JP2000026499A - New peptide, antimicrobial agent, new peptide gene, new recombinant dna and production of new peptide - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a new peptide comprising a peptide having a specific amino acid sequence, existing in the body fluid of beetle, exhibiting a strongly antibacterial action on Escherichia coli, Staphylococcus aureus, etc., useful as an antiseptic for foods, an antimicrobial agent for treatment, etc. SOLUTION: This new peptide comprises an amino acid sequence of the formula or comprises an amino acid sequence in which one or a plurality of amino acids are added, deleted or replaced in the amino acid sequence of the formula and has antimicrobial activity, has excellent antimicrobial activity against Escherichia coli, Staphylococcus aureus, etc., and is useful as an antiseptic for foods, an antimicrobial agent for medical treatment, etc. The peptide is obtained by injecting Escherichia coli into a beetle larva to induce antimicrobial activity, cutting a foot to release a body fluid, adding aprotinin to the body fluid, centrifuging, heat-treating the supernatant liquid, subjecting the heat-treated liquid to reversed phase chromatography, eluting an adsorbed fraction, collecting an antimicrobial active fraction and purifying it by high- performance liquid chromatography.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a novel peptide present in a beetle body fluid having induced antibacterial activity, an antibacterial agent comprising the peptide as an active ingredient,
The present invention relates to a novel peptide gene encoding the peptide, a novel recombinant DNA containing the gene, and a method for producing a novel peptide.

[0002]

2. Description of the Related Art When bacteria enter the body cavity of an insect, antibacterial proteins or peptides are induced into body fluids as one of the biological defense reactions. As an antimicrobial peptide obtained from the body fluid of a beetle, defensin [Biochem.
Biophys. Res. Commun., Vol. 220, 526-531, (1996)].

[0003]

An object of the present invention is to provide a novel beetle-derived peptide and an antibacterial agent containing the peptide as an active ingredient. It is a further object of the present invention to provide a novel recombinant DNA for efficiently producing the peptide using a genetic engineering technique.

[0004]

Means for Solving the Problems The present inventors have isolated two kinds of novel antimicrobial peptides having excellent antibacterial activity against Escherichia coli, Staphylococcus aureus and the like from a beetle body fluid having induced antibacterial activity. Succeeded, and a novel recombinant DNA for efficiently producing the peptide was prepared by using a genetic engineering technique, thereby completing the present invention.

That is, the present invention relates to (1) a peptide comprising an amino acid sequence represented by SEQ ID NO: 1 or an amino acid sequence in which one or more amino acids are added, deleted or substituted in the amino acid sequence, and which has an antibacterial activity. (2) an antibacterial agent containing the peptide according to item (1) as an active ingredient; (3) an anti-Escherichia coli agent containing the peptide according to item (1) as an active ingredient; Or a peptide comprising an amino acid sequence in which one or more amino acids have been added, deleted or substituted in said amino acid sequence, and having an antibacterial activity; (5) The peptide according to (4) as an active ingredient (6) an anti-Staphylococcus aureus agent comprising the peptide according to (4) as an active ingredient;

(7) A gene encoding the novel peptide according to item (1) or (4). (8) A novel peptide gene according to item (7) is inserted into a vector DNA. (9) A method for producing a peptide, which comprises obtaining the peptide according to (1) or (4) from a beetle larva.

[0007] The novel peptide of the present invention (hereinafter referred to as "beetlesin") can be produced, for example, from a body fluid of a beetle in which antibacterial activity has been induced, using a conventional method for isolating a protein. Further, it can be produced using a conventional peptide synthesis method or a genetic engineering technique.

[0008] Examples of the genetic engineering techniques include a method for producing a novel peptide using a host cell transformed or transduced with a recombinant DNA into which a novel peptide gene has been inserted, a rabbit reticulocyte, a wheat germ and the like. And a method of producing the buttocin by translating the recombinant DNA using a cell-free protein synthesis system using E. coli.

[0009]

BEST MODE FOR CARRYING OUT THE INVENTION A method for isolating beetosine from a body fluid of a beetle in which an antibacterial activity has been induced and a method for producing beetosine by genetic engineering will be described in detail below. [1] Method of Isolating Beetle from Beetle Body Fluid with Induced Antibacterial Activity The starting material for obtaining beetosine may be any beetle body fluid with induced antibacterial activity. As a method for inducing antibacterial activity, for example, a method of injecting a physiological saline suspension of Escherichia coli into the body cavity of a larva of a beetle can be mentioned.

Twenty to twenty-eight hours after the induction of the antimicrobial activity, the larval feet of the beetle are cut off and the body fluid is collected. After heating this body fluid, it is centrifuged to obtain a supernatant.

Next, the obtained supernatant is subjected to reverse phase column chromatography. The adsorbed fraction is eluted with a mixture of acetonitrile containing trifluoroacetic acid and water, and an antibacterial active fraction is collected. As the reversed phase column used here, for example, a product name: Seppak C18 cartridge (manufactured by Waters) can be mentioned.

Next, the obtained antibacterial active fraction is subjected to gel filtration FPLC or HPLC. F used here
Examples of gel filtration columns for PLC include trade names: Superdex 75 HR 10/30 (Pharmacia), HPL
As the gel filtration column for C, for example, trade name: TSKgel S
W2000 (manufactured by Tosoh Corporation) and the like.

Next, the antibacterial active fraction obtained by gel filtration is subjected to reverse phase FPLC or reverse phase HPLC. Two antimicrobial activity peaks are obtained by eluting the adsorbed fraction with a concentration gradient eluent of acetonitrile aqueous solution containing trifluoroacetic acid. Among these, the fraction having antibacterial activity eluted at a higher acetonitrile concentration is collected. As the reversed-phase FPLC column, for example, trade name: Pep RP
Examples of C HR 5/5 (Pharmacia) and reverse phase HPLC columns include, for example, Capsule Pack C18 SG300 (manufactured by Shiseido) and the like.

The collected antibacterial active fraction is again subjected to reverse phase H
Subject to PLC. Elution is carried out with a gradient of acetonitrile containing trifluoroacetic acid. By relaxing the concentration gradient of acetonitrile, two kinds of antimicrobial peptides of the present invention, SEQ ID NO: 1 (SEQ ID NO: 1 is referred to as Kabutosin A) and SEQ ID NO: 2 (SEQ ID NO: 2 is referred to as Kabutosin B)
Are separated and eluted, and each can be isolated.

The antibacterial activity of the antibacterial peptide of the present invention is measured by using the formation of a growth inhibition circle on a plate medium as an index.
aureus ATCC 6538P).

[2] Method for Producing Kabutosin by Genetic Engineering Technique The following describes a method for cloning a katocin gene and a recombinant DNA into which a DNA containing the kabutosin gene has been inserted.
A method for transforming or transducing a host cell to produce beetosine using the obtained recombinant microorganism will be described.

The DNA containing the beetosine gene can be obtained by cloning a natural gene derived from a beetle genomic DNA or cDNA. As a method for cloning the gene, a suitable probe DNA is synthesized based on the amino acid sequences of the two antibacterial peptides of the present invention,
A method for screening from a library of beetle genomic DNA or cDNA using the same, or an appropriate primer DNA based on the amino acid sequence of the peptide
And DNA containing the gene fragment is specifically amplified by an appropriate PCR method such as the 5′RACE method or the 3′RACE method, and these are ligated to obtain a DNA containing the full-length gene. Method and the like.

One or more amino acids may be added, deleted or substituted in the amino acid sequence encoded by the beetosine gene as long as the amino acid sequence does not lose the antibacterial activity. The invention of the present invention includes all butohsin genes whose amino acid sequences have been changed within a range that does not cause loss of antibacterial activity.
Examples of a method for introducing a mutation into a beetosine gene include a method in which the gene is brought into contact with a mutagenic agent, specifically, hydroxylamine, nitrite, sulfurous acid, 5′-bromouracil, or the like. In addition, methods such as ultraviolet irradiation, cassette mutation, and site-specific mutagenesis using PCR can be widely used. Moreover,
It is also possible to anneal chemically synthesized DNA to construct a mutated kabutosin gene having a mutation at a desired site.

It is preferable that the DNA containing the beetosine gene is provided with an appropriate restriction enzyme at both ends thereof, for example, a recognition site such as EcoRI or SalI. Thereby, the DNA can be efficiently inserted into the vector DNA.

In the case of chemically synthesizing a DNA containing a beetosine gene, the DNA is divided into a plurality of oligonucleotides, chemically synthesized, annealed, and then ligated by DNA ligase. In such a case, the codon which does not affect the amino acid sequence of cabtocin is preferably replaced with a codon frequently used in a host cell. As a result, a larger amount of a beetosine protein can be produced as compared with a case where a natural beetosine gene is used.

The DNA containing the beetosine gene of the present invention can be easily amplified. That is, the DNA is inserted into an appropriate vector DNA, for example, a plasmid DNA, bacteriophage DNA or the like, to obtain a recombinant DNA. Next, a host cell, for example, Escherichia coli or the like is transformed or transduced with the recombinant DNA to obtain a recombinant microorganism. After culturing the recombinant microorganism and preparing a recombinant DNA using a conventional method, the insert DNA may be cut out using an appropriate restriction enzyme and purified. When preparing recombinant DNA from a recombinant microorganism, the dideoxy method [Methods Enzymol., Vol. 101,
20-78 (1983)] and the like, it is preferable to confirm the base sequence of the insert DNA.

[0022] Eukaryotic cells and prokaryotic cells can be used as host cells for producing beetosine. Eukaryotic cells include cells of animals, plants, insects, yeasts and the like, and prokaryotic cells include Escherichia coli, Bacillus subtilis, actinomycetes and the like. When plant or insect cells are used as host cells, they do not need to be cultured cells.
Specifically, it may be a tobacco plant or a silkworm larva.

When an antimicrobial peptide such as cabtocin is produced in a prokaryotic cell such as Escherichia coli, the target peptide is expressed as a fusion protein with β-galactosidase, β-lactamase, maltose binding protein or protein A. Is preferred. Since beetosine expressed as a fusion protein does not show antibacterial activity, it does not inhibit the growth of prokaryotic host cells. Prokaryotic cells that can be used as hosts in the present invention include Escherichia strains such as Escherichia coli JM109, E.
scherichia coli HB101 (ATCC33694) and the like.

The antimicrobial peptide expressed as a fusion protein can be purified by using affinity chromatography when the fusion protein is soluble.
When it is insoluble, it can be easily purified by centrifugation.

The vector DNA for expressing the beetin peptide may be any vector DNA as long as it can be replicated in a host cell, and examples thereof include plasmid DNA and bacteriophage DNA. As the vector DNA when the host cell is Escherichia coli, for example, plasmid pMAL-C2 (manufactured by NEW England Labs), pGEX-5X-1 (manufactured by Pharmacia), pXa1 (manufactured by Boehringer) and the like can be used.

Next, a recombinant DNA is prepared by inserting a DNA containing the beetosine gene into an appropriate restriction enzyme site of the vector DNA. By using this recombinant DNA to transform or transduce a host cell, a recombinant microorganism can be obtained. Transformation was carried out by the DM Morrison method [Methods Enzymol., 68, 3
26-331 (1979)], calcium chloride method [Gene, 6, 23
, (1979)], and transduction can be performed by the Beehone method [Methods Enzymol., 68, 299-309 (1979)].

Next, this recombinant microorganism is cultured in a medium, and cabtocin is collected from the culture.

When eukaryotic cells are used as host cells and cabtocin is expressed in a single form, an ordinary protein isolation method can be used as a method for collecting cabtocin. In other words, bacteriolysis using enzymes such as lysozyme, ultrasonic crushing, disruption of the cells by grinding, etc.,
The buttocin is excreted outside the cells. Next, a highly purified beetosine preparation can be obtained by using the same method as used for isolating beetosine from a beetle body fluid, that is, gel filtration, ion exchange resin, and reverse phase HPLC.

In the case where eukaryotic cells or prokaryotic cells are used as host cells and cabtocin is expressed as a fusion protein, the fusion protein is obtained by disrupting the cells and then performing a combination of centrifugation, affinity chromatography and the like. Next, a captocin peptide is cut out from the fusion protein by an enzyme treatment using Factor Xa (manufactured by Boehringer Mannheim) or the like, and purified.

The beetosine obtained by the genetic engineering technique exhibits exactly the same antibacterial activity as that of the beetle isolated from the beetle body fluid in which the antibacterial activity is induced.

Kabutosin is, for example, Bacillus subtili which causes spoilage of rice, bread and the like.
s), Staphylococcus aureus (Staphyloco
ccusaureus), Escherichia coli, Bacillus, Staphylococcus
occus) genus, Clostridium (Clostridium) genus, Streptococcus (Streptococcus) gram-positive bacteria such as genus,
Escherichia, Pseudomonas
It can exert antibacterial activity widely on Gram-negative bacteria such as Monas). In particular, cabtocin A showed antibacterial activity against Escherichia coli, and cabtocin B showed antibacterial activity against Staphylococcus aureus. Table 1 shows specific data.

Kabutosin can be used as an antibacterial agent as it is or as a tablet, powder, wettable powder, emulsion, capsule or the like using a commonly used solid carrier, liquid carrier, emulsifying dispersant or the like. it can. As the carrier, water, gelatin, starch, magnesium stearate,
Lactose, gum arabic, vegetable oil and the like. When beetosine is used as an antibacterial agent, an extract obtained from a beetle having induced antibacterial activity or a crude culture having antibacterial activity obtained by a genetic engineering technique can be used without purification.

The antibacterial agents mentioned above include food preservatives, medical antibacterial agents, building materials and paint preservatives, agricultural and horticultural antibacterial agents, livestock feed preservatives, fish feed preservatives, and the like. It can be used in a wide range of fields.

When beetosine is added to a food as a food preservative, there are exemplified a method of mixing it into the food, a method of applying it to the surface of the food, and the like. In that case, 20 mg or more, preferably about 50 to 500 mg, may be added per 1 kg of food.

Examples of applicable foods include fish paste products such as kamaboko and chikuwa, processed meat products such as ham and sausage, beverages such as soft drinks and fruit drinks, cakes, puddings, and the like.
Sweets such as buns are exemplified.

The antibacterial agent containing cabtocin as an active ingredient can be used by being appropriately mixed with other bactericides, pharmaceuticals, preservatives, food additives and the like.

The following is an example in which beetosine is isolated from a beetle body fluid in which an antibacterial activity has been induced, an example in which a recombinant DNA for producing beetosine efficiently by genetic engineering techniques, and an antibacterial activity. The present invention will be specifically described by test examples, but these are not intended to limit the scope of the present invention.

[0038]

【Example】

 Example 1 Isolation and Structural Analysis of Beetle A and B
Isolation of Shin A and B. Third instar larva of beetle (Allomyrina dichotoma)
Escherichia coli JM (purchased from Tsukuba Chicken)
109, manufactured by Takara Shuzo Co., Ltd. in physiological saline (2.5 × 10 ⁷(Pcs / ml)
Was injected into the body cavity at a rate of 0.02 ml / animal, and antibacterial activity
Was induced. Twenty-four hours later, the larvae's feet are cut and the body fluid is released.
Aprotinin (Sigma)
Collected in a centrifuge tube. The final concentration of aprotinin was about 2
It was adjusted to 0 μg / ml. Immediately centrifuge this body fluid
The blood cells were separated and sedimented, and the supernatant was recovered. Collection
After heating the supernatant at 95 ° C for 5 minutes,
Separation was performed to obtain a supernatant.

3 ml of the obtained centrifuged supernatant was added to 0.05
The solution was allowed to flow through a Seppak C18 cartridge (manufactured by Waters) equilibrated with trifluoroacetic acid. 10, 20, 30, containing 0.05% trifluoroacetic acid
Elution was carried out by sequentially flowing 5 ml of each of acetonitrile aqueous solutions of 40, 50 and 60%, and acetonitrile containing 0.05% of trifluoroacetic acid. The eluate was fractionated according to the acetonitrile concentration. 30, 40 and 5
Antimicrobial activity was observed in the fraction eluted with 0% acetonitrile.

The obtained active fractions were combined, concentrated by a centrifugal evaporator, and then concentrated in PBS (NaC per liter).
_{l 8g, Na 2 PO 4 1.44g} , KH 2 PO 4 0.
24 g, KCl 0.2 g, pH 7.4)
Superdex 75 HR 10/30 (Pharmacia) FPL
Gel filtration was performed by flowing through a C column. PBS for elution
Was used. The flow rate was 0.5 ml / min, and the eluate was 0.1 ml / min.
Each 5 ml was fractionated. Antibacterial active fractions were collected and concentrated.

The obtained concentrate was applied to a reverse phase FPLC column of PepRPC HR 5/5 (Pharmacia) equilibrated with 0.05% trifluoroacetic acid. If the adsorbed fraction is 0
Elution was carried out with a gradient of acetonitrile containing 05% trifluoroacetic acid. That is, the concentration of acetonitrile was increased from 0% to 40% over 120 minutes.
The flow rate was 0.25 ml / min, and the eluate was fractionated by 0.25 ml. The antibacterial activity was divided into two peaks, and the active fraction eluted later was concentrated. The active fraction eluted earlier contained defensin, a known antibacterial protein of beetles.

The concentrated solution of the active fraction eluted later was added to 0.0
MRPC C2 / C equilibrated with 5% trifluoroacetic acid
It was applied to a reverse phase column of 18PC 3.2 / 3 (manufactured by Pharmacia) and further purified. Adsorption fraction is 0.05%
It was eluted with a gradient of acetonitrile containing trifluoroacetic acid. That is, first, the concentration of acetonitrile was increased from 0% to 20% over 5 minutes, and then from 20% to 30% over 60 minutes.
The elution was performed at a flow rate of 0.25 ml / min while monitoring the absorbance at 225 nm. 2 eluted per 60 minutes
The two peaks were collected, and the one that eluted first was designated as captocin B, and the one that eluted later was designated as captocin A. In this way, 3 ml of beetle body fluid is converted into beetin A
And B were each obtained in an amount of 1 μg. The protein is 2
It was calculated from the absorbance at 25 nm, and 11 OD was defined as 1 mg.

The antibacterial activity when purifying beetosine A and B was measured using the formation of a growth inhibition circle on a plate medium as an index [Nature, Vol. 292, 246 (1981)]. Staphylococcus aureus subsp. Aur
eus ATCC 6538P).

(2) Structural Analysis of Kabutosin A and B (a) Mass Spectrometry The mass was measured by an electrospray ionization method using a mass spectrometer (M-1200H LC / MS system, manufactured by Hitachi, Ltd.). As a result of the measurement, 7,73 of beetin B was detected.
1Da and Kabutosin A obtained a value of 7,740 Da.

(B) N-terminal amino acid sequence The N-terminal amino acid sequences of the beetins A and B were analyzed by the Edman method using a protein sequencer (type 473A, manufactured by Applied Biosystems). The obtained N-terminal amino acid sequence of beetosine A is shown in SEQ ID NO: 3,
It is shown in SEQ ID NO: 4 for that of buttocin B, respectively.

(C) Amino acid sequence of protease digested product After digesting cabtocins A and B with lysyl endopeptidase (manufactured by Wako Pure Chemical Industries, Ltd.), the resulting peptide fragment was subjected to reverse phase H
PLC (reverse phase column: Capsule Pack C8 SG300
(Manufactured by Shiseido Co., Ltd.), and the amino acid sequence of each obtained fragment was analyzed using a protein sequencer. With respect to cabtocin A, fragments having the amino acid sequences shown in SEQ ID NOs: 5 and 6 were obtained. With respect to cabtocin B, a fragment having the amino acid sequence shown in SEQ ID NO: 5 in addition to SEQ ID NO: 4 was obtained.

(3) Measurement of antibacterial activity The antibacterial activities of cabtocin A and B against various bacteria are as follows.
According to the method described in [Eur. J. Biochem., 187, 381-386 (1990)], it was determined by the minimum growth inhibitory concentration (MIC).

(Test Bacteria) Escherichia coli (Escherichia coli JM109, manufactured by Takara Shuzo) Staphylococcus aureus subsp. Aureu
s ATCC 6538P) Bacillus subtilis ISW 1214 (Iwaki Glass)

(Testing method for antibacterial activity)
(triptic soy broth, manufactured by Difco) at 37 ° C
After culturing until the exponential growth phase, collect the cells by centrifugation,
The cells were washed with a buffer of 10 mM sodium phosphate (pH 7.4) and suspended in the same buffer. 0.03% TSB,
10 ml of 1% agarose containing 0.02% Tween 20 (autoclaved and kept at 42 ° C)
To a suspension of the bacterial cells cell number 2 to 6 × 10 ⁶ cells / 10m
1 and mixed, and immediately poured into a 9 cm diameter petri dish and hardened. Using a gel puncher, make a 2 mm diameter hole on the agar medium.
5 μl of an aqueous solution of beetosine A or B adjusted to a concentration of g / ml was added. After standing at 37 ° C. for 2 hours, 10 ml of 1% agarose containing 6% TSB (sterilized in an autoclave and kept at 42 ° C.) was poured onto the agar medium and solidified. After allowing this to stand at 37 ° C. for 24 hours, the diameter of the formed growth inhibition circle was measured. Table 1 shows the obtained results. In addition, the diameter of the stop circle is 2.00 mm.
Indicates that no blocking circle was formed.

[0050]

[Table 1] Antibacterial activity (diameter of inhibition circle (mm)) Test bacteria Cabutosin A Cabutosin B Staphylococcus aureus 2.00 3.67 Escherichia coli 4.00 2.00 Bacillus subtilis 2.00 2.00

From the results shown in Table 1, it was found that beetosine A has an antibacterial effect on Escherichia coli and that beetosine B has an antibacterial effect on Staphylococcus aureus.

Example 2 cDN of Kabutosin A and B
Cloning of A In order to elucidate the entire primary structure of kabutosin B, cDN coding for kabutosin B by the following PCR method
A was cloned. The beetin A can be cloned in the same manner.

(1) Beetle fat body mRNA and cD
Preparation of NA Antibacterial activity was induced by injecting Escherichia coli into the third instar larva of the beetle. Larvae were laparotomized 18 hours after the injection, and fat pads were collected. The fat pad was stored at -130 ° C until use. QuickPrep mRNA Purification from this fat body
The mRNA was purified using Kit (Pharmacia). cDNA was synthesized using the mRNA obtained by the purification as a template and a cDNA first-strand synthesis kit (Pharmacia). Not I- (dT18) primer attached to the kit was used as a primer at this time.

(2) Acquisition of cDNA fragment of Kabutosin B and cloning of cDNA Based on the N-terminal amino acid sequence of Kabutosin B revealed by a protein sequencer,
Mix primers (primer 1 (SEQ ID NO: 9) and primer 2 (SEQ ID NO:
10)) was synthesized. When PCR was performed using the cDNA obtained in the previous step as a template, an amplification product of about 80 bp was obtained. Ampli Taq Gold is used as the polymerase during the amplification reaction.
(Manufactured by PerkinElmer) and the supplied buffer and dN
TP substrate was used according to the instructions. The thermal cycler is GENE AMP PCR SYSTEM 2400 manufactured by PerkinElmer.
Was used. This product was cloned into the plasmid vector pCR 2.1 (Invitrogen). Dye Terminator CycleSequencing FS Ready React
The DNA was analyzed using a DNA sequencer (Model 373S, manufactured by Applied Biosystems) using an ion Kit (manufactured by Applied Biosystems). The amino acid sequence deduced from this nucleotide sequence corresponds to the 3rd to 30th residues of the partial amino acid sequence of the beetle B which has been clarified, indicating that the fragment of the target gene has been amplified. Was. Primer 1: CA (A / G) CC (A / C / G / T) GG (A / C / G / T) GC (A / C /
G / T) CC (A / C / G / T) AA (C / T) TT (C / T) (SEQ ID NO: 9) Primer 2: (A / G) TT (A / C / G / T) GG (A / C / G / T) CC (C / T) TG
(C / T) TG (C / T) TC (A / C / G / T) AC (SEQ ID NO: 10)

Next, a base sequence further downstream including the region revealed in the previous step was obtained by the 3 ′ RACE method as follows. First, as an upstream primer for PCR for this purpose, the following sequence was selected from the nucleotide sequences identified in the previous step and synthesized, and this was used as primer 3 (SEQ ID NO: 11). As the other downstream primer, cDNA
The base sequence in Not I- (dT18) primer used in the synthesis was synthesized and used (Primer 4 (SEQ ID NO: 1
2)). Combining primer 3 and primer 4,
When PCR was performed using cDNA as a template, about 300
A bp amplification product was obtained. This product was cloned into pCR 2.1, and the nucleotide sequence of the product was examined. As a result, it was found that the target region was amplified. Primer 3: GATGCCCGCTTCACAGTTA (SEQ ID NO: 1
1) Primer 4: AACTGGAAGAAATTCGCGGC (SEQ ID NO: 1
2)

The nucleotide sequence further upstream than the sequence obtained up to the previous step was examined by the 5 'RACE method as follows.
At this time, 5 'RACE System for Rapid Amplification of c
DNA End Reagent Assembly, Ver.2 (Gibco BRL)
Was used. Based on the sequence revealed in the downstream analysis of the previous step, the most downstream primer (primer 5
(SEQ ID NO: 13)) and primer 6 (SEQ ID NO: 14) were synthesized based on the sequence immediately upstream of primer 5. Using mRNA extracted from the fat pad as a template, single-stranded cDNA was synthesized using a primer 5 and reverse transcriptase. After adding a dC polymer to the 3 ′ end of the obtained single-stranded cDNA, PCR was performed using this as a template and combining an anchor primer and primer 6 attached to the kit. In order to clone the product, PCR was carried out using this product as a template and combining the adapter primer and primer 6 attached to the kit with about 550
A bp amplification product was obtained. This product was cloned into pCR2.1 and the nucleotide sequence was examined. As a result, the nucleotide sequence of the target region was obtained. Primer 5: CCACCTATAAGTTCCACC (SEQ ID NO: 1
3) Primer 6: AACGCTCCAATTCGGTTTGCTTTTT (SEQ ID NO: 14)

Next, the following PCR was carried out in order to obtain partial sequences on the upstream and downstream sides of the beetin B identified in the preceding step as a continuous sequence, ie, a clone containing the full-length cDNA of the beetin B. . First, a primer 7 (SEQ ID NO: 15) was synthesized based on the obtained sequence on the upstream side of the beetin B. Next, primer 7 and primer 4 were combined, and PCR was performed using cDNA as a template.
As a result, an amplified fragment of about 600 bp was obtained. This product was cloned into pCR2.1 and the nucleotide sequence was examined. As a result, the sequence shown in SEQ ID NO: 7 was obtained. Primer 7: GAGACGAAATTGTATCGCTC (SEQ ID NO: 1
5)

The nucleotide sequence of beetosine A was examined by the same cloning operation as that of beetosine B. That is, the following PCR was carried out in order to obtain a clone containing the full length of the cDNA of beetosine A. First, a primer 8 (SEQ ID NO: 16) was synthesized using a base sequence portion on the upstream side of beetosine A different from beetosine B. Next, the primer 4 and the primer 8 previously synthesized were combined as the downstream primer, and PCR was performed using cDNA as a template. As a result, an amplified fragment of about 600 bp was obtained. This product was cloned into pCR2.1 and the nucleotide sequence was examined. As a result, the sequence shown in SEQ ID NO: 8 was obtained. Primer 8: GAGACGAAATCGTATCGTTC (SEQ ID NO: 1
6)

From these results, it was concluded that the amino acid sequence of beetosine B was SEQ ID NO: 2, and that the amino acid sequence of beetosine A was SEQ ID NO: 1. Kabutosin A or B
Was first translated in the form of a precursor peptide, and the upstream peptide was removed by processing, resulting in the mature form of the peptide, kabutosin A or B.

Escherichia coli was transformed with the recombinant DNA of beetosine A cloned into pCR2.1 to obtain a recombinant microorganism E. coli JM109 (pCRKABUA1). pCR
Similarly, for the recombinant DNA of beetosine B cloned in 2.1, the transformed recombinant microorganism
E. coli JM109 (pCRKABUB1) was obtained. Recombinant microorganism Ec
oli JM109 (pCRKABUA1) has been deposited as FERM P-16859, and the recombinant microorganism E. coli JM109 (pCRKABUB1) has been deposited as FERM P-16860 at the Biotechnology Industrial Research Institute, National Institute of Advanced Industrial Science and Technology.

"Sequence List Free Text" SEQ ID NO: 9 DNA designed based on the N-terminal amino acid sequence of cabtocin B. SEQ ID NO: 10 DNA designed on the basis of N-terminal amino acid sequence of beetosine B SEQ ID NO: 11 Kabutosin B was obtained by 3'RACE method.
DNA designed to amplify a part of the cDNA of the above. SEQ ID NO: 12 NotI- (dT18) primer
DNA designed to correspond to the base sequence in. SEQ ID NO: 13 5 ′ RACE method (1st step)
DNA designed to amplify a part of the cDNA of beetosine B SEQ ID NO: 14 5 'RACE method (2nd step)
DNA designed to amplify a part of the cDNA of beetosine B SEQ ID NO: 15 DNA designed to amplify full-length cDNA of buttocin B SEQ ID NO: 16 DNA designed to amplify full-length cDNA of cabtocin A

[0062]

According to the present invention, beetle production 2
Kinds of novel antimicrobial peptides (captocins A and B) and recombinant DNA for efficiently producing the peptides have been provided. Since kabutosin A has an effective antibacterial effect on Escherichia coli and cabutosin B has an effective antibacterial effect on Staphylococcus aureus, it is suitable as a food preservative and a medical antibacterial agent.

[0063]

[Sequence List] SEQUENCE LISTING <110> Director General, National Institute of Sericultural and Entomol ogical Science Noda Institute for Scientific Research <120> Novel peptides, antibacterial agents, novel peptide genes, novel recombinant DNAs and a process for producing novel peptides <130 > SP211 <160> 16 <210> 1 <211> 72 <212> PRT <213> Allomyrina dichotoma <400> 1 Ser Leu Gln Pro Gly Ala Pro Asn Phe Pro Leu Pro Gly Ser Gln Leu 1 5 10 15 Pro Thr Ser Ile Thr Ser Asn Val Glu Arg Gln Gly Pro Asn Thr Ala 20 25 30 Ala Thr Ile Asn Ala Gln His Lys Thr Asp Arg Tyr Asp Val Gly Ala 35 40 45 Thr Trp Ser Lys Val Ile Arg Gly Pro Gly Lys Ser Lys Pro Asn Trp 50 55 60 Ser Val Gly Gly Thr Tyr Arg Trp 65 70 <210> 2 <211> 72 <212> PRT <213> Allomyrina dichotoma <400> 2 Ser Leu Gln Pro Gly Ala Pro Asn Phe Pro Met Pro Gly Ser Gln Leu 1 5 10 15 Pro Thr Ser Ile Thr Ser Asn Val Glu Gln Gln Gly Pro Asn Thr Ala 20 25 30 Al a Thr Ile Asn Ala Gln His Lys Thr Asp Arg Tyr Asp Val Gly Ala 35 40 45 Thr Trp Ser Lys Val Ile Arg Gly Pro Gly Lys Ser Lys Pro Asn Trp 50 55 60 Ser Val Gly Gly Thr Tyr Arg Trp 65 70 <210 > 3 <211> 44 <212> PRT <213> Allomyrina dichotoma <400> 3 Ser Leu Gln Pro Gly Ala Pro Asn Phe Pro Leu Pro Gly Ser Gln Leu 1 5 10 15 Pro Thr Ser Ile Thr Ser Asn Val Glu Arg Gln Gly Pro Asn Thr Ala 20 25 30 Ala Thr Ile Asn Ala Gln His Lys Thr Asp Arg Tyr 35 40 <210> 4 <211> 30 <212> PRT <213> Allomyrina dichotoma <400> 4 Ser Leu Gln Pro Gly Ala Pro Asn Phe Pro Met Pro Gly Ser Gln Leu 1 5 10 15 Pro Thr Ser Ile Thr Ser Asn Val Glu Gln Gln Gly Pro Asn 20 25 30 <210> 5 <211> 12 <212> PRT <213> Allomyrina dichotoma <400> 5 Thr Asp Arg Tyr Asp Val Gly Ala Thr Trp Ser Lys 1 5 10 <210> 6 <211> 10 <212> PRT <213> Allomyrina dichotoma <400> 6 Pro Asn Trp Ser Val Gly Gly Thr Tyr Arg 1 5 10 <210> 7 <211> 591 <212> DNA <213 Allomyrina dichotoma <400> 7 GaGaCGaaaT TGTaTCGCTC aaCTGaaaaC aTaTTGGTGT aTaTCTCGCC 50 TaaTaGTTaa aTCTTCaaCT aCGaTTTaaa G aTG aTG aaa CTC TaC 96 Met Met Lys Leu Tyr -70 GTT aTC TTT GGT TCT GCT TCT GTT GCT CCT GTT CTGT GTT CTT GTT CTT GTT CTT GTT CTT GTT CTT GTT CTT GTT CTT GTT CTT GTT CTT GTT CTT GTT CTT GTT CTT GTT CTT GTT CTT GTT CTT GTT CGT GCT CTCT Leu Ile Val Leu Ser Thr Ala Tyr Val Val Pro Glu -65 -60 -55 CGT TaC TTT CaG CCT aTa TaT CCT GaT aCT GCG GCG GTG CaT GCC TTC 192 Arg Tyr Pyr Gln Pro Ile Tyr Pro Asp Thr Ala Ala Val His Ala Phe -50 -45 -40 AGA GAC GAG CCT TTC ACG GTG ACA CCT GCC GAA TTG CGC TCA TAT CTA 240 Arg Asp Glu Pro Phe Thr Val Thr Pro Ala Glu Leu Arg Ser Tyr Leu -35 -30 -25 -20 GGT ATC ACC GAT GAA GAT GAA ATA GAA ATG CCG GTA GTT TAT AAT CGT 288 Gly Ile Thr Asp Glu Asp Glu Ile Glu Met Pro Val Val Tyr Asn Arg -15 -10 -5 GAA AGG AGG TCC TTA CAG CCA GGT GCA CCT AAT TTC CCG ATG CCC GGT 336 Glu Arg Arg Ser Leu Gln Pro Gly Ala Pro Asn Phe Pro Met Pro Gly -1 1 5 10 TCA CAG TTA CCT ACC AGC ATC ACC TCT AAT GTT GAA CAA CAG GGG CCA 384 Ser Gln Leu Pro Thr Ser Ile Thr Ser Asn Val Glu Gln Gln Gly Pro 15 20 25 AAT ACT GCA GCC ACT ATC AAT GCC CAA CAT AAA ACT GAT AGG TAC GAC 432 Asn Thr Ala Ala Thr Ile Asn Ala Gln His Lys Thr Asp Arg Tyr Asp 30 35 40 45 GTT GGA GCC ACC TGG AGC AAG GTC ATT CGC GGA CCA GGA AAA AGC AAA 480 Val Gly Ala Thr Trp Ser Lys Val Ile Arg Gly Pro Gly Lys Ser Lys 50 55 60 CCG AAT TGG AGC GTT GGT GGA ACT TAT AGG TGG TAACACCTGT ATTTC 528 Pro Asn Trp Ser Val Gly Gly Thr Tyr Arg Trp 65 70 GTTATTTTTG TAAAATATTT TTTGATATAA ATTAAATTTT GTTCGCAAAA 578 AAAAAAAAAA AAA 591 <210> 8 <211> 596 <212> DNA <213> Allomyrina dichotoma <400> 8 GAGATCATC ATC TAGTATCATCGTC ACT ATG ATG AAA CTC TAC 96 Met Met Lys Leu Tyr -70 ATT ATT TTC GGT CTT ATT GCA CTT TCT ACT GCT TAT GCG GTT CCA GAA 144 Ile Ile Phe Gly Leu Ile Ala Leu Ser Thr Ala Tyr Ala Val Pro Glu -65 -60 -55 CGC TAC TTC CAG CCT CCA TAT CCT GAT ACT GCG GCC GTG CAT GCC TAC 192 Arg Tyr Phe Gln Pro Pro Tyr Pro Asp Thr Ala Ala Va l His Ala Tyr -50 -45 -40 AGA GAC GAG CCT TTC ACG GTT ACA CCT ACC GAA TTC CGC TCC TAT CTA 240 Arg Asp Glu Pro Phe Thr Val Thr Pro Thr Glu Phe Arg Ser Tyr Leu -35 -30 -25- 20 GGT ATC ACC GAT GAA GAT GAA ATA GAA ATG CCG GTA GTT TAT ATT CGC 288 Gly Ile Thr Asp Glu Asp Glu Ile Glu Met Pro Val Val Tyr Ile Arg -15 -10 -5 GAA AGG AGG TCC TTA CAG CCA GGT GCA CCT AAT TTC CCG CTG CCC GGT 336 Glu Arg Arg Ser Leu Gln Pro Gly Ala Pro Asn Phe Pro Leu Pro Gly -1 1 5 10 TCA CAG TTA CCT ACC AGC ATC ACC TCT AAT GTT GAA CGA CAG GGG CCA 384 Ser Gln Leu Pro Thr Ser Ile Thr Ser Asn Val Glu Arg Gln Gly Pro 15 20 25 AAT ACT GCA GCC ACT ATC AAT GCC CAA CAT AAA ACT GAT AGG TAC GAT 432 Asn Thr Ala Ala Thr Ile Asn Ala Gln His Lys Thr Asp Arg Tyr Asp 30 35 40 45 GTT GGA GCC ACC TGG AGC AAG GTC ATT CGC GGA CCA GGA AAA AGC AAA 480 Val Gly Ala Thr Trp Ser Lys Val Ile Arg Gly Pro Gly Lys Ser Lys 50 55 60 CCG AAT TGG AGC GTT GGT GGA ACT TAT AGG TGG TAACACCTGT ATTTC 528 Pro Asn Trp Ser Val Gly Gly Thr Tyr Arg Trp 65 70 GTTATTTTTG TAAAATATTT TTTGATATAA ATTAAATTTT GTTCGCAAAA 578 AAAAAAAAAA AAAAAAAA 596 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <223> Designed DNA degenerated from N-terminal amino acid sequence of kabutocin B. <400> 9 CARCCTTAANG CNC 21 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Designed DNA degenerated from N-terminal amino acid sequence of kabutocin B. <400> 10 RTTNGGNCCY TGYTGYTCNA C 21 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Designed DNA for amplification of a part of kabutocin B cDNA by 3'RACE. <400> 11 GATGCCCGCT TCACAGTTA 19 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Designed DNA corresponds to a part of the NotI- (dT18) primer. <400> 12 AACTGGAAGA AATTCGCGGC 20 <210> 13 <211> 18 <212> DNA < 213> Artificial Sequence <220> <223> Designed DNA for amplification of ap art of kabutocin B cDNA in the 1st step of 5'RACE. <400> 13 CCACCTATAA GTTCCACC 18 <210> 14 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Designed DNA for amplification of a part of kabutocin B cDNA in the 2nd step of 5'RACE. <400> 14 AACGCTCCAA TTCGGTTTGC TTTTT 25 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Designed DNA for amplification of the full length of kabutocin B cDNA. <400> 15 GAGACGAAAT TGTATCGCTC 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Designed DNA for amplification of the full length of kabutocin A cDNA <400> 16 GAGACGAAAT CGTATCGTTC 20

────────────────────────────────────────────────── ───

[Procedure amendment]

[Submission date] August 11, 1998 (1998.
1)

[Procedure amendment 1]

[Document name to be amended] Statement

[Correction target item name] 0063

[Correction method] Change

[Correction contents]

[0063]

[Sequence List] SEQUENCE LISTING <110> National Institute of Sericultural and Entomological Science Noda Institute for Scientific Research <120> Novel peptides, antimicrobiol agents, novel peptide genes, novel recombinant DNAs and a process for producing novel peptides <130> SP221 <160 > 16 <210> 1 <211> 72 <212> PRT <213> Allomyrina dichotoma <400> 1 Ser Leu Gln Pro Gly Ala Pro Asn Phe Pro Leu Pro Gly Ser Gln Leu 1 5 10 15 Pro Thr Ser Ile Thr Ser Asn Val Glu Arg Gln Gly Pro Asn Thr Ala 20 25 30 Ala Thr Ile Asn Ala Gln His Lys Thr Asp Arg Tyr Asp Val Gly Ala 35 40 45 Thr Trp Ser Lys Val Ile Arg Gly Pro Gly Lys Ser Lys Pro Asn Trp 50 55 60 Ser Val Gly Gly Thr Tyr Arg Trp 65 70 <210> 2 <211> 72 <212> PRT <213> Allomyrina dichotoma <400> 2 Ser Leu Gln Pro Gly Ala Pro Asn Phe Pro Met Pro Gly Ser Gln Leu 1 5 10 15 Pro Thr Ser Ile Thr Ser Asn Val Glu Gln Gln Gly Pro Asn Thr Ala 20 25 30 Ala Thr Ile Asn Ala G ln His Lys Thr Asp Arg Tyr Asp Val Gly Ala 35 40 45 Thr Trp Ser Lys Val Ile Arg Gly Pro Gly Lys Ser Lys Pro Asn Trp 50 55 60 Ser Val Gly Gly Thr Tyr Arg Trp 65 70 <210> 3 <211> 44 <212> PRT <213> Allomyrina dichotoma <400> 3 Ser Leu Gln Pro Gly Ala Pro Asn Phe Pro Leu Pro Gly Ser Gln Leu 1 5 10 15 Pro Thr Ser Ile Thr Ser Asn Val Glu Arg Gln Gly Pro Asn Thr Ala 20 25 30 Ala Thr Ile Asn Ala Gln His Lys Thr Asp Arg Tyr 35 40 <210> 4 <211> 30 <212> PRT <213> Allomyrina dichotoma <400> 4 Ser Leu Gln Pro Gly Ala Pro Asn Phe Pro Met Pro Gly Ser Gln Leu 1 5 10 15 Pro Thr Ser Ile Thr Ser Asn Val Glu Gln Gln Gly Pro Asn 20 25 30 <210> 5 <211> 12 <212> PRT <213> Allomyrina dichotoma <400> 5 Thr Asp Arg Tyr Asp Val Gly Ala Thr Trp Ser Lys 1 5 10 <210> 6 <211> 10 <212> PRT <213> Allomyrina dichotoma <400> 6 Pro Asn Trp Ser Val Gly Gly Thr Tyr Arg 1 5 10 <210> 7 < 211> 591 <212> DNA <213> Allomyrina dichot oma <400> 7 gagacgaaat tgtatcgctc aactgaaaac atattggtgt atatctcgcc 50 taatagttaa atcttcaact acgatttaaa g atg atg aaa ctc tac 96 Met Met Lys Leu Tyr -70 gtt atc ttt ggt ctt att gta ctt tctg gct ctt tctg gtt Ile Val Leu Ser Thr Ala Tyr Val Val Pro Glu -65 -60 -55 cgt tac ttt cag cct ata tat cct gat act gcg gcg gtg cat gcc ttc 192 Arg Tyr Pyr Ghe Pro Ile Tyr Pro Asp Thr Ala Ala Val His Ala Phe -50 -45 -40 aga gac gag cct ttc acg gtg aca cct gcc gaa ttg cgc tca tat cta 240 Arg Asp Glu Pro Phe Thr Val Thr Pro Ala Glu Leu Arg Ser Tyr Leu -35 -30 -25 -20 -20 ggt atc acc gat gaa gat gaa ata gaa atg ccg gta gtt tat aat cgt 288 Gly Ile Thr Asp Glu Asp Glu Ile Glu Met Pro Val Val Tyr Asn Arg -15 -10 -5 gaa agg agg tcc tta cag cca ggt gca cct aat ttc ccg atg ccc ggt 336 Glu Arg Arg Ser Leu Gln Pro Gly Ala Pro Asn Phe Pro Met Pro Gly -1 1 5 10 tca cag tta cct acc agc atc acc tct aat gtt gaa caa cag ggg cca 384 Ser Gln Leu Pro Thr Ser Ile Thr Ser Asn Val Glu Gln Gln Gly Pro 15 20 25 aat act gca gcc act atc aat gcc caa cat aaa act gat agg tac gac 432 Asn Thr Ala Ala Thr Ile Asn Ala Gln His Lys Thr Asp Arg Tyr Asp 30 35 40 45 gtt gga gcc acc tgg agc aag gtc att cgc gga cca gga aaa agc aaa 480 Val Gly Ala Thr Trp Ser Lys Val Ile Arg Gly Pro Gly Lys Ser Lys 50 55 60 ccg aat tgg agc gtt ggt gga act tat agg tgg taacacctgt atttc 528 Pro Asn Trp Ser Val Gly Gly Thr Tyr Arg Trp 65 70 gttatttttg taaaatattt tttgatataa attaaatttt gttcgcaaaa 578 aaaaaaaaaa aaa 591 〈210〉 8 〈211〉 596 〈212〉 DNA 〈213〉 Allomyrina dichotoma 〈400〉 8 gagacgaaat cgtatcctatcaggacta gatcgactat atcgacta cctatcct atcgacta gcatact 96 Met Met Lys Leu Tyr -70 att att ttc ggt ctt att gca ctt tct act gct tat gcg gtt cca gaa 144 Ile Ile Phe Gly Leu Ile Ala Leu Ser Thr Ala Tyr Ala Val Pro Glu -65 -60 -55 cgc tac ttc cag cct cca tat cct gat act gcg gcc gtg cat gcc tac 192 Arg Tyr Phe Gln Pro Pro Tyr Pro Asp Thr Ala Ala Val His Ala Tyr -50- 45 -40 aga gac gag cct ttc acg gtt aca cct acc gaa ttc cgc tcc tat cta 240 Arg Asp Glu Pro Phe Thr Val Thr Pro Thr Glu Phe Arg Ser Tyr Leu -35 -30 -25 -20 ggt atc acc gat gaa gat gaa ata gaa atg ccg gta gtt tat att cgc 288 Gly Ile Thr Asp Glu Asp Glu Ile Glu Met Pro Val Val Tyr Ile Arg -15 -10 -5 gaa agg agg tcc tta cag cca ggt gca cct aat ttc ccg ctg ccc ggt Glu Arg Arg Ser Leu Gln Pro Gly Ala Pro Asn Phe Pro Leu Pro Gly -1 1 5 10 tca cag tta cct acc agc atc acc tct aat gtt gaa cga cag ggg cca 384 Ser Gln Leu Pro Thr Ser Ile Thr Ser Asn Val Glu Arg Gln Gly Pro 15 20 25 aat act gca gcc act atc aat gcc caa cat aaa act gat agg tac gat 432 Asn Thr Ala Ala Thr Ile Asn Ala Gln His Lys Thr Asp Arg Tyr Asp 30 35 40 45 gtt gga gcc acc tgg agc aag gtc att cgc gga cca gga aaa agc aaa 480 Val Gly Ala Thr Trp Ser Lys Val Ile Arg Gly Pro Gly Lys Ser Lys 50 55 60 ccg aat tgg agc gtt ggt gga act tat agg tgg taacacctgt atttc 528 Pro Asn Trp Ser Val Gly Gly Thr Tyr Arg Trp 65 70 gttatttttg taaaatat tt tttgatataa attaaatttt gttcgcaaaa 578 aaaaaaaaaa aaaaaaaa 596 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Designed DNA degenerated from N-terminal amino acid sequence of kabutocin B. <400> 9 carccnggng cnccnaaytty 21 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Designed DNA degenerated from N-terminal amino acid sequence of kabutocin B. <400> 10 rttnggnccy tgytgytcna c 21 <210 > 11 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Designed DNA for amplification of a part of kabutocin B cDNA by 3'RACE. <400> 11 gatgcccgct tcacagtta 19 <210> 12 <211 > 20 <212> DNA <213> Artificial Sequence <220> <223> Designed DNA corresponds to a part of the NotI- (dT18) primer. <400> 12 aactggaaga aattcgcggc 20 <210> 13 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Designed DNA for amplification of a part of ka butocin B cDNA in the 1st step of 5'RACE. <400> 13 ccacctataa gttccacc 18 <210> 14 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Designed DNA for amplification of a part of kabutocin B cDNA in the 2nd step of 5'RACE. <400> 14 aacgctccaa ttcggtttgc ttttt 25 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Designed DNA for amplification of the full length of kabutocin B cDNA. <400> 15 gagacgaaat tgtatcgctc 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Designed DNA for amplification of the full length of kabutocin A cDNA. 400> 16 gagacgaaat cgtatcgttc 20

Continuing from the front page (72) Inventor Seiichi Hara 399 Noda, Noda-shi, Chiba F-term (Reference) in Noda Institute of Industrial Science 4B024 AA01 AA05 BA67 BA80 CA04 CA06 EA04 GA11 HA01 4C084 AA02 AA06 AA07 BA01 BA20 CA49 CA53 DA42 MA22 MA35 MA37 MA43 MA52 ZB352 4H011 AA02 4H045 AA10 AA20 AA30 BA21 CA51 EA29 FA71 FA74 GA15 GA22 GA25

Claims (9)

[Claims] 1. A novel peptide of the following (a) or (b): (A) a peptide consisting of the amino acid sequence of SEQ ID NO: 1; (B) a peptide comprising an amino acid sequence in which one or more amino acids have been added, deleted or substituted in the amino acid sequence of SEQ ID NO: 1, and having an antibacterial activity; 2. An antibacterial agent comprising the peptide according to claim 1 as an active ingredient. 3. An anti-Escherichia coli agent comprising the peptide according to claim 1 as an active ingredient. 4. A novel peptide of the following (a) or (b): (A) a peptide consisting of the amino acid sequence of SEQ ID NO: 2; (B) a peptide comprising an amino acid sequence in which one or more amino acids have been added, deleted or substituted in the amino acid sequence of SEQ ID NO: 2, and having an antibacterial activity; 5. An antibacterial agent comprising the peptide according to claim 4 as an active ingredient. 6. An anti-Staphylococcus aureus agent comprising the peptide according to claim 4 as an active ingredient. A gene encoding the novel peptide according to claim 1 or 4. 8. A novel recombinant DNA obtained by inserting the peptide gene according to claim 7 into a vector DNA. 9. A method for producing a peptide, comprising obtaining the peptide according to claim 1 from a beetle larva.