in the partner nucleic acid. The base sequence complementary to the specific base sequence of the nucleic acid of the partner forming the hybrid is a free portion of the single-stranded polynucleotide, that is, a portion not bound to the polymer particles, such as a free portion in the case of a linear polynucleotide. It is preferable from the viewpoint of hybridization that the compound be present at a different end. Especially,
The linear single-stranded polynucleotide is immobilized on the polymer particle at the 5 ′ end, and when a base sequence complementary to the specific base sequence is present on the free 3 ′ end, A nucleic acid elongation reaction using a nucleic acid synthase using the present strand polynucleotide as a primer becomes possible, which is preferable because it can be applied to the synthesis of cloned DNA on polymer particles or the detection of a specific base sequence based on the incorporation of a labeled nucleotide.

The carrier of the present invention comprises, for example, organic polymer particles having a nonporous surface and a carboxyl group and having a particle size of 0.05 to 5 μm, and two or more nucleotides having a primary amino group are continuous. It can be prepared by reacting a single-stranded polynucleotide containing a nucleotide sequence with a dehydrating condensing agent. The polymer particles used as a starting material in this method need to have a carboxyl group involved in the formation of an amide bond on the surface,
Other conditions are as described above. Therefore, when the polymer particles used as a raw material do not have a carboxyl group on the surface, it is necessary to introduce a carboxyl group on the surface in advance. It is preferable that at least one carboxyl group exists per 1 nm ^{2 of the} surface area of the polymer particles, more preferably 3 or more, further preferably 5 or more. Polymer particles having such a carboxyl group on the surface and suitable for the above-mentioned method include, for example, Imtex SSM-6
0, SSM-58, SSM-57, G0303, G03
02, G0301, G0201, G0202, G050
1, L0101 and L0102; and commercially available products such as Imtex DRB-F1, DRB-F2, and DRB-F3 (trade names (JSR Corporation)). In addition, various known methods can be used to introduce a carboxyl group on the surface of a polymer particle having no carboxyl group.

The single-stranded polynucleotide used in the above-mentioned preparation method is as described above, except that two or more nucleotides having a primary amino group (-NH ₂ ) are continuously present in the molecule. Nucleotide sequence (hereinafter,
"Amino acid-containing nucleotide sequence". This amino group-containing nucleotide sequence usually has 2 to 2 nucleotides having a primary amino group.
It is composed of 15 pieces in a row. If the number of nucleotides having a primary amino group is less than 2, the immobilization rate of the single-stranded polynucleotide on the polymer particles is undesirably low. In addition, when the single-stranded polynucleotide used in this method is linear, the amino group-containing nucleotide sequence is preferably present at its end, particularly preferably at the 5 'end. Among the single-stranded polynucleotides used in this method, preferred are those in which an amino group-containing nucleotide sequence is present on the 5′-terminal side and is substantially complementary to a specific nucleotide sequence of a nucleic acid to be hybridized. It is a single-stranded polynucleotide whose sequence is located at the 3 'end, particularly a single-stranded DNA.

Examples of the nucleotide having a primary amino group include deoxyadenylic acid (dA), deoxycytidylic acid (dC), and deoxyguanylic acid (dG). DA and dC are preferred from the viewpoint of high reactivity in dehydration condensation with a carboxyl group. The amino group-containing nucleotide sequence is 1
May be composed of different types of nucleotides, or may be composed of two or more nucleotides, but may be complementary to a nucleotide sequence other than the specific nucleotide sequence in the nucleic acid to be hybridized by chance. Is preferred to consist of one nucleotide, especially dA or dC.

In the case where the single-stranded polynucleotide to be used for preparing the carrier of the present invention does not contain an amino group-containing nucleotide sequence, it is necessary to prepare the single-stranded polynucleotide before subjecting it to the above-mentioned preparation method.
It is necessary to introduce an amino group-containing nucleotide sequence into the molecule. In this case, when the single-stranded polynucleotide used in the above-described preparation method is produced by, for example, chemical synthesis using a DNA synthesizer, a required amino group-containing nucleotide sequence is formed at a desired position in the molecule. What is necessary is just to make a program and manufacture it. In addition, an amino group-containing nucleotide sequence can be introduced into the end of the polynucleotide by an addition reaction using terminal deoxytransferase. Furthermore, an amino group-containing nucleotide sequence can be introduced by linking a polynucleotide and an oligonucleotide comprising an amino group-containing nucleotide sequence using T4 DNA ligase. Other well-known tailing reactions of nucleic acids and ligation reactions between nucleic acids can be used. [For example, “Molecular Cloning”, Cold Spring Harbor
Laboratories, 1982].

The dehydrating condensing agent used in the above-mentioned preparation method includes, for example, carbodiimides such as 1-ethyl-3- (N, N'-dimethylamino) propyl carbodiimide, Woodward reagent K, N-ethoxycarbonyl- 2
Preferred are water-soluble dehydrating condensing agents such as -ethoxy-1,2-dihydroquinoline (EEDQ), but oil-soluble dehydrating condensing agents can also be used. These dehydration condensing agents are usually 1 to 20 mol per 1 equivalent of the carboxyl group on the surface of the polymer particles used,
Preferably, 2 to 10 moles are used. In this reaction, for example, after charging polymer particles having a carboxyl group on the surface and a single-stranded polynucleotide containing an amino group-containing nucleotide sequence in a reaction vessel of an appropriate size, the dehydrating condensing agent is added. Can be performed.
The amount of the polymer particles to be used is generally 0.5 to 500 g, preferably 5 to 50 g, per 1 mmol of the single-stranded polynucleotide containing the amino group-containing nucleotide sequence. The reaction is usually performed in an aqueous medium having a pH of about 3 to 11 at 4 to 70 ° C.
At 5 minutes to overnight. The carrier of the present invention is formed by dehydrating and condensing the primary amino group of the amino group-containing nucleotide sequence of the single-stranded polynucleotide with the carboxyl group on the surface of the polymer particle by the above method to form an amide bond. can get.

The carrier of the present invention and the above-mentioned preparation method can be used for detection of nucleic acids by a sandwich method and a competitive method. According to the sandwich method, first, two specific and non-overlapping specific base sequences are selected from the base sequences of the nucleic acids to be detected from the specimen sample. Next, one of the two types of nucleic acids having a base sequence complementary to each specific base sequence is bonded to a polymer particle to form the carrier of the present invention, and the other is labeled with an appropriate label to form a labeled nucleic acid probe. I do. When the carrier and the labeled nucleic acid probe are subjected to hybridization with the nucleic acid in the sample, if the nucleic acid containing the specific base sequence to be detected is present in the sample, the nucleic acid of the carrier and the labeled nucleic acid probe are combined. The nucleic acids in the sample are bound by hybridization so as to sandwich the nucleic acids. Next, a nucleic acid containing a specific base sequence can be detected by detecting the labeled nucleic acid probe bound to the carrier as a tracer.

According to the competition method, first, a single-stranded nucleic acid containing a base sequence complementary to a specific base sequence of a nucleic acid to be detected in a sample is bound to polymer particles to obtain a carrier of the present invention.
On the other hand, a nucleic acid containing a specific base sequence substantially equivalent to the nucleic acid to be detected in the specimen sample is labeled and used as a probe.
Next, when the carrier, the specimen sample and the probe are mixed and subjected to a hybridization reaction, if a nucleic acid having a specific base sequence to be detected is present in the sample, the nucleic acid is a single-stranded nucleic acid bound to the carrier. Compete with the probe for hybridization with the nucleic acid. If there is no nucleic acid to be detected in the sample, only the probe will hybridize with the single-stranded nucleic acid on the carrier. The amount of the probe that forms a hybrid with the single-stranded nucleic acid on the carrier decreases in accordance with the amount of the nucleic acid to be detected present in the sample.By detecting this probe, the nucleic acid containing the specific base sequence can be specifically identified. Can be quantitatively determined.

In the above sandwich method and competitive method, a sample sample containing nucleic acid, a labeled nucleic acid probe and a buffer suitable for hybridization are added to polymer particles bound with nucleic acid, and the mixture is left at an appropriate temperature for about 2 hours. To form a hybrid. Next, the excess labeled nucleic acid probe is removed by centrifugation or the like, and the label bound to the carrier is detected by analysis. The probe used for the detection of the nucleic acid is a single-stranded nucleic acid to be directly detected and has a label that can be easily detected. The labels used should be readily detectable as tracers, such as enzymatically active groups, fluorophores, chromophores, luminophores, ligands capable of specific binding, heavy metals and radioisotopes. The labeled probe trapped on the carrier by hybridization can be easily detected. The sandwich method and the competitive method described above can be used for detection of pathogens such as bacteria and viruses, screening of antibiotics and antiviral agents, diagnosis of genetic disorders, and detection of cancer cells.

Further, the carrier of the present invention can be used for separating nucleic acids containing a specific base sequence. This nucleic acid separation is performed by immobilizing a single-stranded nucleic acid containing a base sequence complementary to a specific base sequence in a nucleic acid sample to polymer particles to form a carrier of the present invention. And a nucleic acid containing a specific base sequence in the nucleic acid sample, and then the nucleic acid hybridized with the carrier is separated.

In this method, in order to separate the nucleic acid to be separated from the nucleic acid on the carrier as a hybrid with the carrier and from nucleic acids and other contaminants that have not hybridized with the carrier, these unnecessary nucleic acids and the like are centrifuged. The nucleic acid having the specific base sequence of interest is recovered by a heat treatment that breaks the hydrogen bond between nucleic acid molecules constituting the hybrid, or a treatment with alkali, formamide, or urea. By doing so, nucleic acids can be separated. This nucleic acid separation is used, for example, to separate a nucleic acid having a specific base sequence such as mRNA or DNA encoding a protein useful for humans, animals, plants or microorganisms from a sample such as a crude extract of cells. Useful. It should be noted that conditions such as a buffer solution, a temperature, and a reaction time which are suitable for the hybridization performed in the above-described nucleic acid detection and separation are obvious to those skilled in the art.

As described above, the carrier of the present invention can be used to clone isolated nucleic acids, particularly RNA, on the carrier. That is, a single-stranded nucleic acid containing a sequence complementary to a part of the sequence to be cloned at the 3 ′ end (hereinafter referred to as immobilized nucleic acid) is immobilized on polymer particles at the 5 ′ end, Is formed, and then the carrier is hybridized with a nucleic acid having a sequence to be cloned in a nucleic acid sample (hereinafter referred to as a target nucleic acid), and the target nucleic acid is used as a template and immobilized. Using nucleic acid as a primer, reverse transcriptase or D
The DNA having a sequence complementary to the target nucleic acid (hereinafter, simply referred to as cloned DNA first strand) can be synthesized by the action of NA polymerase.

Further, the Okayama-Berg method (H. Okayama and
P. Berg; Molecular and Cellular Biology,
2, 161-170, 1982), and the Gubler-Hoffmann method (U. Gubler and GJ Hoffmann; Gene, 2).
5,263-269,1983), Cloning of cDNA using S ₁ nuclease (Williams, J.
G. FIG. "Genetic Engineering", vo1.1, p. 1
~ 59, Academic Press, London and New Yor
k, 1981) and the like, a sequence complementary to the cloned DNA first strand, that is, a DNA having a sequence equal to the target nucleic acid (hereinafter simply referred to as cloned DNA).
A second strand), and the target nucleic acid can be converted into a single-stranded nucleic acid and then cloned. In the above method, a restriction enzyme may be present between the sequence of the immobilized nucleic acid in which two or more nucleotides having a primary amino group are continuous and a sequence complementary to a part of the target nucleic acid at the 3 ′ end. By inserting a recognition sequence, the cloned DNA
After the chain is synthesized, the cloned DNA can be cut off from the carrier by the action of a restriction enzyme and recovered.

Further, after synthesizing the first strand of the cloned DNA using the immobilized nucleic acid containing the recognition sequence of the restriction enzyme,
Oligo (dA), oligo (dT), oligo (dC) or oligo (dG) is added to the 5 'end of the cloned DNA by an addition reaction, the target nucleic acid is removed by degradation or denaturation, and the added oligonucleotide (addition A hybrid is formed between the single-stranded nucleic acid containing a base sequence complementary to the base sequence on the 3 ′ end side and containing a recognition sequence of a restriction enzyme, and a tailing site of the cloned DNA first strand, Next, using the nucleic acid complementary to the additional sequence as a primer and the cloned DNA first strand as a template, DN
After synthesizing the second strand of the cloned DNA by the action of a nucleic acid elongation enzyme represented by A polymerase, the restriction enzyme is actuated to cause both ends (5 'end and 3'
The cloned DNA having a recognition site for a restriction enzyme at the end can be cut off and recovered. The cloned DNA thus obtained can be directly incorporated into a plasmid having the same restriction enzyme recognition site. In this method for synthesizing cloned DNA, the nucleic acid complementary to the additional sequence may be the carrier for hybridization of the present invention immobilized on polymer particles.

[0025]

Hereinafter, the present invention will be described in detail with reference to examples. However, the present invention is not limited to the examples. Example 1 (1) Polynucleotide 5 ′-(dC) _n (dT) ₃₀ −
The prepared nucleotide sequence of 3 ′ (n = 0, 1, 3, 7, or 10) is 5 ′-(dC) _n (dT) ₃₀ -3 ′
(N = 0, 1, 3, 7, or 10) [where the 5'- at the left end and the -3 'at the right end indicate the 5' end and the 3 'end, respectively. Hereinafter the same) 5
Species polynucleotides were synthesized by the solid phase method using the β-cyanoethyl method using a DNA synthesizer (Applied Biosystems, Model 381A). Excision and collection of the synthesized polynucleotide from the solid phase were performed according to the manual for the device. Next, each of the obtained polynucleotides was dissolved in 250 μl of a TNE buffer (a buffer composed of 10 mM Tris-HCl buffer, pH 7.5, 100 mM sodium chloride and 1 mM ethylenediaminetetraacetic acid), and then swollen with the TNE buffer. The mixture was subjected to gel filtration using a Sephadex G-50 (Pharmacia) column (5 ml). The eluate from the gel filtration was sequentially collected in 0.5 ml portions, and each fraction was analyzed at 260 nm.
The absorbance was measured, and the fractions passed through were discriminated and collected. The polynucleotide was purified from the collected polynucleotide solution by precipitation with ethanol. Next, after dissolving the purified polynucleotide in 500 μl of sterilized water, the absorbance at 260 nm was measured to quantify the polynucleotide. As a result, about 1 mg of each of the five polynucleotides was obtained as a 500 μl aqueous solution.

(2) Labeling with ³² P Each of the five polynucleotides obtained in (1) was labeled with ³² P as follows. 1 μl of the polynucleotide aqueous solution obtained in (1) (containing 2 μg of polynucleotide),
1 μl of polynucleotide kinase (manufactured by Boehringer Mannheim) (8 U of enzyme activity), 5 μl of γ- ³² P-adenosine triphosphate (50 μCi of radiation dose),
5 μl of 0 × 5′-phosphorylation buffer and 38 μl of sterile water were placed in a 1.5 ml Eppendorf centrifuge tube, mixed and incubated at 37 ° C. for 30 minutes.

Next, a polynucleotide kinase was extracted from the reaction solution by a phenol extraction method (“Molecular Cloning”, Cold
Spring Harbor Laboratories, 1982, p. 45
8), the reaction solution was subjected to gel filtration using a Sephadex G-50 (manufactured by Pharmacia) column (1 ml) swollen with a TNE buffer solution. The 10-fold concentration 5'-phosphorylation buffer used above has the following composition. The eluate from the gel filtration was fractionated in an order of 100 μl, and the radiation dose of each fraction was measured by the Cherenkov counting method to discriminate the passed fractions and collect them. As a result, 5 kinds of polynucleotides 5 ′-(dC) labeled with ³² P
200 μl of TNE buffer solution for each of _n (dT) ₃₀ -3 ′ (where n = 0, 1, 3, 7 or 10) was obtained. These are 400,000 cpm per μl
The solution had a radiation dose of the count.

(3) Carboxy-modified polymer
Immobilization particle size 0.36μm to particles, the polymer particle surface is carboxy modified so as to have a surface area 1 nm ² per 9 carboxyl groups Imutekkusu SSM-60 (JSR (Ltd.))
1 (w / v)% 0.0001N hydrochloric acid suspension 500μ
1, the nucleotide sequence synthesized in (1) is 5 ′-(d
C) _n (dT) ₃₀ -3 ′ (where n = 0, 1, 3, 7)
Or 10) a is polynucleotide 1 nmole, 1-ethyl-3-(N, N'-dimethyl amino) propyl carbodiimide 0.5 (w / v)% 0.0001N hydrochloric acid solution 500 [mu] l, ³² prepared in (2) A P-labeled polynucleotide (having the same dC number as an unlabeled polynucleotide) of 400,000 cpm is placed in a 1.5 ml Eppendorf centrifuge tube and mixed overnight in a thermostat set at 50 ° C. to obtain ³² P-labeled polynucleotide. Was bound to the polymer particles via an amide bond. afterwards,
The carrier for hybridization was collected as a precipitate by centrifugation at 10,000 rpm for 5 minutes. Next, a binding buffer (10 mM Tris-HCl buffer pH 7.5, 500 m
M sodium chloride (a buffer consisting of 0.1% (w / v) sodium dodecyl sulfate and 1 mM ethylenediaminetetraacetic acid) was added to the hybridizing support in an amount of 1 ml, and the hybridizing support was redispersed.
The operation of collecting the hybridization support by centrifugation at rpmM for 5 minutes was repeated three times to wash the hybridization support. The radioactivity remaining on the hybridization support thus obtained was measured by the Cerenkov counting method, and this value was divided by the count of the added ³² P-labeled oligonucleotide (400,000 cpm) to determine the immobilization rate. Was. Table 1 shows the results.

[0029]

[Table 1]

Real Rotation Example 2 Quantification of Polyadenylic Acid Sequence Contained in Vaccinia Virus mRNA (1) Preparation of Hybridization Support First, the base sequence was 5'-CCCC using a DNA synthesizer.
CCCCCCTTTTTTTTTTTTTTTTTTTTTT
'Polynucleotide 5 is a' TTTTTTTTTTT-3 - were synthesized _{(dC) 10 (dT) 30} -3 '. The (dT) ₃₀ sequence at the 3 ′ end of this polynucleotide is complementary to a polyadenylic acid (hereinafter abbreviated as “poly (A)”) sequence contained in vaccinia virus mRNA. The (dC) ₁₀ sequence at the 5 ′ end is a portion used for immobilization to polymer particles. Carboxy-modified polymer particles (Imtex SSM-60, JSR
2.5 ml of a 1% (w / v)% 0.0001N hydrochloric acid suspension in 1% (w / v), 0.0 mg of 5 mg / ml of 1-ethyl-3 (N, N'-dimethylamino) propylcarbodiimide.
2.5 ml of a 001N hydrochloric acid solution, 100 μg of the above-mentioned synthetic polynucleotide and a method similar to that of Example 1- (2).
^The above synthetic polynucleotide 10, labeled with ³² P,
000 cpm and reacted at 50 ° C. for 6 hours. After the reaction, the suspension of the carrier for hybridization is 3,000 rpm.
For 15 minutes to collect the solid content of the carrier for hybridization. The carrier for hybridization was suspended again in 10 ml of 0.0001N hydrochloric acid, and washed by repeating centrifugation. After thorough washing, 10 mM
Tris hydrochloride buffer pH 7.5, 0.1 M sodium chloride, 1 mM ethylenediaminetetraacetic acid (pH 7.5), and suspended in a solution consisting of 0.1 (w / v)% sodium dodecyl sulfate to make the total volume 5 ml. did. 0.5 (w / v)% of the thus obtained hybridizing carrier
The suspension was stored at 4 ° C. The immobilization rate of the polynucleotide of the carrier for hybridization thus prepared was 98%.
That is, it was found that 98 μg was immobilized on the polymer particles at the 5 ′ end side.

(2) Poly (A) of vaccinia virus
Preparation of mRNA having sequence Vaccinia virus was added to a detergent (0.5 (w / v)%
NP40) and collected as a pellet by centrifugation. Add 50 mM Tris-HCl buffer (pH 8.6), 7.5 mM magnesium chloride,
0 mM β-mercaptoethanol, 5 mM adenosine triphosphate, 5 mM cytidine triphosphate, 5 mM guanosine triphosphate, 5 mM uridine triphosphate, 0.5 (w / v)%
Solution containing NPS-40, 0.3 mM S-adenosylmethionine and RNase inhibitor 2,000
0 μl was added and incubated at 37 ° C. for 3 hours.
Next, the supernatant obtained by centrifuging the reaction solution at 15,000 rpm for 10 minutes is extracted with phenol, and then subjected to column chromatography using Sephadex G-100 (manufactured by Pharmacia) to collect a flow-through fraction. Was. The collected fraction is applied to a column filled with oligo (dT) cellulose, and fractionated into mRNA having a poly (A) sequence and mRNA having no poly (A) sequence,
18 μg of mRNA having a poly (A) sequence and 10 μg of mRNA having no poly (A) sequence were obtained.

(3) mRNA of poly (A) sequence
Quantitative (3-1) Transfer 20 μl of the carrier suspension for hybridization prepared in (1) to an Eppendorf centrifuge tube,
After adding 1 ml of M Tris-HCl buffer (pH 8.3), the carrier for hybrid formation was recovered by centrifugation at 10,000 rpm for 5 minutes. The carrier for hybrid formation has the following composition: 100 mM Tris-HCl buffer (pH 8.3) 160 mM potassium chloride 20 mM β-mercaptoethanol 1 mM deoxyadenosine triphosphate 1 mM deoxyguanosine triphosphate 1 mM deoxythymidine triphosphate 49 μl of a solution containing 1 mM deoxycytidine triphosphate 10 μCi α- ³² P deoxycytidine triphosphate 10 mM magnesium chloride 8 U RNase inhibitor was added, and the mRNA having the poly (A) sequence prepared in (2) was further subjected to 65 ° C. And then rapidly cooled in an ice bath for 10 ng, 1 ng, 0.1 ng.
After adding ng or 0 ng, hybridization was carried out by incubating at 43 ° C. for 10 minutes. Next, 1 μl of reverse transcriptase RTase (Life Science) was added to the reaction solution.
(Equivalent to 17 U) was added and incubated at 43 ° C. for 15 minutes. Thereafter, 1 μl of 0.5 M ethylenediaminetetraacetic acid (pH 8.0) was added, and 10 mM Tris-HCl buffer (pH 8.0), 100 mM sodium chloride and 1 mM ethylenediaminetetraacetic acid were added while performing suction filtration using a 0.22 μm membrane filter. Acetic acid (pH 8.
Washed with the solution consisting of 0). After washing, the membrane filter is dried, and a toluene-based liquid scintillator 5 ml
The radioactivity of the hybridization support filtered on a membrane filter was measured.

(3-2) mRN having poly (A) sequence
The experiment was performed according to the same procedure as described in the above section (3-1), except that mRNA having no poly (A) sequence prepared in (2) was used instead of A. The radioactivity of the hybridization support filtered on the membrane filter was measured.

(3-3) Table 2 shows the results of the measurements in (3-1) and (3-2).

[0035]

[Table 2]

Example 3 Detection of Rotavirus 10th Gene Segment (1) Preparation of Hybridization- Supporting Carrier In Example 2 (1), the polynucleotide 5′-
(DC) ₁₀ (dT) ₃₀ Instead of -3 ′, the base sequence is 5 ′.
-CCCCCCCCCCGGTCACCACTAAGAC
DN which is CATCTCTCTCCATTAACG-3 '
A carrier for hybrid formation was prepared in the same manner as in (1) of Example 2 except that the polynucleotide synthesized by the A synthesizer was used. This polynucleotide has the 3′-terminal nucleotide sequence CGUUAAUGGAAGGAAUGGUCUU contained in the mRNA of the rotavirus 10th gene segment.
It contains a nucleotide sequence complementary to AGUGUGACC.

(2) Preparation of rotavirus mRNA Human rotavirus (Wa Strain) particles were treated with 100 mM ethylenediaminetetraacetic acid and collected as a pellet by centrifugation. To this pellet, 100 mM Tris-HCl buffer (pH 8.0), 10 mM magnesium chloride, 2 mM adenosine triphosphate, 2 mM cytidine triphosphate, 2 mM guanosine triphosphate, 2 mM uridine triphosphate, 10 mM S-adenosylmethionine And R
200 μl of a solution containing a NA-degrading enzyme inhibitor was added, and the mixture was incubated at 37 ° C. for 3 hours. Reaction solution 1
The supernatant obtained by centrifugation at 5,000 rpm for 30 minutes at 0 ° C. was extracted with phenol, and then subjected to column chromatography using Sephadex G-100 to collect a flow-through fraction. Thus, 130 μg of a mixture of mRNAs of the first to eleventh gene segments of rotavirus was obtained.

(3) m of the 10th gene segment of rotavirus
Quantification of RNA The carrier suspension for hybridization prepared in (1) of this embodiment is used instead of the carrier suspension for hybridization containing the (dT) ₃₀ sequence in (3) and (3-1) of Example 2. Liquid 50
μl, and using 10 ng or 0 ng of a mixture of mRNAs of the 1st to 11th gene segments of the rotavirus prepared in (2) of this example instead of the mRNA of the vaccinia virus having the poly (A) sequence. An experiment was performed in the same manner as in (3) and (3-1) of Example 2. Table 3 shows the results.

[0039]

[Table 3]

Test Example 1 Vaccinia virus poly (A) sequence-containing mRNA
Separation / purification (1) m having vaccinia virus poly (A) sequence
Preparation of RNA After treating vaccinia virus with NP40, the concentration of uridine triphosphate in the solution added to the pellet obtained by centrifugation was changed to 0.5 mM, and α- ³² was added to the solution.
After adding 50 μCi of P-uridine triphosphate, the vaccinia virus poly (A) was prepared in the same manner as in Example 2 (2).
An mRNA having the sequence was obtained.

(2) Separation and purification of mRNA from contaminants
The manufacturing Example 2 Hybridization carrier suspension 10 [mu] l (0.5 w / v)% was prepared in the same manner as (1) was taken in an Eppendorf centrifuge tube, 0.5M sodium chloride, 0.1
(W / v) 50 μl of 10 mM Tris-HCl buffer (pH 7.5) containing sodium dodecyl sulfate and 1 mM ethylenediaminetetraacetic acid, 50 μg of bovine serum albumin, 30 μg of ribosomal RNA, 30 μg of transfer RNA and (1) above Poly (A) prepared
300 ng of sequence-containing mRNA was added and incubated at 37 ° C. for 10 minutes. After this, 5 at 10,000 rpm
After centrifugation for minutes, the supernatant and the solid content were separated, and the radioactivity of each was measured by the Cherenkov counting method. The equation for the efficiency of hybridization is: Was 94.7%.

Next, 10 mM containing 0.1 (w / v)% sodium dodecyl sulfate and 1 mM ethylenediaminetetraacetic acid was added to the carrier for hybrid formation prepared in the above (1).
10 μl of Tris-HCl buffer (pH 7.5) was added, and the mixture was heated at 65 ° C. for 5 minutes.
The mixture was centrifuged at 00 rpm for 5 minutes to separate the supernatant and the carrier for hybridization.
It was measured by the counting method. Formula for recovery: Was 91.6%,

Test Example 2 Separation and Purification of Globin mRNA (1) Separation and Purification of Globin mRNA 0.5 (w / v)% suspension of a carrier for hybrid formation prepared in the same manner as (1) of Example 2 200 μl of the solution
Place in a 1.5 ml Eppendorf centrifuge tube, 15,000
After centrifugation at rpm for 5 minutes, the supernatant was discarded. Next, the same binding buffer 10 as in (3) of Example 1 was added to this centrifuge tube.
0 μl and 20 μl of 50 μg / ml globin mRNA (hereinafter, referred to as sample O) sterile aqueous wave (manufactured by Bethesda Research) were added, mixed well with the hybridization support, and then incubated at 37 ° C. for 10 minutes. Thereafter, the mixture was centrifuged at 15,000 rpm for 5 minutes, and a supernatant (hereinafter, referred to as Samburu U) was collected. 100 μl of an elution buffer (a buffer consisting of 10 mM Tris-HCl buffer pH 7.5, 0.1 (w / v)% sodium dodecyl sulfate and 1 mM ethylenediaminetetraacetic acid) was added to the precipitated hybrid-forming carrier, The carrier for hybridization was redispersed in this, heated at 65 ° C. for 5 minutes, centrifuged at 4 ° C. at 15,000 rpm for 5 minutes, and the resulting supernatant (hereinafter referred to as Samburu B) was collected. Next, each of the sample U and the sample B was subjected to ethanol precipitation, and a nucleic acid component contained in the sample was recovered as a precipitate.

(2) Synthesis of globin In order to confirm that the globin mRNA obtained in the above (1) has a complete structure, a translation kit (Dupont) Globin mRN in each sample
Globin protein was synthesized from A. The reagents necessary for this synthesis were those provided in the kit, and the synthesis was performed according to the manual for the kit. After completion of the globin protein synthesis reaction, each reaction solution was added to 15 (w /
v) After electrophoresis using% SDS-PAGE (polyacrylamide gel) and drying the gel, an autoradiogram was taken. For comparison, an autoradiogram was similarly obtained for a blank containing no mRNA. The sketch of the obtained autoradiogram is shown in FIG. From the above autoradiogram, the globin mRNA isolated in sample B was the mM of the original sample O.
RNA function is not impaired, and sample U
It could be confirmed that globin mRNA did not remain therein.

(3) Globin complementary DNA (cDNA)
The sample B and the sample O described in the above (1) were converted to cD
NA Synthesis Kit (Amersham) and cDNA
Was synthesized. In this synthesis, the reagents provided in the kit were used according to the manual for the kit, except that 50 μCi of α- ³² P-deoxycytidine triphosphate was used. After the completion of the globin cDNA synthesis reaction, 5 μl of the reaction solution was subjected to electrophoresis using a 1 (w / v)% agarose gel, and the gel was dried and an autoradiogram was taken. FIG. 2 shows a sketch of the obtained radiograph. From this autoradiogram, sample B
Was found to have higher purity of globin mRNA than sample O.

[0046]

The carrier for hybridization of the present invention is useful for detection, separation, purification, etc. of a nucleic acid having a specific base sequence, and high-precision detection of non-specific trapping of the nucleic acid during hybridization is difficult. Separation, purification, etc. are possible. Further, those in which the nucleic acid is immobilized with the 3 ′ end free are also useful for cDNA synthesis and the like. The preparation method provided by the present invention is a highly practical method that allows simple and efficient immobilization of a nucleic acid on such a carrier.

[Brief description of the drawings]

FIG. 1 shows an autoradiogram obtained by subjecting a synthesized reaction solution to electrophoresis and drying the obtained gel.

FIG. 2 shows an autoradiogram obtained by subjecting the reaction solution synthesized to electrophoresis and drying the obtained gel after drying.

Claims (2)

[Claims] 1. A non-porous surface having a particle size of 0.05 to 5
On the surface of the organic polymer particles having a size of μm, a single-stranded polynucleotide has a primary amino group in a portion of a nucleotide sequence comprising two or more consecutive nucleotides having a primary amino group contained therein. A hybrid-forming carrier which is immobilized by an amide bond (excluding a peptide bond) formed by a carboxyl group of the organic polymer particles. 2. An organic polymer particle having a nonporous surface and having a carboxyl group and a particle size of 0.05 to 5 μm, and a nucleotide sequence comprising two or more consecutive nucleotides having a primary amino group. The single-stranded polynucleotide is characterized by reacting with a single-stranded polynucleotide in the presence of a dehydrating condensing agent, wherein the single-stranded polynucleotide is a part of the nucleotide sequence on the organic polymer particles, the primary amino group and the A method for preparing a carrier for hybridization, which is immobilized by an amide bond (excluding a peptide bond) formed by a carboxyl group.