WO2006059433A1

WO2006059433A1 - Novel anthocyanidin glucosyltransferase gene

Info

Publication number: WO2006059433A1
Application number: PCT/JP2005/019294
Authority: WO
Inventors: Jun Ogata; Yoshiaki Kanno; Hidehito Tsugawa; Masahiko Suzuki
Original assignee: Aomori Prefecture
Priority date: 2004-11-30
Filing date: 2005-10-20
Publication date: 2006-06-08
Also published as: JP4691720B2; JP2006149293A

Abstract

A gene which is obtained from a rose and codes for a protein having 473 amino acid residues. The gene cords for a protein having such activity that it transfers a glucosyl group to the 5-position hydroxy group of anthocyanidin and then transfers a glucosyl group to the 3-positon hydroxy group.

Description

Specification

A novel anthocyanidin darcosyltransferase gene

Technical field

[0001] The present invention encodes a protein having an activity of transferring a darcosyl group to the hydroxyl group at the 5-position of anthocyanin and an activity of transferring Z or darcosyl group to the hydroxyl group at the 3-position of anthocyanin 5-darcoside. It relates to genes and their use.

Background art

[0002] Anthocyanins are the most common among plant pigments, and anthocyanins exhibit many colors from light blue to deep red. Industrially, plant color is one of the most important traits, and as seen in the diversification of flower color, good color development of fruits, and stabilization of coloration, it is uniform. It is a big economic factor in vegetables. Color development by anthocyanins, a directly identifiable trait, has been the subject of many genetic, biochemical and molecular biological studies, and today there are genes involved in flavonoid biosynthesis systems, including flavonoids containing anthocyanins. Flowers such as petunia, goldfish, arabidopsis, fruits such as apples and grapes, and vegetables such as eggplant and perilla are also crawling. In addition, the mechanism of anthocyanin expression is being elucidated by natural product chemistry and physiological analysis.

[0003] To date, nearly 500 anthocyanins have been reported from various plant species. Anthocyanidin is an aglycone that forms the skeleton of anthocyanin, but it does not exist in the plant body as it is, but it always exists in a glycosylated form (anthocyanin). As a result of glycosylation, anthocyanins become non-toxic anthocyanins and become stable, and they become soluble in water and become soluble in the vacuole of cells. Anthocyanins form complex pigment macromolecules by forming intramolecular associations, intermolecular associations, and coordination bonds with auxiliaries such as flavones / flavonols and metal ions in the vacuole, and exhibit unique colors of each plant. . Therefore, anthocyanin glycosides are important as the first reaction to form anthocyanins and are essential chemical reactions for the subsequent color development.

[0004] The sugar residue that binds to the hydroxyl group of anthocyanin is the 3-position of the C ring, the 5-position, 7-position of the A-ring, and the 3 ' Forces found at the 5 'position, etc. The order in which these sugar residues bind is considered to be a common reaction pathway across plants, as reported by various plant species. It is known in many plants that the glycoside of the hydroxyl group of anthocyanin begins the 3-position force of the C ring, and this is generally recognized as the first reaction process of the glycoside. The It is thought that sugar residues bind to the hydroxyl groups at the 3rd and 5th positions, and glycosides are generated in the order of 3rd to 5th positions. Glycosyltransferases are still found both enzymatically and molecularly.

The gene for an enzyme that catalyzes the transfer of a sugar residue to the hydroxyl group at the 3-position of anthocyanin (a glycosyltransferase (glycoside enzyme)) was first isolated from maize using a transposon (Fedoroff et al. al., 1984) Proc. Natl. Acad. Sci. USA 81: 3825-3829). Subsequently, the same glycosyltransferase gene has been isolated from other plant species using this gene as a probe (Wise et al "(1990) Plant Mol. Biol. 14: 277-279, Ford et al" (1998) J. Biol. Chem. 273: 9224-9233, Yamazaki et al "(2002) Plant Mol. Biol. 48: 401-411). Also, a reaction to transfer a glucose residue to the 5-position hydroxyl group of anthocyanin. The gene for the catalyzing enzyme was isolated for the first time using the red perilla force differential 'display method (Patent Document 1, Yamazaki et al., (1999) J. Biol. Chem. 274: 7405-7411). The gene was also found in Petunia (Yamazaki et al., (2002) Plant Mol. Biol. 48: 401-411) .Several other cases in which other flavonoid glycosyltransferases were cloned were also reported. The gene of an enzyme that catalyzes the reaction of transferring a galactose residue to the 3-position hydroxyl group of flavonol (Mato et al., (1998) Plant C ell Physiol. 39: 1145-1155, Miller et al., (19 99) J. Biol. Chem. 274: 34011-34019), an enzyme that catalyzes the reaction of transferring a glucose residue to the 7-position hydroxyl group of flavone. The gene (Hirotani et al., (2000) Planta 210: 1006-101 3), and betadine 5-glycotransferase gene that catalyzes the reaction of transferring the glucose residue to the 4 'or 7 position of flavonol. (Vogt et al., (1997) Planta 203: 349-361, Vogt, (1999) Plant J. 19: 509-519), and transferring the glucose residue to position 3 of the B ring. The gene for the enzyme that catalyzes the reaction has been found in Gentian (patent document 2) The gene for the enzyme that catalyzes the reaction of sequentially transferring glucose residues to the hydroxyl groups at two different sites in anthocyanidin Sequential sugar residues from the 3-position to the 5-position hydroxyl group An enzyme gene that catalyzes a transfer reaction has been isolated from gentian (Patent Document 3). In rose, the enzyme that catalyzes the reaction of transferring sugar residues has not been known so far, and the activity of the enzyme has not been measured, the enzyme has not been purified, or the gene has not been cloned. The main reason for this is that rose petals are rich in tannins and other secondary metabolites, which were difficult to isolate using methods that were successful in other plants. . In addition, the power of over 7,000 roses produced so far The red rose petals have Shiaxin, which is glycosylated with glucose residues at the 3rd and 5th positions of the anthocyanin shiaxin. Roses containing only 3,5-didarcoside, and conversely only sialidin 3-dalcoside, in which only the 3-position is glycosylated have been reported!

[0006] Patent Document 1: International Publication No. 99/05287 Pamphlet

Patent Document 2: International Publication No. 01/92509 Pamphlet

Patent Document 3: JP-A-10-113184

Disclosure of the invention

Problems to be solved by the invention

[0007] The present invention relates to a gene encoding a protein having an activity of transferring a darcosyl group, preferably an activity of transferring a darcosyl group to the hydroxyl groups at the 5-position and 3-position of anthocyanin in an order different from the known order. It was an object to obtain a gene encoding a protein having a protein. A gene encoding a protein having a dalcosyl group transfer activity obtained in the present invention or a similar gene is introduced into a plant and expressed to modify the type of flavonoid compound to be accumulated, so that flower color, fruit, etc. It is possible to change the color of the plant body. In rose, gene expression control by RNAi method, gene disruption method, etc. using this gene and known modification enzymes (glycosyltransferase (glycosylation enzyme), acylation) in anthocyanins reported so far. By introducing the enzyme) into the rose petals, the anthocyanins that cannot exist in roses can be produced in the rose petals, and V-flower-colored roses can be produced.

Means for solving the problem

[0008] The present inventor has found an enzyme that catalyzes the reaction of transferring the darcosyl group to the hydroxyl group at the 3-position after transferring the darcosyl group to the hydroxyl group at the 5-position of anthocyanin. The gene was clawed. RT-PCR was performed using degenerate primers synthesized based on the nucleotide sequence that is common to glycosyltransferases. The cDNA fragment was amplified and its nucleotide sequence was determined. Based on the obtained base sequence information, the protein coding region of the gene was cloned by RT-PCR. For the functional analysis of the obtained clone, the enzyme activity was analyzed using a protein obtained by utilizing a recombinant protein synthesis system of Escherichia coli. The present invention has been completed based on the above findings.

[0009] That is, the present invention provides the following [1] to [16].

[1] The first aspect of the present invention is the activity of transferring a darcosyl group to the hydroxyl group at the 5-position of anthocyanin and the activity of transferring Z or darcosyl group to the hydroxyl group at the 3-position of anthocyanin 5-darcoside. It is a gene that encodes a protein it has.

[2] A second aspect of the present invention is the gene according to [1], which encodes the following proteins (a) to (:

(A) a protein having the amino acid sequence set forth in SEQ ID NO: 2,

(b) a protein having an amino acid sequence in which one or more amino acids are added, deleted and substituted with Z or other amino acids in the amino acid sequence shown in SEQ ID NO: 2;

(c) a protein having an amino acid sequence showing 20% or more homology to the amino acid sequence set forth in SEQ ID NO: 2,

(d) a protein having an amino acid sequence showing 70% or more homology to the amino acid sequence set forth in SEQ ID NO: 2,

[3] The third aspect of the present invention is that stringent conditions are applied to a part or all of the nucleic acid represented by the nucleotide sequence set forth in SEQ ID NO: 1 or the nucleic acid encoding the amino acid sequence set forth in SEQ ID NO: 2. A protein that hybridizes below and has the activity of transferring the darcosyl group to the hydroxyl group at the 5-position of anthocyanin and the activity of transferring Z or darcosyl group to the hydroxyl group at the 3-position of anthocyanin 5-dalcoside It is a gene that encodes

[4] The fourth aspect of the present invention is that both the activity of transferring a darcosyl group to the hydroxyl group at the 5-position of anthocyanin and the activity of transferring the darcosyl group to the hydroxyl group at the 3-position of anthocyanin 5-darcoside It is a gene according to any one of [1] to [3] that encodes a protein having [5] A fifth aspect of the present invention is a vector comprising the gene according to any one of [1] to [3].

[6] A sixth aspect of the present invention is a vector containing the gene according to [4].

[7] A seventh aspect of the present invention is a host cell transformed with the vector according to [5] or [6].

[8] An eighth aspect of the present invention is a protein encoded by the gene according to any one of [1] to [4].

[9] A ninth aspect of the present invention is that the host cell according to [7] is cultured or grown, and then the host cell force darcosyl group is transferred to the hydroxyl group at the 5-position of anthocyanin. A method for producing a protein comprising collecting a protein having an activity and an activity of transferring Z or a dalcosyl group to a hydroxyl group at the 3-position of anthocyanin 5-darcoside.

[10] A tenth aspect of the present invention is a method for producing the protein by a cell-free protein synthesis system using the gene according to any one of [1] to [4].

[11] An eleventh aspect of the present invention is a plant transformed by introducing the gene according to any one of [1] to [4] or the vector according to [5] or [6] It is.

[12] A twelfth aspect of the present invention is a progeny of the plant having the same properties as the plant according to [11].

[13] The thirteenth aspect of the present invention is the plant according to [11] or the progeny tissue of the plant according to [12].

[14] A fourteenth aspect of the present invention is a cut flower of the plant according to [11] or the progeny of the plant according to [12].

[15] The fifteenth aspect of the present invention is an anthocyanin by introducing the gene according to [4] or the vector according to [6] into a plant or plant cell and expressing the gene. This is a method in which the darcosyl group is transferred to the hydroxyl group at the 5-position of gin and then transferred to the hydroxyl group at the 3-position.

[16] In the sixteenth aspect of the present invention, the gene according to any one of [1] to [4] or the vector according to [5] or [6] is introduced into a plant or plant cell, By expressing the gene, It is a method of adjusting the flower color of a plant body.

[17] In the seventeenth aspect of the present invention, in the plant having the gene according to any one of [1] to [4], the flower color of the plant body is regulated by suppressing the expression of the gene. It is a method to do.

[0027] Hereinafter, the present invention will be described in detail.

[0028] (1) Gene

The gene of the present invention encodes a protein having an activity of transferring a darcosyl group to the hydroxyl group at the 5-position of anthocyanin and an activity of transferring Z or darcosyl group to the hydroxyl group at the 3-position of anthocyanin 5-darcoside. is there.

[0029] Examples of the gene of the present invention include the following genes (A) to (D).

[0030] (A) a gene encoding a protein having the amino acid sequence set forth in SEQ ID NO: 2 and having! /, One or both of the two enzyme activities

Here, “having the amino acid sequence described in SEQ ID NO: 2” means that a plurality of amino acids are added to the N-terminal or C-terminal side of such a protein that includes only the protein having only the amino acid sequence described in SEQ ID NO: 2. The purpose is to include the purified protein. The number of amino acids to be added is not particularly limited as long as the above darcosyl group transfer activity is not lost, but it is usually within 400, preferably within 50.

[0031] (B) one or more amino acids in the amino acid sequence set forth in SEQ ID NO: 2 have an amino acid sequence added, deleted, and substituted with Z or other amino acids, and the two enzyme activities A gene encoding a protein having either one or both of the above proteins having an amino acid sequence that has been added, deleted, or substituted may be natural or artificial. . The number of amino acids to be added, deleted or substituted is not particularly limited as long as the above darcosyl group transfer activity is not lost, but is usually within 20 and preferably within 5.

[0032] (C) encodes a protein having an amino acid sequence exhibiting a certain homology to the amino acid sequence of SEQ ID NO: 2 and having either one or both of the two enzyme activities Gene

As used herein, “a certain degree of homology” usually means a homology of 20% or more, preferably 50% or more, more preferably 60% or more, most preferably 70% or more. Intention Taste.

[0033] (D) Hybridization under stringent conditions for part or all of the nucleic acid represented by the nucleotide sequence set forth in SEQ ID NO: 1 or the amino acid sequence encoding the amino acid sequence set forth in SEQ ID NO: 2. A gene encoding a protein having one or both of the two enzyme activities

Here, “part of the nucleic acid” means, for example, a portion encoding 6 or more amino acid sequences in the consensus sequence region.

[0034] The "stringent condition" refers to a condition in which only specific hybridization occurs and non-specific hybridization does not occur. For example, the temperature is 50 °. C, salt concentration is 5 X SSC (or equivalent salt concentration). The appropriate hybridization temperature depends on the base sequence of the nucleic acid and the length of the nucleic acid.For example, when a DNA fragment of 18 bases encoding 6 amino acids is used as a probe, the temperature is 50 ° C. The following temperatures are preferred.

[0035] Examples of the gene selected by such hybridization include natural genes, for example, plant-derived genes, particularly rose-derived genes. Further, the gene selected by hybridization may be cDNA or genomic DNA.

[0036] Among the above genes, naturally occurring ones can be obtained by screening a cDNA library or the like, as shown in the Examples described later. In addition, non-naturally occurring genes can be obtained by using site-directed mutagenesis or PCR.

[0037] (2) Vector

The vector of the present invention can be produced by inserting the gene (1) into a known expression vector.

[0038] The known expression vector used here is not particularly limited as long as it contains an appropriate promoter, terminator, replication origin and the like. For example, the trc promoter, tac promoter, lac promoter, etc. can be used if the promoter is expressed in bacteria, and if expressed in yeast, the dalyceraldehyde 3-phosphate dehydrogenase promoter, PH05 promoter, etc. can be used. Can be used and expressed in filamentous fungi If present, the amylase promoter, trpC promoter, etc. can be used, and if expressed in animal cells, the SV40 early promoter, SV40 rate promoter, etc. can be used.

[0039] (3) transformed host cell

The transformed host cell in the present invention is a host cell transformed with the vector (2).

[0040] The host cell may be either prokaryotic or eukaryotic. As prokaryotes, for example, Escherichia coli, Bacillus subtilis, etc. can be used. Examples of eukaryotes include yeast and filamentous fungi, as well as animal and plant cultured cells. Examples of yeasts include Saccharomvces cerevisk (Saccharomvces cerevi Sk§) and the like. Examples of filamentous fungi include Aspergillus orvzae and Aspergillus nkgi. Animal cells include: Examples thereof include cultured cells such as mouse, mouse, muster, monkey, human and silkworm.

[0041] The method of transforming with the vector of (2) is not particularly limited, and can be performed according to a conventional method.

[0042] (4) Protein

Proteins encoded by the gene (1) are also included in the present invention. This protein can be produced, for example, by the method (5) described later.

[0043] (5) Protein production method

The method for producing a protein of the present invention comprises culturing or growing the host cell of (3), and then transferring the host cell force darcosyl group to the hydroxyl group at the 5-position of anthocyanin and Z or dalcosyl. It is characterized by collecting a protein having an activity of transferring a group to the hydroxyl group at the 3-position of anthocyanin 5-darcoside, or by producing a protein using a cell-free protein synthesis system or the like.

[0044] The culture or growth of the host cell can be performed according to a method according to the type of the host cell. In addition, protein production by a cell-free protein synthesis system can be performed according to a conventional method.

[0045] The protein can be collected according to a conventional method. For example, the protein can be filtered and removed from the culture. The target protein can be obtained by collecting and purifying by heart separation, cell disruption, gel filtration, ion exchange chromatography and the like.

[0046] (6) Plant

The plant of the present invention is transformed by introducing the gene (1) or the vector (2).

[0047] Plants to which genes and the like are to be introduced are not particularly limited. Gelaum, petunia, tulip, rice, barley, wheat, rapeseed, potato, tomato, poplar, banana, eucalyptus, sweet potato, soybean, alfalfa, lupine, corn, cauliflower, lobelia, apple, bud, peach, oyster, Plums, citrus fruits, etc. can be mentioned.

[0048] (7) Plant offspring

The progeny of the plant of the above (6) is also included in the present invention.

[0049] (8) Tissues such as plants

Tissues of the plant of the above (6) or the progeny of the plant of (7) are also included in the present invention.

[0050] (9) Cut flowers such as plants

Cut flowers of the plant of the above (6) or the progeny of the plant of (7) are also included in the present invention.

[0051] (10) Method for transferring darcosyl group

The method for transferring a darcosyl group of the present invention comprises the activity of transferring a darcosyl group to the hydroxyl group at the 5-position of anthocyanin in the gene of (1) above and the hydroxyl group at the 3-position of anthocyanin 5-glucoside. Of the vector (2), which encodes a protein having both the activity of transferring to aldose, or the activity of transferring the dalcosyl group to the hydroxyl group at the 5-position of anthocyanin and the darcosyl group of anthocyanin 5-darcoside Introducing a gene encoding a protein having both activities to be transferred to the hydroxyl group at position 3 into a plant or plant cell and expressing the gene results in the 5th position of anthocyanin. After the darcosyl group is transferred to the hydroxyl group, the darcosyl group is transferred to the hydroxyl group at the 3-position.

[0052] (11) Flower color adjustment method The method for regulating flower color of the present invention comprises introducing the gene (1) or the vector (2) into a plant or a plant cell and expressing the gene, or a plant having the gene (1). In this method, the color of the flower or fruit of the plant body is regulated by suppressing the expression of the gene. The plant targeted for gene transfer is not particularly limited, and for example, the plant exemplified in (6) above can be used. Further, the plant to be suppressed by the gene (1) is not particularly limited as long as it is a plant having the gene (1).

[0053] The introduction and expression of the gene of (1) can be performed according to a conventional method. In addition, suppression of gene expression in (1) can also be carried out according to conventional methods (for example, the antisense method, the cosuppression method, and the RNAi method).

The invention's effect

[0054] By using the gene expression product obtained by the present invention, a darcosyl group can be transferred to the hydroxyl group at the 5-position of anthocyanin, and then the darcosyl group can be transferred to the hydroxyl group at the 3-position. This makes it possible to modify plant tissues that are colored by the accumulation of anthocyanins such as flowers and fruits.

Brief Description of Drawings

[0055] [Fig. 1] The results of the reactions of [A. Cy (Cyanidin), B. Cy5G (Cyanidin 5-Og lucoside), C. Cy3G (Cyanidin 3-Q-glucoside)] by the rose petal extract enzyme solution. Show.

[Figure 2] One clone of glycosyltransferase activity recognized by substrate [D. Cy (Cyanidin), E. Cy5G (Cyanidin 5-O-glucoside), F. Cy3u (Cyanidin 3-gmcoside)] The best mode for carrying out the invention

[0056] The present invention will be described in more detail below with reference to examples.

[Example 1] Preparation of enzyme reaction substrate and standard compound

(1) Preparation of plant material

The seedlings of Rose 'Crimson Lory, (Rosa hvbrida cv. Crimson Glory) (Hiroshima Rose Garden) were transplanted to No. 10 polypot and raised in a glass greenhouse. After that, the flower petals of 'Crimson Laurie' used for anthocyanin extraction were dried by ventilation at 35 ° C and then stored in a vacuum desiccator until used for extraction of anthocyanins.

(2) Determination of substrate and reaction product Enzyme reaction substrates and reaction products were identified by thin layer chromatography (TLC), high performance liquid chromatography (HPLC) analysis with co-chromatography with standards and spectroscopic techniques. Commercially-available products (manufactured by Funakoshi Co., Ltd.) were used for shia-zin, shia-zin 3-darcoside, and shia-zin 3,5-darcoside.

(3) Isolation of cyanidin 5-darcoside

Rose dried petals (HPLC (described later as a result of 520 analysis, containing 95% or more of ciazine 3,5-diglucoside in the crude extract: raw weight 100 g) in 1 L of 0.05% hydrochloric acid aqueous solution-left at room temperature After the crude extract was obtained, fractionation was performed with petroleum ether, black mouth form, and ethyl acetate, a glass column (30 mm id X 600 mm) packed with Amberlite XAD-7 Organo Co., Ltd. After equilibrating with 0.01% aqueous hydrochloric acid, the aqueous layer fraction diluted twice was passed through the column to adsorb the dye. After washing the unadsorbed material, the dye was eluted with 80% aqueous methanol solution containing 0.01% hydrochloric acid. The eluate was dried and solidified.

The dried and solidified pigment powder was redissolved in 0.05% aqueous hydrochloric acid solution, and an equal amount of 12% aqueous hydrochloric acid solution was added thereto, followed by heating at 80 ° C for 20 minutes for acid hydrolysis. After heating, an equal amount of isoamyl alcohol was added to the solution, and the mixture was vigorously stirred and centrifuged to remove the isoamyl alcohol layer. After this was performed three times, an equal amount of ethyl acetate was added, stirred, centrifuged, and the aqueous layer was fractionated. Paper chromatography (Whatman 3MM) was performed twice from the aqueous layer obtained by the above-mentioned method. 5-Dalcoside was isolated. First modification using Arisumi's method (Arisumi Yamaguchi University Faculty of Agriculture, Scientific Report No.18, 1967), developing solvent 2 methyl-1-propanol: hydrochloric acid: water = 5: 2: 4 supernatant Chromatography was performed to obtain three types of dye fractions (cyanidine 3-darcoside, cyadin 5-darcoside, and cyadin 3,5-didarcoside). After the development, it was air-dried, and a fraction (Shiajin 5-Dalcoside) showing strong fluorescence under 320 nm UV was used for the second paper chromatography. Developing solvent: Purified using hydrochloric acid: acetic acid: water = 15: 3: 82. One type of dye fraction was obtained, and after elution, it was confirmed that it had been purified by HPLC analysis, and used as a substrate for the subsequent enzyme reaction. If it was not single, fractionation by HPLC was performed.

Reversed column WakosiHI5C18AR column (4.6 mm id) for HPLC analysis and fractionation X 250 mm) at a column temperature of 35 ° C. At a flow rate of lml / min, an aqueous solution containing 0.5% TFA and 5% acetonitrile (A) with a linear concentration gradient of 20% of acetonitrile solution (B) containing 0.5% TFA at 5% force for 20 minutes The elution time was detected using PDA.

[Example 2] Measurement of enzyme activity for transferring a darcosyl group to 5- and 3-positions of anthocyanins in nora petals

Reaction solution containing 0.1 M Tris-HCl buffer (pH 8.0), 0.5 mM thiazine or thiazine 5-darcoside or thiazine 3-darcoside, ImM UDP-glucose and crude enzyme solution 30 1 50 μ 1 was reacted at 30 ° C. Stop the reaction by adding 10 μl of 1M aqueous hydrochloric acid, add an equal volume of chloroform: methanol = 2: 1, stir, centrifuge, dry the supernatant in a freeze dryer, and HPLC solvent Α / Β = 95: 5 10 / ζ 1 was added, redissolved and centrifuged, and the supernatant was used as an analysis sample. The HPLC analysis of the enzyme reaction product was performed by the method described above. The dissolution time of each compound under these conditions is as follows. Cyanidine 3,5-didarcoside: 6.12 minutes, cyanidin 3-glucose: 9.34 minutes, sheadin 5 -darcoside: 9.72 minutes, sheadin: 14.17 minutes.

[Example 3] Detection of activity of anthocyanin 5-position darcosyltransferase and anthocyanin 5-dalcoside 3-position darcosyltransferase

Nora 'Crimson Glory' (Rosa hvbrida cv. Crimson Glory) 'Croton Roze' (cv. Carl Red) petals, respectively The activity was measured using siadin 3-darcoside as a substrate. The following experiments were performed at 0-4 ° C.

(1) Preparation of crude enzyme solution

10 g of frozen petals were ground with a mortar and pestle in the presence of liquid nitrogen together with 5 g of polyvinylpolypyrrolidone (PVPP). 100 ml of buffer A (100 mM potassium phosphate buffer (pHLO), 14 mM 2-mercaptoethanol, 1% polybutylpyrrolidone K-30 (PVP), lOOmM sodium chloride, 5 mM EDTA, 5 mM sodium ascorbate, 10% glycerol , 0.1% Triton X-100) was stirred and eluted. The extracted suspension was filtered through quadruple gauze and then centrifuged at 12,000 rpm for 20 minutes.

(2) Ammonium sulfate fraction

After salting out the filtrate (about 100 ml) with 10% saturated ammonium sulfate for 40 minutes, insoluble matter was removed at 12,000 rpm. Removed by centrifugation for 20 minutes. Salting out was performed again with 70% saturated ammonium sulfate, and a precipitate was obtained by centrifuging at 12,000 rpm for 20 minutes. The precipitate was redissolved in a minimum amount of buffer B (50 mM Tris-HCl (pH 8.0), 14 mM 2-mercaptoethanol) and then equilibrated with buffer B. Sep hadex G-25 Fine (30 mm id X 500 mm; Amersham Bioscience) was used for desalting. The protein fraction (about 20 ml) was collected and subjected to the following chromatography.

(3) Adsorption / desorption of anion exchange resin by open column

DE52 (manufactured by Whatman), an anion exchange resin, was packed in a column (30 mm i.d. X 50 mm) and equilibrated with buffer B. A 2-fold diluted enzyme solution was added to the column, washed with buffer B, and then eluted with buffer B containing 0.3 M sodium chloride to obtain a crude enzyme solution.

[Example 4] Reaction characteristics of crude enzyme solution

The enzyme activity was measured using the above crude enzyme solution. HPLC analysis was performed according to the method described in Examples 1 and 2. As a result, when siadine was used as a substrate, the reaction products were siadine 5-darcoside, siadine 3,5-didalcoside, and trace amounts of siadine 3-darcoside. As a substrate, cyadin 3,5-diglucoside was not obtained. Furthermore, sheadin 3,5-didarcoside was obtained when sheadin 5-darcoside was used as a substrate. Figure 1 shows the reaction results for each substrate. In other words, it was thought that glycosylation at the 3rd position of anthocyanin, followed by glycosylation at the 5th position! /, Biosynthesis (Tanaka et al, (1998) Plant Cell Physiol. 39: 1119-1126, Forkmann, (2003) in: Encyclopedia of rose science Vol.1 256-262, Elsevier academic press, Oxford). Glycosylation at position 3 was detected in the crude enzyme solution. Furthermore, when pelargogin, a glycon of pelargogin 3,5-zidarcoside contained in rose petals, is used as a substrate, a glycoside reaction similar to that of siadine occurs, and pelargogin 3-dalcoside is converted. When used as a substrate, no reaction product was obtained, as was Cyadin 3-Dalcoside.

These results indicate that an enzyme having darcosyltransferase activity for the 5-position hydroxyl group of anthocyanin and an enzyme having darcosyltransferase activity for the 3-position hydroxyl group of anthocyanin 5-darcoside are present in rose petals. Was strongly suggested to exist. These findings have never been reported so far. Example 5 Amplification of a gene fragment of a gene of rough labronoid glycosyltransferase

(1) RNA preparation

Total RNA was prepared from petals of rose cultivar, Krimson Laurie by the modified CTAB method (Chang et al., 1993, Mukai 'Yamamoto Plant Cell Engineering Series 7 pp.57-62). using poly (A) + RNA Yoko total RNA (2 ⁵ 0 / zg) Power et Oligotex- dT30 super (Takara), was prepared in the manufacturer's recommended ways.

(2) 3 'RACE

The prepared total RNA was treated at 99 ° C for 2 minutes, cooled on ice, and then cDNA was synthesized using the first strand cDNA synthesis kit (Pharmacia) by the method indicated by the manufacturer. A highly conserved region in plant secondary metabolite glycosylation enzyme using the synthesized cDNA as a model PSPG-box (Huges and Huges (1994) DNA Seq., 5:

41-49) based on the degenerate primer GTSPFd [WCICAYTGYGGIT GGAAYTC: SEQ ID NO: 3] designed based on the amino acid sequence and the sequence present in Not Id (T) used for cDNA synthesis.

18

PCR was performed using the designed NotlRl [AACTGGAAGAATTCGCGGC: SEQ ID NO: 4] as a primer. The PCR reaction solution was 2 μ 1 cDNA, lx Expand HF buffer (BOEHRINGE R MANNHEIM), 0.2 mM dNTPs ゝ primer 1.6 pmol / μ 1 each, Expand High Fidelity P CR system enzyme mix 1.75 unit total volume 50 μ 1 Prepared. The reaction was performed at 94 ° C for 2 minutes, followed by 40 cycles of 94 ° C for 30 seconds, 48 ° C for 30 seconds, 72 ° C and 30 seconds, and finally treated at 72 ° C for 1 minute. did. The obtained reaction product was subjected to 0.8% agarose gel electrophoresis, and a DNA fragment having the expected size was recovered. NotR2 (GAACGCGGCCG) designed on the 3 'side of NotlRl based on the sequences present in GTSPFd and Not Id (T)

18

PCR reaction was performed using CAGGAAT: SEQ ID NO: 5) as a primer. The PCR reaction solution was 2 1 cD NA, lx Expand HF buffer (BOEHRINGER MANNHEIM), 0.2 mM dNTPs ゝ Primer 1.6 pmol / μ1 each, Expand High Fidelity PCR system Enzyme mix 1.75 unit total volume 50 / zl Prepared. The reaction was performed at 94 ° C for 2 minutes, followed by 40 cycles of 94 ° C for 30 seconds, 48 ° C for -30 seconds, 72 ° C for .30 seconds, and finally treated at 72 ° C for 1 minute. did. The obtained reaction product was subjected to 0.8% agarose gel electrophoresis, and a DNA fragment of the expected size was recovered. The recovered DNA product was cloned into pGEM Easy T vector (Promega). in this way The ABI ™ BigDye ™ Terminator cycle sequencing reaction ver.3.1 (Applied Biosystem) was used to determine the total nucleotide sequence using DNA sequencer model 3100. A BLASTX search was performed, and a clone RhGT fra.42 that was found to be homologous to the glycosyltransferase gene was found.

(3) 5 'RACE

CDNA for mRNA having 5 ′ end used for 5 ′ RACE was synthesized using GeneRacer kit (Invitrogen) according to the method indicated by the manufacturer. 1st-PCR using the GeneRacer 5 'primer (CGACTGGAGCACGAGGACACTGA: SEQ ID NO: 6) and primer 42R1 (TTATGCGGGCCCAACAT GCC: SEQ ID NO: 7) set to the internal sequence of RhGT Fra. went. PCR reaction solution: 1 μ 1 cDNA, lx LA PCR Buffer II (Takara), 0.2 mM dNTPs ゝ 3 μ 1 GeneRacer 5 ′ primer (10 M), 2 1 42R1 (5 μ M), 2 mM MgCl, Takara LA Taq The total volume of 2.5 units was adjusted to 50 μ1. The reaction is

2

After reacting at 94 ° C for 2 minutes, 40 cycles of 94 ° C for 30 seconds, 58 ° C for 30 seconds and 72 ° C for 2 minutes were performed, and finally, treatment was performed at 72 ° C for 2 minutes. This reaction solution was subjected to 0.8% agarose electrophoresis, the amplification product band was cut out, and the amplification product was recovered using a Qiagen Gel Extraction kit (Qiagen). Neat-PCR was performed using the recovered amplification product in a cage shape using GeneRacer 5 ′ Nested primer of GeneRacer kit and primer 42R2 (CCACAGCTGAGCCAA CTTGG: SEQ ID NO: 8) set to the internal sequence of RhGT Fra.42. PCR reaction solution is 1 1 cDNA, lx LA PCR Buffer II (Takara), 0.2 mM dNTPs, 1 μ 1 GeneRacer 5 'primer (10 M), 2 1 42R1 (5 μM), 2 mM MgCl, Takara LA Taq 2.5 The total volume of unit was adjusted to 50 μ 1

2

. The reaction was performed at 94 ° C for 2 minutes, followed by 40 cycles of 94 ° C for 30 seconds, 58 ° C for 30 seconds and 72 ° C for 2 minutes, and finally treated at 72 ° C for 2 minutes. did. The reaction solution was subjected to 0.8% agarose electrophoresis, and the amplified product band was cut out. The amplified product was recovered using the Qiagen Gel Extraction kit (Qiagen). The obtained PCR product was cloned into pGEM Easy T vector (Promega). Several clones of the plasmids obtained in this way were anti-centered using ABI ™ BigDye ™ Terminator cycle sequencing reaction ver.3.1 (.Applied Biosystem) and all bases using NA Sequencer model 3100. After sequencing, DNASIS was used to estimate the amino acid sequence to be coded. [Example 6] Cloning of the entire protein coding region of RhGT Fra.42 and expression of recombinant protein in E. coli

(1) Cloning of the entire protein coding region of RhGT Fra.42

The protein coding region predicted from the base sequence of the clone obtained in Example 5 was amplified by PCR and cloned into a pET vector for expression of E. coli. CDNA for total RNA was synthesized using a first strand cDNA synthesis kit (Pharmacia) and reverse transcription reaction using Not I dT primer according to the method recommended by the manufacturer. Primer RhGTFd (GACGACGACAAG ATGGGTGGTGATGCTATAGTTTG: SEQ ID NO: 9) and termination codon including the sequence for cloning into pET30 Ek / LIC (Novagen) for expression of E. coli and the start codon of the protein predicted from the base sequence obtained in Example 5 Primer containing

10) was synthesized according to the method recommended by the manufacturer. The PCR reaction solution is 2 μ 1 cDNA, lx Expand HF Knoffer (BOEHRINGER MANNHEIM), 0.2 mM dNTPs, each primer 1.6 pmol / μ 1, Expand High Fidelity PCR system Enzyme mix 1.75 units total volume 50 1 〖 did. The reaction was performed at 94 ° C for 2 minutes, followed by 40 cycles of 94 ° C for 30 seconds, 55 ° C for 30 seconds, 72 ° C-2 minutes, and finally treated at 72 ° C for 2 minutes. did. The obtained reaction product was subjected to 0.8% agarose gel electrophoresis, and the amplified product was purified from the gel using QIAquick Gel Extraction Kit (Qiagen). After ligating the obtained DNA to pET30Ek / LIC (Novagen) according to the method recommended by the manufacturer, it was transformed into E. coli JM109, and several clones were used with BigDye Terminator Ver. 3 using T7 promoter and T7 terminator primer. After performing Cycle Sequencing Reaction using 1., the base sequence was determined using ABI3100 Genetic Analyzer. Among the pET clones whose nucleotide sequence was determined, pETRhGTl consists of 1,422 base pairs (this nucleotide sequence is shown in SEQ ID NO: 1) and 473 amino acid residues (this amino acid sequence is shown in SEQ ID NO: 2). Was coded. Functional analysis was performed using this pETRh GT1.

(2) Recombinant protein expression

pETRhGTl was transformed into E. coli BL21 (DE3) (Novagen). The transformed strain was cultured at 37 ° C with shaking in 3 ml of LB medium containing 30 μg / ml kanamycin. 500 μl of this culture Add to LB medium containing 30 g / ml kanamycin and shake culture until the absorbance at 600 nm reaches 0.4, then add isopropyl-β-D-thiogalatatoside (IPTG) to a final concentration of 0.4 mM, 22 ° C After culturing for 12 hours, the cells were recovered by centrifuging (8000 rpm, 4 ° C, 20 minutes).

[Example 7] Measurement of enzyme activity of protein encoded by pETRhGTl cDNA

(1) Extraction of recombinant protein

For extraction of recombinant protein, the bacterial cell pellet was added to 1 ml of lysis buffer (pH 8.0) (100 mM Tris-HCl, 300 mM sodium chloride, 14 mM 2-mercaptoethanol 0.1% Protease and

Phosphatase Inhibitor Cocktails (manufactured by SIGMA)), suspended in an ultrasonic crusher, and separated in a cooling centrifuge. The supernatant was used as a recombinant protein solution and used for enzyme activity measurement.

(2) Enzyme activity measurement of recombinant proteins and identification of enzyme reaction products

Enzymatic reaction was performed using recombinant pETRhGTl protein. The recombinant protein solution 30 1 was used in the same manner as in [Example 2]. For the analysis by HPLC, a reverse layer column Wakosil-II5C18AR column (4.6 mm id × 250 mm) was used and the column temperature was 35 ° C. Detection using PDA with an elution time of 20 minutes in a linear concentration gradient with a 20% 0.5% TFA solution containing 0.5% TFA and an aqueous solution containing 0.5% TFA and 5% acetonitrile at a flow rate of lml / min. did. Figure 2 shows the reaction results for each substrate. From the results of co-chromatography analysis with a standard substance, the reaction products were identified as cyadin 3,5-didarcoside and cyadin 5-darcoside, respectively. Furthermore, when shia-zin 3-darcoside was used as a substrate, the reaction product was unable to be obtained. The elution time of each compound under these conditions is as follows. Shea-jin 3,5-didarcoside: 6.31 minutes, Shea-jin 3-darcoside: 9.85 minutes, Shea-gin 5-darcoside: 10.68 minutes, Shea-jin: 16.34 minutes. From the above results, it is clear that the recombinant enzyme of the pETRhGTl clone has both UDP-glucose: cyanidin 5-Q-glucosyltransferase and UDP-glucose: cyaniain 5-O-glucoside 3-Q-glucosyltransferase activities. It was. Therefore, the RhGTl gene encodes UDP—glucose: anthocyanidin 5,3—glucosyltransferase, which sequentially shifts the glycosyl group to the hydroxyl groups at the 5- and 3-positions of anthocyanin. ! /, Confirmed that. This specification includes the contents described in the specification and Z or drawings of the Japanese patent application (Japanese Patent Application No. 2004-345322) which is the basis of the priority of the present application. In addition, all publications, patents, and patent applications cited in the present invention are incorporated herein by reference as they are.

Claims

The scope of the claims

[1] A gene encoding a protein having an activity of transferring a darcosyl group to the hydroxyl group at the 5-position of anthocyanin and an activity of transferring Z or darcosyl group to the hydroxyl group at the 3-position of anthocyanin 5-darcoside.

[2] The gene according to claim 1, which encodes the following proteins (a) to (

(a) a protein having the amino acid sequence of SEQ ID NO: 2,

(d) a protein having an amino acid sequence showing 70% or more homology to the amino acid sequence set forth in SEQ ID NO: 2.

[3] A gene that hybridizes under stringent conditions to part or all of the nucleic acid represented by the nucleotide sequence set forth in SEQ ID NO: 1 or the nucleic acid encoding the amino acid sequence set forth in SEQ ID NO: 2. A gene encoding a protein having an activity of transferring a darcosyl group to the hydroxyl group at the 5-position of anthocyanin and an activity of transferring Z or darcosyl group to the hydroxyl group at the 3-position of anthocyanin 5-darcoside.

[4] The invention encodes a protein having both an activity of transferring a darcosyl group to the hydroxyl group at the 5-position of anthocyanin and an activity of transferring a darcosyl group to the hydroxyl group at the 3-position of anthocyanin 5-darcoside. The gene according to any one of -3.

[5] A vector comprising the gene according to any one of claims 1 to 3.

[6] A vector comprising the gene according to claim 4.

[7] A host cell transformed with the vector according to claim 5 or 6.

[8] A protein encoded by the gene according to any one of claims 1 to 4.

[9] The host cell according to claim 7 is cultured or grown, and then the activity of transferring a glucosyl group from the host cell to the hydroxyl group at the 5-position of anthocyanin and the Z or dalcosyl group is converted to an anthocyanic acid. A method for producing the protein, comprising collecting a protein having an activity of transferring to a hydroxyl group at the 3-position of gin 5-darcoside.

[10] A method for producing the protein by a cell-free protein synthesis system using the gene according to any one of claims 1 to 4.

[11] A plant transformed by introducing the gene according to any one of claims 1 to 4 or the vector according to claim 5 or 6.

[12] A progeny of the plant having the same properties as the plant of claim 11.

[13] The tissue of the plant according to claim 11 or the progeny of the plant according to claim 12.

[14] A cut flower of the plant according to claim 11 or a progeny of the plant according to claim 12.

[15] The gene according to claim 4 or the vector according to claim 6 is introduced into a plant or plant cell, and the gene is expressed to transfer the dalcosyl group to the hydroxyl group at the 5-position of anthocyanin. And then transferring the darcosyl group to the hydroxyl group at the 3-position.

[16] The flower color of the plant body by introducing the gene according to any one of claims 1 to 4 or the vector according to claim 5 or 6 into a plant or plant cell and expressing the gene. How to adjust.

[17] A method for controlling the flower color of a plant body by suppressing the expression of the gene in a plant having the gene according to any one of claims 1 to 4.