JPH10179179A - Determination of specific gene sequence and reagent for determination - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a method for detecting or determining a gene having a specific sequence, and a reagent therefor. SOLUTION: This method for detecting or determining a single strand DNA having a specific gene sequence and the reagent therefor are constituted by hybridizing a DNA probe bonded with a carrier formed by bonding a single strand DNA probe having a complemental sequence with a specific gene sequence of a single strand DNA fragment having a specific gene sequence to be detected or determined in a specimen with a carrier consisting of a material hardly adsorbing the DNA mediated by or not mediated by a spacer, with the DNA fragment in the specimen, and detecting or determining the DNA fragments hybridized with the carrier bonded DNA probe.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a simple detection or quantification method for early diagnosis of genotypes and gene mutations, and a detection or quantification reagent used for the method.

[0002]

2. Description of the Related Art Cancer can be detected early by various types of image diagnosis and biochemical diagnosis. However, it is often impossible to discover it until it has progressed to some extent. In addition, since pancreatic cancer cannot be easily biopsied like gastric cancer and colon cancer, it is difficult to distinguish it from chronic pancreatitis in many cases, and in some cases, treatment becomes difficult.

[0003] In recent years, due to the progress of molecular biological research on cancer, pancreatic ductal carcinoma, which accounts for the majority of human pancreatic cancer, has a Kr
It has been found that a point mutation at as codon 12 is expressed at a high rate, and detection of this point mutation using PCR (Polymerase Chain Reaction) has attracted attention as a differential diagnosis method for pancreatic cancer. However, although the PCR method is highly sensitive, it is expensive, and it is easy to cause gene contamination and the procedure is complicated. Therefore, this method is not yet widely used as a differential diagnosis method for pancreatic cancer. .

[0004] Further, with respect to a method for purifying a substance utilizing specific affinity, for example, a method for purifying a protein specifically adsorbed to the probe DNA using a DNA probe bound to a carrier (Japanese Unexamined Patent Publication No. No. 61493) is known. Also, a method of enriching or purifying DNA or RNA specifically binding to a probe using a DNA probe bound to the carrier using a carrier that does not exhibit non-specific adsorption [Journal of Colloid and Interface・ Science (J. Colloid and Interface S)
ci.), 177 , 245 (1996)].

However, there is no known method for detecting or quantifying a specific gene fragment capable of eliminating a single base mismatch using a hybridization method.

[0006]

SUMMARY OF THE INVENTION An object of the present invention is to provide a method for detecting or quantifying a single-stranded DNA fragment having a specific gene sequence using a hybridization method, and a detection or quantification reagent used for the method. . The method is useful for detecting or quantifying a point mutation or the like caused by various diseases such as cancer.

[0007]

According to the present invention, there is provided a single-stranded D having a specific gene sequence to be detected or quantified in a sample.
A carrier-bound DNA probe in which a single-stranded DNA probe having a sequence complementary to a specific gene sequence of an NA fragment and a carrier made of a substance that does not readily adsorb DNA are bound with or without a spacer, and a DNA fragment in a sample And a method for detecting or quantifying a single-stranded DNA fragment having a specific gene sequence, comprising detecting or quantifying a DNA fragment in a sample hybridized with the carrier-bound DNA probe.

A single-stranded DNA probe having a sequence complementary to a specific gene sequence of a single-stranded DNA fragment having a specific gene sequence to be detected or quantified in a sample, and a carrier made of a substance which is difficult to adsorb DNA. Has a sequence complementary to a partial sequence other than the specific gene sequence of a single-stranded DNA fragment having a specific gene sequence to be detected or quantified in a sample, and a carrier-bound DNA probe bound with or without a spacer. DNA in the sample together with the single-stranded DNA probe
A in the sample hybridized to fragment A and hybridized to the carrier-bound DNA and the single-stranded DNA probe.
A method for detecting or quantifying a single-stranded DNA fragment having a specific gene sequence, comprising detecting or quantifying the A fragment is provided.

Further, a single-stranded DNA probe having a sequence complementary to a specific gene sequence of a single-stranded DNA fragment having a specific gene sequence to be detected or quantified in a sample, and a carrier comprising a substance which is difficult to adsorb DNA. Hybridizes a DNA fragment in a sample with a carrier-bound DNA probe bound with or without a spacer, and then single-stranded DN
After the action of an enzyme that cleaves the A fragment, the carrier-bound DN
There is provided a method for detecting or quantifying a single-stranded DNA fragment having a specific gene sequence, comprising detecting or quantifying a DNA fragment in a sample hybridized with the A probe.

According to the present invention, there is provided a 10- to 30-mer having a sequence complementary to a specific gene sequence of a single-stranded DNA fragment having a specific gene sequence to be detected or quantified in a sample.
-Bound DNA in which a single-stranded DNA probe and a carrier that does not readily adsorb DNA are bound with or without a spacer
A probe is provided. According to the present invention, a single-stranded DNA probe having a sequence complementary to a specific gene sequence of a single-stranded DNA fragment having a specific gene sequence to be detected or quantified, and a carrier that does not easily adsorb DNA are provided via a spacer or a spacer. Bound DNA probe and single-stranded DN having a specific gene sequence to be detected or quantified in a sample
A reagent consisting of a single-stranded DNA probe having a sequence complementary to a partial sequence other than the specific gene sequence of the A fragment and a label-bound DNA probe, and a specific gene sequence consisting of a reagent for detecting or quantifying a labeled compound And a reagent kit for detecting or quantifying a single-stranded DNA fragment having:

A single-stranded DNA probe having a sequence complementary to a specific gene sequence of a single-stranded DNA fragment having a specific gene sequence to be detected or quantified, and a labeled binding DNA probe and a DNA bound to a labeling compound. Provided is a carrier-bound labeled DNA probe to which a carrier that does not easily adsorb is bound with or without a spacer. In addition, a single-stranded DNA probe having a sequence complementary to a specific gene sequence of a single-stranded DNA fragment having a specific gene sequence to be detected or quantified is adsorbed on a labeled binding DNA probe and a DNA in which a labeling compound is bound. A reagent having a specific gene sequence consisting of a reagent consisting of a carrier-bound labeled DNA probe to which a difficult carrier is bound with or without a spacer, a reagent consisting of an enzyme that cleaves single-stranded DNA, and a reagent for detecting or quantifying a labeled compound A reagent kit for detecting or quantifying a strand DNA fragment is provided.

DETAILED DESCRIPTION OF THE INVENTION In the present invention, a single-stranded DNA probe having a sequence complementary to a specific gene sequence of a single-stranded DNA fragment having a specific gene sequence to be detected or quantified in a sample, and a DNA A carrier-bound DNA probe to which a carrier that does not easily adsorb is bound with or without a spacer is used.

The shape of the carrier is not particularly limited, and examples thereof include a plate-like carrier and a particulate carrier, and the particulate carrier is preferable because a large amount of DNA probes can be bound per unit volume. The particle size of the particulate carrier is 0.01 to 1
00 μm is preferable, and 0.05 to 20 μm is particularly preferable. Preferably, the carrier surface is covered with a substance that does not readily adsorb DNA. The substance that hardly adsorbs DNA is a substance having a large number of hydrophilic functional groups on the surface, and can be used as a natural polymer or a synthetic polymer compound. Examples of the natural polymer include polysaccharides such as chitosan and hyaluronic acid. Examples of the synthetic polymer compound include a synthetic polymer compound having a hydroxyl group or an amide group in a side chain.

The monomers constituting these synthetic polymer compounds include, for example, ethylene oxide-containing (meth) acrylates such as ethylene glycol (meth) acrylate and triethylene glycol (meth) acrylate, and hydroxymethyl (meth) acrylate. , (Meta)
Hydroxyl group-containing (meth) acrylates such as hydroxypropyl acrylate, epoxy group-containing (meth) acrylates such as glycidyl (meth) acrylate, and alkyl (meth) such as methyl (meth) acrylate and ethyl (meth) acrylate Monoethylenically unsaturated amides such as acrylate, acrylamide, methacrylamide, diacetacrylamide, N-hydroxymethylacrylamide, and ethylenically unsaturated nitrile compounds such as acrylonitrile and methacrylonitrile are exemplified.

Examples of the synthetic high molecular compound include a polymer composed of one kind of these monomers and a copolymer composed of two or more kinds of these monomers. Further, a polymer compound obtained by making these polymers hydrophilic by a reaction is suitably used.
Specific preferred polymer compounds include, for example, glycidyl methacrylate polymers. These synthetic polymer compounds may form at least the surface layer of the plate or the particle, and the inside may be a hydrophobic polymer such as polystyrene or polyvinyl. The surface of the plate or particle is particularly preferably prepared to be rich in epoxy groups. Examples of such particles include particles having a core-shell structure of polystyrene / polyglycidyl methacrylate.

The synthesis of the polymer compound varies depending on the type of the monomer and the type of the polymer compound, but can be synthesized by a known method. Particularly when producing particles, for example, a suspension polymerization method, an emulsion polymerization method, or the like is used. In the case of synthesis by the suspension polymerization method, for example, polyacrylamide and its limited hydrolyzate, polyacrylic acid, hydroxypropylcellulose, ethylcellulose, methylcellulose, polyvinyl alcohol, polyvinyl acetate, etc. Molecules can be used. As the polymerization initiator, azobisisobutyronitrile, 2,2
An azo initiator such as 2'-azobis (2-aminopropane) dihydrochloride, a peroxide such as benzoyl peroxide, and the like can be used. The polymerization initiator in the emulsion polymerization is not particularly limited as long as it is used in ordinary emulsion polymerization. As the polymerization method in the emulsion polymerization method, each system such as a batch system, a semi-batch system, and a continuous system is used. As the emulsion polymerization method, it is preferable to use a soap-free emulsion polymerization method comprising water, a monomer, and a polymerization initiator in order to keep the particle surface clean and to prevent the adsorbed substances from being brought in. Legit is preferred.

A spacer is a single-stranded DNA having a sequence complementary to a specific gene sequence of a single-stranded DNA fragment having a specific gene sequence to be detected or quantified in a sample, which is a carrier made of a substance that does not readily adsorb DNA. It binds the probe. Examples of the spacer include a polyethylene glycol diglycidyl ether chain, a single-stranded DNA chain,
Single-stranded RNA strands and the like can be mentioned. As the polyethylene glycol diglycidyl ether chain length, an ethylene unit is preferably from 1 to 10, and more preferably from 1 to 5.
When a single-stranded DNA strand or a single-stranded RNA strand is used as a spacer, the base sequence of the strand may be any, but adenine (A), guanine (G), cytosine ( Those having C) at the terminal are preferred. The length of the single-stranded DNA chain and the single-stranded RNA chain is preferably 5 to 40 mer, and 10 to 20 me.
r is more preferred.

The length of the DNA fragment of the single-stranded DNA probe having a sequence complementary to the specific gene sequence of the single-stranded DNA fragment having the specific gene sequence to be detected or quantified in the sample is 10 to 50 bases. , More preferably 10-3
0 bases, particularly preferably 15 to 25 bases. Specific gene sequences of single-stranded DNA fragments having specific gene sequences to be detected or quantified include DNA fragments derived from genes involved in various traits, genes involved in diseases, and the like. For example, genes involved in various traits include PS1 (priserinin 1) gene, PS2 (priserinin 2) gene, APP (beta-amyloid precursor protein) gene, lipoprotein gene, HLA
(Human leukocyte antigen) gene, hepatitis C virus gene,
Hepatitis B virus gene, hMSH2 gene and the like. In addition, genes involved in the disease include K-ras
Gene, p53 gene and the like. For mutations in the K-ras gene, see Japanese Journal of Cancer Research (Jpn. J. Cancer Res.) , 8
4 , 961 (1993) and 85 , 147 (199)
4), 85 , 1240 (1994), 85 , 100
5 (1994), 86 , 1150 (1995), 8
6 , 737 (1995) and 87 , 466 (199).
6), 87 , 1056 (1996), 87 , 793
(1996). Regarding the mutation of the p53 gene, see the Japanese Journal of
Cancer Research (Jpn. J. Cancer Res.), 8
5 , 1087 (1994) and 85 , 1247 (199).
4), 86 , 1143 (1995), 86 , 57
(1995), 86 , 174 (1995), 86 ,
730 (1995) and 87 , 930 (1996). For the hMSH2 gene, see Japanese Journal of Cancer Research (Jp.
n. J. Cancer Res.), 87 , 279 (1996).

Tables 1 and 2 respectively show K-ras
FIG. 1 shows an example of a partial change in a nucleotide sequence that is known to cause a mutation in a gene and p53 gene sequence accompanying canceration. A DNA fragment complementary to a specific gene sequence containing the base sequence of these known mutations is used as a probe D
It becomes NA sequence.

[0020]

[Table 1]

[0021]

[Table 2]

Tables 3 and 4 show partial sequences of human hepatitis C virus and human leukocyte antigen genes, respectively. A DNA fragment complementary to a specific gene sequence containing these sequences becomes a probe DNA.

[0023]

[Table 3]

[0024]

[Table 4]

As described above, the sequence of the single-stranded DNA probe may be designed based on these known sequences. The gene sequence to be detected or quantified particularly suitably applicable in the present invention is a sequence known to have an internal point mutation of a known sequence. In this case, the position of the base complementary to the mutated base in the DNA probe is preferably at least three bases inside both ends of the DNA probe, and particularly preferably within two bases from the center of the DNA probe.

A single-stranded DNA probe having a sequence complementary to a specific gene sequence of a single-stranded DNA fragment having a specific gene sequence to be detected or quantified in a sample can be used for a chemical synthesis reaction of DNA with a carrier such as silica. It can be synthesized using a DNA synthesizer or the like automated by the solid phase method used. As the reaction substrate, a nucleotide derivative in which the amino group of the base and the 5′-OH of ribose are protected with a protecting group, and the 3′-OH of ribose is bonded to diisopropylphosphoramidite is used. Examples of the protecting group for the amino group of the base include a benzoyl group and an isobutyl group, and examples of the protecting group for the 5′-OH of ribose include a dimethoxytrityl group. According to the base sequence, a column in which any one of nucleotides of adenine, thymidine (T), cytosine, and guanine protected with an amino group and a 5′-OH group is fixed to a support via 3′-OH as a starting material, After removal of the trityl group with an acid (formation of 5′-OH), the above-mentioned nucleotide derivative having a phosphoramidite group at the 3 ′ end is added under a suitable condensing agent such as tetrazole. Further, both bonds are converted into a stable phosphotriester bond with iodine and water. This cycle of the detritylation and the condensation reaction is repeated, and finally the cleavage from the deprotecting group and the support is carried out by treatment with ammonia. By the above operation, the target DNA probe can be synthesized. When the spacer is a single-stranded DNA, its sequence may be synthesized continuously. This allows
A DNA probe having a DNA spacer can be synthesized.

A single-stranded DNA probe having a sequence complementary to a specific gene sequence of a single-stranded DNA fragment having a specific gene sequence to be detected or quantified in a sample and a carrier made of a substance which is difficult to adsorb DNA are a spacer. A method for preparing a carrier-bound DNA probe bound with or without intermediary will be described. Depending on the type of spacer and the type of carrier,
The method of binding the carrier, the spacer and the single-stranded DNA probe can be determined. Generally, it is carried out by bonding an amino group of a base at the end of the DNA probe to an epoxy group, a carboxyl group, an aldehyde group, a hydroxyl group or the like of a carrier or a spacer.

When the spacer is a single-stranded DNA and the carrier has an epoxy group on the surface, the DNA probe is bound to the carrier as follows, for example. According to the above-described DNA synthesis method, a DNA probe having a DNA spacer and a single-stranded DNA having a sequence complementary to the probe and having no spacer sequence are synthesized. Next, the two are hybridized to form a double strand, the amino group of the base of the gene sequence to be detected or quantified is protected, and the amino group of the base of the free spacer portion is bonded to the epoxy group of the carrier. After binding to the carrier, dissociate the single-stranded DNA having a sequence complementary to the probe and no spacer sequence,
An intended carrier-bound DNA probe can be prepared.

Hybridization is carried out with an aqueous solution containing formamide, salt, protein, stabilizer, buffer and the like, if necessary. Hereinafter, this solution is referred to as a hybridization solution. Formamide concentration is 0-60%, preferably 10-60%
It is 50%, more preferably 20 to 30%. Examples of the salt include inorganic salts such as sodium chloride and potassium chloride, and organic acid salts such as sodium citrate and sodium oxalate. The salt concentration is 0 to 2.0M, preferably 0.15M.
~ 1.0M. Examples of proteins include serum albumin and the like. Examples of the stabilizer include ficoll. Examples of the buffer include a phosphate buffer and the like, and the concentration is preferably 1 to 100 mM. The complementary 2
For the hybridization of the seed DNAs, the single-stranded DNAs synthesized in the hybridization solution were added at an equimolar concentration, and the mixture was added at 60 to 90 ° C for 1 to 60 ° C.
It can be performed by gradually cooling the mixture to 0 to 40 ° C. over 1 to 24 hours after heating. Thus, a partial double-stranded D having a single-stranded polynucleotide spacer
NA is prepared.

The bond with the carrier is carried out by washing the carrier particles having an epoxy group with 1 to 100 mM phosphate buffer, equilibrating the particles, and then combining the carrier with the carrier in the same buffer solution used for washing. The partially double-stranded DNA having a single-stranded DNA spacer prepared by the method is mixed, and the mixture is mixed for 5 to 50 hours and then for 20 to 5 hours.
It is carried out by keeping the temperature at 0 ° C. Unreacted DNA
After removing by washing with an aqueous solution containing salts such as 3M sodium chloride, unreacted epoxy groups present on the carrier are added with a Tris-hydrochloric acid buffer and added at room temperature for 5 to 50 minutes.
Insulate for a time and let it open. Thus, double-stranded DNA bound to the carrier is prepared.

By washing the carrier-bound double-stranded DNA in a hybridization solution at 70 to 90 ° C., a carrier-bound single-stranded DNA can be prepared. Washing is performed using a hybridization solution at 70 to 90 ° C.
Perform several times with centrifugation at thousands to tens of thousands of g. When the spacer is polyethylene glycol diglycidyl and the carrier has an epoxy group on the surface, the binding between the DNA probe and the carrier is
For example, it can be performed as follows. Ammonium hydroxide or hexamethylenediamine hydrochloride is added to the carrier particles in an amount of 10 to 100 times the molar amount of the epoxy group, and the mixture is reacted at 60 to 70 ° C. at pH 10 to 12 for 0.5 to 2 days to aminate the particle surface. After the reaction, the mixture is washed by centrifugation, and if necessary, dialyzed with ion-exchanged water to remove unreacted ammonium hydroxide or hexamethylenediamine hydrochloride. The amino group-introduced carrier has 50-20 amino groups.
A 0-fold molar amount of polyethylene glycol diglycidyl is added, and the mixture is reacted by reacting at a pH of 10 to 12 and a temperature of 20 to 40 ° C. for 0.5 to 2 days. Thus, the spacer binds to the carrier. Epoxy group of spacer and probe D
The binding of NA is performed according to the method described above.

Next, a method for preparing a single-stranded DNA fragment having a specific gene sequence to be detected or quantified will be described.
Biological test samples used for detection or quantification are various organs, tissues,
It can be prepared from blood or the like by a known DNA extraction method. The isolated DNA is cleaved with a specific restriction enzyme to prepare a single-stranded DNA fragment having a length of 10 to 200 mer, preferably 20 to 100 mer containing a specific gene sequence to be detected or quantified. For example, when DNA extracted from cells is treated with restriction enzymes Ddel and HinfI, K-ra
A 70-mer DNA fragment containing codon 12 of s can be prepared. In the present invention, it is only necessary to fragment DNA so as to have a specific gene sequence to be detected or quantified.

The target DNA to be labeled with the labeling compound may be any of the DNA fragments in the sample or the specific gene sequence of the single-stranded DNA fragment having the specific gene sequence to be detected or quantified in the sample, depending on the detection or quantification method. Single-stranded DNA probe having a sequence complementary to a partial sequence other than, a single-stranded DNA having a specific gene sequence to be detected or quantified in a sample
Single-stranded DNA probe of a carrier-bound DNA probe in which a single-stranded DNA probe having a sequence complementary to the specific gene sequence of fragment A and a carrier made of a substance that does not readily adsorb DNA are bound with or without a spacer. Any of the parts.

A single-stranded DNA fragment having a sequence complementary to a partial sequence other than the specific gene sequence of a single-stranded DNA fragment having a specific gene sequence to be detected or quantified in a sample is labeled with a labeling compound. Is simply referred to as a labeled DNA probe. Further, a single-stranded DNA probe having a sequence complementary to a specific gene sequence of a single-stranded DNA fragment having a specific gene sequence to be detected or quantified in a sample and a carrier made of a substance that does not easily adsorb DNA form a spacer. In the following description, a single-stranded DNA probe portion of a carrier-bound DNA probe bound with or without a carrier is labeled as a carrier-bound labeled DNA probe.

As the labeling compound for labeling DNA, any labeling compound can be used as long as it can be directly or indirectly detected or quantified. For example, biotin, a heat-stable antigen, can be mentioned, and is bound by a covalent bond. Further, a label-bound DNA probe and a carrier-bound label D
As the labeling compound of the NA probe, radioisotopes,
Examples of the labeling compound include heat-resistant labeling compounds such as a coloring reagent, a fluorescent reagent and a luminescent reagent, and biotin is particularly preferable.

A method for binding DNA to biotin will be described. Biotinylation of the 3 ′ end of DNA can be performed using a biotin-linked deoxyribonucleoside triphosphate, for example, using 3 ′
End labeling method, Bio-Bridge
The enzyme can be bound enzymatically by the method e), the nick translation method or the like. Examples of biotin-bound deoxyribonucleoside triphosphate include, for example, Bio-11-d
UTP, Bio-16-dUTP, Bio-11-dC
TP is available as a commercial product from Enzo and the like. When the DNA is a synthetic DNA, a 5′-terminal biotin-labeled DNA can be synthesized by an automatic synthesizer based on the cyanoethyl phosphoramidite method. Biotinylated DNA can be purified by gel filtration such as spin column method using Sephadex G-50.

As the reagent for detecting or quantifying the labeled compound, any reagent can be used as long as it can detect or quantify the labeled compound. When the labeling compound is biotin, the detection or quantification reagent comprises a labeled enzyme-conjugated avidin and the labeling enzyme activity detection or quantification reagent. Examples of the labeling enzyme include peroxidase, alkaline phosphatase and the like.

When the labeling enzyme is peroxidase, examples of reagents for detecting or quantifying enzyme activity include hydrogen peroxide and 3,3'-diaminobenzidine, o-dianisidine,
-Methoxy-1-naphthol, 2,2'-azino-bis (3-ethylbenzothiazoline) -6-sulfonic acid (A
BTS), 10-N-methylcarbamoyl-3,7-dimethylamino-10H-phenothiazine (MCDP),
10-N-carboxymethylcarbamoyl-3,7-dimethylamino-10H-phenothiazine (CCAP),
N- (carboxymethylaminocarbonyl) -4,4 '
-Bis (dimethylamino) diphenylamine sodium (DA-64), 4,4'-bis (dimethylamino)
A reagent comprising a coloring reagent such as diphenylamine or bis [3-bis (4-chlorophenyl) methyl-4-dimethyl-aminophenyl] amine (BCMA), or hydrogen peroxide and homovanillic acid, p-hydroxyphenylacetic acid or diacetylfluorescin Derivatives (diacetylfluorescin, diacetyldichlorofluorescin, etc.)
Or a reagent consisting of a fluorescent reagent such as hydrogen peroxide and luminol, isoluminol, pyrogallol or bis (2,
Examples of the reagent include a luminescent reagent such as (4,6-trichlorophenyl) oxalate.

Further, a detection or quantification reagent comprising a color-forming reagent of a 1-naphthol derivative such as 4-methoxy-1-naphthol, a lanthanide fluorescent reagent such as europium, and a luminescent reagent such as acridinium can be used. When the labeling enzyme is alkaline phosphatase, examples of the detection or quantification reagent include a detection or quantification reagent comprising a phosphoric acid ester such as paranitrophenyl phosphate and a luminescent reagent of an adamantyl oxetane derivative.

In particular, reagents for detecting or quantifying alkaline phosphatase include NADP, INT-violet,
A detection or quantification reagent consisting of NADH, ethanol, diaphorase and alcohol dehydrogenase is preferred. Buffers, other substrates, other enzymes, surfactants, enzyme stabilizers, and the like may be added to these enzyme activity detection or quantification reagents as necessary. The enzyme activity detection or quantification reagent may be prepared as a kit comprising two or more reagents as necessary.

Examples of enzymes that cut single-stranded DNA include nucleases such as S1 nuclease and mung bean nuclease. A carrier in which a single-stranded DNA probe having a sequence complementary to a specific gene sequence of a single-stranded DNA fragment having a specific gene sequence to be detected or quantified is bound to a carrier that does not easily adsorb DNA with or without a spacer. A labeled compound is bound to a binding DNA probe and a single-stranded DNA probe having a sequence complementary to a partial sequence other than the specific gene sequence of a single-stranded DNA fragment having a specific gene sequence to be detected or quantified in a sample. Reagent consisting of labeled DNA probe and labeled binding DNA in which a single-stranded DNA probe having a sequence complementary to the specific gene sequence of a single-stranded DNA fragment having a specific gene sequence to be detected or quantified and a labeling compound are bound Probe and DNA
It is preferable that, for example, the above-mentioned hybridization solution or the like is added to a reagent comprising a carrier-bound labeled DNA probe to which a carrier that does not easily adsorb is bound via a spacer or not.

Next, a single-stranded DNA probe having a sequence complementary to the specific gene sequence of the single-stranded DNA fragment having the specific gene sequence to be detected or quantified in the sample, and a carrier comprising a substance that does not readily adsorb DNA. Is hybridized with a DNA fragment in a sample and a carrier-bound DNA probe, which is bound with or without a spacer,
A method for detecting or quantifying a single-stranded DNA fragment having a specific gene sequence, comprising detecting or quantifying a DNA fragment in a sample hybridized with a probe will be described. Hybridization is performed under stringent conditions using the above-mentioned hybridization solution. For example, a sample containing a carrier-bound DNA probe and a DNA fragment is added to the hybridization solution, and the temperature is 70-90 ° C., preferably 80-8 ° C.
After heating at 5 ° C for 1 to 20 minutes, preferably 5 to 15 minutes, gradually cooling to 20 to 50 ° C, preferably 20 to 30 ° C over 0.5 to 24 hours, preferably 1 to 6 hours. Performed by Next, when particles are used as the carrier, a centrifugal operation is performed, and when a plate is used as the carrier, a washing operation is performed to remove DNA fragments in the unhybridized sample. Detection or quantification of the DNA fragment hybridized to the carrier-bound DNA probe can be performed by a method of detecting or quantifying the DNA in a hybridized state or after isolation from the carrier probe.

The detection or quantification of the hybridized DNA fragment is preferably performed using a labeled compound.
First, a detection or quantification method in the case where all the sample DNAs are labeled is described. According to the method described above, all the DNA fragments in the sample are labeled. Next, the labeled DNA is hybridized with the carrier-bound DNA probe. Hybridization conditions are the same as the strict hybridization conditions described above. The detection or quantification of the hybridized DNA fragment is performed by removing the non-hybridized DNA fragment and then detecting or quantifying the label of the labeled DNA sample hybridized to the carrier-bound DNA probe.

Further, a detection or quantification method using a labeled DNA probe will be described. Sample DNA, carrier-bound DN
The A probe and the labeled DNA probe are hybridized under the above hybridization conditions. Hybridization conditions are the same as the strict hybridization conditions described above. Next, the sample DNA fragment and the labeled DNA probe which are not hybridized to the carrier-bound DNA probe are removed by washing such as centrifugation. Detection or quantification of the hybridized DNA fragment
Sample DN hybridized to carrier-bound DNA probe
The detection is performed by detecting or quantifying the label of the label-bound DNA probe further hybridized to the A fragment.

Further, a detection or quantification method using a carrier-bound DNA-labeled probe will be described. The sample DNA fragment and the carrier-bound labeled DNA probe are hybridized.
The conditions for hybridization are not particularly limited, and may be such conditions that DNA fragments having a single-base mismatch hybridize if completely complementary DNA fragments hybridize. Next, an enzyme such as S1 nuclease, which cuts single-stranded DNA, is allowed to act to cut the label-bound DNA probe that has not formed double-stranded DNA. A DNA fragment that is not completely complementary hybridizes to the probe DNA, and the partially single-stranded probe DNA is cleaved by the present enzyme reaction. The detection or quantification of the completely hybridized DNA fragment is performed by detecting or quantifying the label of the carrier-bound labeled DNA probe. This carrier-bound DN
When an A-labeled probe is used, it is preferable not to use a spacer that binds the DNA probe and the carrier, or to use one other than a DNA chain. As a spacer,
For example, the aforementioned polyethylene glycol diglycidyl ether chain is preferred. This method is particularly preferable in that even if a sample DNA fragment bound with a mismatch is generated, this can be eliminated and only a sample DNA having a sequence completely complementary to the probe DNA can be detected.

In the present invention, the concentration of DNA to be detected or quantified in a sample can be detected or quantified by preparing a calibration curve using a known amount of sample DNA in advance. Next, a method for detecting or quantifying a labeled compound will be described. When using biotin as the labeling compound,
Biotin can be detected or quantified by, for example, binding a labeled enzyme-conjugated avidin to biotin, and then detecting or quantifying the enzyme activity of the labeled enzyme-conjugated avidin bound to biotin.

The binding between biotin and the labeled enzyme-conjugated avidin is carried out, for example, by allowing to stand at room temperature for 0.5 to 2 hours in a solution containing a surfactant, salts, a buffer, etc. Enzyme bound avidin is removed by centrifugation or washing. The activity of the enzyme bound to avidin can be determined by a conventional method using the above-mentioned enzyme activity detection or quantification reagent.

When the biotin-binding labeling enzyme is alkaline phosphatase, a sensitizing system using alcohol dehydrogenase and diaphorase [(Ann. Biol. Clin),
47 , 527 (1989)].
Detection or quantification is performed by reacting alcohol dehydrogenase on NAD and ethanol produced by alkaline phosphatase to produce NADH, and producing the produced NADH and INT.
-A dye produced by the action of diaphorase on a diaphorase substrate such as violet, for example, formazan can be colorimetrically measured at 492 nm.

[0049]

【Example】

Example 1 (Synthesis of carrier-bound DNA probe) (1) Synthesis of single-stranded DNA A DNA chain having the following K-ras mutant sequence: 5'-GTTGGAGCTCGTGGCGTAGGG-
3 ′ (20mer; SEQ ID NO: 1, mutation point: C at position 10) and DNA having 10 bases G consecutive to the complementary sequence of SEQ ID NO: 1, 5′-GGGGGGGGGGGCCTACGCCCACGA
GCTCCAAC-3 ′ (30 mer; SEQ ID NO: 2) was synthesized using a DNA synthesizer. (2) Synthesis of carrier 1.2 g of styrene, 1.0 g of glycidyl methacrylate, and 0.04 g of divinylbenzene were weighed and placed in a 200 ml four-necked flask having a stirrer, and dispersed in 110 ml of water. It was set and replaced with nitrogen gas.
While stirring this solution at 200 rpm, 2,2′-azobis (2-aminopropane) as a polymerization initiator
0.06 g of dihydrochloride was added to initiate polymerization. Two hours later, 0.3 g of glycidyl methacrylate was added, and the mixture was further reacted for 22 hours. This reaction solution is centrifuged (3
(000 g, 10 minutes), and the precipitate was washed three times with distilled water and purified to obtain carrier particles. Particles produced by this method are abbreviated as SG particles below. The prepared particles were monodispersed and had a particle size of about 0.2 μm. (3) Immobilization of DNA on carrier The SG particles prepared in (2) above were washed by centrifugation with a 10 mM phosphate buffer (pH 8.0) to equilibrate the particles. 8 μg of the double-stranded DNA prepared in the above (1) and 30
mg of the equilibrated SG particles was reacted in 400 μl of a phosphate buffer at 37 ° C. for 24 hours to be immobilized. Wash 3 times with 2.5 M aqueous sodium chloride solution by centrifugation,
NA was removed. Next, a 10 mM Tris-hydrochloric acid buffer (pH
7.9) Reaction was performed in 1 ml at room temperature for 24 hours. (4) Preparation of carrier-bound DNA probe 2 immobilized on 2 mg of the SG particles obtained in (3) above
The single-stranded DNA was added to 400 ml of a hybridization solution consisting of 25% formamide, 0.75 M sodium chloride, 0.075 M sodium citrate, 1% bovine serum albumin, 1% polyvinylpyrrolidone, and 1% ficoll, and the mixture was added at 80 ° C. By treating for 5 minutes and washing 5 times under this temperature condition, the 5 ′ end of the base sequence of SEQ ID NO: 2 and S
A probe to which the G carrier was bound was obtained.

The average number of DNA fragments of SEQ ID NO: 2 per particle of the carrier was several tens as a result of measuring the absorbance at 260 nm with a spectrophotometer.

Example 2 (Reagents for the Labeled DNA Probe Method) (1) Preparation of Biotin-Labeled DNA Probe 4 bases of G contiguous to a 16 base sequence complementary to the K-ras sequence other than the following regions to be detected or quantified: DN with
A, 5'-CACAAGTTTTACTCAGGGGG-
3 ′ (20mer; SEQ ID NO: 3) was synthesized using a DNA synthesizer.

Next, 15 μg of the synthetic DNA and 15 μg of biotinylated dUTP [manufactured by Enzo]) were reacted in the standard reaction buffer in the presence of terminal transferase using the 3′-end labeling kit of the company, and 3 ′
-Biotin was attached to the end. Unreacted biotinylated d
UTP was removed by spin column method using Sephadex G-50 to obtain a target biotin-bound DNA probe. (2) Preparation of detection reagent A K-ras mutation detection kit having the following composition was prepared. First reagent: 20 mg / ml of the SG particle-bound DNA probe (having the DNA of SEQ ID NO: 2) prepared in Example 1 and 6 μg / ml of the biotin-labeled DNA probe (having the DNA of SEQ ID NO: 3) prepared in the above (1) 10m including ml
M phosphate buffer (pH 8.0). Second reagent: 10 mM phosphate buffer containing 100 U / ml avidin-bound alkaline phosphatase (pH 8.
0). Third reagent: AMPAK ™ reagent, DAKO
Company.

Example 3 (Detection of K-ras Mutant Gene Sequence) DNA of SEQ ID NO: 1 was synthesized with a DNA synthesizer, and then 5 ′
The terminal was labeled with biotin according to the cyanoethyl phosphoramidite method. 2 mg of the carrier-bound DNA probe prepared in Example 1 was diluted with 1/50 surfactant (neutral washing solution containing a nonionic surfactant, manufactured by Kyowa Medex), 1 M sodium chloride, 10 mM phosphate buffer (pH 8.0). )) And various amounts of the biotin-labeled D
50 μl of NA and 100 U / ml of avidin-bound peroxidase were added, and the mixture was allowed to stand at room temperature for 60 minutes. Then, it was centrifuged with a solution of the same composition and washed three times. Collect carrier and 100
The mixture was dispersed in μl of a solvent, 100 μM MCDP (manufactured by Kyowa Medex) and 1 μM hydrogen peroxide were added, and the mixture was reacted at 37 ° C. for 30 minutes. The change in absorbance before and after the reaction was 620 nm.
Was measured. The results are shown in FIG.

As shown in FIG. 1, DNA can be quantified.

Example 4 (Detection of a single base mismatch) DNA having the following K-ras sequence: 5'-GTTGGAGCTGGTGGCGTAGGG-
3 ′ (20mer; SEQ ID NO: 4) and an arbitrary sequence, 5′-CAAGAGTGCCTTTGACGATAC-
3 ′ (20 mer; SEQ ID NO: 5) was synthesized using a DNA synthesizer, labeled with biotin in the same manner as in Example 3, and used as a sample together with the biotin-labeled DNA of SEQ ID NO: 1 prepared in Example 3. Samples containing 2 mg of the carrier-bound DNA probe prepared in Example 1 and 0.6 μg of each of the biotin-labeled DNAs were prepared as shown in Table 5, and each sample was subjected to hybridization at 80 ° C.
After keeping it warm for 0 minutes, it was cooled to 25 ° C. over 3 hours. 100
After 50 μl of U / ml avidin-bound peroxidase was added and allowed to stand at room temperature for 60 minutes, the peroxidase activity in the carrier was measured according to Example 3. The results are shown in Table 5.

[0056]

[Table 5]

As a result, a change in absorbance was observed only in a sample having completely complementary DNA, and a change in absorbance was hardly observed in a sample containing a single base mismatch sequence.

Example 5 (Labeled DNA probe method) DNA having the following K-ras mutant sequence: 5'-TGAGTAAAACTTGTGGGTAGTT
GGAGCTCGGTGGCGTAGGCAAGAGTG
CCTTGACGATACAGCTTAATTCAG-
3 ′ (70mer; SEQ ID NO: 6, mutation point is C at position 29), DNA having a K-ras sequence, 5′-TGAGTATAACTTGTGGGTAGTT
GGAGCTGGGTGGCGTAGGCAAGAGTG
CCTTGACGATACAGCTTAATTCAG-
3 ′ (70mer: SEQ ID NO: 7) and a DNA sequence partially modified to an arbitrary sequence, 5′-TGAGTATAACTTGTGGGTACAA
GAGTGCCTTGACGATACCAAGAGTG
CCTTGACGATACAGCTTAATTCAG-
3 ′ (70 mer; SEQ ID NO: 8, the arbitrary sequence is the 20th to 39th bases, 20 bases) was synthesized using a DNA synthesizer. Then, the above SEQ ID NOs: 6 to 8
120 μl of hybridization solution containing 2 μg of each of the two types of synthetic DNAs (same composition as in Example 1)
Was prepared and used as a sample of the DNA sequence to be detected.

To a 2 ml microtube, 120 μl of the first reagent synthesized in Example 2 and 120 μl of the above sample were added, treated at 80 ° C. for 10 minutes, and then gradually cooled to 25 ° C. over 3 hours. 2.5M sodium chloride solution 400
Washed by centrifugation twice with μl. After washing, 20 μl of the second reagent prepared in Example 2 was added to the centrifuge tube, and the mixture was allowed to stand at room temperature for 1 hour. 400 μl of 1/50 surfactant (neutral washing solution containing nonionic surfactant, manufactured by Kyowa Medex) 1 M sodium chloride, 10 mM phosphate buffer (pH
After washing three times with the solution consisting of 7.0), 500 μl of the third reagent prepared in Example 2 was added to the fraction containing the carrier, and
The reaction was performed at 7 ° C. for 30 minutes, and the absorbance at 492 nm was measured. The results are shown in Table 6.

[0060]

[Table 6]

Only a DNA sample having a completely identical sequence showed a significant increase in absorbance.

Example 6 SEQ ID NO: 1 and SEQ ID NO: 4 were synthesized using a DNA synthesizer, and labeled with biotin in the same manner as in Example 3. 2 mg of the carrier-bound DNA probe prepared in Example 1 and each of the above biotin-labeled DNAs were mixed with the probe DNA at a molar ratio shown in Table 7 to prepare a sample. Each sample was kept in the hybridization solution at 80 ° C. for 10 minutes and then cooled to 25 ° C. over 3 hours. After 50 μl of 100 U / ml avidin-bound peroxidase was added and allowed to stand at room temperature for 60 minutes, the activity of peroxidase bound to the carrier was measured according to Example 3, and the absorbance was determined. The results are shown in Table 7.

[0063]

[Table 7]

As a result, it was shown that a completely complementary sequence can be detected even in a sample in which a one-base mismatch sequence has 100 times the number of moles of the completely complementary sequence.

Example 7 (Synthesis of Carrier-Binding Labeled DNA Probe) In the same manner as in Example 1, a carrier-bound DNA probe in which the 5 'end of the base sequence of SEQ ID NO: 2 was bound to an SG carrier was prepared. Subsequently, biotin was bound to the 3 'end in the same manner as in Example 2 to prepare a carrier-bound labeled DNA probe. About 0.06 μg of the probe DNA was bound to 1 mg of the SG particles.

Example 8 (Reagent for Carrier-bound Labeled DNA Probe Method) A kit comprising the following fourth to seventh reagents was prepared. Fourth reagent: 27.8 mg / ml of the carrier-bound labeled DNA probe prepared in Example 7, 2.8 M sodium chloride, 1
0 mM zinc sulfate and 300 mM acetate buffer (pH 4.
A reagent solution containing 6).

Fifth reagent: a reagent containing 300 U / ml S1 nuclease (manufactured by Lifetech Oriental), 150 mM sodium chloride, 0.05 mM zinc sulfate, 50% glycerol, and 10 mM acetate buffer (pH 4.6). Sixth reagent: 10 mM phosphate buffer containing 100 U / ml avidin-bound alkaline phosphatase (pH 8.
0).

Seventh reagent: AMPAK ™ reagent, manufactured by DAKO.

Example 9 (Carrier-bound labeled DNA probe method) DNA having the K-ras mutant sequence of SEQ ID NO: 1 and DNA having the K-ras sequence of SEQ ID NO: 4 were each dissolved by dissolving 2 μg in 120 μl of water and detected. DNA sample to be used.
To a 2 ml microtube, 120 μl of the fourth reagent synthesized in Example 8 and 120 μl of the above DNA sample were added.
After treatment at 0 ° C. for 10 minutes, the mixture was gradually cooled to 25 ° C. over 3 hours. Washing was performed by centrifugation twice with 400 μl of a 2.5 M sodium chloride solution. Then, Example 8 was added to the precipitate fraction.
Add 100 μl of the fifth reagent prepared at 37 ° C. or 45 ° C.
C. and kept for 1 hour to allow S1 nuclease to act.

After the completion of the reaction, the mixture was washed twice by centrifugation twice with 400 μl of a 2.5 M sodium chloride solution, and 20 μl of the sixth reagent prepared in Example 8 was added to the precipitate fraction, followed by standing at room temperature for 1 hour. 400 μl of 1/50 surfactant (neutral washing solution containing nonionic surfactant, manufactured by Kyowa Medex) 1 M sodium chloride, 10 mM phosphate buffer (p
H7.0), washed three times with a solution consisting of H7.0), 500 μl of the seventh reagent prepared in Example 8 was added to the fraction containing the carrier,
The reaction was carried out at 37 ° C. for 30 minutes, and the absorbance at 492 nm was measured.

As a result, when the absorbance obtained using SEQ ID NO: 1 was set to 100%, when SEQ ID NO: 4 was used, 8.2 when S1 nuclease was allowed to act at 37 ° C.
%, When S1 nuclease was allowed to act at 45 ° C., a relative absorbance of 0% was obtained. This result indicates that a completely complementary DNA fragment can be detected or quantified without detecting a single nucleotide mismatch sequence.

Test Example 1 DNA strand having the following K-ras mutant sequence: 5'-TGAGTATAAACTTGTGGGTAGTT
GGAGCTCGGTGGCGTAGGCAAGAGTG
CCTTGACGATACAGCTTAATTCAG-
3 '(70mer; SEQ ID NO: 6, mutation point is C at position 29), DN obtained by adding 9 bases of G to a sequence complementary to SEQ ID NO: 6
A, 5'-GGGGGGGGGGCTGAATTAGCTGT
ATCGTCAAGGCACTCTTGCCTACCGC
CACGAGCTCCAACTACCACAAGTTT
ATACTCA-3 '(79mer; SEQ ID NO: 9) and K-ras sequence, 5'-TGAGTAAAACTTGTGGGTAGTT
GGAGCTGGGTGGCGTAGGCAAGAGTG
CCTTGACGATACAGCTTAATTCAG-
3 ′ (70mer; SEQ ID NO: 7) was synthesized using a DNA synthesizer.

The probe of SEQ ID NO: 2 and SEQ ID NO: 1 (completely complementary combination) and the probe of SEQ ID NO: 2 and combination of SEQ ID NO: 4 (combination having a single base mismatch) were respectively 25% formamide and 0.75 M sodium chloride. , 0.075 M sodium citrate, 1% bovine serum albumin, 1% polyvinylpyrrolidone, 1% ficoll, and annealed to obtain a DNA dissolution curve. The result is shown in FIG.
Similarly, the probe of SEQ ID NO: 9 and SEQ ID NO: 6 (perfectly complementary combination) and the probe of SEQ ID NO: 9 and SEQ ID NO: 7 (combination having a single base mismatch) were similarly tested to obtain a melting curve of DNA. . The result is shown in FIG.
As a result, when the length of the probe is 70 mer, almost no difference in the melting temperature is recognized, while when the length of the probe is 20 mer, the difference in the melting temperature is about 5 ° C. This result indicates that the length of the probe has a great effect. That is, it suggests that a single base mismatch can be separated when the length of the probe DNA is less than 70.

Test Example 2 DNA strand of SEQ ID NO: 24 (having a completely complementary sequence having a length of 7 bases to the DNA strand of SEQ ID NO: 22;
For a 17-mer having a 0-base poly G sequence,
SEQ ID NO: 22 (DNA having SEQ ID NO: 24) having a DNA strand of SEQ ID NO: 22 (7mer having a completely complementary strand to the DNA strand of SEQ ID NO: 24) having biotin bound to the 5 ′ end and DNA having SEQ ID NO: 24 having biotin bound to the 5 ′ end Incomplete complementary strand (1
7mer) DN with base mismatch)
The A chain was annealed in the same manner as in Test Example 1 to obtain a melting curve of DNA.

The relative absorbance at 35 ° C. was determined by taking the absorbance at 260 nm at 20 ° C. as 1. A combination (SEQ ID NO: 22) that is completely complementary to the relative absorbance of the combination having a single base mismatch (SEQ ID NO: 23 and SEQ ID NO: 24)
And the relative absorbance of SEQ ID NO: 24) were determined. Similarly, SEQ ID NO: 25 (15me
r) and SEQ ID NO: 27 (25mer) [having a completely complementary sequence] and SEQ ID NO: 26 having biotin bound to the 5 'end
(15mer) and SEQ ID NO: 27 (25mer) [having a single-base mismatch sequence] SEQ ID NO: 1 (20mer) having 5′-terminal biotin and SEQ ID NO: 2 (30me)
r) [having a completely complementary sequence] and SEQ ID NO: 4 (20mer) and SEQ ID NO: 2 (3
0mer) [having a single-base mismatch sequence] SEQ ID NO: 28 (25mer) and SEQ ID NO: 30 (35mer) having biotin bonded to the 5 'end [having a completely complementary sequence]
And SEQ ID NO: 29 (25
mer) and SEQ ID NO: 30 (35mer) [having a one-base mismatch sequence] SEQ ID NO: 31 (30mer) and SEQ ID NO: 33 (40me) having biotin bound to the 5 ′ end
r) [having a completely complementary sequence] and SEQ ID NO: 32 (30 mer) and SEQ ID NO: 33 having biotin bound to the 5 ′ end
(40mer) [having a single base mismatch sequence] and SEQ ID NO: 6 (70me
r) and SEQ ID NO: 9 (79mer) [having a completely complementary sequence] and SEQ ID NO: 7 (7
0mer) and SEQ ID NO: 9 (79mer) [having a one-base mismatched sequence], the relative absorbance difference was similarly determined.

FIG. 4 shows the difference in relative absorbance with respect to the probe length. As a result, a remarkable difference in relative absorbance is observed at 7 to 70 mer, particularly at 15 to 25 mer.

[0077]

According to the present invention, a gene sequence to be detected or quantified can be easily detected or quantified. This also enables highly sensitive quantification of the mutant gene by a simple procedure.

[0078]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 20 Sequence type: nucleic acid Number of strands: single strand Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence GTTGGAGCTC GTGGCGTAGG 20

SEQ ID NO: 2 Sequence length: 30 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence GGGGGGGGGG CCTACGCCAC GAGCTCCAAC 30

SEQ ID NO: 3 Sequence length: 20 Sequence type: Number of nucleic acid chains: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence CACAAGTTTA TACTCAGGGG 20

SEQ ID NO: 4 Sequence length: 20 Sequence type: nucleic acid Number of strands: single strand Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence GTTGGAGCTG GTGGCGTAGG 20

SEQ ID NO: 5 Sequence length: 20 Sequence type: number of nucleic acid chains: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence CAAGAGTGCC TTGACGATAC 20

SEQ ID NO: 6 Sequence length: 70 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence TGAGTATAAA CTTGTGGTAG TTGGAGCTCG TGGCGTAGGC AAGAGTGCCT TGACGATACA GCTAATTCAG 70

SEQ ID NO: 7 Sequence length: 70 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence TGAGTATAAA CTTGTGGTAG TTGGAGCTGG TGGCGTAGGC AAGAGTGCCT TGACGATACA GCTAATTCAG 70

SEQ ID NO: 8 Sequence length: 70 Sequence type: number of nucleic acid strands: single strand Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence TGAGTATAAA CTTGTGGTAC AAGAGTGCCT TGACGATACC AAGAGTGCCT TGACGATACA GCTAATTCAG 70

SEQ ID NO: 9 Sequence length: 79 Sequence type: nucleic acid Number of strands: single strand Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence GGGGGGGGGC TGAATTAGCT GTATCGTCAA GGCACTCTTG CCTACGCCAC GAGCTCCAAC TACCACAAGT TTATACTCA 79

SEQ ID NO: 10 Sequence length: 20 Sequence type: Number of nucleic acid chains: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence GGATAGGCTG ACGTCTACCT 20

SEQ ID NO: 11 Sequence length: 20 Sequence type: nucleic acid Number of strands: single strand Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence GAGCCATCCT GCCCACCCCA 20

SEQ ID NO: 12 Sequence length: 20 Sequence type: number of nucleic acid chains: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence CCAAGAGGGA CGGGAACCTC 20

SEQ ID NO: 13 Sequence length: 20 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence ACCCTCGTTT CCGTACAGAG 20

SEQ ID NO: 14 Sequence length: 20 Sequence type: nucleic acid Number of strands: single stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence GCTGAGCCCA GGACCGGTCT 20

SEQ ID NO: 15 Sequence length: 20 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence TTCTTGTGGC AGCTTAAGTT 20

SEQ ID NO: 16 Sequence length: 21 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence TTCCTGTGGC AGCCTAAGAG G 21

SEQ ID NO: 17 Sequence length: 21 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence GTTTCTTGGA GCAGGTTAAA C 21

SEQ ID NO: 18 Sequence length: 21 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence AGTTCCTGGA AAGACTCTTC T 21

SEQ ID NO: 19 Sequence length: 21 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence GGTTGCTGGA AAGACGCGTC C 21

SEQ ID NO: 20 Sequence length: 21 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence GATTCCCCGC AGAGGATTTC G 21

SEQ ID NO: 21 Sequence length: 28 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence CACCTGCAGT GCGGAGCTCC AACTGGTA 28

SEQ ID NO: 22 Sequence length: 7 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence GCTCGTG 7

SEQ ID NO: 23 Sequence length: 7 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence GCTGGTG 7

SEQ ID NO: 24 Sequence length: 17 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence GGGGGGGGGG CACGAGC 17

SEQ ID NO: 25 Sequence length: 15 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence TGGAGCTCGT GGCGT 15

SEQ ID NO: 26 Sequence length: 15 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence TGGAGCTGGT GGCGT 15

SEQ ID NO: 27 Sequence length: 25 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence GGGGGGGGGG ACGCCACGAG CTCCA 25

SEQ ID NO: 28 Sequence length: 25 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence GTAGTTGGAG CTCCTGGCGT AGGCA 25

SEQ ID NO: 29 Sequence length: 25 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence GTAGTTGGAG CTGGTGGCGT AGGCA 25

SEQ ID NO: 30 Sequence length: 35 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence GGGGGGGGGG TGCCTACGCC ACGAGCTCCA ACTAC 35

SEQ ID NO: 31 Sequence length: 30 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence TGGTAGTTGG AGCTCGTGGC GTAGGCAAGA 30

SEQ ID NO: 32 Sequence length: 30 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acids Synthetic DNA sequence TGGTAGTTGG AGCTGGTGGC GTAGGCAAGA 30

SEQ ID NO: 33 Sequence length: 40 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence GGGGGGGGGG TCTTGCCTAC GCCACGAGCT CCAACTACCA 40

[Brief description of the drawings]

Fig. 1 Calibration curve of DNA amount

FIG. 2 DNA when probe length is 20 mer
Dissolution curve

[Explanation of symbols]

 − ● −SEQ ID NO: 2 and SEQ ID NO: 1 (completely complementary sequence) − ▲ −SEQ ID NO: 2 and SEQ ID NO: 4 (1 base mismatch)

FIG. 3 DNA when probe length is 70 mer
Dissolution curve

[Explanation of symbols]

 -● -SEQ ID NO: 9 and SEQ ID NO: 6 (completely complementary sequence)-○ -SEQ ID NO: 9 and SEQ ID NO: 7 (1 base mismatch)

Fig. 4 Difference in relative absorbance with probe length

────────────────────────────────────────────────── ─── Continued on the front page (51) Int.Cl. ⁶ Identification code FI G01N 33/547 G01N 33/547 33/566 33/566 33/58 33/58 A (72) Inventor Aiko Kubota Yokohama-shi, Kanagawa 164-35 Karibacho, Hodogaya-ku Green Hills Yokohama D-411 (72) Inventor Masanori Fukui 1-28-12 Midoridai, Himeji-shi, Hyogo

Claims (23)

[Claims] 1. A single-stranded DNA probe having a sequence complementary to a specific gene sequence of a single-stranded DNA fragment having a specific gene sequence to be detected or quantified in a sample, and a carrier comprising a substance which is difficult to adsorb DNA. Bound to the carrier-bound DNA probe with or without a spacer and D in the sample
A method for detecting or quantifying a single-stranded DNA fragment having a specific gene sequence, comprising hybridizing an NA fragment and detecting or quantifying a DNA fragment in a sample hybridized with the carrier-bound DNA probe. 2. A single-stranded DNA probe having a sequence complementary to a specific gene sequence of a single-stranded DNA fragment having a specific gene sequence to be detected or quantified in a sample, and a carrier comprising a substance which is difficult to adsorb DNA. And a single-stranded DN having a specific gene sequence to be detected or quantified in a sample.
A sample in which a single-stranded DNA probe having a sequence complementary to a partial sequence other than the specific gene sequence of the A fragment is hybridized together with the DNA fragment in the sample, and hybridized to the carrier-bound DNA and the single-stranded DNA probe. A method for detecting or quantifying a single-stranded DNA fragment having a specific gene sequence, comprising detecting or quantifying a DNA fragment therein. 3. A single-stranded DNA probe having a sequence complementary to a specific gene sequence of a single-stranded DNA fragment having a specific gene sequence to be detected or quantified in a sample, and a carrier comprising a substance which is difficult to adsorb DNA. Bound to the carrier-bound DNA probe with or without a spacer and D in the sample
A specific gene comprising hybridizing an NA fragment and then reacting with an enzyme capable of cleaving a single-stranded DNA fragment, and then detecting or quantifying the DNA fragment in the sample hybridized with the carrier-bound DNA probe. A method for detecting or quantifying a single-stranded DNA fragment having a sequence. 4. A DNA fragment obtained by labeling a DNA fragment in a sample with a labeling compound and hybridizing with a carrier-bound DNA probe.
The method for detecting or quantifying a single-stranded DNA fragment having a specific gene sequence according to claim 1, wherein the detection or quantification of the A fragment is performed by detecting or quantifying a labeled compound of the DNA fragment in the sample. 5. A DNA in which a single-stranded DNA probe having a sequence complementary to a partial sequence other than a specific gene sequence of a single-stranded DNA fragment having a specific gene sequence to be detected or quantified in a sample is labeled with a labeling compound. 3. A probe having a specific gene sequence according to claim 2, wherein the probe is a probe, and the detection or quantification of the DNA fragment hybridized to the carrier-bound DNA and the single-stranded DNA probe is performed by detecting or quantifying a labeled compound of the DNA probe. A method for detecting or quantifying a strand DNA fragment. 6. A single-stranded DNA probe having a sequence complementary to a specific gene sequence of a single-stranded DNA fragment having a specific gene sequence to be detected or quantified in a sample, and a carrier comprising a substance which is difficult to adsorb DNA. -Stranded DNA probe bound to a carrier-bound DNA probe with or without a spacer
The specific gene sequence according to claim 3, wherein the A probe portion is labeled with a labeling compound, and the detection or quantification of the DNA fragment hybridized with the carrier-bound labeled DNA probe is performed by detecting or quantifying the labeled compound of the carrier-bound labeled DNA probe. A method for detecting or quantifying a single-stranded DNA fragment having: 7. The method for detecting or quantifying a single-stranded DNA fragment having a specific gene sequence according to claim 1, wherein the gene sequence to be detected or quantified is a point mutant gene. 8. A single-stranded DNA probe having a sequence complementary to a gene sequence to be detected or quantified in a sample,
The method for detecting or quantifying a single-stranded DNA fragment having a specific gene sequence according to any one of claims 1 to 6, which is 30 mer. 9. The method for detecting or quantifying a single-stranded DNA fragment having a specific gene sequence according to claim 1, wherein the spacer is polyethylene glycol diglycidyl ether, single-stranded DNA or single-stranded RNA. 10. The method for detecting or quantifying a single-stranded DNA fragment having a specific gene sequence according to claim 1, wherein the carrier that does not easily adsorb DNA is a particle having a core-shell structure of styrene-glycidyl methacrylate. . 11. The labeling compound is biotin, and the detection or quantification of the labeling compound is performed by binding the avidin-binding enzyme to the labeling compound biotin, and then detecting or quantifying the enzyme activity of the bound enzyme. 7. A method for detecting or quantifying a single-stranded DNA fragment having the specific gene sequence according to any one of items 1 to 6. 12. The method for detecting or quantifying an enzyme activity is a method incorporating amplification by enzyme cycling.
A method for detecting or quantifying a single-stranded DNA fragment having the specific gene sequence according to 1. 13. A 10- to 30-mer single-stranded DNA probe having a sequence complementary to a specific gene sequence of a single-stranded DNA fragment having a specific gene sequence to be detected or quantified in a sample, and a carrier which does not easily adsorb DNA. Is a carrier-bound DNA probe that is bound with or without a spacer. 14. The carrier-bound DNA probe according to claim 13, wherein the carrier that does not easily adsorb DNA is a particle having a core-shell structure of styrene-glycidyl methacrylate. 15. A single-stranded DNA probe having a sequence complementary to a specific gene sequence of a single-stranded DNA fragment having a specific gene sequence to be detected or quantified, and a carrier that does not easily adsorb DNA are interposed with or without a spacer. A bound carrier-bound DNA probe, a single-stranded DNA probe having a sequence complementary to a partial sequence other than the specific gene sequence of a single-stranded DNA fragment having a specific gene sequence to be detected or quantified in a sample, and a labeling compound A reagent kit for detecting or quantifying a single-stranded DNA fragment having a specific gene sequence, comprising a reagent comprising a labeled binding DNA probe to which is bound and a reagent for detecting or quantifying a labeled compound. 16. The method according to claim 16, wherein the carrier-bound DNA probe is 10 to 30.
and the labeled bound DNA probe is 10 to 30 m
17. A reagent kit for detecting or quantifying a single-stranded DNA fragment having the specific gene sequence according to claim 15, which is an er. 17. The method according to claim 15, wherein the labeled compound of the labeled DNA probe is biotin, and the reagent for detecting or quantifying the labeled compound is a reagent for detecting or quantifying the enzyme activity of avidin-binding enzyme. Main chain D
Reagent kit for detection or quantification of NA fragments. 18. The avidin-binding enzyme is alkaline phosphatase, and the reagent for detecting or quantifying the enzyme activity of the avidin-binding enzyme is NADP, INT-violet, NAD
18. The reagent kit for detecting or quantifying a single-stranded DNA fragment having a specific gene sequence according to claim 17, comprising H, ethanol, diaphorase and alcohol dehydrogenase. 19. A labeled binding DNA probe and a DNA in which a single-stranded DNA probe having a sequence complementary to a specific gene sequence of a single-stranded DNA fragment having a specific gene sequence to be detected or quantified is bound to a labeling compound. A specific gene sequence comprising a reagent comprising a carrier-bound labeled DNA probe to which a carrier which does not easily adsorb is bound with or without a spacer, a reagent comprising an enzyme capable of cleaving single-stranded DNA, and a reagent for detecting or quantifying a labeled compound. A reagent kit for detecting or quantifying a single-stranded DNA fragment. 20. The method according to claim 19, wherein the carrier-bound labeled DNA probe is 10 to 10.
The reagent kit for detecting or quantifying a single-stranded DNA fragment having a specific gene sequence according to claim 19, which is 30 mer. 21. The specific gene according to claim 19, wherein the labeled compound of the carrier-bound labeled DNA probe is biotin, and the reagent for detecting or quantifying the labeled compound is a reagent for detecting or quantifying the enzyme activity of avidin-binding enzyme. A reagent kit for detecting or quantifying a single-stranded DNA fragment. 22. The avidin-conjugating enzyme is alkaline phosphatase, and the reagent for detecting or quantifying the enzyme activity of the avidin-conjugating enzyme is NADP, INT-violet, NAD
22. The reagent kit for detecting or quantifying a single-stranded DNA fragment having a specific gene sequence according to claim 21, comprising H, ethanol, diaphorase, and alcohol dehydrogenase. 23. A labeled binding DNA probe and a DNA in which a single-stranded DNA probe having a sequence complementary to a specific gene sequence of a single-stranded DNA fragment having a specific gene sequence to be detected or quantified is bound to a labeling compound. A carrier-bound labeled DNA probe to which a carrier that does not easily adsorb is bound with or without a spacer.