KR100186866B1 - Compositions and methods for the control of flukes - Google Patents

Abstract

The present invention relates to novel isolates and genes of Bacillus thuringiensis (B.t.) that express toxins having nematode eradication activity. Also included in the present invention are methods for controlling nematodes and insects.

Description

Genes encoding Bacillus thuringiensis microorganisms active against nematodes and nematode-active toxins cloned from Bacillus thuringiensis isolates

The present invention relates to isolates, genes and gene fragments of B. turingiensis that produce toxins having biological activity.

Regular use of chemicals to control conventional undesirable organisms can result in tolerant strains. It occurs in many species of economically important insects, as well as in nematodes of sheep, goats and horses. Advances in tolerability have necessitated the continued study of novel inhibitors with different modes of action.

Recently, the accepted nematode control methods have attracted attention as drugs of benzimidazole and its cooperative agents. The drug has been used extensively to produce many resistances in nematode frequency (Rachhard, R. K. et al. [1980] Problems of Insect Resistant Resistance in Nematodes, Sustr. Vet. J. 56: 239-251; S., M. C. [1986] Insect repellent in sheep, Veterinary Clinics Of North America: Food Animal Practice, Vol. 2: 423-432 [Herd, RP eds] WBSaunders, New York). More than 100,000 species of nematodes have been described.

The bacterium Bacillus thuringiensis (B.t.) yields δ-endotoxin, which has been shown to be active against many rapidly growing nematodes.

Toxicity to lepidopteran insects is only observed initially and is therefore toxic to fly and coleopteran insects. It has been extended to separatist technology. These toxins accumulate as crystalline contents in organisms and many B.t. The strain produces a crystalline content that is not proven toxic to all insects tested.

A few research papers have been published on the effects of B. turingiensis (B.t.) delta endotoxin on the viability of nematode eggs (egg). Boater, Bonn and Gil (Experimental Parasitology 60: 239-244, 1985) are described in B.t. Kurstaki and B.t. Israelensis has been reported to be toxic in vivo to the eggs of the nematode Tricotstrongus Colubbriformis. The other 28 B.t. Strains were extensively tested for toxicity.

The strongest effect is when the LD ₅₀ value is in the ng range. Ignoffo, CM and Dropkin (VH [1977] J. Kans. Entomol. Soc. 50: 394-398) are Bt's heat-resistant toxins (beta exotoxins) that are endemic nematodes, ie Panaggres readybybuses. (Body); Plant-parasitic nematodes, ie melidodoginco gnita (Cittwood); And fungi on nematode-eating nematodes, namely Aperencus avena (Bastien). Betty exotoxins are generalized cytotoxins with little or no specificity. In addition, H. Kyordia and WE Biselle (Jour. Of Parasitology 47:41 [excerpt] 1961) reported the impact of Bt on nematodes in several livestocks at the outset.

Insects belong to (subclass) Lee Saeng-mok, and (rivers) among insects (river).

All the above-mentioned biscuits are intermediate hosts, and the veterinary-important families mainly found in mammals including the human body are found in hepatomegaly, celiac, and diploids mainly in the gallbladder, digestive tract, and vascular system.

Depending on the phagocytic site, the eggs pass through the final host (mainly present in stool or urine) and advance the larval stage in the intermediate host of the worm animal portal.

Some clinical symptoms may be associated with hepatic reptile (pasiola species) infection, depending on the stage of maturation and the number and presence or absence of characteristic bacteria (Clostridium novi). Acute reptile disease occurs upon liver infiltration by recently ingested cystic larvae. Sheep can die suddenly due to necrosis of the small wounds and extensive subcutaneous bleeding.

Insect repellents used in the United States mainly include albendazole, which is only allowed in a few weeks where Pesshia Hepatica is a serious problem. Treatment of sheep with albendazole in other parts of the United States requires special care. Other effective insect repellents (insecticides)-dimethylphenetide, nitroxynyl, oxcyclozanide, lepoxanid, and triclabendazole- are not allowed in the United States.

At present, there is a need for more effective means to control many nematodes and reptiles that can significantly damage susceptible hosts.

The present invention relates to isolates, genes and gene fragments of B. turingiensis that produce biologically active toxins. The toxins have been shown to be active against nematodes. Specific examples of the nematodes include Kenorheditis elegance, Pretyltencus spp. And Paneglerus readyvibus. Panagrelus Ready Vibus is called the Beer-Mat nematode and is a native nematode that is very easy to hold in the laboratory. It is therefore sometimes used as an indicator of nematode activity. The toxins of the present invention may also be used to control reptiles, including liver reptiles Pesiola hepatica.

The novel B.t. isolate of the present invention is B.t. strain PS80JJ1, B.t. Strain PS 158D5, B.t. Strain PS167P, B.t. strain PS169E, B.t. strain F1, B.t. strain PS177G, B.t. Strain PS204G4 and B.t. strain PS204G6.

B.t. which can be used according to the invention. The isolates can be propagated and the resulting delta-endotoxins can be recovered by standard methods and further methods described below. Recovered toxins or B.t. The isolate itself may be prepared using standard methods associated with the use of nematode eliminators or insecticides.

The invention also relates to B.t. PS17, B.t. PS33F2, PS63B. A gene or gene fragment cloned from the B. thuringiensis isolates named PS52A1 and PS69D1. The present invention is directed to B.t. Four genes cloned from the B. thuringiensis isolate named PS17. The genes were named PS17a, PS17b, PS17d and PS17e. Aka B.tPS33F2, B.t.PS63b, B.t. PS52A1 B.t. In addition to specific genes from each of the B. t. Isolates of PS69D1, the genes of PS17 encode B. thuringiensis delta-endotoxins with nematode inhibitor activity. The genes or gene fragments of the invention can be delivered to a suitable host via recombinant DNA vectors.

The appended DNA sequences are briefly described below.

SEQ ID NO: 1 is the DNA sequence of PS17a, SEQ ID NO: 2 is the amino acid sequence of the toxin encoded by PS17a, SEQ ID NO: 3 is the DNA sequence of PS17b, SEQ ID NO: 4 is the amino acid sequence encoded by PS17b, and SEQ ID NO: 5 of the PS33F2 gene. Nucleotide sequence, SEQ ID NO: 6 is the amino acid sequence of the protein expressed by the gene of PS33F2, SEQ ID NO: 7 is the nucleotide sequence of the gene of PS52A1, SEQ ID NO: 8 is the amino acid sequence of the protein expressed by the gene of PS52A1, 9 is the nucleotide sequence of the PS69D1 gene, and SEQ ID NO: 10 is the amino acid sequence of the protein expressed by the gene of PS69D1.

B.t. which can be used according to the invention. B.t. PS17, B.t. PS33F2, B.t. PS52A1, B.t. PS63B, B. t. PS69D1, B.t. PS80JJ1, B.t. PS158D5, B.t. PS167P, B. t. PS169E, B.t. PS177F1, B.t. PS117G, B.t. PS204G4, and B.t. PS204G6.

The novel toxin genes or gene fragments of the present invention can be obtained from nematode-active Turingensis (B.t.) isolates, which are PS17, PB33F2, PS63B, PS52A1 and PS69D1. Genes encoding nematode eradicating toxins are also described in B.t. PS80JJ1, B.t. PS138D5, B.t. PS167P, B. t. PS169E, B.t. PS177F1, B.t. PS177G, B.t. PS204G4, and B.t. It may also be obtained from PS204G6.

The E. coli host, which contains a subculture of Bacillus thuringiensis isolate and the toxin gene of the present invention, has been deposited in Norson Researcher's Retortory (Department of Agriculture, United States, Illinois, Peoria, United States Department of Agriculture). Is as follows.

Toxin genes that can be used in accordance with the present invention can be obtained, for example, from B. thuringiensis of the so-called PS17. As described above, B.t. containing the toxin gene of the present invention. Passage of PS17 was deposited. E. coli and B. t. Isolate B.t. containing the toxin gene of the present invention. PS33F2, B.t. PS63B, B. t. PS52A1 and B.t. PS69D1 was also deposited.

The culture was deposited under 37 CFR 1.14 and 35 USC 122 under conditions which ensure that the culture was obtained during the patent period of this patent application to those granted by the Patent and Trademark Office. This deposit is available if the application is required by foreign patent legislation in the country in which the copy or succession was filed. It should be noted, however, that the availability of the deposit does not constitute a requirement for the practice of the invention that may diminish the patent rights recognized by government policy.

In addition, the culture deposits may be stored and made public in accordance with the provisions of the Budapest Treaty for Microbial Deposits, ie, stored for at least 5 years after a recent request for a quantity of deposits and for at least 30 years from the date of deposit. Or the culture will be stored in an uncontaminated survival state for the validity of the described patent. The depositor is meant to replace a deposit which, upon request, can not supply a sample. Restrictions on the public availability of this culture deposit will all be removed upon grant of the patent for which it is described.

The novel B. t. Genes of the invention encode toxins that are active against the nematode to be tested. Diseases, commonly described as parasites, are caused by infection of an animal host with parasitic pests known as helminths. Parasites are widespread and are a serious economic problem for livestock such as pigs, sheep, horses, cattle, goats, dogs, cats, and poultry. Among the parasites, a group of pests described as nematodes are the cause of a wide range and are often severely infected in many types of animals. The most common nematodes that infect the above-mentioned animals are Hemonus, Tricotstrongus, Oxstergia, Nematodyrus, Coperia, Ascaris, Bunostomum, Esopagostomum, Schaertia, Tricuris, Strongus, Triconema, Dictio Kaulus, Capillaria, Herreakis, Tosokara, Ascariadia, Oxyuris, Ansilostoma, Uncinaria, Tosascarris, Kenoheditis and Parascarris. Of these, Nematodyrus, Coopepia and Esopagostomum mainly penetrate the intestinal tract, while Dictiocaulus is found in the lungs. Other parasites may also be present in other tissues and organs of the body.

Toxins encoded by the novel Bt genes of the present invention are Versaparencus, Triconnemela, Dytyrenecus, Globodera, Helicotirencus, Herredodera, Meldioginine, Pratilencus, Redophorus, Rote It is useful as a nematode eradication agent for controlling soil nematodes and plant parasites selected from the genus Linkers or Tyrene.

The methods and compositions of the present invention are also useful for controlling liver reptiles that can be parasitic in mammals. In particular, the present invention may be useful for controlling poultry in humans, livestock, poultry and other animals. Livestock described herein includes, for example, sheep, cattle, pigs, and goats. The methods and compositions of the present invention may be useful for controlling immature and mature reptiles. Liposomes or other carriers carrying but not limited to toxins to the liver or gallbladder are pasteurized (for mammals and intermediate hosts); Treating native reptiles in the digestive tract of a mammalian host.

The insect repellent killer B.t. Toxins may be used alone or alternately or in combination with other insect repellent killing agents such as albendazole.

As described herein, the B.t. Isolates have activity against hepatic reptiles. The isolate is expected to have activity against the other reptiles described above.

B.t. of the present invention. Toxins can be administered orally in unit dosage forms or potions such as capsules, cyclics or tablets when used as insect repellents in soil and mammals to control plant nematodes. Potion can usually include a suspending agent such as bentonite and a wetting or other excipient together as a solution, suspension or dispersion with the active ingredient in water. In general, the potion may also include a forge agent. Potion formulations generally comprise from about 0.001 to 0.5% by weight of active compound. Preferably from 0.01 to 0.1% by weight, capsules and macrocycles comprise the active ingredient in admixture with a carrier such as starch, talc, magnesium stearate or dicalcium phosphate.

When the toxin compound is administered in anhydrous solid dosage unit form, capsules, macrocycles or tablets containing the required amount of the active compound are usually used. Such dosage forms are made by thoroughly and homogeneously mixing the active ingredient with a suitable finely divided diluent, filler, disintegrant and / or binder (eg, starch, lactose, talc, magnesium stearate, vegetable gum, etc.). The unit dosage form may vary greatly in the total amount of the preparation and the content of the active agent depending on the type of host animal to be treated, the severity and type of infection, and the weight of the host.

When the active compound is administered through animal feed, it is either dispersed completely in the feed or used in the form of a top dressing or pellet to add to the feed or optionally provide it separately. Toxin compounds can also be administered parenterally, such as by intraluminal, intramuscular, bronchial, or subcutaneous injection, in which case the active ingredient is dissolved or dispersed in a liquid carrier. For parenteral administration, the active substance is suitably mixed with a suitable carrier, preferably a variety of vegetable oils (eg, peanut oil, cottonseed oil, etc.).

Other parenteral carriers may also be used, such as solketal, glycerol, formal and organic formulations with water soluble parenteral formulations. The active compound is dissolved or suspended in the parenteral preparation for administration; The formulations generally comprise from 0.005 to 5% by weight of active compound.

When the toxin is administered as a component in the animal's food or dissolved or suspended in beverages, the active compound is thoroughly mixed in an inert carrier or diluent to provide a composition. An inert carrier means one that does not react with the active agent and that can be safely administered to the animal. Preferably, the carrier for food administration is a component or ingredient capable of animal feed.

Suitable compositions include mixtures or supplements in the food, which are suitable for direct feeding to animals in which a significant amount of the active ingredient is present or for direct addition to the food or after the intermediate dilution or mixing step.

Carriers or diluents suitable for the composition usually include, for example, distilled grains, corn, citrus fruits, fermented products, oyster shell powder, wheat grains, molasses solutions, corn cups, edible soy flour, soybean particles, ground limestone, and the like.

In addition to having a nematode killer adsorbent scavenger action in the mammalian gut, B.t. The isolate's spores pass through the animal's digestive tract and germinate and multiply in the stool, thus further controlling larvae that hatch and multiply therein.

The novel B.t. The gene of the isolate can be introduced into a microorganism capable of occupying, surviving and propagating plant regions according to the method of European Patent Application No. 0 200 344. When the plant is ingested by an animal with nematodes or reptiles, the toxin can be used in an animal host to control nematode or reptile encroachment.

The toxin gene or gene fragment of the present invention can be introduced into various microbial hosts. Transduction of the toxin gene results in intracellular production and retention of nematode eradication agents either directly or indirectly. Appropriate hosts (e.g., Shadowmonas) can be applied to nematode sites grown and digested by nematodes.

As a result, nematodes can be controlled. In addition, microorganisms carrying toxin genes can be treated under conditions that can delay the activity of toxins produced in cells. The treated cells are then applied to the environment of the target pest (s). The resulting product was B.t. Possesses toxicity Under conditions capable of stably retaining and expressing the gene, B.t. Several methods are available for introducing gene transgenic toxins into microbial hosts. A DNA construct can be provided that comprises a transcriptional and translational regulatory signal for the expression of a toxin gene, wherein the toxin gene is under host organism control and is homologous to the host's DNA sequence and, thus, is coupled to the host's replication system. By being able to use a combination or stable retention is possible.

The transcription initiation signal will include a promoter and a transcription initiation site.

In some cases it will be required to provide regulated expression of the toxin, which occurs only after release to the environment, which induces changes in the physical or chemical environment of the microorganism by incorporating a promoter or enhancer at the operator site. can do. For example, a thermoregulatory site can be used to propagate organisms in the laboratory without the expression of toxins, and expression is initiated upon release to the environment. Alternatively, specific nutritional media can be used in the laboratory, where the special media inhibits the expression of toxins and the nutritional medium in the environment allows the toxin to be expressed. For initiation of translation, ribosomal binding sites and initiation codons will be present.

In addition to sequences that enhance the stability of mRNA, in particular, active promoters can be used to enhance the expression of mRNA.

Translation initiation and termination sites include stop codon (s), terminator sites, and optionally polyadenylation signals.

In the direction of transcription, i.e., in the 5 '→ 3' direction of the coding sequence or the sense sequence, a transcriptional regulatory site and a promoter (the regulatory site is at 5 'or 3' of the promoter), ribosomal binding site, start codon, stop codon (S), structural genes having an open reading frame in which the polyadenylation signal sequence and terminator site are present. This sequence of the double helix can use itself for the transformation of a microorganism, but usually comprises a DNA sequence with a marker and the second DNA sequence can bind to the toxin expression construct during the introduction of DNA into the host.

Markers are structural genes provided for selecting a host to be mutated or transformed. These markers usually offer selective advantages, such as providing pesticide resistance, ie antibiotic or heavy metal resistance; It provides complement that can provide prototrophy to an oxotropic host. Preferably, the use of complement allows not only to select a modifying host, but also to be competitive outdoors. One or more markers can be used to obtain a host modification as well as a construct.

The organism is further modified to provide a competitive advantage over other cured microorganisms in the field. For example, a gene that expresses a metal chelating agent (eg cyderopoa) can be introduced into the host along with a structural gene that expresses a toxin. In the same way, increased transduction of cyderopoa offers a competitive advantage over toxin producing hosts, and thus can effectively compete with wild-type microorganisms and stably occupy the jig of the environment.

If no functional replication system is present, the construct will also comprise at least 50 bp, preferably at least 100 bp, and a sequence whose sequence homology with the host's sequence does not exceed about 1000 bp. In this method, the likelihood of proper syntheses is increased, so that the gene will bind to the host and be stably retained in that host. Preferably, the toxin gene will be present in close proximity to a gene that can provide complement as well as a gene that can provide a competitive advantage. Thus, if the toxin gene is lost, neither the producing organism nor the gene providing the competitive advantage can be lost, thus making it impossible to compete in the environment with the gene with the original construct.

Many transcriptional regulatory sites are available from photonic microbial hosts (eg, bacteria, bacteriophages, cyanobacteria, algae, fungi, etc.) and various transcriptional regulatory sites are available for trp genes, lac genes, gal genes, lambda loci and postal mail. Promoter, Tac promoter, a site associated with a natural promoter that is functional in a host associated with the toxin gene. Reference. US Pat. Nos. 4,332,898, 4,342,832 and 4,356,270 termination sites are termination sites associated with transcription initiation sites or different transcription initiation sites (where the head sites are coexistable and functional in the host).

If stable epimal retention or binding is required, the plasmid will use a replication system that is functional in the host. This replication system can escape from chromosomes from episomal components normally present in a host or other host and the viral replication system is stable in the host. Many plasmids are available, such as pBR322, pACYC 184, RSF 1010, pRO 1614 and the like. Reference. Olson et al., (1982) J. Bacteriol 150: 6069, and Bethacerian et al., (1981) Gene 16: 237, and US Pat. Nos. 4,356,270, 4,362,817 and 4,371,625.

The B. t. Gene is introduced between the transcriptional and translational initiation site and the termination site to place it under regulatory control of the initiation site. This construct is contained within the plasmid, which includes at least one replication system, which may include one or more, in which case the replication system is used for cloning during the propagation of the plasmid and the second replication system is in a complete host. It needs to work. In addition, there may be more than one marker, which has already been described above. If binding is desired, the plasmid preferably comprises a sequence homologous to the host genome.

Transformants can be isolated in a conventional manner, usually using selection methods, which can screen for the desired organisms for possible unmodified or transitional organisms.

When a B. t. Toxin gene or gene fragment is introduced into a microbial host via a suitable vector, it is essential to apply the host to the environment in a live state and to use a host microorganism. The microbial host selects those known to inhabit the `` plant rights '' (leaflets, leaflets, bulbous layers and / or bulbous zones) in which one or more crops of interest are present. The microorganisms compete successfully with wild-type microorganisms in each environment (grains and other insect habitats) and provide stable maintenance and expression of genes that express polypeptide pesticides, and preferably from environmental degradation and inactivation. Choose to better protect against nematode killers.

Numerous microorganisms are known which inhabit the laminae (surface of plant leaves) and / or bulbous spheres (soil at the plant root level) present in a variety of important crops. Such microorganisms include bacteria, algae and fungi. Among the microorganisms of particular interest are the bacteria Genus: Shadowdomonas, Erwinia, Serratia, Krebsila, Xanthomonas, Streptomyses, Rizovium, Rhodododomonas, Methylophilia, Agrobacterium, Acetobacter, Lactobacillus Bacillus, Ertrobacter, Azotobacter, Luconostoke and Alcaligenes; Fungi, in particular yeast, include the genus Saccharomyces, Cryptococcus, Cluberomyces, Sproboromyces, Rhodorulda and Oreobashidium. Of particular interest are Shadow Monas Syringe, Shadow Monas Fluoresses, Serratia Marsense, Acetobacter Xylium, Agrobacterium Tumfafaciens, Rhodo Shadow Monas Spheroids, Xanthomonas Campestris, Resorbidium Mellis Phytosphere bacterial species such as ot, alcaligens entropus and azovector beanland; And Rhodotorullarubra, R. glutinis, R. Merina, R. Orantiaca, Cryptococcus alvidus, C. difluence, C. laurenti, Saccharomyces losei, S. fritor Nsis, S. There are plant-like yeast species such as Cerevisiae, Sporobol Romanis Roses, S. Odorus, Gluberomyces verone and Oureobasidium pollens.

Among them are pigmented microorganisms.

When cells containing nematode scavengers or insecticidal scavengers are treated to delay the activity of intracellular toxins when the treated cells are sprayed into the environment of the target pest (s), the appropriate host cell may be prokaryotic or eukaryotic. It is usually limited to cells that do not produce toxic substances in higher organisms such as mammals. However, organisms can be used that produce substances that are toxic to higher organisms, and the toxins are used in small amounts to avoid the possibility of toxicity to mammalian hosts. Of particular interest are hosts prokaryotic and lower eukaryotic (eg fungi). Examples of eukaryotic cells are both picto-negative and picto-positive cells, and are enterobacteria (eg, Escherichia, Erwinia, Shigella, Salmonella and Proteus); Mycobacteria (eg, mycorrhizal family); Helix fungi (e.g., Photobacterium, Zymonamonas, Ceratia, Eromonas, Vibrio, Desulfovibrio, Spirum; Lactobacillus; Shedomonadas (e.g., Shadowdomonas and acetobacter); Azotobacteria Eukaryotic cells such as picomas and ascomysets, which include yeasts such as Saccharomyces and Shizocaromyces; and Rhodotorula, Oureobasidium, Sporoboro There are Bassidiomyces yeasts such as Myces and the like.

In selecting suitable host cells for production purposes, the characteristics are the ease of introducing Bt genes into the host, the availability of the expression system, the efficiency of expression, the stability of the nasal or sorbents in the host, and the presence of secondary hereditary capacity. . Key features for use as nematode killer or adsorbent microcapsules include protection against toxins such as thick cell walls, pigments, and the formation of intracellular packings or conjugates; Leaf affinity; Lack of toxicity to mammals; Pest attraction for digestion; There is no harm of toxins and the ease of fixation. Other considerations are ease of formulation and operation, economy and storage stability.

Host organisms of primary interest are yeasts (eg, Rhodotoula spp., Oureobasidium spp., Saccharomyces spp., And Sporoboromics spp.); Lamellar organisms (eg, Shadowmonas species, Erwinia species and Flavobacterium species); Or other organisms (eg, Escherichia, Lactobacilles, Species, Bacillus Species, etc.).

Specific organisms include Shadowmonas aeruginosa, Shadowmonas fluoresces, Saccharomyces cerevisiae, Bacillus thuringiensis, E. coli, Bacillus subtilis, and the like.

The cells are usually intact and in some cases spores are used but at the time of treatment they are more proliferative than spores.

Treatment of microbial cells, such as microorganisms comprising Bt toxin genes or gene fragments, is chemical and / or by chemical or physical means, or unless it reduces the cell's ability to protect the toxin without adversely altering the toxin's characteristics. Physical means can be combined.

Examples of chemicals are halogenated materials, in particular halogens of atomic numbers 17-80.

More specifically, iodine can be used under mild conditions for a time sufficient to achieve the desired result. Other suitable techniques include aldehydes (eg formaldehyde and glutaraldehyde); Anti-infectives (eg, zephyran chloride and cetylpyridirium chloride); Alcohols (eg isopropyl and ethanol); Various tissue fixatives (eg Bowins fixative and Helis fixative, see Humason, Gretchenel, Animal Tissue Act, W. H. Freeman and Company, 1967); Or treatment with a combination of physical (thermal) and chemical reagents that, when administered to a host animal as a cell, preserve and delay the activity of toxins produced in the cell. Examples of physical means are shortwaves such as gamma rays and X-rays, freezing, UV radiation, lyophilization and the like.

In general, the cells will have improved structural stability which enhances resistance to environmental conditions. In the case of preliminary pesticides, the inactivation method should be chosen so long as it does not inhibit the process of the preform with a mature pesticide by the pathogen of the target pest. For example, formaldehyde can crosslink proteins and inhibit the process of polypeptide pesticide preforms. Inactivation or pesticidal methods retain at least part of the bioavailability or biological activity of the toxin.

The cell host containing the B. t. Toxin gene or gene fragment is propagated in any convenient nutrient medium, wherein the DNA construct provides the optional advantage of providing an active medium so that almost all or all cells carry the B. t. Gene. The cells can then be cultured according to conventional methods. In addition, the cells are cultured after treatment.

B. t. Cells can be produced in several ways. That is, as wettable powders, particulates or dusts by mixing with various inert materials such as inorganic minerals (phyllosilicates, carbonates, sulfates, phosphates, etc.) or vegetable materials (powdered corn cups, rice cups, walnut shells, etc.). Can be used.

The formulation may also include a dispersant-adhesive adjuvant, stabilizer, other pesticidal adjuvant or surfactant. Liquid formulations may be water-based or insoluble substrates and are used as foams, gels, suspensions, emulsifiable concentrates. The above components may include flow agents, surfactants, emulsifiers, dispersants or polymers.

Toxin concentrates vary widely depending on the condition of the particular agent, especially whether it is its pesticide or can be used directly. The toxin is present in at least 1% by weight and may be present in 100% by weight. Dry formulations contain about 1 to 95 weight percent of toxins and liquid formulations are generally present in the liquid phase at about 1 to 60 weight percent. Such formulations typically contain about 10 ² to 10 ⁴ cell numbers / mg and will be administered from about 50 mg (liquid or dry) to 1 kg.

The formulation may be applied by a method such as spraying, spraying, or spraying the environment of nematode or reptile (eg, plant, soil or water).

In addition, because some plant parasites represent parasites, nematode B. t. Genes that encode toxins are genetically engineered into plant cells to yield nematode-resistant plants. Methods for genetically engineered plant cells are well known (see Nester, E.W., Gordon, M.P., Amasino, R.M. and Yanofsky, M.F., Ann Rev. Plant Physiol. 35: 387-399, 1984).

It is already known that the amino acid sequence of a protein is determined by the nucleotide sequence of DNA. Since the excess of the genetic code, ie one or more coding nucleotide triplets (codons), is used for most of the amino acids used to make proteins, different nucleotide sequences can encode particular amino acids. Thus, the genetic code can be expressed as:

Phenylalanine (Phe) TTK Histidine (His) CAK

Leucine (Leu) XTY Glutamine (Gln) CAJ

Isoleucine (Ile) ATM Asparagine (Asn) AAK

Methionine (Aet) ATG Lysine (Lys) AAJ

Val GTL Aspartic Acid GAK

Serine QRS Glutamic Acid (Glu) GAJ

Proline (C) CCL Cysteine (TGK)

Threonine (Thr) ACL Tryptophan (Trp) TGG

Alanine (Ala) GCL Arginine (Arg) WGZ

Tyrosine (Tyr) TAK Glycine (Gly) GGL

Closing Signal TAJ

Note: Each 3-letter deoxynucleotide triplet corresponds to a trinucleotide of mRNA with a 5'-end on the left and a 3'-end on the right. All DNA sequences presented herein are stranded sequences corresponding to mRNA sequences where thymine is substituted with uracil. The letter represents a purine or pyrimidine base that forms a deoxynucleotide sequence.

A = Adenine

G = guanine

C = cytosine

T = Thymine

X = T or C (if Y is A or G)

X = C (if Y is C or T)

Y = A, G, C, or T (if X is C)

Y = A or G (if X is T)

W = C or A (if Z is A or G)

W = C (if Z is C or T)

Z = A, G, C, or T (if W is C)

Z = A or G (if W is A)

QR = TC (if S is A, G, C or T)

QR = AG (if S is T or C)

J = A or G

K = T or C

L = A, T, C or G

M = A, C or T

As mentioned above, the equivalent nucleotide sequence which the novel amino acid sequence of B. t. Toxin codes for the protein of the same amino acid sequence can be manufactured. Accordingly, the present invention encompasses the equivalent nucleotide sequences above. In addition, the protein of the identified structure and function may be formed by changing the amino acid sequence unless the secondary structure is changed. (Kaiser, ET and Kezdy, FJ [1984] Science 223: 249-255) Thus, the present invention Even if the protein structure or variant of the amino acid sequence described herein does not change the secondary structure of the protein, it includes variants that retain biological activity. The invention also encompasses variants of organisms in which all or part of the toxins encoding genes of the invention are present. Such microbial mutants can be prepared by methods well known to those skilled in the art. For example, UV radiation can be used to prepare variants of host organisms, and likewise, such variants may also comprise spore-free host cells that can be prepared by methods known in the art.

Numerous methods are already known for use in preparing transformants of the plasmids and host organisms. All of these methods are described in the Molecular Cloning: A Laboratory Manual (Maniatis, T., Fritsch, EF, and Sambrook, J. (1982), Cold Spring Harbor Laboratory, New York). Cleavage of restriction enzymes, electrophoresis of DNA fragments, tailing and annealing plasmids, insertion and ligation into DNA, transformation of cells, preparation of plasmid DNA, and electrophoresis of proteins to sequence DNA It is within the scope of those skilled in the field of genetic engineering.

The restriction enzymes described herein are sold by Bechester Star Research Laboratories (Gaysburg, MD) or New England Biolabs (Beverly, Mass.) Or Boehringer Mannheim (Indianapolis, Indiana). . The enzymes are used according to the instructions given by the supplier.

The following is an example describing a method including the best mode for practicing the present invention. These embodiments do not limit the invention.

All percentages are by weight and all solvent mixture ratios are by volume unless otherwise noted.

Example 1-Culture of B.t. Separation

Subcultures of B. t. Isolates are used to inoculate the following medium, peptone, glocose, salt medium.

Bactopeptone 7.5g / 1

Glucose 1.0 g / 1

KH ₂ PO ₄ 3.4g / 1

K ₂ HPO ₄ 4.35 g / 1

Salt solution 5.0m1 / 1

CaCl ₂ solution 5.0m1 / 1

Salt solution (100m1)

MgSO ₄ .7H ₂ O 2.46 g

MnSO ₄ .H ₂ O 0.04 g

ZnSO ₄ .7H ₂ O 0.28 g

FeSO ₄ .7H ₂ O 0.40 g

CaCl ₂ solution (100ml)

CaCL ₂ .2H ₂ 0 3.66 g

pH7.2

Salt solution and CaCl ₂ solution are filter-sterilized and added to the broth cooled by autoclave upon inoculation. The flask is incubated at 30 ° C. on a rotary stirrer at 200 rpm for 64 hours.

The method can be easily extended to large fermenters by methods known in the art.

B.t. obtained by the fermentation. Spores and crystals can be separated by methods well known in the art. A frequently used method is to treat cultured fermentation broth by separation (eg, centrifugation).

Example 2-Purification and Amino Acid Sequence Analysis

B. t. Isolates that can be used as the toxin protein source of the invention are, for example, B. t. PS17, B.t.PS5A1, B.t.PS33F2, B.t.PS63B, B.t.PS69D1, B.t.PS80JJ1, B.t.PS158D5, B.t.PS167P, B.t.PS169E, B.t.PS177F1, B.t.PS177G, B.t.PS204G.B.t.PS204G PS204G6. The isolate can be cultured using the culture described in Example 1 or other standard medium, or cultured by a fermentation method known in the art. Toxin protein content can be cultured by standard settling centrifugation. The recovered protein content can be partially purified by sodium bromide (28-38%) homogeneous gradient centrifugation (Pfannenstiel, MA, EJ Ross, VC). Kramer and KW Nickerson. [1984] FEMS Microbiol Lett 21: 39) Each toxin protein was then dissolved in crystalline protein complex in alkaline buffer, and each protein was dissolved in DEAE-Sepharose CL-6B (Sigma Chem. Co., St. Louis). (MO) Chromatography was isolated with gradual increase in NaCl-containing buffer concentration (Reichenberg. D., Ion exchangers in Organic and Biochemistry [C. Calmon and TRE Kressman, eds], Interscience, New York, 1957). Fractions containing proteins toxic to Keno hetis elegance (CE) were subjected to Western blotting (Towbin, H., T. Staehelin and Ko Gordon [1979] Proc. Natl. Acad. Sci. USA 76: 4350). To PVDF membranes (Millipore, Bedford, MA) The N-terminal amino acids were determined by standard Edman half using a combined gas-phase sequencer (Hunkapiller, MW, RM Hewick, WL Dreyer, and LE Hood [1983] Meth. Enzymol. 91: 399). Is as follows :

PS17a AILNELYPSVPYNV

PS17b AILNELYPSVPYNV

PS33F2 ATLNEVYPVN

PS52A1 MIIDSKTTLPRHSLINT

PS63B QLQAQPLIPYNVLA

PS69D1 MILGNGKTLPKHIRLAHIFATQNS

In addition, internal amino acid sequence data was derived from PS63B. The toxin E protein was cleaved with the S. phyllococcus oreus V8 protease as shown (Cleveland, D.W., S.G.Fischer, M.W.Kirschner and U.K.Laemmli [1977] J. Biol Chem. 252: 1102). The cleaved material was blotted onto PVDF membrane and about 28 KDa restriction peptides were selected by N-terminal sequencing as described above.

The obtained sequence is as follows:

63B (2) V Q R I L D E K L S F Q L I K

From these sequence data oligonucleotide probes were designed using codon tables combined from the available sequence data of other B. t. Toxin genes. The probe was synthesized by Applied Biosystems, Inc., a DNA synthesizer.

Example 3 Cloning of a New Toxin Gene and E. Transformation into collie]

A.B.t. PS 17

Whole cell DNA was prepared by propagating Bt PS 17 cells to low optical density (0D ₆₆₀ = 1.0) and recovering by centrifugation. The cells were rounded in TES buffer (30 mM Tris-Cl, 10 mM EDTA, 50 mM NaCl, pH 8.0) containing 20% sucrose and 50 mg / ml lysosomes.

The whalocytes were digested by addition to SDS at a final concentration of 4%. The cell material was precipitated overnight at 4 ° C. in 100 mM (final concentration) neutral potassium chloride. Extracted twice with supernatant phenol / chloroform (1: 1). DNA was precipitated twice with ethanol and purified to homogeneous band on CsCl ₂ -echidium bromide gradient.

Whole cell DNA of PS17 was digested with EcoR1 and subjected to electrophoresis on 0.8% agarose-TAE (W / V) (50 mM Tris-HC1, 20 mM NaOA 2.5 mM EDTA pH = 8.0) buffer gel. Sudden blots of gels were hybridized with [ ³² P] -radiolabeled oligonucleotide probes derived from the N-terminal amino acid sequence of 130 KDa purified protein of PS17. The oligonucleotide sequence synthesized is (GCAATTTTAAATGAATTATATCC). As a result, hybrids of EcoRl fragments of PS17 are 5.0Kb, 4.5Kb, 2.7Kb, and 1.8Kb in size, and are predominantly identified for at least four new nematode-active toxin genes, PS17d, PS17b, PS17a and PS17e, respectively. .

Libraries were formed from PS17 total cell DNA partially digested with Sau 3A and sized by electrophoresis. 9-23 Kb sites of the gel were cut and the DNA was eluted and concentrated using an Elutip ^™ ion exchange column (Schleicher and Schuel, Kelne NH).

The isolated Sau 3A fragments were ligated to lambda GEM-11 ^™ (PROMEGA). Combined phage is KW 251. High titers were pooled on PROMEGA and screened using the above radiolabeled synthetic oligonucleotides as nucleic acid hybridization probes. Hybridization plaques were purified and rescreened to low plaque density. KW251 E. coli in liquid culture for the production of phage for DNA isolation using a single isolated purification clark hybridized with a probe. Used to infect Collie. The DNA was isolated by standard methods.

The recovered preparative phage DNA was digested with EcoRl and subjected to electrophoresis on 0.8% agarose-TAE gel. The gel was suddenly blotted and hybridized with oligonucleotide probes characterized by a toxin gene isolated from the lambda library. There were two aspects of clones containing 4.5 Kb (PS 17b) or 2.7 Kb (PS 17a) EcoRl fragments. The reserve amount of phage DNA was digested with SAl I (insertion DNA was separated from the lambda arm) and subjected to electrophoresis on a 0.6% agarose-TAE gel. The large fragments eluted and concentrated as described above were ligated to Sal I-cleaved and dephosphorylated pBClac. The ligation mixture was transformed into NM522 useful E. coli cells and subjected to ampicillin, isopropyl- (beta) -D-thiogalactoside (IPTG) and 5-bromo-4-chloro-3-indolyl- (beta) Plated on LB agar containing -D-galactoside (XGAL). White colonies with putative inserts in the (beta) -galactosidase gene of pBClac were treated by standard rapid plasmid purification to isolate the desired plasmid. Selected plasmids containing 2.7 Kb EcoRI fragments were named pMYC 1627 and plasmids containing 4.5 Kb EcoRI fragments were named pMYC 1628.

Toxin genes were sequenced by `` walking '' with standard Sanger dideoxy chain termination using the synthetic oligonucleotide probes described above and primers to prepare new toxin gene sequences.

PS17 toxin genes were expressed in B.t. Subclones with shuttle vector pHT 3101 (Lereclus. D. et al [1989] FEMS Microbilol. Lett. (60: 211-218)) using standard methods for transfection in vitro.

Briefly, Sal I fragments containing PS17a and PS17b toxin genes were isolated from pMYC1629 and pMYC1627, respectively, by preparative agarose gel electrophoresis, electroeluting and concentrating as described above. The concentrated fragments above were ligated with SalT and carbonylated pHT 3101. The ligation reaction mixtures were used individually to transform the useful E. coli NM 522 frozen. The plasmid of each prepared E. coli strain was treated by alkaline digestion and analyzed by agarose gel electrophoresis. The resulting subclones, pMYC 2311 and pMYC2309, incubated PS17a and PS17b toxin genes, respectively. The plasmids were prepared by standard electrophoresis (Instruction Manual, Biorad, Richmond, CA). Strain HD-1 Cry B Aronson, A. Purdue University, West Lafayette. IN).

Recombinant B. t. Strains HD-1 Cry B [pMYC 2311] and [pMYC2309] were propagated with spores and wild-type B.t. The protein was purified by gradient centrifugation on the protein.

B.B.t. PS52A1

Total cell DNA was grown from Bt PS52A1 cells to optical density (600 nm) 1.0. Cells were pelleted by centrifugation and resuspended in plasma buffer (20 mg / ml lysozyme, 25 mM Tris-Cl [pH 8.0], 25 mM EDTA) in 0.3 ^M sucrose. After antigen treatment at 37 ° C. for 1 hour, the protoplasts were digested by repeating two freezing and thawing cycles. Nine volumes of 0.1M Nacl, 0.1% SDS, 0.1M Tris-Cl solution were added to the total digest. The clear digest was extracted twice with phenol: chloroform (1: 1) and the nucleic acid precipitated with 2 volumes of ethanol and pelleted by centrifugation. The pellet was resuspended in TE and RNase was added at a final concentration of 50 μg / ml. After incubation at 37 ° C. for 1 hour, extraction was performed once with phenol: chloroform (1: 1) and TE-saturated fluoroform. DNA was precipitated from the aqueous layer by adding 1/10 volume of 3M NaOAc and 2 volumes of ethanol. DNA was pelleted by centrifugation, washed with 70% ethanol, dried and resuspended in TE.

Restriction fragment length polymorph (RFLP) analysis was performed by standard hybridization of sudden blots of Bt PS52Al DNA with a ³² P-labeled oligonucleotide probe, Probe 52Al-C. The sequence of the probe is as follows:

5 'ATG ATT ATT GAT TCT TAAA ACA ACA TTA CCA AGA CAT' TCA / T TTA ATA / T AAT ACA / T ATA / T AA 3 '

Hybridization bands include about 3.6 kbp Hind III fragments and about 8.6 kbp EcoRV fragments.

The gene library was B.t. partially digested with Sau3A. It is formed from PS52A1 DNA. Partial restriction enzyme digest was fractionated by agarose gel electrophoresis. DNA fragments having a size of 6.6 to 23 kbp were cut out of the gel, eluted from the gel slice, purified on an Elutip-D ion exchange column, and recovered by ethanol precipitation. Sau 3A inserts were ligated with the cut lambda Gem-11 (Promega). Recombinant phage was ligated and plated on E. coli KW 251 cells (Promega).

Plaques were selected by hybridization with emissive layer labeled probes 52A1-C. Hybridized phage were plaque-purified and used to infect liquid cultures of E. coli KW 251 cells to isolate phage DNA by standard methods (Meniatis, et al.). For subcloning, DNA reserves were digested with EcoRI and Sal I and electrophoresed on agarose gels.

About 3.1 kbp bends containing the toxin gene were cut out of the gel, eluted from the gel slices and purified by ion exchange chromatography. Purified DNA inserts included a replica of EcoRI + Sal I -cleaved pHTBlue II (pBlueseript S / K [Stratagene] and the existing Bt plasmid [D. Lerecluset al. (1989) FEMS Microbiology Letters 60: 211-218] L. coli / Bt shuttle vector). The ligation mixture was used to transform into frozen useful E. coli NM522 (ATCC 47000). The transformants were ampicillin, isopropyl- (β) -D-thiogalactoside (IPTG) and 5-bromo-4-chloro-3-indolyl- (β) -D-galactoside (XGAL) Plated on LB agar containing. The plasmids were purified from putative recombinants by alkaline assay (Meniatis, et al.) And analyzed by EcoRI and Sal I cleavage on agarose gel.

The desired plasmid construct (pMYC 2321) contains a new toxin gene compared to a map of other toxin genes encoding nematode killer agents.

Plasmid pMYC2321 was electrophoresed to B.t. Entered strain CryB. Expression of about 55-60 kDa crystalline protein was demonstrated by SDS-PAGE assay and nematode eradication activity. NaBr-purified crystals were prepared to evaluate the toxicity of the clone gene product against Planti-Parasitic and Panagrelus ediviverse (sponsored).

The cloned gene product is active against the nematode.

C. B.t. PS33F2

Total cell DNA was propagated to optical density (600 nm) 1.0 to B.t. Prepared from PS33F2 cells. Cells were pelleted by centrifugation and resuspended in plasma buffer (20 mg / ml lysozyme, 25 mM Tris-Cl [pH 8.0], 25 mM EDTA) in 0.3 M sucrose. After 1 hour of antigen treatment at 37 ° C., the protoplasts were digested by the addition of 9 volumes of 0.1M NaCl, 0.1% SDS, 0.1M Tris-Cl solution followed by two freezing and thawing cycles. The clear digest was extracted twice with phenol: chloroform (1: 1) and the nucleic acid precipitated with 2 volumes of ethanol and pelleted by centrifugation. The pellet was resuspended in 10 mM Tris-Cl, 1 mM EDTA (TE) and RNase was added at a final concentration of 50 μg / ml. After incubation at 37 ° C. for 1 hour, each extraction was performed once with phenol: chloroform (1: 1) and TE-saturated chloroform. DNA was precipitated from the aqueous layer by adding 1/10 volume of 3M NaOAc and 2 volumes of ethanol. DNA was pelleted by centrifugation, washed with 70% ethanol, dried and resuspended in TE.

Plasmid DNA was extracted from the plasma prepared as described above.

Nine volumes of a solution of 10 mM Tris-Cl, 1 mM EDTA, 0.085 N NaOH, 0.1% SDS (pH 8.0) were added to degrade to protoplast. SDS was added to a final concentration of 1% to complete degradation. 1/2 volume of 3M KOAc was added and cell material was allowed to settle at 4 ° C. overnight. After centrifugation, DNA was precipitated with ethanol and the plasmid was purified by homogenous centrifugation on CaCl ₂ -Ethidium bromide gradient.

RFLP analysis was performed by a standard hybrid method of Sudden blot using total cell DNA with PS33F2 plasmid and ³² P-labeled oligonucleotide probes defined by the N-terminal amino acid sequence of Example 2.

Probe 33F2A: 5 'GCA / T ACA / T TTA AAT GAA GTA / T TAT3'

Probe 33F2B: 5'AAT GAA GTA / T TAT CCA / T GAT / T AAT3 '

The hybrid band contains about 5.85 kbp EcoRI fragment. Probe 33F2A and inverted PCR primers were used to amplify a DNA fragment of about 1.8 kbp that could be used as a hybridization probe for cloning PS33F2 toxin gene. The sequence of inverting primers is as follows:

Gene libraries are formed from PS33F2 plasmid DNA digested with EcoRI. Restriction enzyme digests were fractionated by agarose gel electrophoresis. DNA fragments having a size of 4.3 to 6.6 kbp were cut out of the gel, eluted from the gel slice, purified on an Eluip-D ion exchange column (Schleicher and Schuel, keene NH) and recovered by ethanol precipitation. The EcoRW insert is an E. coli / Bt comprising a replica of EcoRI-cleaved pHTBlueII (pBlueseript S / K [Stratagene] and the existing Bt plasmid [D. Lereclusetal. (1989) FEMS Microbiology Letters 60: 211-218]. Ligation vector).

The ligation mixture was used to transform into frozen useful E. coli NM522 (ATCC 47000). The transformants were ampicillin, isopropyl- (β) -D-thiogalactoside (IPTG) and 5-bromo-4-chloro-3-indolyl- (β) -D-galactoside (XGAL) It was plated on LB agar containing. Colonies were screened under hybridization with the radiolabeled PCR amplified probes described above. The plasmid was purified from putative toxin gene clones by alkaline assay and restriction enzyme digests were analyzed by electrophoresis on akarose gel. The desired plasmid structure (pMYC 2316) comprises about 5.85 kbp EcoR I inserts; Toxin genes are included on the novel DNA fragment (33F2a) as compared to the DNA sequences of other toxin genes encoding nematode killer agents.

Plasmid pMYC 2316 was electrophoresed to Cry-B.t. The host, HD-1 Cry B, was introduced. Expression of about 120-140 kDa crystalline protein was demonstrated by SDS-PAGE assay and nematode eradication activity. Purification with NaBr-gradients (M.A. Pfannenstiel et al. 1984, described above) assessed the toxicity of the clone gene product against Pratirencus.

D. B.t. PS69D1

Total cell DNA was prepared from Bt PS69D1 as described above for other isolates. RFLP analysis was performed by standard hybrid method with sudden blots of ³² P-labeled oligonucleotide probes and PS69D1 DNA defined as PS69D1-D. The sequence of the 69D1-D probe is as follows:

The hybridization band contained about 2.0 kbp HindIII fragment.

Gene libraries are formed from PS69Dl DNA partially digested with Sau 3A. Partial restriction enzyme digests were fractionated by agarose gel electrophoresis. DNA fragments having sizes 6.6-23 kbp were cut out of the gel, eluted from the gel slices, purified on an Elutip-D ion exchange column, and recovered by ethanol precipitation. Sau 3A inserts were ligated with BamHI-cut lambda Gem-11 (Promega, Madison, Wis.). Recombinant phage was ligated and plated on E. coli KW251 cells (Promega, Madison, Wis.). Plaques were selected by hybridization with the radiolabeled oligonucleotide probe 69Dl-D. Plaque-purified hybridized phage and used to screen liquid cultures of E. coli KW251 cells to separate phage DNA by standard methods (Mannitis et al. [1982] Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, NY). did. For subcloning, DNA reserves were Hind III cut and electrophoresed on agarose gels. An about 2.0 kbp band containing the toxin gene was cut out of the gel, eluted from the gel slices and purified by ion exchange chromatography. Purified DNA inserts were prepared by Hind III-cleaved pHTBlue II (pBlueseript SK [Stratagene, San Diego, Calif.] And conventional Bt plasmid [D. Lereclu, et al. (1989) FEMS Microbiol. Lett. 60: 211-218. E. coli / Bt shuttle vector containing the clone). The ligation mixture was used to transform into frozen useful E. coli NM522 (ATCC 47000). The transformants were plated on LB agar containing 5-bromo-4-chloro-3-indolyl- (β) -D-galactoside (XGAL). Purified from putative recombinants by alkaline assay (Meniatis, et al.) And Hind III cleavage was analyzed by electrophoresis on akarose gel. The desired plasmid construct (pMYC 2317) contains other toxin genes that encode nematode killer agents.

E. B.t. PS63B

Example 2 shows the amino terminus and internal polypeptide sequence of PS63B toxin protein as determined by standard Edman protein sequencing.

From this sequence, two oligonucleotide primers were identified as B.t. The codon frequency table combined from the genes was used to define.

The sequence of the progressing primers (63B-A) is complementary to the DNA speculative sequence at the 5 'end of the gene:

63B-A-5 'CAA T / CTA CAA GCA / T CAA CC 3'

The sequence of retrograde primer (63B-INT) was complementary to the reverse of the internal DNA expected sequence:

63B-INT-5 'TTC ATC TAA AAT TCT TTG A / TAC 3'

The primers were used in a standard polymerase chain reaction (Cetus Co.) to amplify about 460 bp fragments of the toxin gene for use as DNA cloning probes. Standard sudden blots of total cell DNA of PS63B were hybridized with radiolabeled PCR probes. Hybrid bands included about 4.4 kbp XbaI fragments, about 2.0 kbp Hind III fragments, and about 6.4 kbp Spe I fragments.

Example 4 B.t. for Kenoraditis Elegance Activity of Toxin Proteins and Gene Products]

Kenor Aditus Elegance (CE) was placed on a 24-well tissue plate plate of Corning Glass Works, Corning, NY containing 0.5 mg ampicillin and 0.01 mg cholesterol in a S-Base medium, (Chem. Tech. Biotechnol. 31: 66-69, 1981). Each well contained an E. coli strain OP-50, uracil oxotroph, of about 10 ⁸ cells. Each well was inoculated with about 100-200 CE and antigen treated at 20 ° C. Protein samples (obtained from wild-type Bt or recombinant Bt) were added to each well as a series of bottom stones.

Each well was examined daily and representative results were as follows:

Example 5 Activity against Plant Nematode Pratilentus

B.t. Toxins coated by PS17a have been shown to be active against pratirenkis. This activity is at about the same level as described in Example 4 for C. elegance.

Pratirencus species (eg, P. scrivneri and P. readyvibus) are known as pathogens of many economically important crops, including corn, lakes, soybeans, elpulpas, beans, tomatoes, and citrus fruits. These structural lesion nematodes are a genus of plant parasitic nematodes that cause the second most important economic damage, and are representative of mobile internal parasites.

Pratirencus were sterilely grown in corn roots cut in Gembergs B5 medium (GIBCO ^R Laboratories, Grand Island, NY). Bioassays were performed on 24 circle assay plates (Corning # 25820) using L 3-4 larvae as described by Tsai and van Grundy (J. Nematol. 22 (3): 327-332). About 20 nematodes are placed in each well.

The entire 80-160 nematode was used for each treatment. Protein samples were suspended in aqueous solution using a handheld Dounce homogenizer.

Mortality was visually confirmed 3 or 7 days after treatment. The oil layer was almost straight, motionless and almost dead when it was not responded to when pressed with a dull probe. Representative results are as follows:

Example 6 B.t. Segregational activity]

The pests were collected in tubes and allowed to stand for about 15 minutes before the water was tilted and replaced 3 or 4 times until fresh water remained clear. 250 μl of washed nematodes (20-30 pests) and 100 μl of spore / crystal suspension were added to 650 μl water in each well of the tray. Nematodes were counted and numbered. After 4 days, the number of surviving pests was counted and the percent mortality was calculated.

The table below shows the B.t. The molecular weight of the alkali-soluble protein in each of the novel nematode-active strains as compared to the strains is shown.

Example 7 Activity against Pasiola Hepatica

Nocturnal B.t. Separation Notes and B.t. Toxins produced by recombinant microorganisms that express proteins were tested for their adsorptive killer activity.

Incubation in vitro (37 ° C., 5% CO ₂ ) was carried out by the method of Ibara and Jenkins (Z. Parasitenkd. 70: 655-661, 1984). The medium consists of RPMI (7.5 pH) with 50% v / v rabbit serum and 2% v / v rabbit RBC.

[Test Compound]

In the test described below, the effect of various substances on the insect repellent of the liver was tested and compared. As used herein, compound PS17 is a B.t. Toxins recovered and purified from the culture of PS17. Compound PS17a is B.t. B.t. named PS17a. Toxins recovered and purified from the culture of recombinant microorganisms transformed with the gene. Compound C is a blank formulation for use as a negative control. ABZ means Albendazole drug, which is commercially available from Smithkline Beecham (NE, Lincoln). Compounds PS17, PS17a and C were added 100 ppm directly to the medium: ABZ was dissolved in 100 μl of pure ethanol and then added to the medium.

[Standards for efficacy]

Insects are examined every hour for 3-8 hours and using an inverted microscope (40X) to compare the effects of drug treatment once or twice as evidence of lethality, lethality or morphology, compared to untreated control reptiles. Investigated / day.

Three-week-old pasiola hepatica, harvested from survivors of experimentally infected rabbits, was incubated in vitro in 1.6 cm Linbro culture plate wells (2 ml medium; 4.6 reptiles / well) for 5 days. After incubation for 5 days, the reptiles were transferred to a medium containing compound PS17a (100 ppm; 5 reptiles). All the reptiles died in compound PS17a by 18 hours. For compound PS17, only one reptile survived (not active) at 24 hours compared to the three surviving reptiles in control medium (Table 1). All reptiles were fixed and stained for morphology studies; There were no obvious changes under the microscope other than that shown in the analysis of dead reptiles. During the 5 days of preculture, the reptiles survived and it was observed to take RBC's from a medium with some digestive function.

Four mature reptiles recovered from naturally infected calves were in vitro cultured in 25 cm tissue culture flasks in 5 ml medium for 24 hours, followed by Compound PS17a (100 ppm), Compound PS17 (100 ppm) and ABZ. (10 ppm) or similar flasks containing untreated medium (Table 2). The reptiles in compound PS17a died at 10 to 18 hours, died at 18 to 20 hours in compound PS17 and up to 64 hours in ABZ. Control reptiles in the medium died within 72 hours with respect to the concentration of medium observed by turbidity and yellow medium coloring.

The reptiles were incubated in RPMI 49% + rabbit serum 49% + rabbit RBC 2% for 5 days before treatment. After 24 hours, the experiment was terminated and all the reptiles were fixed for morphological studies. The reptile motility prior to lethality was less active and aspirated on the media surface. Upon death, the reptiles contract and relax and disintegrate.

Example 8

Additional experiments were conducted for the efficacy of compounds PS17 and PS17a against F. hepatica by comparing known efficacy to the alvendazole (ABZ), the pseudo drug (positive response control) and the unreacted media control. The test was carried out on 1) mature reptiles recovered from naturally infected calves and 2) immature reptiles of 5 week old rabbits.

[Immature Insects]

Five week-old immature F. hepatica was recovered from the livers of experimentally infected rabbits and tripled in medium (1.6 cm Linbro medium plate, 2-3 reptiles / well) overnight. Then transfer to 2 ml of compound PS17a (100 ppm), compound PS17 (100 ppm), albendazole (ABZ, 10 ppm) or similar Linbro plate containing untreated medium (Table 3). For compound PS17a, all 7 died at 20 hours; Weak mobility after 8 hours of exposure. For compound PS17, the remaining lethality (2 of 7) and mild motility were observed at 20 hours; At 31 hours 5 of 7 died; At 48 hours all the reptiles died. In the ABZ positive control group, one of the seven died at 20 hours, four died at 31 hours and the remaining reptiles died at 60 hours. In untreated control medium, 2 of 7 died at 31 hours, 3 at 48 hours, 4 at 55 hours, 5 at 60 hours and all 7 at 72 hours. (Note: The surface layer of some wells became cloudy after 35 hours of exposure; all reptiles were washed with RPMI to transfer to wells containing fresh medium with original drug concentration.)

[Mature Reptiles]

Roucher's Meat Packing (Plaquemin, LA), recovered from diseased three calves with Passioriasis, is washed, stored in sterile saline (2-3 hours) and four reptiles are stored in Compound PS17a (100 ppm). ; Compound PS17 (100 ppm); Two 25 mL tissue culture flasks containing ABZ (10 ppm) or untreated control medium were placed in each (Table 4). All the reptiles died at 10-11 hours in compound PS17a and at 20 hours in compound PS17. For ABZ, the reptiles died at 48-54 hours. In the control medium, two animals died at 48 hours and all reptiles died at 66 hours (Note: flask contaminants appeared at 31-48 hours).

Example 9

Reptiles were recovered from the gallbladder ducts of diseased calves and washed with sterile RPMI for 2-3 hours per 20-30 reptile groups. Only one reptile was incubated in each well of a 6-well Linv tissue culture plate (10 ml size) with each well containing 4 ml of treated or untreated medium. Blank formulations (compound C) with unknown insecticidal activity were also tested. Additional controls were added to identify potential contaminants, including media controls with 2% RBC and media controls without 2% RBC. ABZ concentration was increased to 25 ppm. Only control wells containing drug and media were also controls for contaminants.

This experiment included 12 replicates (Table 5); Six of them have corresponding wells with only treated or untreated media. For compound PS17a, all 12 reptiles died at 12 hours; At 10 hours, he showed weak mobility. All compound PS17 reptiles died upon observation at 19 or 24 hours. Compound C reptile mortality was observed at 36-58 hours. For medium with 2% RBC and without 2% RBC control, one reptile died at 36 hours, 2 at 58 hours, and 3 at 72 hours; One reptile survived for up to 115 hours in medium with 2% RBC. Two of eight of the 12 replicates and six of the corresponding media controls showed changes in medium in both the reptile-containing and non-repeat-containing wells after 24 hours of exposure. Otherwise, all the reptiles died at 58 hours in 6 of the 8 replicates due to turbidity and yellowing of the medium. Two reptile replicates in which the medium changed within 24 hours were not contaminated. Six media control (no reptiles) replicates were not contaminated during 115 hours of incubation.

Example 10 Insertion of Toxin Genes into Plants

As described above, a novel gene coding for a novel lamellar-active toxin was inserted into plant cells using Ti plasmid of Agrobacter tumefaciens. Plant cells can then be regenerated into plants (Zambryski, P., Joos, H., Gentello, C., Leemans, J., Van Montague, M. and Schell, J [1983] Cell 32: 1033-1043. ).

Particularly useful vectors in this observation are pEND4K (Klee, H. J., Yanofsky, M. F. and Nester, E. W. Bio / Technology 3: 637-642). This plasmid can replicate in both plant cells and bacteria and has multiple cloning sites for the transgene. For example, toxin genes were inserted into Bam H1 of pEND4K to propagate in E. coli and transformed into appropriate plant cells.

Example 11-B.t. Cloning of Genes]

The novel genes of the present invention were cloned into baculo virus, such as Autographa california nuclear polyhedrosis virus (AcNPV). This plasmid was formed to contain the AcNPV genome cloned with a conventional cloning vector such as pUC 8. The AcNPV genome was modified so that the coding site of the polyhedron gene was removed and the specific cloning site for the transgene could be placed directly behind the multiple promoters. Examples of such vectors are pGP-B6874 (Pennock, GD, Shoemaker, C. and Miller, LK [1984] Mol. Cell. Bio1: 399-406) and pAC380 (Smith, GE, Summers, MD and Fraser, MJ [1983] Mol Cell.Bio1: 2156-2165). The genes encoding the novel protein toxins of the invention were modified with Bam H1 at appropriate sites both upstream and downstream of the coding site and inserted into the delivery site of one of the AcNPV vectors.

It is to be understood that the embodiments and embodiments described herein are for illustrative purposes only and that various modifications and alterations will be presented to those skilled in the art and are included within the spirit and scope of the claims.

Claims (12)

a) Bacillus thuringiensis (B.t.) strain PS80JJ1; b) Bacillus thuringiensis (B.t.) strain PS158D5; c) Bacillus thuringiensis (B.t.) strain PS167 P; d) Bacillus thuringiensis (B.t.) strain PS169E; e) Bacillus thuringiensis (B.t.) strain PS177F1; f) Bacillus thuringiensis (B.t.) strain PS177G; g) Bacillus thuringiensis (B.t.) strain PS204G4; And h) Bacillus thuringiensis isolate having reactivity with nematodes selected from the isolate group consisting of Bacillus thuringiensis (B.t.) strain PS204G6. a) a nucleotide sequence comprising the sequence set forth in SEQ ID NO: 1 encoding a nematode exterminating toxin or a fragment thereof having equivalent activity thereto; b) a nucleotide sequence comprising the sequence set forth in SEQ ID NO: 3 encoding a nematode exterminating toxin or a fragment thereof having equivalent activity thereto; c) a nucleotide sequence comprising the sequence set forth in SEQ ID NO: 5 encoding a nematode exterminating toxin or a fragment thereof having equivalent activity thereto; d) a nucleotide sequence comprising the sequence set forth in SEQ ID NO: 7 encoding a nematode eliminator toxin or a fragment thereof having equivalent activity thereto; e) a nucleotide sequence comprising the sequence set forth in SEQ ID NO: 9 encoding a nematode exterminating toxin or a fragment thereof having equivalent activity thereto; f) B.T having a 4.4kbXba I hybridization band, an N-terminal amino acid sequence comprising QLQAQPLIPYNVLA and an internal amino acid sequence comprising VQRILDEKLSFQLIK by restriction fragment length polymorphism analysis. DNA comprising a nucleotide sequence of a gene encoding a nematode toxin obtained from a Bacillus thuringiensis isolate of nematode inhibitor action defined as PS63B or a fragment thereof having equivalent activity thereto; g) B.t. with 5.0 kb EcoRI hybridization band by restriction fragment length polymorph analysis. DNA comprising a nucleotide sequence of a gene encoding a nematode toxin obtained from a Bacillus thuringiensis isolate of nematode inhibitor action defined as PS17d or a fragment thereof having equivalent activity thereto; h) B.t. with a 1.8 kb EcoRI hybridization band by restriction fragment length polymorph analysis. DNA comprising a nucleotide sequence of a gene encoding a nematode toxin obtained from a Bacillus thuringiensis isolate of nematode inhibitor action defined as PS17e or a fragment thereof having equivalent activity thereto; And i) Bacillus thuringiensis strain PS80JJ1, Bacillus thuringiensis strain PS158D5, Bacillus thuringiensis strain PS167P, Bacillus thuringiensis strain PS169E, Bacillus thuringiensis strain PS177F1, Bacillus thuringiensis strain PS177G, Bacillus thuringiensis strain DNA selected from the group consisting of DNA encoding an nematode toxin comprising a DNA sequence of a gene obtained from one of PS204G4 and Bacillus thuringiensis strain PS204G6. DNA encoding a nematode toxin having an amino acid sequence selected from the sequences set forth in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, and SEQ ID NO: 10. B.t. PS33F4, B.t. PS63B, B. t. PS52A1, B.t. PS69D1, B.t. PS17a, B. t. PS17b, B. t. PS17d and B.t. A recombinant DNA transfer vector comprising a gene selected from among genes defined as PS17e. The recombinant DNA transfer vector of claim 4, wherein the recombinant DNA transfer vector is selected from the group consisting of pMYC 2316, pMYC 2321, pMYC 2317, pMYC 1627, pMYC 1628, pMYC 2309, and pMYC 2311. a) the amino acid sequence set forth in SEQ ID NO: 2 having almost all nematodeergic action or a part thereof having equivalent activity; b) the amino acid sequence set forth in SEQ ID NO: 4 having almost all nematodeergic action or a part thereof having equivalent activity; c) the amino acid sequence set forth in SEQ ID NO: 6 having almost all nematodeergic action or a portion thereof having equivalent activity; d) the amino acid sequence set forth in SEQ ID NO: 8 having almost all nematodeergic action or a portion thereof having equivalent activity; And e) the amino acid sequence set forth in SEQ ID NO: 10 having almost all nematodeergic action or a portion thereof having equivalent activity; Active toxin for nematodes having an amino acid sequence comprising one of the following. a) a toxin having the amino acid sequence set forth in SEQ ID NO: 2 having almost all nematodeergic action or a part thereof having equivalent activity; b) a toxin having the amino acid sequence set forth in SEQ ID NO: 4 having almost all nematodeergic action or a portion thereof having equivalent activity; c) a toxin having the amino acid sequence set forth in SEQ ID NO: 6 having almost all nematodeergic action or a portion thereof having equivalent activity; d) a toxin having the amino acid sequence set forth in SEQ ID NO: 8 having almost all nematodeergic action or a portion thereof having equivalent activity; And e) a toxin having the amino acid sequence set forth in SEQ ID NO: 10 having almost all nematodeergic action or a portion thereof having equivalent activity thereto; f) Bacillus thuringiensis strain PS80JJ1, Bacillus thuringiensis strain PS158D5, Bacillus thuringiensis strain PS167P, Bacillus thuringiensis strain PS169E, Bacillus thuringiensis strain PS177F1, Bacillus thuringiensis strain PS177G, Bacillus thuringiensis strain PS204G4 And a nematode toxin comprising a DNA sequence of a gene obtained from one of Bacillus thuringiensis strain PS204G6; A host cell transformed to express Bacillus thuringiensis nematode toxin selected from among. 8. The host of claim 7, wherein the host is a) E. coli (NM522) (pMYC2316), characterized by nematodeergic characteristics of NRRL B-18785; b) E. coli (NM522) (pMYC2321), characterized by the nematodeergic properties of NRRL B-18770; c) E. coli (NM522) (pMYC2317), characterized by the nematodeergic properties of NRRL B-18816; d) E. coli (NM522) (pMYC1627), characterized by the nematodeergic properties of NRRL B-18651; e) E. coli (NM522) (pMYC1628), characterized by the nematode parasite characterization of NRRL B-18652; f) E. coli (NM522) (pMYC2311); And g) a transformed host that is a bacterial host selected from E. coli (NM522) (pMYC2309). a) a nucleotide sequence comprising the sequence set forth in SEQ ID NO: 1 encoding the nematode toxin or a fragment thereof having an equivalent activity thereof; b) a nucleotide sequence comprising the sequence set forth in SEQ ID NO: 3 encoding a nematode toxin or a fragment thereof having an activity equivalent thereto; c) a nucleotide sequence comprising the sequence set forth in SEQ ID NO: 5 encoding a nematode toxin or a fragment thereof having an equivalent activity thereof; d) a nucleotide sequence comprising the sequence set forth in SEQ ID NO: 7 encoding a nematode toxin or a fragment thereof having equivalent activity thereto; e) a nucleotide sequence comprising the sequence set forth in SEQ ID NO: 9 encoding a nematode toxin or a fragment thereof having equivalent activity thereto; f) B.t. with a 4.4 kb Xba I hybridization band, an N-terminal amino acid sequence comprising QLQAQPLIPYNVLA and an internal amino acid sequence comprising VQRILDEKLSFQLIK by restriction fragment length polymorphism analysis. DNA comprising a nucleotide sequence of a gene encoding a nematode toxin obtained from a Bacillus thuringiensis isolate having an activity of nematode deprivation defined as PS63B or a fragment thereof having equivalent activity thereto; g) B.t. with 5.0 kb EcoRI hybridization band by restriction fragment length polymorph analysis. DNA comprising a nucleotide sequence of a gene encoding a nematode toxin obtained from a Bacillus thuringiensis isolate of nematode inhibitor action defined as PS17d or a fragment thereof having equivalent activity thereto; h) B.t. with a 1.8 kb EcoRI hybridization band by restriction fragment length polymorph analysis. DNA comprising a nucleotide sequence of a gene encoding a nematode toxin obtained from a Bacillus thuringiensis isolate of nematode inhibitor action defined as PS17e or a fragment thereof having equivalent activity thereto; And i) Bacillus thuringiensis strain PS80JJ1, Bacillus thuringiensis strain JS158D5, Bacillus thuringiensis strain PS167P, Bacillus thuringiensis strain PS169E, Bacillus thuringiensis strain PS177F1, Bacillus thuringiensis strain PS177G, Bacillus thuringiensis strain DNA encoding a nematode toxin comprising a DNA sequence of a gene obtained from one of PS204G4 and Bacillus thuringiensis strain PS204G6; An almost intact recombinant cell comprising at least one intracellular nematode eradicating toxin that is a transgene of the Bacillus thuringiensis toxin gene encoding a δ-endotoxin polypeptide toxin encoded by a DNA selected from among. An nematode anesthetic composition comprising the recombinant cell of claim 9. a) a nucleotide sequence comprising the sequence set forth in SEQ ID NO: 1 encoding the nematode toxin or a fragment thereof having an equivalent activity thereof; b) a nucleotide sequence comprising the sequence set forth in SEQ ID NO: 3 encoding a nematode toxin or a fragment thereof having an activity equivalent thereto; c) a nucleotide sequence comprising the sequence set forth in SEQ ID NO: 5 encoding a nematode toxin or a fragment thereof having an equivalent activity thereof; d) a nucleotide sequence comprising the sequence set forth in SEQ ID NO: 7 encoding a nematode toxin or a fragment thereof having equivalent activity thereto; e) a nucleotide sequence comprising the sequence set forth in SEQ ID NO: 9 encoding a nematode toxin or a fragment thereof having equivalent activity thereto; f) B.t. with a 4.4 kb Xba I hybridization band, an N-terminal amino acid sequence comprising QLQAQPLIPYNVLA and an internal amino acid sequence comprising VQRILDEKLSFQLIK by restriction fragment length polymorphism analysis. DNA comprising a nucleotide sequence of a gene encoding a nematode toxin obtained from a Bacillus thuringiensis isolate having an activity of nematode deprivation defined as PS63B or a fragment thereof having equivalent activity thereto; g) B.t. with 5.0 kb EcoRI hybridization band by restriction fragment length polymorph analysis. DNA comprising a nucleotide sequence of a gene encoding a nematode toxin obtained from a Bacillus thuringiensis isolate of nematode inhibitor action defined as PS17d or a fragment thereof having equivalent activity thereto; h) B.t. with a 1.8 kb EcoRI hybridization band by restriction fragment length polymorph analysis. DNA comprising a nucleotide sequence of a gene encoding a nematode toxin obtained from a Bacillus thuringiensis isolate of nematode inhibitor action defined as PS17e or a fragment thereof having equivalent activity thereto; And i) Bacillus thuringiensis strain PS80JJ1, Bacillus thuringiensis strain PS158D5, Bacillus thuringiensis strain PS167P, Bacillus thuringiensis strain PS169E, Bacillus thuringiensis strain PS177F1, Bacillus thuringiensis strain PS177G, Bacillus thuringiensis strain Nematode eradication comprising the step of transforming plant cells with DNA selected from the group consisting of DNA encoding the nematode toxin comprising the DNA sequence of a gene obtained from one of PS204G4 and Bacillus thuringiensis strain PS204G6 Method for producing a plant having. a) a nucleotide sequence comprising the sequence set forth in SEQ ID NO: 1 encoding the nematode toxin or a fragment thereof having an equivalent activity thereof; b) a nucleotide sequence comprising the sequence set forth in SEQ ID NO: 3 encoding a nematode toxin or a fragment thereof having an activity equivalent thereto; c) a nucleotide sequence comprising the sequence set forth in SEQ ID NO: 5 encoding a nematode toxin or a fragment thereof having an equivalent activity thereof; d) a nucleotide sequence comprising the sequence set forth in SEQ ID NO: 7 encoding a nematode toxin or a fragment thereof having equivalent activity thereto; e) a nucleotide sequence comprising the sequence set forth in SEQ ID NO: 9 encoding a nematode toxin or a fragment thereof having equivalent activity thereto; f) B.t. with a 4.4 kb Xba I hybridization band, an N-terminal amino acid sequence comprising QLQAQPLIPYNVLA and an internal amino acid sequence comprising VQRILDEKLSFQLIK by restriction fragment length polymorphism analysis. DNA comprising a nucleotide sequence of a gene encoding a nematode toxin obtained from a Bacillus thuringiensis isolate having an activity of nematode deprivation defined as PS63B or a fragment thereof having equivalent activity thereto; g) B.t. with 5.0 kb EcoRI hybridization band by restriction fragment length polymorph analysis. DNA comprising a nucleotide sequence of a gene encoding a nematode toxin obtained from a Bacillus thuringiensis isolate of nematode inhibitor action defined as PS17d or a fragment thereof having equivalent activity thereto; h) B.t. with a 1.8 kb EcoRI hybridization band by restriction fragment length polymorph analysis. DNA comprising the nucleotide sequence of a gene encoding a nematode toxin or a fragment thereof having equivalent activity thereof, obtained from a Bacillus thuringiensis isolate having an activity of nematode determinant defined as PS17e and i) Bacillus thuringiensis Strain PS80JJ1, Bacillus thuringiensis strain PS158D5, Bacillus thuringiensis strain PS167P, Bacillus thuringiensis strain PS169E, Bacillus thuringiensis strain PS177F1, Bacillus thuringiensis strain PS177G, Bacillus thuringiensis strain PS204G4 and Bacillus thuringiensis strain A nematode rescued effective amount of toxin encoded by said DNA selected from the group consisting of DNA encoding the nematode toxin comprising the DNA sequence of the gene obtained from one of PS204G6 and transformed into a plant or other host cell Nematode control, including contact with Law.