JPH11178577A - Norcoclaurine 6-o-methyltransferase and enzyme gene thereof - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain the subject new enzyme containing a specific amino acid sequence, having an enzyme activity of norcoclaurine 6-O-methyltransferase and useful for the production, etc., of various alkaloids derived from coclaurine or reticulin. SOLUTION: This new polypeptide contains an amino acid sequence described in the formula or an amino acid sequence in which one or more amino acids are added, deleted or replaced in the amino acid sequence and having an enzyme activity of norcoclaurine 6-O-methyltransferase(6-OMT) and is useful for the efficient production, etc., of coclaurine, reticulin and/or various alkaloids which are plant secondary metabolites biosynthesized from the compounds. The enzyme is obtained by preparing a DNA probe based on an internal amino acid sequence of the 6-OMT isolated from a cultured cell of Coptis japonica Makino, searching for a DNA library derived from a cultured cell of the Coptis japonica Makino using the prepared DNA probe, integrating the resultant gene into a vector and expressing the gene in a host cell.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to norcoclaurin 6-O-methyltransferase (hereinafter abbreviated as "6-OMT") which is a cocrawlin biosynthetic enzyme, a DNA encoding the enzyme, and a DNA encoding the enzyme. Using the transformed microorganisms and plants, and the plants or their cultured cells and / or tissues, cocouraurin, reticulin and / or
Alternatively, the present invention relates to a method for producing various alkaloids biosynthesized from these compounds.

[0002]

BACKGROUND OF THE INVENTION Berberine is a kind of secondary metabolite of a plant classified as an isoquinoline alkaloid, and is a plant of the family Ranunculaceae ( Coptis japonica Makino var. Di.
ssecta (Yatabe) Nakai) and Japanese larch ( Thalictrum mi
nus var. hypolencum), yellow citrus ( Phelloden)
dron amurense Rupr), Barberry ( Berber)
is wilsoniae ) and is used as a local pharmaceutical. At present, berberine is produced by extraction from berberine-containing plant natural products such as the above plant species, and an industrial production method using cultured cells of the plant is being studied [K. Matsubara e
t al., J. Chem. Tech. Biotechnol. 46, 61-69 (198
9)].

[0003] Berberine is the first alkaloid whose biosynthetic pathway has been elucidated at the enzyme level, and tyrosine 2
Using (S) -norcoclaurine as a precursor for the molecule 13
It is biosynthesized by the enzymatic reaction in a step (FIG. 1). As shown in FIG. 1, berberine is biosynthesized by a 13-step enzymatic reaction using tyrosine as a precursor. The enzymes that catalyze the reactions at each of these steps have been identified, and enzymatic chemistry has been energetically studied [H.
M. Schumacher et al., Plant Med. 48, 212-220 (198
3); M. Ruffer et al., Plant Med. 49, 131-137 (198
3); F. Sato etal., Phytochemistry 32, 659-664 (199
3); N. Okada et al, Phytochemistry 27, 979-982 (19
93)].

6-OMT, which catalyzes the first methylation reaction of berberine biosynthesis, uses S-adenosyl-L-methionine (hereinafter abbreviated as "SAM") as a methyl group donor at the 6-position of norcoclaurine. It is an enzyme that methylates hydroxyl groups to produce coclaurine. The enzymatic properties of this enzyme have also been investigated [F. Sato et al., Eur. J. Biochem. 22
5, 125-131 (1994)], a previously reported enzyme that catalyzes a similar reaction,
(S) -3′-hydroxy-N-methylcoclaurine 4′-O-methyltransferase (hereinafter abbreviated as “4′-OMT”) [T.
Frenzel and MH Zenk, Phytochemistry 29, 3505-3
511 (1990)] and (S) -scorelin 9-O-methyltransferase (hereinafter abbreviated as "SMT") [F. Sato et al.,
Phytochemistry 32, 659-664 (1993)] and a comparison of the properties thereof, showed a large difference in the substrate specificity (FIG. 2), revealing that they have extremely unique properties. However, there has been no research to elucidate the amino acid sequence of 6-OMT and the DNA encoding the amino acid sequence.

[0005]

DISCLOSURE OF THE INVENTION The present invention efficiently produces 6-OMT which can be used as an industrial enzyme by incorporating DNA encoding 6-OMT into a microorganism or a plant cell in a sense or antisense form. To produce a specific compound efficiently by modifying the metabolism of a host cell. An object of the present invention is to modify the metabolism of a host cell to modify the production ratio of a specific compound group.

[0006]

Means for Solving the Problems As a result of earnest studies, the present inventors have prepared a DNA probe based on the result of the internal amino acid sequence of 6-OMT isolated from cultured cells of spinach, and used this probe to prepare a DNA probe. The target DNA was successfully isolated from a cDNA library derived from cultured spinach cells. Then this DNA
Was inserted into a vector and then introduced into Escherichia coli to express a large amount of a protein derived from the DNA. Examination of the enzymatic properties of this protein revealed the same reaction as 6-OMT isolated from cultured spinach cells, that is, the production of coclaurine from norcoclaurin. Was confirmed.

[0007] That is, the present invention includes the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence in which one or more amino acids have been added, deleted or substituted in said amino acid sequence, and which comprises norcocrawlin 6-O- Provided is a polypeptide having a methyltransferase enzymatic activity. This polypeptide may be norcoclaurin 6-O-methyltransferase comprising the amino acid sequence set forth in SEQ ID NO: 1. The present invention also provides a DNA encoding the polypeptide. This DNA may encode a polypeptide comprising the amino acid sequence of SEQ ID NO: 1. The present invention also relates to a DNA comprising the nucleotide sequence of SEQ ID NO: 2, and a DNA comprising the nucleotide sequence of SEQ ID NO: 2, which hybridizes under stringent conditions, and comprises norcoclaurin 6-O-methyl. A DNA encoding a polypeptide having the enzyme activity of transferase is provided. Further, the present invention provides a vector containing the above-mentioned DNA. This vector is used to transfer norcoclaurin in microbial and / or plant cells.
It is preferable that the polypeptide be capable of expressing a polypeptide having the enzyme activity of 6-O-methyltransferase.
Furthermore, the present invention provides a microorganism transformed with the above-described vector, and a method for producing a polypeptide having the enzyme activity of norcoclaurin 6-O-methyltransferase using the transformed microorganism. Further, the present invention produces a plant secondary metabolite using a plant cell, plant tissue or plant transformed with the vector, and the transformed plant, or a cultured cell and / or tissue of the plant. Provide a way. The secondary plant metabolite may be an alkaloid biosynthesized from coclaurine or reticulin. The alkaloid may be a berberine alkaloid, a morphine alkaloid or a papaverine alkaloid. The transformed plant is preferably a plant of the genus Ouren or a plant of the genus Poppy.

Hereinafter, the present invention will be described in detail. The present inventors determined the 6-OMT enzymatic activity (production of 6-O-methyllaudanosoline from norlaudanosoline and S-adenosylmethionine) from cultured berberine-producing celibaouren cells as an indicator. -OMT was isolated and purified, and a DNA probe was prepared based on the internal amino acid sequence of this polypeptide. Next, a cDNA library was prepared from the cultured cells of Seriubauren, and a phage containing the full-length DNA encoding 6-OMT was obtained from plaques positive with the probe. When the target DNA isolated from the phage DNA was subcloned into Escherichia coli and then expressed, the obtained polypeptide exhibited the enzyme activity of 6-OMT. 6-O
It was confirmed that the DNA encodes MT and 6-OMT.

[0009] The present inventors have developed 6-OMT from cultured cells of spinach, one of berberine-type alkaloid producing plants.
And a gene whose gene has been isolated but has a reaction of converting norcoclaurin to coclaurin using SAM as a methyl group donor, contains substantially the same enzyme and DNA as the 6-OMT of the present invention. Therefore, the enzyme and DNA substantially identical to the 6-OMT of the present invention can be isolated from those plants using the method described herein. Plants having a reaction of converting norcoclaurine to coclaurine as a SAM as a methyl donor include buttercup family Coptis genus plants such as ceribaouren,
Ranunculaceae Thalictrum genus plants such as Japanese larch, Rutaceae Phellodendron genus plants such as yellowfin, Barberry berberis genus plants such as barberry , Poppy family Papa such as poppy
Examples include plants of the genus ver .

[0010] In the present invention, 6-OMT isolated from cultured cells of spinach has the amino acid sequence shown in SEQ ID NO: 1. However, the 6-OMT of the present invention itself substantially comprises One or more amino acids may be added, deleted or substituted in the amino acid sequence of SEQ ID NO: 1 as long as it has a function equivalent to that of 6-OMT derived from Ouren cells. It is well known that the physiological activity such as the enzymatic function of a protein may not be changed by addition, deletion or substitution of one or more amino acids of its constituent amino acids. Methods for inducing various amino acid changes have also been reported [Nuc
leic Acids Res., 10, 6487-6500 (1982)].

[0011] In addition, as for the nucleotide sequence, one or more bases may be added to the nucleotide sequence of SEQ ID NO: 2 as long as it encodes an enzyme protein having substantially the same function as 6-OMT derived from Ouren cells. May be deleted or substituted. As DNA encoding such an enzyme protein having substantially the same function as 6-OMT derived from a spinach cell, a DNA that hybridizes under stringent conditions with a DNA containing the nucleotide sequence described in SEQ ID NO: 2 And DNA encoding a polypeptide having the enzyme activity of -OMT. Here, as a hybridization method, Denhart's
Solution [J. Sambrook, EF Fritsch, T. Ma
niatis, Molecular Cloning: A Laboratory Manual 2nd
ed. ColdSpring Harbor Laboratory]. Specifically, 6 × SSC, 5 × Denhardt's, 0.1%
SDS, 100 μg / ml denatured salmon sperm DNA, 20 mM NaH ₂ PO ₄ (PH
7.5) After subjected to prehybridization at least 2 hours at 42 ° C. in a solution, ³² P labeled DNA probe solution was added and further incubated overnight, then, 6 × at room temperature
After washing with an SSC solution and then with a 6 × SSC, 0.1% SDS solution at 50 ° C., autoradiography can be exemplified.

Examples of the vector that can be used in the present invention include vectors conventionally used for transforming microorganisms and / or plant cells, and include a DNA encoding 6-OMT that satisfies the above-mentioned conditions. In addition, to use a conventionally known constitutive expression type or expression control type promoter for expressing the DNA, a drug resistance gene which facilitates selection of transformants, and an Agrobacterium binary vector system. And the starting point of replication.

Examples of basic vectors include pBluescript IISK- vector and pET vector for introduction into microorganisms such as Escherichia coli, and pBI101 and pBI101 as suitable for introduction with Agrobacterium for introduction into plant cells. pBI1
21 and the like. When introducing into a plant cell using the electroporation method, the vector is not particularly limited. Examples of the drug resistance gene DNA include an ampicillin resistance gene, a kanamycin resistance gene, a hygromycin resistance gene, and the like.
Examples include the 35S promoter (constant expression type) and the promoter of heat shock induction protein (expression control type). Examples of the replication origin include a replication origin derived from a Ti or Ri plasmid.

The DNA encoding the 6-OMT of the present invention can be introduced into a microorganism to express a large amount of the 6-OMT protein. As a microorganism that introduces DNA encoding 6-OMT,
Examples include bacteria such as E. coli and viruses such as baculovirus. The most common method for introducing foreign DNA into Escherichia coli, the most common host, is to use a heat shock method or electroporation method to transfer the foreign DNA into competent cells prepared by the calcium chloride method or the like.
There is a method of incorporating a plasmid into which DNA has been incorporated. Even if the target is a host other than Escherichia coli, a DNA transfer method similar in principle to the above can be used.

The microorganism transformed in this manner is
It can be grown by a conventionally known method, and a desired 6-OMT polypeptide can be extracted and separated from the obtained cells. In addition, it is also possible to add a specific substrate to the transformed microorganism during the cultivation, cause an O-methylation reaction, and recover the enzyme reaction product from the culture.

The DNA encoding 6-OMT of the present invention may be used for the purpose of improving the productivity of a specific compound or modifying the production ratio of a specific compound group by modifying the metabolism of a host cell. It can be incorporated into plants in the form of a sense. As a plant incorporating DNA encoding 6-OMT, SA
Any plant that has a reaction of converting norcoclaurine to coclaurine using M as a methyl group donor can be used, but among others, buttercup family Copt such as ceribaouren
It is a plant of the genus, Ranunculaceae Thalictrum such as Akikaramatsu
Genus plant, Phellodendron genus plant such as Rutaceae,
Examples include plants of the genus Barberis belonging to the genus Barberis, such as barberry, and plants of the genus Papaver, such as poppy.

Examples of a method for introducing the DNA into a plant cell include a conventionally known method such as an Agrobacterium method or an electroporation method, in which the DNA is incorporated into a vector comprising the above-mentioned components. In the Agrobacterium method, from a plant to be transformed, a section such as a sterilized leaf is created, and the DNA is transfected in a binary form with Agrobacterium tumefaciens or Agrobacterium rhizogenes. The DNA can be incorporated into plant cells. Thereafter, the Agrobacterium attached to the plant section is washed and sterilized, and the plant section is cultured in a medium containing an antibiotic corresponding to the drug resistance marker incorporated in the vector together with the DNA, and transformation occurs. From these cells, it is possible to selectively grow transformed tissues such as tumor tissues, roots and shoots.

In the electroporation method,
From a plant to be transformed, sterilized leaves, stems, roots, embryos, or cultured cells are prepared, and appropriate fine particles such as gold particles coated with a vector incorporating the DNA are prepared using a particle gun or the like. It can be driven into cells. Thereafter, as in the case of the Agrobacterium method, the plant section was cultured in a medium containing an antibiotic corresponding to the drug resistance marker incorporated in the vector, and cells were selectively transformed from the transformed cells. The growth of the transformed tissue or cells can be achieved.

From the thus-obtained transformed plant tissue, a plant individual can be regenerated by a conventionally known plant tissue culture method, and can be cultivated in a field or the like. Also, the transformed plant cells can be grown in a liquid medium or the like, like ordinary plant culture cells, so that they can be cultured in large quantities in tanks or the like. The obtained transformed plant or cell can be subjected to extraction of an active ingredient with an organic solvent or the like, similarly to a normal plant or cell.

Further, as shown in FIG. 2, 6-OMT of the present invention can be used in addition to norcoclaurin, norlaudanosoline and
Since a structurally similar compound such as 6-O-methyllaudanosoline can also be methylated, the method of the present invention can be applied to any plant other than the above-mentioned plant species, if the plant contains these norcoclaurine structurally similar compounds. Can be applied.
As a result of enzymatic studies, it has been revealed that 6-OMT according to the present invention has the following basic properties.

─────────────────────────────────── Molecular weight: 40,000 (SDS / PAGE) Isoelectric point: 4.7 (Mono-P) optimum pH: 9.0 K _m value: 3.95 mM (S- adenosyl -L- methionine) 2.23 mM ((R, S ) - nor Lauda Bruno Solin) K _i values: 2.1 mM (S- adenosyl -L- methionine) 0.18 mM ((R, S ) - nor Lauda Bruno Solin) (K _i values are both S- adenosyl -L- against homocysteine) ^{inhibitors: Ni 2+, Co 2+, Cu} 2 ⁺ , Zn ²⁺ , Fe ²⁺ , Mn ²⁺ Reaction mechanism: Bi-bi Ping-Pong reaction ─────────────────────────── ────────

[0022]

EXAMPLES Hereinafter, the present invention will be described more specifically with reference to Examples, but the scope of the present invention is not limited to these Examples. Example 1 Preparation of 6-OMT Purified Fraction First, berberine-producing cultured cells were derived from seribaouren as follows.

[0023] The leaves and petiole of the squirrel spinach are sterilized with a 70% ethanol and antiformin solution, and then cut into slices. A rinse medium Skoog agar medium containing 10 ^-5 Mα-naphthaleneacetic acid and 10 ^-8 M6-benzyladenine is prepared. And cultured in the dark at 25 ° C. About three weeks after the start of the culture, yellow calli generated at the cut end of the section were collected, transplanted to the same agar medium as described above, and further grown. The callus thus obtained was suspended in a liquid medium having the same composition as described above, and cultured at 25 ° C in the dark in the same manner as described above, with shaking at 100 rpm using a rotary rotary shaker, to obtain a suspension.
The transplant was repeated every three weeks.

The obtained liquid culture cells have a diameter of several tens μm.
Since the cells consist of cell clusters of a few mm in diameter, a berberine high-producing strain was selected using these cell clusters as a unit. That is,
A part of the cell mass was uniformly spread on the agar medium and cultured, and colonies were grown from each cell mass. The obtained colonies were individually grown on the same agar medium, while the content of berberine was measured using liquid chromatography, and those with a high content were selected as high-producing cells, and this strain was used as a new parent strain. , And the selection by the above operation was repeated to obtain a high production strain.

The berberine-producing cultured cells were subcultured every three weeks in a Linsmeyer-Skoog liquid medium containing 10 μM α-naphthaleneacetic acid and 0.01 μM 6-benzyladenine, and then subcultured every three weeks. J. Biochem. 225,
125-131 (1994)]. Briefly, cultured spinach cells were ground under ice-cooling, and 10 mM dithiothreitol, 1 mM EDTA and 10 mM
0.1 M sodium phosphate buffer containing 5% glycerol (pH
8.0), and the enzyme was extracted. The suspension was filtered through cheesecloth and the filtrate was centrifuged at 5000 xg for 30 minutes.
The resulting supernatant was precipitated with 20-75% saturated ammonium sulfate, desalted by dialysis, alkaloids were removed by SP-toyopearl 650C column, Q-Sepharose FF column chromatography (Pharmacia) using enzyme activity as an index, and then Bio-Gel HTP (Bi
oRad) Separated by column chromatography, concentrated by ultrafiltration, chromatofocusing with Mono-P column, and reversed phase chromatography. The above operations were all performed at 0 to 5 ° C.

FIG. 3 shows how the purity is improved during the enzyme purification process.
The results are shown by SDS-PAGE. The 6-OMT purified enzyme preparation thus obtained contained two peptides of 40 kDa and 41 kDa, as shown also in the results of SDS-PAGE in FIG. We tried amino acid sequence analysis of the amino terminus of both peptides,
We couldn't get any superior information because we were blocked. Therefore, for the purpose of analyzing the internal amino acid sequences of both peptides, both peptides were purified by reverse phase chromatography using the purified enzyme solution after Mono-P as a sample under the following conditions.

─────────────────────────────── HPLC: LKB2150 (LKB) Column: YMC-Pack ODS-AP303 ( Detection: UV 210 nm Flow rate: 0.8 ml / min Mobile phase: A: 0.1% TFA in H ₂ O, B: 70% AcCN, 0.1% TFA A / B 32/68 → 29 / 71 ───────────────────────────────

Each fraction collected was confirmed by SDS / PAGE as shown in FIG. As a result, 40 kDa and
The 41 kDa peptide both further separated into two peaks. The molecular weight of the peptide at each peak was determined by SDS-PAGE.
As a result, it was found that the peptide molecular weights of the peaks indicated by 40A and 40B were all 40 kDa, and the peptide molecular weights indicated by 41A and 41B were all 41 kDa. FIG. 5 shows the peptide map obtained when the 40 kDa peptide was treated with Achromobacter Protease I and the obtained internal amino acid sequence. Although the amino acid sequence of the peak 1 in FIG. 5 could not be analyzed,
And 40B were found to match.

Example 2 The 40-kDa peptide and the 41-kDa peptide of the 6-OMT purified fraction
Peptide Mapping and Analysis of Internal Amino Acid Sequence After solidifying the peptide solution collected by the above-described reverse phase chromatography using Speed Vac, 100 μl of a 10% SDS solution was added thereto, and ultrasonic treatment was performed to dissolve the peptide. SDS
After dilution to a concentration of 0.1% or less, centricon 30
(Amicon) to concentrate to about 50 μl. 5 of them
μl was used to confirm peptide recovery by SDS-PAGE. Check that the pH of the remaining solution is around neutral, and use protease solution (Residue-specific Protease Kit,
(Company a) 100 μl was added and reacted at 37 ° C. for 16 hours. 80%
The reaction was stopped by adding 5 μl of formic acid and centrifuged at 15,000 rpm for 5 minutes, and the supernatant was separated by reverse phase chromatography. About the two peptides 41A and 41B, about 30 μg of each sample was hydrolyzed with Achromobacter Protease I, which specifically recognizes and cuts lysine residues.
Staphylococcus aureus V8 Protease, which specifically recognizes and cleaves glutamic acid residues, and 40-kDa peptide, Trypsin, which specifically recognizes and cleaves arginine or lysine residues
Was used to hydrolyze about 50 μg of each peptide. The elution conditions for the reverse phase chromatography were the same as those for the purification of two peptides in the 6-OMT purified fraction, and the linear concentration gradient (A /
B 80/20 → 20/80). Fragments with insufficient separation were again separated by reverse phase chromatography with a gentler linear gradient (A / B 85/15 → 50/50) than the previous conditions. The peptide solution obtained here was concentrated to about 100 μl using Speed Vac, and the amino acid sequence was analyzed using a gas phase protein sequencer (Model 477A, Applied Biosystems).

Since 40A and 40B, and 41A and 41B have very similar reverse phase chromatography profiles, and the amino acid sequences of the corresponding peptide fragments were identical, 40A and 40B and 41A and 41B were identical. Was found to have been separated by chance during reverse phase chromatography (FIGS. 6 and 7).
From the peptide fragments obtained in this manner, a sequence of about 100 amino acids was finally obtained for the 41 kDa peptide.
For the 0 kDa peptide, a sequence of about 80 amino acids was analyzed.

[Example 3] Oligonucleotides for cDNA cloning of 6-OMT The subsequent procedures were performed according to the method of Sambrook [J.
Sambrook et al., Molecular Cloning; A Laboratory
Manual 2nd ed., Ed. Cold Spring Harbar laboratory]
Followed. Since the analysis results of the internal amino acid sequence were sufficient for the preparation of an oligonucleotide probe for screening the two peptides contained in the purified fractions of 6-OMT and 4'-OMT, the results were obtained from the cultured rice culture cells. 40 kDa and 41 kDa using the cDNA library
Peptide cDNA screening was performed. This cDNA
The library uses the ZAP-cDNA® Synthesis Kit
(Stratagene), and cDNA is Uni-
Introduced in ZAP XR vector. Also, Uni-ZAP XR ve
ctor contains the entire nucleotide sequence of pBluescript II SK-, before and after which the signal of the replication origin and termination is integrated. In addition, there is also a signal for circularizing and packaging the replicated DNA, so that E. coli contains Uni-ZAP XR v
By simultaneously infecting ector and f1 phage, subcloning from a phage vector to a plasmid vector is enabled. Based on the amino acid sequence analysis results, oligonucleotide probes were designed to include all possible sequences encoding the amino acid sequence,
Two types of probes were used for each of the kDa peptide and the 41 kDa peptide, respectively, using a DNA synthesizer (Model 381A, Applied
Biosystems) (FIG. 8).

[Example 4] Labeling of 5'-end of oligonucleotide probe The following reaction solution was prepared, incubated at 37 ° C for 1 hour, and subjected to paper chromatography (filter paper: DE81 (What
After confirming that the incorporation rate of ³² P was 50% or more using a developing solution (manufactured by Mann Co., Ltd., 2.3% ammonium formate), it was used for hybridization.

合成 Synthetic oligonucleotide (10 pmol / (l) 1 μl 10x kinase buffer ^* 1 μl [γ- ³² P] ATP aqueous solution 5 μl T4 polynucleotide kinase (10 units / μl, NEB) 1 μl * 700 mM Tris / HCl (pH 7.6), 10 mM MgCl ₂ , 5 mM DTT ─── ─────────────────────────────

Example 5 Screening of 6-OMT Primary screening was performed using a cDNA library (library size: 300,000) of the above-mentioned cultured spinach cells once amplified. 40 kDa for probe
Peptide probe 1, 41 kDa peptide probe 1 was used until tertiary screening. Place a nitrocellulose filter on the surface of NZYM top agarose, punch out three asymmetrical positions on the filter with a needle with blue ink first, and transfer DNA to filter paper soaked with denaturing solution (0.5 N NaOH, 1.5 M NaCl) It was put on it so that the surface that was made to face up was left for 5 minutes. Next, neutralization solution (1.5 M NaCl, 0.5 M Tris / HCl
(pH 8.0)) and baked in an oven at 80 ° C. for 2 hours to fix the DNA on the filter. Put this filter in a hybridization bag, and mix the prehybridization solution (6xSSC, 5xDenhardts, 0.1% SDS, 100 μg / ml
Denatured salmon sperm DNA, 20 mM NaH ₂ PO ₄ (pH 7.5))
Air bubbles were removed as much as possible and sealed. After incubating at 42 ° C. for 2 hours or more, a probe solution was added, and the mixture was further incubated overnight to perform hybridization. After hybridization is complete, the filters are first
2x with 6xSSC solution, then 2x with 6xSSC-0.1% SDS solution at 50 ° C
Washed twice. Excess water in the filter was removed with a paper towel, and the filter was exposed overnight by autoradiography. Two filters were prepared for each plate, and a signal whose signal position matched the two filters was defined as a positive signal. The top agarose at the position where the signal was emitted was punched out with a blue chip whose tip was cut off, and collected in a 1.5 ml tube. 100 μl into this tube
l SM solution and 1 µl chloroform were added and vortexed to obtain a phage solution. 100 times dilution of this phage solution 1
Added 0μl E. coli solution of _{200μl (XLI-Blue OD 550 =} 2), and incubated at 37 ° C. 20 min, and kept at 50 ° C. 5
Added to mM NZYM top agarose and spread on NZYM plate. This plate was cultured at 37 ° C. overnight, and plaque formation was confirmed. Thereafter, the same procedure as in the above-described primary screening was performed up to the tertiary screening, and a positive clone was isolated. The 40 kDa peptide is approximately
70 positive signals were obtained, of which 26
Secondary screening was performed, and as a result of the tertiary screening, 18 positive clones were finally obtained. On the other hand, 41 kDa
For the peptide, 18 positive signals were obtained in the primary screening, and up to the third screening, 9 positive clones were isolated.

Example 6 Subcloning into a plasmid vector (in vivo ex
ision) In order to subclone the clone isolated in Example 5 from the phage vector into the plasmid vector, in vivo exision was performed as follows. Tertiary agar 500 [mu] l SM solution punched resulting plaques screened, vortexed adding 20μl of chloroform, Escherichia coli solution 200 [mu] l of which _{(XLI-Blue OD 550 = 2} ) 200 μl
And 1 μl R408 helper phage at 37 ° C
For 20 minutes. Next, add 3 tube contents
It was added to 2 ml of 2xYT medium and cultured with shaking at 37 ° C for 2.5 hours.
The resulting cultures are then incubated at 70 ° C. 20 min, a 50μl of the E. coli solution _{(XLI-Blue OD 550 = 2} ) 200
In addition to μl, 100 μl was plated.
The mixture was incubated at 37 ° C. overnight to obtain a colony having the plasmid subcloned into the pBluescript II SK-vector from the Uni-ZAP XR vector. In addition, insert cD
NA: pBluescript II SK-vector restriction enzymes Eco RI, Xho
I Inserted into site.

Example 7 In order to confirm whether the clone obtained by Southern hybridization in vivo exision was the desired one, plasmid DNA was purified.
The insert was cut out with a restriction enzyme and subjected to Southern hybridization using an oligonucleotide probe as follows. E. coli colonies obtained by in vivo exision are picked with a toothpick and LB (+ ampicilin 50
μg / ml), and cultured with shaking for 24 hours. After that, plasmid DNA was purified from the resulting Escherichia coli, and then the restriction enzyme Eco R
The insert was cut out by treating with I and XhoI, and subjected to 0.8% agarose electrophoresis. After photographing the DNA stained with ethidium bromide with a polaroid camera, the gel was immersed in a denaturing solution (0.5 M NaOH, 1.5 M NaCl) for 20 minutes, and then neutralized (0.
It was transferred to 5 M Tris / HCl (pH 7.0), 1.5 M NaCl, 1 mM EDTA) and gently shaken for 30 minutes. The gel was placed on a blotting table, and the DNA in the gel was capillary-transferred to a nylon membrane overnight. The nylon membrane is denatured (0.5 M NaOH, 1.5 M NaCl) for 1 minute and then neutralized (0.5 M Tris / HCl (pH 7.0), 1.5 M NaCl, 1 mM EDTA)
For 1 minute and finally in 2xSSC for 10 minutes. The resulting nylon membrane was baked in an oven at 80 ° C. for 2 hours to immobilize DNA, and then a 40 kDa peptide, 41 kD
Southern hybridization was performed for each of probe 1 and probe 2 for the a peptide. As a result, it was confirmed that the two types of probes hybridized to all the clones isolated by screening for both the 40 kDa peptide and the 41 kDa peptide. Therefore, the obtained clones were estimated to encode the 40 kDa peptide or the 41 kDa peptide, respectively.

Example 8 40 kDa peptide and 41 kDa contained in 6-OMT purified fraction
Expression of the peptide in E. coli 40 kDa peptide, to examine whether the 41 kDa peptide is 6-OMT, both peptides were expressed in E. coli,
The reactivity of the products was examined. (1) Examination of culture conditions and expression vectora.Expression of 40 kDa peptide and 41 kDa peptide in Escherichia coli using pBluescript II SK-vector cDNA of both peptides was introduced into pBluescript II SK-vector and inserted cDNA. Can be expressed as a fusion protein of β-galactosidase under the induction of IPTG (isopropyl-β-D (−)-thiogalactopyranoside). Among the clones obtained by the screening, three clones of the 40 kDa peptide were introduced in frame. On the other hand, since the 41 kDa peptide had a stop codon immediately upstream of the first methionine, none of the clones obtained by screening expressed the target protein. But,
Among the deletion clones used for the nucleotide sequence analysis, there was a clone containing the first methionine and introduced in frame, and the clone was used for the subsequent operations (FIG. 9). Hereinafter, the above operation will be described in detail.

Each clone contained 5 ml LB (+ ampicillin (50
μg / ml)) Put the cells in a culture medium with shaking at 37 ° C for 24 hours.
After inoculating LB (+ ampicillin (50 μg / ml))
_Incubate at 37 ° C with shaking so that ₆₀₀ = 0.4-0.8.
mM was added. Furthermore, at 37 ° C for 4 hours,
After shaking culture at 18 ° C for 10 hours and 10 ° C for 48 hours, 4 ° C,
Centrifuged at 3000 rpm for 15 minutes. All subsequent operations were performed at 4 ° C. 5 ml of extraction buffer (100 mM Tris / HC)
l (pH 7.5), 10 mM sodium ascorbate, 20 mM
β-mercaptoethanol) and suspend at 3000 rpm
Centrifuge for 15 minutes. After 1 ml of extraction buffer was added to the precipitate for resuspension, the cells were disrupted by sonication and centrifuged at 15,000 rpm for 15 minutes to obtain a supernatant as a crude protein extract. Using this solution, an enzyme reaction was performed under the following conditions. In determining the presence or absence of the activity, laudanosolin, norlaudanosolin and 6-O-methylnorlaudanosolin were used as substrates.

条件 Enzyme reaction conditions Substrate 2.5 mM SAM (S-adenosyl-L-methionine) 1 mM Sodium ascorbate 25 mM Ches / NaOH (pH 9.0) 300 mM enzyme solution 20 μl Total 50 μl HPLC analysis conditions Column: Nova-Pack C18 3.9 × 150 mm (Waters) Detection: UV 280 nm Flow rate: 1.0 ml / min Mobile phase: 10% acetonitrile + 1% acetic acid ─────────────────────────────

The 41 kDa peptide showed activity against laudanosolin and 6-O-methyllaudanosoline only when the culture condition was 10 ° C. for 48 hours, but showed activity against norlaudanosoline. The absence of the peptide suggested that the present peptide was 4′-OMT instead of 6-OMT. In addition, since the activity of the 40 kDa peptide was not observed under any culture conditions, expression was attempted using a pET system (Novagen). b. Expression of 40 kDa peptide and 41 kDa peptide in E. coli in the pET system In the pET system, the target gene is inserted downstream of the strong T7 phage promoter on the plasmid and T7 RNA supplied by the host E. coli.
Transcribed by polymerase. This T7 RNA polymerase gene is integrated into the host E. coli chromosome and
c Since it is downstream of the UV5 promoter, expression can be controlled by induction with IPTG addition. Hereinafter, an operation for examining the expression of the 40 kDa peptide and the 41 kDa peptide using the system will be described in detail.

For subcloning into a pET vector, a mutated primer into which a restriction enzyme site was newly introduced was synthesized (FIG. 10). 40 kDa peptide and 41 kDa peptide,
Two types were synthesized for each of pBluescript II SK-.
Initially, using Transformer 40-1 and 41-1
^In vivo mutagenesis was attempted using ^TM Site Directed Mutagenesis Kit (Clonteck).
Due to a malfunction that seems to be due to poor synthesis of K-1, PCR was performed using primers 40-2, 41-2 and M13 universal primer, and the amplified DNA fragment was converted to pET21d vector.
It was introduced into Bam HI and Xho I sites and expressed as a fusion protein with T7 gene 10 (FIG. 11). In FIG. 10, 40 kDa
Peptides were mentioned as an example, but the 41 kDa peptide was performed similarly. In this system, both peptides can be expressed as a fusion protein of T7 gene 10. In FIG. 10, the sequence derived from the vector is underlined. The PCR conditions are as follows.

─────────────────────────────────── PCR conditions Mutant primer 40-2 or 41-2 100 pmoles M13 universal primer 100 pmoles template DNA 0.5 μg Taq DNA polymerase (Pharmacia) 2.5 units 10 × buffer 10 μl mixture of 4 dNTPs 2.5 mM each 100 μl 90 ° C. 1 minute → 45 ° C. 2 minutes → 72 ° C. 3 minutes One cycle was performed and 30 cycles were performed. ───────────────────────────────────

The amplified DNA fragment and the pET21d vector were treated with restriction enzymes BamHI and XhoI, ligated, and transformed into E. coli BL21 cells by electroporation. The resulting colonies were randomly selected, the plasmid DNA was purified, and the restriction enzyme Bam H
Treated with I and Xho I. Clones successfully introduced by agarose electrophoresis were selected, cultured under the above conditions (at 10 ° C. for 48 hours), and the presence or absence of enzyme activity was examined. As a result, 41
The kDa peptide did not show activity and did not appear to be expressed. On the other hand, the 40 kDa peptide had a slight activity on laudanosolin and norlaudanosolin, indicating that it was 6-OMT.

(2) Expression of the 40-kDa peptide and the 41-kDa peptide of the 6-OMT purified fraction in Escherichia coli
Culture conditions were such that shaking culture was performed at 37 ° C. so that OD ₆₀₀ = 0.4-0.8, IPTG was added to 1 mM, and shaking culture was further performed at 10 ° C. for 48 hours. In addition, the expression vector,
The 40 kDa peptide was introduced into the pET vector (pE4
0) and the 41 kDa peptide used were those introduced into pBluescript II SK-vector (pBS41). As a control for pE40, a pET21d vector without an insert was used, and as a control for pBS41, a pBluescript II SK- vector without an insert was used.

The 40 kDa peptide produced a product having the same retention time as the purified 6-OMT (positive control) from norcoclaurin as a purified 6-OMT (positive control) of cultured spinach cells, that is, 6-OMT from the production of cocraurin. Was. In addition, the 41 kDa peptide was converted from 3-hydroxy-N-methylcoclaurin to 6-OMT (positive control
A product having the same retention time as l), that is, reticulin was produced, which revealed that it was 4'-OMT (FIG. 12).

[0046] For Example 9 shall insert in clones isolated by determining screening nucleotide sequence of the longest, was performed to determine the entire nucleotide sequence according to the following procedure. (1) Large-scale preparation of plasmid DNA Escherichia coli colonies were picked with a toothpick, placed in a 100 ml LB (+ ampicillin (50 μg / ml)) medium, and cultured with shaking overnight. Centrifuge at 3000 rpm for 15 minutes at room temperature. Add 4 ml TEG (T
ris / HCl (pH 8.0), 10 mM EDTA, 50 mM glucose) was added and suspended, and a 1 mM lysozyme (25 mg / ml) solution was added and left for 5 minutes. 10 mM NaOH-SDS (0.2 N NaOH 10% SDS)
The solution was added, and the mixture was ice-cooled for 5 minutes. Then, 7.5 ml of 5 M potassium acetate was added, and further ice-cooled for 10 minutes. After centrifugation at 3000 rpm for 15 minutes at room temperature, 13.5 ml isoamyl alcohol was added to the supernatant, and the mixture was left at room temperature for 15 minutes. Centrifuge at 3000 rpm for 15 minutes at room temperature,
The precipitate was dissolved in 4.7 ml TE (containing RNase A (50 μg / ml)) and incubated at 37 ° C. for 10 minutes. After adding and dissolving 5 g of CsCl, 0.3 ml of ethidium bromide (10 mg / ml) was added. Centrifuge at 100,000 rpm for 5 hours at room temperature (TL 100 (Beck
man), rotor: TLA 100-3), and then irradiated with ultraviolet light to collect the position of the red fluorescent band. For collected samples
The extraction operation of ethidium bromide was repeated 4 times with the addition of 500 μl of isoamyl alcohol, and the lower layer was collected and 20 μl of 3 M sodium acetate (pH 5.2), 500 μl.
μl ethanol was added and left at 4 ° C. overnight. This is 15,
The supernatant was removed by centrifugation at 000 rpm for 15 minutes, 70% ethanol was added to the precipitate, followed by vortexing, followed by centrifugation again at 15,000 rpm for 5 minutes. The precipitate was dried in a Speed Vac and dissolved in 100 μl TE to obtain a plasmid DNA solution.

(2) Preparation of deletion clone As described above, cDNA was obtained from pBluescript II SK-vector.
It has been cloned into Eco RI and Xho I sites. Therefore, when performing deletion from the M13 universal primer side, treatment was performed with restriction enzymes ApaI and XhoI, and when performing deletion from the M13 reverse primer side, treatment was performed with restriction enzymes SacI and EcoRI. The operation will be described below in detail.

10 μg of the plasmid DNA was digested with a restriction enzyme (Apa I
, XhoI or SacI, EcoRI), phenol / chloroform / isoamylalcohol treatment, and then ethanol precipitation followed by drying.
Exo III buffer (66 mM Tris / HCl (pH 8.0), 6 mM
MgCl ₂ ), incubate at 30 ° C for 5 minutes,
Add 1 μl (180 units) of Exonuclease III and add 3
2.5 μl was sampled every 0 seconds and added to the 7.5 μl S1 reaction mixture kept at 0 ° C. to obtain a total of 25 samples. After incubation at room temperature for 30 minutes, 1 μl S1 stop mixture (0.3 M Tris base 50 mM EDTA (pH 8.0)) was added,
The reaction was stopped by incubation at 10 ° C for 10 minutes. After ice cooling 1
Use μl for electrophoresis to confirm proper deletion, and add 1 μl Klenow mixture (33 mM MgCl ₂ , 3.3 mM
M Tris / HCl (pH 7.6), Klenow fragment of E. coli, and 0.1 units of DNA polymerase I).
Incubated for minutes. Add 1 μl of 0.5 mM dNTP mixture for each base, incubate at room temperature for 15 minutes, and then add 40 μl ligase mixture (10 xligation buffer (0.5
MTris / HCl (pH 7.6), 0.1 M MgCl ₂ , 0.1 M DTT) 4 μl,
4 μl of 5 mM rATP, 30% (w / w) polyethylene glycol
10 μl, T4 DNA ligase 0.2 Weiss units)
Incubation was further performed for 2 hours, and ligation was performed. This was introduced into Escherichia coli by a heat shock method and cultured to obtain a colony. Colonies were randomly selected, picked with a toothpick, placed in an LB (+ ampicillin (50 μg / ml)) medium, cultured with shaking overnight, plasmid DNA was purified, and the length of the insert was examined by agarose electrophoresis. Clones were selected so that the deletion was about every 200 bp, and the nucleotide sequence was analyzed.

(3) Determination of base sequence Two kinds of systems were used for determination of base sequence. One is to perform a reaction with T7 DNA polymerase using a fluorescently labeled primer and determine the nucleotide sequence by the Sanger method. Specifically, the Auto Read Sequencing Kit (Pharmacia)
Double-stranded DNA sequencing reaction using Automated Laser Fluorescent A.LF DNA Seq
uencer (Pharmacia) was used. In addition, M13 universal primer and M13 reverse primer were used as primers. The other is the Dye Deoxy ^™ Cycle Sequencing Kit 40 using the 3'-end fluorescent label sequencing method.
115 (Applied Biosystems), specifically, a double-stranded DNA was subjected to a sequencing reaction by a thermal cycler, and the reaction-terminated liquid was purified by CTAB precipitation, followed by ABI 373A DNA Sequencer (Applied Biosystems).
Company).

The entire base sequence of 6-OMT (40 kDa peptide) is as shown in FIG. In FIG. 13, shaded portions indicate estimated SAM recognition sites. Sequences analyzed by peptide mapping are underlined. The sequence used for the preparation of the oligonucleotide probe is indicated by a double line. 6-OMT
CDNA is 1267 bp, has one ORF encoding 347 amino acids, and has an estimated molecular weight of 38,655.
Met. The sequence predicted and reported as a SAM recognition site was preserved in the cDNA sequence. Although the estimated molecular weight is smaller than the value estimated from the results of SDS-PAGE,
The clone was determined to contain the full length based on the fact that the presence of the translation initiation signal was suggested, and the fact that the deviation from the SDS-PAGE result was considered as an error range.

(4) Comparison of the primary structures of three hydroxyl methyltransferases of berberine biosynthesis Gene Analysis DNA Gene Works, InteliGenetics
Was used to compare the amino acid sequences of three hydroxyl methyltransferases for berberine biosynthesis. In the homology plot, a setting was made such that a black dot was drawn when 67% or more was the same in the range of 6 residues before and after each amino acid residue to be compared. 6-OMT of the present invention, 4′-OMT and SMT obtained from the analysis of the present invention [N. Takeshita, H. Fu
jiwara, H. Mimura, JH Fitchen, Y. Yamada, Fisat
o Molecular cloning and characterization of S-aden
osyl-L-methionine: scouler: ne-plant Cell physiol.
36:29 (95)] The homology at the amino acid level among the three is 22% for the entire length, and 3% at the C-terminal side where the SAM recognition site exists.
It was 4% and 13% on the N-terminal side (FIG. 14). Also, 6-OMT and
The homology of the 4'-OMT at the amino acid level is
The percentage was 51%, 58% on the C-terminal side, and 47% on the N-terminal side (FIG. 15).
Furthermore, the homology at the amino acid level between SMT and 6-OMT was 30% for the full length, 43% for the C-terminal side, and 21% for the N-terminal side (FIG. 16). The homology at the amino acid level between SMT and 4'-OMT is 30% for the full length, 42% for the C-terminal,
On the terminal side, it was 21% (FIG. 17).

(5) Comparison of the amino acid sequences of the deduced SAM recognition sites between 6-OMT and 4'-OMT and other hydroxyl group methylases Estimation of 6-OMT and 4'-OMT and other hydroxyl group methylases S
Comparison of the amino acid sequences of the AM recognition sites revealed that the sequences were well conserved in both 6-OMT and 4'-OMT (FIG. 18). In FIG. 18, amino acids having similar side chain properties are shown in capital letters.

(6) Phylogenetic tree of hydroxyl methyltransferase 6-OMT and 4'-O by UPGMA using Gene Works
A phylogenetic tree was constructed from the full-length amino acid sequences of MT and other hydroxyl methyltransferases. It was suggested that the enzymes related to plant secondary metabolism are evolutionarily closer to each other as compared to the hydroxyl group methylating enzymes derived from microorganisms and animals (FIG. 19).

[0054]

According to the present invention, a plant secondary metabolite derived from cocolaurin or reticulin, which is useful as a raw material for pharmaceuticals, is converted to 6-OM, a biosynthetic enzyme of cocolaurin.
It can be efficiently produced using a microorganism, a plant, or a cultured cell and / or tissue of the plant transformed with T or a DNA encoding the enzyme.

[0055]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 347 Sequence type: Amino acid Topology: Linear Sequence type: Polypeptide Origin Organism name: Seribaouren Strain name: Sequence: 156-1 Met Glu Val Lys Lys Asp Asn Leu Ser Ser Gln Ala Lys Leu Trp Asn 5 10 15 Phe Ile Tyr Gly Phe Ala Glu Ser Leu Val Leu Lys Cys Ala Val Gln 20 25 30 Leu Asp Leu Ala Asn Ile Ile His Asn Ser Gly Thr Ser Met Thr Leu 35 40 45 Ser Glu Leu Ser Ser Arg Leu Pro Ser Gln Pro Val Asn Glu Asp Ala 50 55 60 Leu Tyr Arg Val Met Arg Tyr Leu Val His Met Lys Leu Phe Thr Lys 65 70 75 80 Ala Ser Ile Asp Gly Glu Leu Arg Tyr Gly Leu Ala Pro Pro Ala Lys 85 90 95 Tyr Leu Val Lys Gly Trp Asp Lys Cys Met Val Gly Ser Ile Leu Ala 100 105 110 Ile Thr Asp Lys Asp Phe Met Ala Pro Trp His Tyr Leu Lys Asp Gly 115 120 125 Leu Ser Gly Glu Ser Gly Thr Ala Phe Glu Lys Ala Leu Gly Thr Asn 130 135 140 Ile Trp Gly Tyr Met Ala Glu His Pro Glu Lys Asn Gln Leu Phe Asn 145 150 155 160 Glu Ala Met Ala Asn Asp Ser Arg Leu Ile Met Ser Ala Leu Val Lys 165 170 175 Glu Cys Gly Asn Ile Phe Asn Gly Ile Thr Thr Leu Val Asp Val Gly 180 185 190 Gly Gly Thr Gly Thr Ala Val Arg Asn Ile Ala Asn Ala Phe Pro His 195 200 205 Ile Lys Cys Thr Val Tyr Asp Leu Pro His Val Ile Ala Asp Ser Pro 210 215 220 Gly Tyr Ser Glu Val His Cys Val Ala Gly Asp Met Phe Lys Phe Ile 225 230 235 240 Pro Lys Ala Asp Ala Ile Met Met Lys Cys Ile Leu His Asp Trp Asp 245 250 255 Asp Lys Glu Cys Ile Glu Ile Leu Lys Arg Cys Lys Glu Ala Val Pro 260 265 270 Val Lys Gly Gly Lys Val Ile Ile Val Asp Ile Val Leu Asn Val Gln 275 280 285 Ser Glu His Pro Tyr Thr Lys Met Arg Leu Thr Leu Asp Leu Asp Met 290 295 300 Met Leu Asn Thr Gly Gly Lys Glu Arg Thr Glu Glu Glu Trp Lys Lys 305 310 315 320 Leu Ile His Asp Ala Gly Tyr Lys Gly His Lys Ile Thr Gln Ile Thr 325 330 335 Ala Val Gln Ser Val Ile Glu Ala Tyr Pro Tyr 340 345

SEQ ID NO: 2 Sequence length: 1041 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA Origin Organism name: Seribaouren Strain name: Sequence: 156-1 ATGGAAGTGA AGAAGGACAA TCTCTCATCT CAAGCTAAAC TGTGGAACTT CATTTATGGT 60 TTTGCTGAAT CACTAGTCCT CAAATGTGCA GTGCAACTTG ATCTAGCCAA CATAATTCAC 120 AACAGTGGCA CGTCCATGAC TCTTTCCGAG TTATCTTCGC GTCTTCCAAG TCAACCTGTC 180 AATGAAGACG CCTTGTATCG AGTCATGCGT TACTTGGTTC ACATGAAGCT ATTCACAAAA 240 GCATCAATAG ATGGAGAACT AAGATATGGA CTTGCACCAC CAGCTAAGTA TCTTGTTAAA 300 GGTTGGGATA AATGTATGGT TGGCTCAATT TTAGCAATCA CTGATAAAGA TTTCATGGCA 360 CCATGGCATT ACCTTAAGGA TGGATTATCA GGCGAAAGTG GTACAGCGTT TGAGAAGGCC 420 TTGGGGACGA ATATATGGGG GTACATGGCA GAGCACCCTG AGAAAAACCA GCTATTTAAT 480 GAAGCAATGG CTAATGATTC AAGGCTTATT ATGTCTGCAT TGGTGAAAGA ATGTGGAAAT 540 ATTTTTAATG GTATAACTAC ACTTGTGGAT GTTGGTGGTG GTACTGGAAC TGCTGTGAGG 600 AATATTGCCA ATGCATTCTCTCATCATTCATTCGTTCATCATTCAGTCATCATTCAGTCGT TGGGTACTC CGAAGTTCAT TGCGTGGCAG GTGATATGTT CAAGTTCATA 720 CCAAAGGCTG ATGCTATCAT GATGAAGTGC ATCCTTCACG ACTGGGATGA CAAAGAATGC 780 ATTGAAATTC TAAAGCGATG CAAGGAGGCA GTACCAGTCA AAGGCGGGAA AGTGATTATA 840 GTCGACATTG TCTTAAATGT GCAATCAGAA CATCCTTATA CCAAGATGAG ACTGACTTTG 900 GATTTGGACA TGATGCTCAA CACTGGAGGA AAAGAGAGGA CTGAAGAGGA ATGGAAGAAG 960 CTCATCCATG ATGCAGGGTA CAAAGGGCAT AAGATAACAC AAATTACTGC TGTACAATCT 1020 GTGATTGAGG CTTATCCATA T 1041

[Brief description of the drawings]

FIG. 1 shows the berberine biosynthetic pathway. 1: L-tyrosine decarboxylase, 2: phenolase, 3: L-tyrosine transaminase, 4: p-hydroxyphenylpyruvate decarboxylase, 5: (S)-
Norcoclaurin synthase, 6: Norcoclaurin-6
-O-methyltotransferase (6-OMT), 7: cocouraurin N-methyltransferase (NMT), 8: phenolase, 9: (S) -3'-hydroxy-N-methylcocraulin
4'-O-methyltransferase (4'-OMT), 10: berberine cross-linking enzyme (BBE), 11: (S) -scourelin 9-O-methyltransferase (SMT), 12: methylenedioxy ring-forming enzyme, 13 ： Tetrahydroberberine oxidase (THBO)

FIG. 2 shows the substrate specificity of 6-OMT / 4′-OMT / SMT for berberine biosynthesis.

FIG. 3 is a photograph of electrophoresis showing confirmation of 6-OMT purification by SDS-PAGE.

FIG. 4 shows purification of 6-OMT by reverse phase chromatography.

[Fig. 5] A 40 kDa peptide was converted to Achromobacter protease.
1 shows the peptide map and the internal amino acid sequence obtained after I treatment.

FIG. 6: A 41-kDa peptide was converted to Achromobacter protease
1 shows the peptide map and the internal amino acid sequence obtained after I treatment.

FIG. 7. Tryptic / Staphylococcuss 40 kDa peptide
2 shows a peptide map obtained by treating with aureus V8 protease and the obtained internal amino acid sequence.

FIG. 8 shows the nucleotide sequence of the oligonucleotide mix primer and the amino acid sequence from which it was derived.

FIG. 9 shows the nucleotide sequence of the junction between the vector and insert of the 41 kDa peptide expression vector pBS41 and the amino acid sequence obtained by translating the nucleotide sequence.

FIG. 10 shows the nucleotide sequence of a mutation primer for mutagenesis.

FIG. 11 shows the procedure of subcloning into a pET vector.

FIG. 12 shows the expression of 40 kDa peptide and 41 kDa peptide in E. coli.

FIG. 13 shows the base sequence of the isolated cDNA of 6-OMT (40 kDa peptide) and the amino acid sequence obtained by translating it.

FIG. 14 shows a comparison of the amino acid sequences of three hydroxyl methyltransferases (6-OMT, 4′-OMT and SMT) for berberine biosynthesis.

FIG. 15 shows a comparison of the amino acid sequences of 6-OMT and 4′-OMT.

FIG. 16 shows a comparison of the amino acid sequences of 6-OMT and SMT.

FIG. 17 shows a comparison of the amino acid sequences of 4′-OMT and SMT.

FIG. 18 shows a comparison of the amino acid sequences of the putative SAM recognition sites of 6-OMT and 4′-OMT with other hydroxyl methyltransferases.

FIG. 19 shows a phylogenetic tree of methylating enzymes.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁶ Identification code FI C12P 17/18 A61K 35 / 78F // A61K 35/78 CK C12N 5/00 B (C12N 1/21 C12R 1:19) (C12N 5/10 C12R 1:91) (C12N 9/10 C12R 1:19) (C12N 9/10 C12R 1:91) (C12P 17/18 C12R 1:91)

Claims (16)

[Claims] 1. An enzyme of norcoclaurin 6-O-methyltransferase comprising the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence in which one or more amino acids have been added, deleted or substituted in said amino acid sequence. A polypeptide having activity. 2. The polypeptide according to claim 1, wherein the polypeptide is norcoclaurin 6-O-methyltransferase comprising the amino acid sequence of SEQ ID NO: 1. 3. A DNA encoding the polypeptide according to claim 1. 4. The DNA according to claim 3, which encodes a polypeptide comprising the amino acid sequence of SEQ ID NO: 1. 5. A DNA comprising the nucleotide sequence of SEQ ID NO: 2. 6. A DNA that hybridizes with a DNA comprising the nucleotide sequence of SEQ ID NO: 2 under stringent conditions and encodes a polypeptide having the enzyme activity of norcoclaurin 6-O-methyltransferase. 7. The DN according to any one of claims 3 to 6.
Vector containing A. 8. In a microorganism and / or plant cell,
The vector according to claim 7, which is capable of expressing a polypeptide having an enzyme activity of norcoclaurin 6-O-methyltransferase. 9. A microorganism transformed with the vector according to claim 7 or 8. 10. A method for producing a polypeptide having norcoclaurin 6-O-methyltransferase enzymatic activity using the transformed microorganism according to claim 9. 11. A plant cell, plant tissue or plant transformed with the vector according to claim 7 or 8. 12. A method for producing a secondary metabolite of a plant, using the transformed plant according to claim 11, or a cultured cell and / or tissue of the plant. 13. The method according to claim 12, wherein the plant secondary metabolite is an alkaloid biosynthesized from coclaurine or reticulin. 14. The method according to claim 12, wherein the alkaloid is a berberine-type alkaloid, a morphine-type alkaloid, or a papaverine-type alkaloid. 15. The method according to claim 12, wherein the transformed plant is a plant of the genus Ouren. 16. The method according to claim 12, wherein the transformed plant is a poppy plant.