JPH11215983A - Antifungal agent with peptide as active component - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain an antifungal agent having antifungal activity and useful for various areas, e.g. foods, medicines, construction materials, paints, agriculture and horticulture, and feeds for stock and fish breeding by using insect-derived peptide with a specific amino acid sequence as the active component. SOLUTION: This antifungal agent contains, as the active component, moricin as insect-derived peptide, composed of the amino acid sequence shown by the formula, or peptide or the like composed of the amino acid sequence shown by the formula wherein one or more amino acids are added, missing or substituted, and having antifungal activity. It can be directly used, or formed into tablet, powder, water dispersible powder, emulsifier or capsule shape after it is mixed with, e.g. solid carrier, liquid carrier or emulsifying dispersant which is normally used. It is useful for various areas, e.g. foods, medicines, construction materials, paints, agriculture and horticulture, and feeds for stock and fish breeding.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to an antifungal agent containing an insect peptide as an active ingredient.

[0002]

2. Description of the Related Art When bacteria enter the body cavity of an insect, a protein or peptide having a bactericidal action or a growth inhibitory action on the bacteria is induced and produced in a body fluid. Already
Numerous antibacterial proteins or peptides have been isolated from various insects, and their antibacterial activity against bacteria has been studied in detail.

[0003] Fungi can be excluded from insects as well as bacteria. Fungi include so-called filamentous fungi (molds). In various industrial fields such as the food hygiene field and the medical field, reducing the damage caused by fungi has become an important issue. However, the antifungal effect of the above-mentioned antibacterial protein or antibacterial peptide on fungi has hardly been studied.

The present inventors have found an antimicrobial peptide having a strong antibacterial activity against various Gram-positive and negative bacteria from the body fluid of silkworm larvae and named it moricin.
No. 8-119995; J. Biol. Chem. 270, 29923 (1992)
Five)]. However, the antifungal effect of moricin on fungi was completely unknown.

[0005]

An object of the present invention is to provide an antifungal agent containing moricin as an active ingredient.

[0006]

Means for Solving the Problems The present inventors have found that moricin exhibits an excellent growth inhibitory effect on fungi, and have completed the present invention. That is, the present invention relates to an antifungal agent containing the following peptide (a) or (b) as an active ingredient. (A) a peptide consisting of the amino acid sequence of SEQ ID NO: 1; (B) A peptide comprising an amino acid sequence in which one or more amino acids have been added, deleted or substituted in the amino acid sequence described in (a), and having an antifungal activity. The above-mentioned peptides (a) and (b) mean the above-mentioned moricin peptide. Further, the antifungal agent referred to in the present invention means an agent having a bactericidal action or a growth inhibiting action on fungi. Furthermore, in the present invention, a bactericidal action or a growth inhibiting action on fungi is referred to as “antifungal activity”.

[0007]

DESCRIPTION OF THE PREFERRED EMBODIMENTS The present invention will be described below in detail.
Moricin can be isolated using a body fluid of a silkworm larva in which antibacterial activity has been induced as a starting material using a conventional peptide purification method. The amino acid sequence of moricin (hereinafter also referred to as “wild-type moricin”) obtained from silkworm larvae is as shown in SEQ ID NO: 1. Wild-type moricin can be isolated from body fluids of silkworm larvae by the method described in JP-A-8-19995. In that case, first, Escherichia coli is injected into the body cavity of the silkworm larva to induce the production of moricin. Next, the body fluid of the silkworm larva is collected and salted out with ammonium sulfate. Then
By subjecting the salted-out product to a gel filtration column, a cation exchange column, and a reverse-phase HPLC, moricin is isolated.

[0008] Wild-type moricin can also be prepared from recombinant microorganisms and the like by genetic engineering techniques.
In that case, first, the wild-type moricin gene is cloned from the silkworm larva, or a gene encoding the amino acid sequence of the wild-type moricin is artificially synthesized. Then
The gene is introduced into an appropriate vector-host system to produce a recombinant microorganism. The recombinant microorganism may be cultured in an appropriate medium, and moricin may be collected from the resulting culture. Examples of the above-mentioned recombinant microorganism include (E. coli) JM109 (pXAMOR) described in JP-A-8-19995.
1) (FERM BP-5099) can be used.

The moricin of the present invention comprises an amino acid sequence in which one or more amino acids are added, deleted or substituted in the amino acid sequence of SEQ ID NO: 1 and has a fungicidal activity (hereinafter referred to as “mutant moricin” "). When preparing a mutant moricin, first, a mutation such as addition, deletion or substitution is introduced into the nucleotide sequence of a wild-type moricin gene to construct a mutant moricin gene. Next, the mutant gene is introduced into an appropriate vector-host system to produce a recombinant microorganism. Among the recombinant microorganisms, those that produce a peptide having antifungal activity, that is, a mutant moricin are screened. A recombinant microorganism capable of producing mutant moricin may be cultured in an appropriate medium, and the mutant moricin may be collected from the resulting culture.

As a method for introducing a mutation into the wild-type moricin gene, there is a method in which the gene is brought into contact with a mutagenic agent, specifically, hydroxylamine, nitrite, sulfurous acid, 5'-bromouracil or the like. Can be. Alternatively, a chemically synthesized oligonucleotide can be annealed to construct a mutant moricin gene having a mutation at a desired site. In addition, ultraviolet irradiation method,
Methods such as a site-directed mutagenesis method using the cassette mutagenesis method and the PCR method and a random mutagenesis method can be widely used.

The moricin of the present invention may be prepared by a peptide chemical synthesis method. In addition, the moricin of the present invention
In the amino acid sequence, one or more amino acids may be modified. The amino acid modification is, for example, phosphorylation, addition of a sugar chain, acylation, alkylation, amidation, hydroxylation and the like. The antifungal agent of the present invention,
It has a bactericidal action or a growth inhibitory action on fungi with morricin as an active ingredient. Fungi include yeasts and mushrooms, as well as so-called filamentous fungi (molds), and specific examples include phytopathogenic filamentous fungi such as cucurbit vines and tomato late blight.

The antifungal agent of the present invention can be used in a wide variety of fields, such as for food, medical use, building materials and paints, agricultural and horticultural use, livestock and fish feed. Moricin may be used as it is as the antifungal agent of the present invention. After mixing morricin with a commonly used solid carrier, liquid carrier, emulsifying dispersant, or the like, the mixture may be formulated into tablets, powders, wettable powders, emulsions, capsules, and the like. As the carrier,
Water, alcohol, gelatin, starch, magnesium stearate, lactose, mineral powder, acacia, vegetable oil and the like can be mentioned.

When moricin is added to foods as a preservative for foods, examples thereof include a method of mixing in foods and a method of applying it to the surface of foods. In that case, 2 kg of food
mg or more, preferably about 4-40 mg. Examples of applicable foods include, but are not particularly limited to, fish paste products such as kamaboko and chikuwa, processed meat products such as ham and sausage, beverages such as soft drinks and fruit drinks, and confectioneries such as cakes, puddings and buns. Is done.

When moricin is used as a preservative for agriculture and horticulture, a method of mixing it with soil / fertilizer, a method of adding it to water for hydroponics, and a method of spraying or applying a moricin solution to plant seeds / saplings or soil Etc. are exemplified. When moricin is mixed with soil / fertilizer, the amount of moricin used may be appropriately set, and is usually 5 / kg of soil / fertilizer.
mg or more, preferably about 10-100 mg.

The moricin solution is prepared by adding moricin to 1 L of a liquid carrier.
The amount may be adjusted by adding and mixing at least 2 mg / preferably, preferably about 4-40 mg / day. Water, alcohol, and the like can be used as the liquid carrier. The antifungal agent of the present invention can be used by appropriately mixing an antifungal agent other than moricin, a pharmaceutical, a food additive, and the like.

[Production Example of Moricin (1)] Isolation of Moricin from Silkworm Body Fluid Induced Antibacterial Activity Silkworm (variety name: Tokai × Asahi, obtained from the Research Institute of Silk and Insect Agriculture, Ministry of Agriculture, Forestry and Fisheries) 5th instar larva To 700 heads, a physiological saline suspension (4 × 10 ⁸ cells / ml) of Escherichia coli HB101 ATCC33694 was injected into the body cavity at a rate of 0.005 ml / head to induce antibacterial activity. 20 hours later,
The bodily fluid was collected by cutting the silkworm's foot, immediately heated on a hot water bath at 100 ° C. for 5 minutes, and then centrifuged. Ammonium sulfate was added to 200 ml of the obtained centrifugal supernatant so as to be 15% saturated, and the salted out product was centrifuged. Ammonium sulfate was added to the centrifuged supernatant to 75% saturation, and the salted out product was collected by centrifugation. This salted-out product was dissolved in 40 ml of distilled water.

The lysate is passed through a column (5 × 100 cm) of Sephadex G-50 equilibrated with 50 mM ammonium acetate (pH 5.0) to perform gel filtration.
The low molecular weight protein fraction was collected. The low molecular weight protein fraction was applied to a column of CM Sepharose FF (2.5 × 4.4 cm) equilibrated with 50 mM ammonium acetate (pH 5.0). The adsorption fraction is
9.5: 0.5 of 50 mM ammonium acetate (pH 5.0) and 0.8 M ammonium acetate (pH 7.0),
9: 1, 8: 2, 7: 3, 6: 4, 5: 5, 4: 6,
The mixture mixed at a volume ratio of 3: 7 was eluted by sequentially flowing 50 ml of the mixture through this column. The eluate was collected in 50 ml portions according to the salt concentration. The fraction eluted with the 4: 6 mixture showed the strongest antibacterial activity.

10 ml of the fraction eluted with the 4: 6 mixture was subjected to reverse phase HPLC (column: Capcell).
PaK C8 SG300 10 × 250 mm). The adsorbed fraction was eluted with a concentration gradient of acetonitrile containing 0.1% trifluoroacetic acid. The remaining eluate was similarly subjected to reverse phase HPLC, and the fraction showing the strongest antibacterial activity was collected. This fraction was again subjected to reverse phase HPLC (column: Capc
el PaK C8SG300 4.6 × 250m
m) and further purified. The adsorption fraction is 0.1
Elution was carried out with a concentration gradient of acetonitrile containing trifluoroacetic acid. A part of the eluted fraction is subjected to Tricine SDS polyacrylamide gel electrophoresis (hereinafter referred to as "Tricine SDS").
-PAGE ”), and the gel after the electrophoresis was subjected to trade name:
When stained with Coomassie Brilliant Blue R-250 (manufactured by BRL), a single stained band was obtained.

According to the above method, 150 μg of moricin was obtained from 200 ml of the centrifugal supernatant of the silkworm body fluid. The antibacterial activity at the time of isolation of moricin was measured using the inhibition circle formation on a plate medium as an index [Nature, vol. 292, p. 246 (198
1)], Staphylococcus (Staphylococcus)
aureus subsp. aureus ATCC 6538P). The protein amount was measured by a modified method of the Lowry method [Methods Enzymol. Vol. 91, p. 95 (1983)], and tricine SDS-PAGE was determined according to [Anal. Biochem.
66, p. 368 (1987)].

Structural analysis (a) Amino acid composition After hydrolysis in a 6N-hydrochloric acid containing 0.1% phenol (under reduced pressure, 110 ° C., 24 hours), analysis was performed using an amino acid analyzer (model 835, manufactured by Hitachi, Ltd.). The results are shown below. Amino acid moles / molysin 1 mole Lys 8.8 Ala 5.9 Ile 4.8 Asp + Asn 4.0 Gly 3.1 Val 3.2 Arg 1.7 Leu 2.1 Phe 2.3 Pro 1.9 Thr 1. 9 His 1.4 Ser 1.0

(B) Molecular weight As a result of analysis by a mass spectrometer (API-III type, manufactured by Perkin Elmer ScieX), a value of 4543.1 ± 0.6 Da was obtained. (C) N-terminal amino acid sequence The N-terminal amino acid sequence of moricin was analyzed by Edman method using a protein sequencer (type 473A, manufactured by Applied Biosystems), and as a result, the amino acid sequence described in SEQ ID NO: 2 was obtained. (D) Amino acid sequence of endoproteinase digested product After moricin was digested with endoproteinase Asp-N (Takara Shuzo), the resulting peptide fragment was subjected to reverse phase HPLC.
Was isolated. As a result of analyzing the amino acid sequence of each fragment by the Edman method, the amino acid sequences of SEQ ID NO: 3 and SEQ ID NO: 4 were obtained. (E) From the results of amino acid analysis, mass spectrometry, and analysis by the Edman method, it was concluded that moricin was a peptide having the amino acid sequence of SEQ ID NO: 1.

[Production Example of Moricin (2)] Production of Moricin by Genetic Engineering Technique Construction of DNA Containing Moricin Gene Using Chemical Synthesis Method (a) Determination of Base Sequence Utilization of codon frequently used in Escherichia coli [Ikemura,
T., J. Mol. Biol .. 151, 389-409 (1987)], and the nucleotide sequence of the DNA to be constructed, ie, the DNA containing the moricin gene, was determined. This DNA is composed of the restriction enzyme Ec
Downstream of the oRI recognition site, the codon corresponding to methionine for cleavage with cyanogen bromide (ATG), the moricin gene, two stop codons (TAA and TAG), and then Sa
It is an lI recognition site. The determined nucleotide sequence of the moricin gene is shown in SEQ ID NO: 5.

(B) Chemical Synthesis of Oligonucleotides The DNA containing the morysin gene was ligated to eight portions (mosy1
To 8) and chemically synthesized. Oligonucleotides were synthesized by a phosphoramidite method using a DNA synthesizer (ABI model 392, manufactured by Applied Biosystems). The base sequences of mosy 1 to 8 are as follows. mosy1 AATTCATGGCTAAAATCCCGATTAAGGCAATTAAA mosy2 ACTGTGGGCAAAGCTGTTGGTAAAGGTCTGCGTG mosy3 CTATCAACATCGCTTCTACCGCTAACGACGTATTCAA mosy4 CTTCCTGAAACCGAAGAAACGTAAACACTAATAG mosy5 CACAGTTTTAATTGCCTTAATCGGGATTTTAGCCATG mosy6 GTTGATAGCACGCAGACCTTTACCAACAGCTTTGCC mosy7 CAGGAAGTTGAATACGTCGTTAGCGGTAGAAGCGAT mosy8 TCGACTATTAGTGTTTACGTTTCTTCGGTTT

(C) Purification of Synthetic Oligonucleotides Purification of synthetic oligonucleotides was performed using QIYAGEN Plasmid Ki
t (manufactured by Funakoshi). First, a part of the oligonucleotide synthesized in (b) was added to a MOPS solution [50
mM MOPS (pH 7.0), 0.1 M NaCl], and 20 μg / m
1 of the oligonucleotide solution was prepared. Equilibration solution [5
0mM MOPS (pH 7.0), 0.1M NaCl, 0.15% Triton X-100] 2
The purification chip (QIYAGEN-tip 20) equilibrated with
1 ml of the above-mentioned oligonucleotide solution was provided, and after adsorbing the oligonucleotide, it was washed with 4 ml of a MOPS solution. Then, elution, precipitation, and washing of the oligonucleotide were performed according to the instructions of the kit. Each of the obtained oligonucleotides (6 to 13 μg) was added to a TE solution [10 mM Tris-HCl (p
H8.0), 1 mM EDTA].

(D) Phosphorylation of oligonucleotides The 5 'end of each of the oligonucleotides mosy2 to 7 is
Phosphorylation was performed using ATP and T4 polynucleotide kinase. The reaction was performed in separate tubes, and the conditions were as follows. 3 μg of oligonucleotide (dissolved in TE solution), 10 × Kation buffer [500
mM Tris-HCl (pH 7.6), 100 mM MgCl ₂ , 50 mM DTT, 1 mM spe
rmidine-HCl, 1mM EDTA Nippon Gene Co., Ltd.] 2μl, 10mM A
Water was added to a mixture of 2 μl of TP and 20 U of T4 polynucleotide kinase (manufactured by Nippon Gene Co., Ltd.) to make a total volume of 20 μl, followed by reaction at 37 ° C. for 2 hours. Then, the mixture was heated at 90 ° C. for 3 minutes to stop the reaction.

(E) Construction of DNA Containing Moricin Gene (i) Annealing of Oligonucleotides The phosphorylation reaction solutions of Mosy 2 to 7 were combined into one tube to make 120 μl, and 3 μg of Mosy1 was added thereto.
And 3 μg of Mosy8 were added. Further, 10 × ligation buffer [500 mM Tris-HCl (pH 7.9), 100 mM Mg
Cl ₂ , 200 mM DTT, 10 mM ATP manufactured by Nippon Gene Co., Ltd.] 20 μl
Was added to make a total volume of 197 μl with water. 5 at 90 ° C
After heating for 1 minute, immediately cool on ice and heat block (Dry Ther
mo Unitmodel AL-10 by Taitec) at 75 ℃
Heated for 0 minutes. Then turn off the heat block,
Left for 5 hours. (ii) Ligation of oligonucleotides To 197 μl of the above reaction solution, 1800 U of T4 DNA ligase (manufactured by Nippon Gene Co., Ltd.) was added and reacted at 16 ° C. for 14 hours.

(Iii) DNA purification A BPB solution (0.1% BP) was added to a part (30 μl) of the above reaction solution.
B, 30% Glycerol), and 3% agarose gel electrophoresis was performed to cut out a band having a chain length of about 140 bp. The DNA in the gel was recovered by freeze-thawing and ethanol precipitation. 800 ng of the obtained DNA
Was dissolved in 9 μl of 1 × Kation buffer. (iv) Phosphorylation of DNA containing moricin gene In 8 μl of the above DNA solution, 1 μm of 10 mM ATP was added.
After the addition of 1 U and 10 U of T4 polynucleotide kinase, the mixture was reacted at 37 ° C. for 2 hours. Then, the mixture was heated at 90 ° C. for 3 minutes to stop the reaction.

(B) Recombinant DNA (plasmid pUCM
Preparation of OR1) Plasmid pUCMOR1 contains DNA containing the moricin gene
Is inserted. This plasmid was obtained as follows. Plasmid pUC119 (Takara Shuzo) 4 μg, 10 × H
Buffer [500mM Tris-HCl (pH7.5) , 100mM MgCl 2, 10
mM DTT, 1000 mM NaCl, manufactured by Takara Shuzo Co., Ltd.] 4 μl, restriction enzyme Eco
A mixture of 20 U of RI (manufactured by GIBCO BRL) and 20 U of SalI (manufactured by Takara Shuzo) was added with water to make a total volume of 40 μl, and then mixed.
Digested for 20 hours at ° C. Then, the reaction was stopped by heating at 65 ° C. for 15 minutes.

The above reaction mixture (2 μl, plasmid 200 n
g), 10 μl of the moricin gene DNA prepared in 1. (5) above, 2 μl of 10 × ligation buffer
1, 2 μg / ml BSA 2 μl and T4 DNA ligase 1200 U were mixed with water to give a total volume of 20 μl.
After that, the ligation reaction was performed at 16 degrees for 6 hours. 20 μl of the above ligation reaction solution was added to a competent cell (Escherichia coli JM109 manufactured by Nippon Gene).
After mixing with 100 μl of the solution, transformation was carried out by holding on ice for 30 minutes, at 37 ° C. for 2 minutes, and on ice for 5 minutes. Next, High competent broth (Nippon Gene) 400
After adding and shaking culture at 37 ° C for 1 hour,
μg / ml ampicillin, 0.1 mM IPTG, 40
2 × YT containing 1.6 μg / ml X-gal (1.6% Trypto
(n, 1% yeast extract, 0.5% NaCl) agar medium was divided into four aliquots and spread, and cultured at 37 ° C for 20 hours to obtain about 300 ampicillin-resistant strains.

From these ampicillin-resistant strains, 20 light blue colonies were selected and cultured at 37 ° C. for 10 hours in 3 ml of LB liquid medium containing 50 μg / ml ampicillin. After centrifuging and collecting the culture, the QIYAGEN Plasmid
Plasmid DNA was purified using Mini Kit (Funakoshi) and dissolved in 20 μl of TE solution. Water was added to a mixture of 2 μl of the above plasmid solution, 1 μl of 10 × H buffer, 3 U of restriction enzyme EcoRI and 3 U of restriction enzyme SalI to make a total volume of 10 μl, and the mixture was reacted at 37 ° C. for 90 minutes. To this reaction solution, 1 μl of a BPB solution was added and subjected to 4% agarose electrophoresis to confirm the chain length of the insert DNA cut out by the restriction enzyme. 12
Fragments of various sizes of about 0 to 140 bp were observed. For 14 plasmids having an insert DNA of about 140 bp, the base sequence of the insert DNA was determined. The nucleotide sequence is Taq Dye Primer Cycle Sequenc
ing Kit (ABI), GeneAmp PCR System 9600 (P
erkin Elmer Cetus, DNA sequencer (model
373A (ABI). There were four plasmids into which the DNA containing the moricin gene had been inserted, and one of them was named pUCMOR1.

(C) Recombinant DNA for moricin expression
Preparation of (Plasmid pXAMOR1) Plasmid pXAMOR1 is obtained by inserting the DNA containing the moricin gene inserted into plasmid pUCMOR1 into EcoR of plasmid pXa1.
I, obtained by subcloning into the SalI site.
This plasmid is controlled by the lac promoter / operator and expresses a fusion protein consisting of β-galactosidase, collagen fragment and moricin. This plasmid was obtained as follows. Plasmid pXa1
(Boehringer) 5 μg, 10 × H buffer 10 μm
1, a mixture of 20 U of restriction enzymes EcoRI and 20 U of SalI was added with water to make a total volume of 100 μl, and then digested at 37 ° C. for 20 hours. Then, the reaction was stopped by heating at 65 ° C. for 15 minutes to obtain a cut plasmid pXa1. On the other hand, the plasmid pUCMOR1 was digested with EcoRI and SalI, and the insert DN was inserted.
After excision of A, the insert DNA was purified using agarose gel electrophoresis. The conditions are as follows.

Water was added to a mixture of 10 μg of plasmid pUCMOR1 and 5 μl of 10 × H buffer, 20 U of restriction enzymes EcoRI and 20 U of SalI to make a total volume of 50 μl.
The reaction was performed at 20 ° C. for 20 hours. BPB was added to 50 μl of this reaction solution.
3 μl of the solution was added, and 3% agarose gel electrophoresis was performed to cut out a band having a chain length of about 140 bp. Next, the DNA in the gel was recovered by freeze-thawing and ethanol precipitation. Obtained insert DNA 60
ng was dissolved in 18 μl of water. Then, 20 ng of the purified insert DNA and the cut plasmid pXa11
μl (50 ng), 10 × ligation buffer
Water was added to a mixture of 1 μl, 2 μg / ml BSA (1 μl) and T4 DNA ligase (600 U) to give a total amount of 10 μl.
After making the volume μl, a ligation reaction was performed at 16 ° C. for 5 hours.

The above ligation reaction solution and competent cells (Escherichia coli JM109, manufactured by Nippon Gene) 10
0 μl was mixed, and the mixture was kept on ice for 30 minutes, at 37 ° C. for 2 minutes, and on ice for 5 minutes for transformation. This reaction solution is
The cells were spread on two 2 × YT agar media containing 50 μg / ml ampicillin and cultured at 37 ° C. for 20 hours to obtain about 1,000 ampicillin-resistant strains. Fourteen strains were selected from the above ampicillin-resistant strains, and cultured at 37 ° C. for 10 hours in 3 ml of an LB liquid medium containing 50 μg / ml ampicillin. After centrifuging and collecting the culture, the QIYAGEN Plasmid Mi
The plasmid was purified using the ni Kit and dissolved in 20 μl of TE solution.

2 μl of the above plasmid solution, 1 μl of 10 × H buffer, 3 U of restriction enzyme EcoRI, SalI restriction enzyme
Water was added to the mixture of 3U to make a total volume of 10 μl, and the mixture was reacted at 37 ° C. for 90 minutes. Add BP to this reaction solution
After adding 1 μl of the B solution and performing 4% agarose electrophoresis to confirm the chain length of the insert DNA cut out by the restriction enzyme, all the plasmids were 140 bp.
It was confirmed that it contained insert DNA of about the same length. One of these plasmids was named pXAMOR1. In addition, recombinant E. coli containing pXAMOR1 is (E.co.
li) Named JM109 (pXAMOR1) and deposited with the National Institute of Bioscience and Human-Technology, National Institute of Advanced Industrial Science and Technology as FERM BP-5099.

(D) Production of moricin fusion protein by recombinant microorganism (i) Confirmation of production of fusion protein Recombinant E. coli J containing plasmid pXAMOR1
One colony of M109 (pXAMOR1) was inoculated into 2 ml of an LB liquid medium containing 50 μg / ml ampicillin, and cultured at 37 ° C. for 2 hours. Next, 10 μl of 100 mM IPTG was added to induce the expression of the fusion protein, and the cells were further cultured at 37 ° C. for 2 hours. After collecting 0.5 ml of the culture solution by centrifugation, the cells were sample buffered [62.5 mM Tris-HCl (pH 6.8), 10%
glycerol, 2% SDS, 5% 2-mercaptoethanol, 0.002
[5% BPB] in 100 µl, and heated at 100 ° C for 5 minutes. Of these, 3 μl were subjected to SDS-PAGE. On the other hand, as a control, a culture solution of the recombinant Escherichia coli cultured without adding IPTG was subjected to SDS-PAGE. The expected molecular weight of the fusion protein consisting of β-galactosidase, collagen fragment and moricin is 127.5 kD. Molecular weight 12 only when cultured with IPTG
A band was observed around 7.5 kD, confirming that the fusion protein was expressed.

(Ii) Crude Purification of Fusion Protein Recombinant Escherichia coli was precultured in 40 ml of 2 × YT liquid medium containing ampicillin at 37 ° C. for 14 hours. Then
2 × YT liquid medium 3 containing 50 μg / ml ampicillin
In three flasks containing 00 ml, add the above pre-cultured solution to 1 flask.
0 ml each was added, and the cells were cultured at 37 ° C. for 2 hours. After adding 1.5 ml of 100 mM IPTG to each flask and culturing for further 2 hours, the culture was centrifuged to collect the cells, and 3.7 g of the cells were obtained.
I got The cells were added to a suspension solution [20 mM Tris-HCL (pH 7.
4), 200 mM NaCl, 1 mM EDTA (pH 8.0), 10 mM 2-mercaptoethanol]. The suspension is freeze-thawed and sonicated (Sonifier Cell Disruptor W200P
BRANSON) to disrupt the cells. Next, the precipitate obtained by centrifuging the crushed material was used as a suspension solution (0.5% Triton X-100,
10 mM EDTA (pH 8.0)]. This was centrifuged again to remove the supernatant, and 9 mg of protein was obtained. This was subjected to the following cyanogen bromide treatment as a crudely purified fusion protein.

(Iii) Cyanogen bromide treatment 1 mg of crudely purified fusion protein obtained by the above method
Then, 200 μl of 70% formic acid and 10 μl of 100 mg / ml cyanogen bromide (dissolved in acetonitrile) were added, reacted at room temperature for 24 hours, and dried under reduced pressure. This was used as crude moricin.

[0038]

The present invention will be described below in more detail with reference to examples. However, the present invention does not limit the technical scope to these examples. (Example 1) Antifungal activity test of moricin To examine the antifungal activity of moricin against various phytopathogenic fungi, [FEMS Microbiol. Lett. Vol. 69, p. 55 (199)
0)] The minimum growth inhibitory concentration (MIC) was determined according to the method described above.

1. Test substance (1) Moricin: The crudely purified moricin obtained by the genetic recombination method of Production Example (2) is Sephadex G-5.
0 (manufactured by Pharmacia Fine Chemical), cation exchange column chromatography using CM Sepharose FF (manufactured by Pharmacia Fine Chemical), Capcell Pak C8 SG300
The product was subjected to reverse-phase HPLC using Shiseido (manufactured by Shiseido Co., Ltd.), and moricin was purified to almost a single substance. Next, the purified moricin was subjected to measurement of molecular weight by a mass spectrometer, analysis of the N-terminal amino acid sequence, and analysis of the amino acid sequence of the endoproteinase digest to confirm that it was identical to the amino acid sequence described in SEQ ID NO: 1. did.

(2) Cecropin B2: As a control antimicrobial peptide, cecropin B2 which is an antimicrobial peptide derived from silkworm
[Comp. Biochem. Physiol. 95B, 551 (1990)] was used by the Institute of Silk and Insect Agriculture Technology of the Ministry of Agriculture, Forestry and Fisheries. (3) Amphotericin B: Amphotericin B (trade name Fungizon, manufactured by GIBCO BRL) was used as a control antifungal agent.

2. Test bacteria (1) Fusarium oxysporum Schlech
tendahl cucumerinumIFO6384) (2) Phytophthora infestans (obtained from Del Monte, Japan)

3. Preparation method of conidia or zoospores (1) When the test bacteria is cucurbit wilt, 30 ° C on an agar medium of potato dextrose (PD) (manufactured by Difco)
For 5 days. An appropriate amount of sterile water was added to the culture to suspend the conidia. Transfer a portion of this suspension to a hemocytometer,
The number of conidia was measured by observation with a microscope (inverted IMT-2, manufactured by Olympus Corporation). The suspension was diluted with a PD liquid medium (manufactured by Difco) so that the number of conidia per ml was about 20,000. (2) If the test bacterium is a tomato late blight, on a PD agar medium
The cells were cultured at 20 ° C. for 14 days. The zoospores were suspended by adding an appropriate amount of sterilized water, and the zoospores were released by leaving the suspension on ice for 2 hours. Transfer 50 μl of this suspension to a 96-well microtiter plate (flat bottom, Falcon),
The number of zoospores was measured by microscopic observation. The suspension was diluted with a PD liquid medium such that the number of zoospores in the visual field was about 20 when observed with a microscope at a magnification of 100 times.

4. Antifungal activity test method The conidia or zoospore suspension prepared above was dispensed into a 96-well microtiter plate at 50 μl per well. After adding 50 μl of an aqueous solution of each concentration of the test substance to each well, the cells were incubated at 28 ° C. for 48 hours. However, in the case of Tomato late blight, the cells were cultured at 20 ° C. for 96 hours. After culture
The degree of hyphal growth was visually observed. The minimum concentration of the test substance at which no growth of the test bacteria was observed was determined as MIC. Table 1 shows the results.

[0044]

[Table 1]

As is clear from the results in Table 1, the antifungal activity of moricin against the test bacteria was comparable to or higher than amphotericin B, a known antifungal agent. Although cecropin B2 also showed antifungal activity, it was not as effective as moricin. Since moricin strongly inhibits the growth of phytopathogenic fungi, it is clear that it is useful as an antifungal agent.

(Preparation Example 1) Morisin purified by the method described in (1) of Example 1 was freeze-dried, and dissolved in water to give 1
A moricin solution of 00 mg / ml was prepared and used as an aqueous preservative for agriculture and horticulture. (Formulation Example 2) 100 mg of moricin, 40 g of clay and 60 g of talc purified by the method described in (1) of Example 1 were pulverized and mixed to prepare a powder. (Formulation Example 3) 100 mg of moricin, 40 g of pentonite, 48 g of clay purified by the method described in (1) of Example 1
And 7 g of ligninsulfonic acid were uniformly mixed, kneaded by adding water, granulated, and further dried to obtain granules.

[0047]

As described above, moricin is provided as a novel antifungal agent because it exhibits excellent antifungal activity. The antifungal agent of the present invention is used for food, medical use, building materials and paints, agricultural and horticultural use, livestock and livestock.
It can be used in a wide variety of fields, such as for fish feed.

[0048]

[Sequence list] SEQ ID NO: 1 Sequence length: 42 Sequence type: Amino acid Topology: Linear Sequence type: Peptide sequence Ala Lys Ile Pro Ile Lys Ala Ile Lys Thr Val Gly Lys Ala Val 5 10 15 Gly Lys Gly Leu Arg Ala Ile Asn Ile Ala Ser Thr Ala Asn Asp 20 25 30 Val Phe Asn Phe Leu Lys Pro Lys Lys Arg Lys His 35 40

SEQ ID NO: 2 Sequence length: 33 Sequence type: Amino acid Topology: Linear Sequence type: Peptide sequence Ala Lys Ile Pro Ile Lys Ala Ile Lys Thr Val Gly Lys Ala Val Gly 1 5 10 15 Lys Gly Leu Arg Ala Ile Asn Ile Ala Ser Thr Ala Asn Asp Val Phe 20 25 30 Asn

SEQ ID NO: 3 Sequence length: 29 Sequence type: amino acid Topology: linear Sequence type: peptide sequence Ala Lys Ile Pro Ile Lys Ala Ile Lys Thr Val Gly Lys Ala Val Gly 1 5 10 15 Lys Gly Leu Arg Ala Ile Asn Ile Ala Ser Thr Ala Asn 20 25

SEQ ID NO: 4 Sequence length: 13 Sequence type: amino acid Topology: linear Sequence type: peptide sequence Asp Val Phe Asn Phe Leu Lys Pro Lys Lys Arg Lys His 150

SEQ ID NO: 5 Sequence length: 126 Sequence type: number of nucleic acid chains: double-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence GCT AAA ATC CCG ATT AAG GCA ATT AAA
ACT GTG GGC AAA GCT GTT GGT 48 Ala Lys Ile Pro Ile Lys Ala Ile Lys
Thr Val Gly Lys Ala Val Gly 5 10 15 AAA GGT CTG CGT GCT ATC AAC ATC GCT TCT ACC GCT AAC GAC GTA TTC 96 Lys Gly Leu Arg Ala Ile Asn Ile Ala Ser Thr Ala Asn Asp Val Phe 20 25 30 AAC TTC C CCG AAG AAA CGT AAA CAC 126 Asn Phe Leu Lys Pro Lys Lys Arg Lys His 35 40

────────────────────────────────────────────────── ─── Continued on the front page (51) Int.Cl. ⁶ Identification symbol FI C07K 14/435 ZNA A61K 35/64 // A61K 35/64 37/02 ADZ

Claims (1)

[Claims] An antifungal agent comprising the following peptide (a) or (b) as an active ingredient: (A) a peptide consisting of the amino acid sequence of SEQ ID NO: 1; (B) A peptide comprising an amino acid sequence in which one or more amino acids have been added, deleted or substituted in the amino acid sequence described in (a), and having an antifungal activity.