JPH10276785A - Gene encoding recombination type trehalose phosphorylase, vector containing the gene, transformant transformed with the gene and production of recombination type trehalose phosphorylase with the transformant - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain the subject new gene encoding trehalose phosphorylase containing a specific amino acid sequence as a partial amino acid sequence and useful for producing trehalose capable of sweetening drinks and foods without causing their discoloration and denaturation. SOLUTION: This new gene encodes trehalose phosphorylase containing amino acid sequences of formula I and formula II or amino acid sequences homologous to the amino acid sequences of formula I and formula II as partial amino acid sequences. The gene is used for producing the trehalose phosphorylase useful for the production of the trehalose capable of sweetening drinks and foods without causing their coloration and denaturation. The enzyme is obtained by extracting the whole DNA from Grifola frondosa CM-236 (FERM 35), subjecting the extracted whole DNA to synthesis and amplification treatments in the presence of a DNA polymerase by the use of the partial gene of the trehalose phosphorylase, inserting the obtained gene into a vector, and subsequently expressing the gene in a host cell.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

[0001] The present invention relates to a recombinant trehalose phosphorylase, a gene encoding the amino acid sequence thereof, an autonomously replicable vector containing the gene, a transformant into which the expression vector has been introduced, and a set using the same. The present invention relates to a method for producing a recombinant trehalose phosphorylase.

[0002] Trehalose is a non-reducing disaccharide in which two reducing groups of glucose molecules are bonded to each other. Naturally, trehalose is widely present in the living world, such as bacteria, fungi, algae, plants, insects, and animals. It is known as an energy storage substance or a substance having a protective effect against low temperature and drying. Since trehalose has no reducing group in the molecule,
Even when heated in the presence of amino acids, there is an advantage that a browning reaction does not occur and a food can be sweetened without fear of coloring or deterioration. However, it is difficult to obtain a desired amount by the conventional method, and it has hardly been actually used for sweetening foods and drinks.

[0003] Conventional methods for producing trehalose include:
(1) A method mainly using microbial cells, (2) A method in which a complex enzyme system acts on carbohydrate, and (3) A method in which an enzyme acts on carbohydrate. For example, the first method is a method of extracting trehalose accumulated in the yeast cells (Japanese Patent Laid-Open No. 5-29).
There is known a method of culturing a bacterium such as Corynebacterium and accumulating trehalose in a filtrate thereof (Japanese Patent Application Laid-Open No. 5-111882). However, these methods have drawbacks such as the necessity of removing impurities and a low yield. In the second method, maltose and glucose are used as substrates, and maltose phosphorylase and β-type trehalose phosphorylase (β
A method in which trehalose phosphorylase using -D-glucose 1-phosphate as a substrate is reacted with a complex enzyme system comprising β-type trehalose phosphorylase, the same applies hereinafter) to purify the resulting trehalose (Japanese Patent Laid-Open No. 58-216695).
It has been known. In this method, although the separation of trehalose itself is relatively easy, the reaction itself is an equilibrium reaction by two kinds of enzymes, and the equilibrium is always inclined toward β-D-glucose 1-phosphate, It was necessary to perform the reaction at a high concentration of the substrate, and it was difficult to increase the yield of trehalose. Further, a third method is disclosed in
As disclosed in Japanese Patent Application Publication No. 8-149980 and the like, a novel enzyme is used by using maltose as a substrate to purify trehalose produced. Although this method has a relatively high yield, in order to obtain maltose, α-
Various enzymes such as amylase, isoamylase, β-amylase, and glucoamylase need to be acted on, requiring several stages of reaction, which is problematic in the reaction.

The present inventors have conducted extensive searches for enzymes that convert trehalose with high efficiency, and found that certain microorganisms belonging to the genus Glyphora and the like act on D-glucose and α-D-glucose 1-phosphate. To produce trehalose phosphorylase that produces trehalose with high efficiency (trehalose phosphorylase using α-D-glucose 1-phosphate as a substrate is referred to as α-type trehalose phosphorylase, hereinafter the same). No. 255473. Furthermore, sucrose phosphorylase and trehalose phosphorylase are used as raw materials for sucrose, which is a storage sugar of sugarcane and sugar beet and can be obtained in large quantities and at low cost.
It has been found that trehalose can be converted with the above efficiency, and is disclosed in JP-A-7-99988. As shown in these, the use of α-type trehalose phosphorylase was expected to solve the above-mentioned problems relating to trehalose. However, these microorganisms do not have sufficient enzyme-producing ability, and when trying to produce trehalose on a large scale, there arises a problem that the microorganisms must be cultured in a large amount.

Until now, trehalose phosphorylase has been known to use β-D-glucose 1-phosphate as a substrate, β-type trehalose phosphorylase (JP-A-50-154485), and α-D-glucose 1-phosphate as a substrate. And α
Type trehalose phosphorylase (JP-A-7-255473) is known. However, no amino acid sequence or N-terminal amino acid is known for any trehalose phosphorylase. For this reason, it is difficult to determine the cDNA sequence of these trehalose phosphorylases, and the fact that the microorganism that produces the trehalose phosphorylase is a eukaryote such as green algae or basidiomycetes doubles the difficulty. Under such circumstances, clarifying the base sequence of the gene of the trehalose phosphorylase, particularly cDNA, facilitates the supply of the enzyme and the improvement of the physicochemical properties, and has important significance in the use of the enzyme. is there. That is, the productivity of the enzyme is improved by introducing the cDNA of the trehalose phosphorylase into a heterologous or homologous microorganism, or the microorganism having the cDNA of the trehalose phosphorylase is used as an insolubilizing enzyme, the cDNA of the trehalose phosphorylase or By using a part of the probe as a probe to search for a new trehalose phosphorylase-producing microorganism, or by substituting a part of the base of the cDNA of the trehalose phosphorylase, the physicochemical properties of the enzyme, such as heat stability or pH stability, are obtained. It has significant technical and economic significance, such as providing the potential for improvement.

[0006]

SUMMARY OF THE INVENTION It is an object of the present invention to apply D-glucose and α-
It is to create a recombinant trehalose phosphorylase that produces trehalose by acting on -D-glucose 1-phosphate. Another object of the present invention is to provide a gene encoding the created recombinant trehalose phosphorylase. A further object of the invention is
An object of the present invention is to provide a replicable recombinant gene containing such a gene. A further object of the present invention is to provide a transformant into which such a recombinant gene has been introduced. A further object of the present invention is to provide a method for producing a recombinant trehalose phosphorylase using such a transformant.

[0007]

The present invention has been made to solve these problems. That is, the present invention relates to a novel recombinant trehalose phosphorylase having an action of converting D-glucose and α-D-glucose 1-phosphate to trehalose. The present invention also relates to the amino acid sequence of such a recombinant trehalose phosphorylase, a gene encoding the same, an autonomously replicable vector containing the gene, and a transformant obtained by introducing the vector into a host. Further, the present invention relates to a method for producing a recombinant trehalose phosphorylase, which comprises culturing the transformant, expressing the recombinant trehalose phosphorylase, and collecting the trehalose phosphorylase from the culture.

That is, the present invention relates to a gene encoding trehalose phosphorylase having an amino acid sequence represented by SEQ ID NO: 1 at the N-terminus and an amino acid sequence represented by SEQ ID NO: 2 as an intermediate fragment sequence. . Furthermore, the gene of the present invention is a gene encoding trehalose phosphorylase containing the amino acid sequence represented by SEQ ID NO: 3 in the sequence listing. The genes encoding these trehalose phosphorylases include genomic DNA represented by SEQ ID NO: 4 in the Sequence Listing and cDNA represented by SEQ ID NO: 5 in the Sequence Listing. It also includes synthetic DNA. These homologous amino acid sequences and DNA sequences include
Even if one or more amino acids or bases are substituted or deleted with another amino acid or base, or one or more amino acids or bases are added, they are included as long as they encode trehalose phosphorylase. It is. These amino acid sequences or DNA sequences include amino acid sequences and DNA sequences homologous to these sequences as long as they encode trehalose phosphorylase. The present inventors have determined that a polypeptide having a homologous amino acid sequence has a GENETYX-CD protein database (Ver. 32 NB
RF Rel.46 Software Development Co., Ltd., February 1996), INT. Score: 99 or less, 27.6% / 134aa
Only polypeptides having the following homology were obtained.
Therefore, in view of this, as amino acid sequences having homology, at least 50% of the amino acid sequences are identical,
Also included are those encoding trehalose phosphorylase.

[0009] In addition, homologous base sequences may be based on the degeneracy of the genetic code, or based on one or two bases.
What encodes trehalose phosphorylase even when one or more bases are substituted or deleted with another base, or one or more bases are added. Furthermore, a gene that hybridizes with an oligonucleotide probe prepared based on the amino acid sequence or the base sequence of SEQ ID NOs: 3 to 5 in the Sequence Listing is also included. This hybridization is performed under the conditions of Example 3. Further, the amino acid sequence of the recombinant trehalose phosphorylase in the present invention has the amino acid sequence shown in SEQ ID NO: 1 as a partial amino acid sequence at the N-terminus and the amino acid sequence shown in SEQ ID NO: 2 as an intermediate fragment sequence. Things. Such an amino acid sequence includes the amino acid sequence shown in SEQ ID NO: 3 in the Sequence Listing. These amino acid sequences also include amino acid sequences having homology to these amino acid sequences. Amino acid sequences with homology include
Even if one or more amino acids are substituted or deleted with another amino acid, or one or more amino acids are added, they are included as long as they have trehalose phosphorylase activity. is there. Further, the recombinant trehalose phosphorylase of the present invention is produced by a genetic engineering technique using the above-mentioned gene. Further, the present invention is an autonomously replicable vector including the gene encoding the trehalose phosphorylase described above,
As such a vector, the plasmid vector pYES2.0
Can be mentioned.

Further, the present invention is a transformant expressing the recombinant trehalose phosphorylase by introducing these vectors into a host. The host can include bacteria, actinomycetes, yeast, filamentous fungi, or other eukaryotes. Further, the present invention is a method for producing a recombinant trehalose phosphorylase, which comprises culturing such a transformant, expressing the recombinant trehalose phosphorylase in a culture, and collecting the trehalose phosphorylase. In the collection in the present invention, a collection and purification means usually used when collecting an enzyme from a culture is used. Examples of these means include centrifugation, filtration, concentration, salting out, dialysis, fractional precipitation, ion chromatography, gel filtration chromatography, hydrophobic chromatography, affinity chromatography, electrophoresis, and the like. A recombinant trehalose phosphorylase is collected using at least one of these means. The recombinant trehalose phosphorylase of the present invention may be purified as an enzyme or may be in a crude enzyme state.

[0011]

DESCRIPTION OF THE PREFERRED EMBODIMENTS The recombinant trehalose phosphorylase of the present invention comprises D-glucose and α-D-glucose 1-glucose.
Acts on phosphoric acid to produce trehalose. The gene of the present invention is inserted into an autonomously replicable vector to form a replicable recombinant gene, which is usually introduced into a host that does not produce recombinant trehalose phosphorylase but can be easily grown. By preparing a transformant and culturing it, a recombinant trehalose phosphorylase can be produced. The transformant of the present invention produces a recombinant trehalose phosphorylase when cultured. By culturing such a transformant, a desired amount of recombinant trehalose phosphorylase can be easily obtained.

Next, the present inventors prepared Grifola frondosa to produce recombinant trehalose phosphorylase.
( Grifola Frontosa CM-236;
The trehalose phosphorylase gene produced by No. 1) was cloned, and an experiment performed to elucidate the nucleotide sequence of the gene was described.

[0013]

[Experimental example 1 amino acid sequence]

EXPERIMENTAL EXAMPLE 1-1 N-terminal amino acid sequence A protein and peptide for sequencing (the purified enzyme obtained in Example 6 of JP-A-7-255473) were dissolved in 60 μl of water, and a glass filter previously treated with polybrene was dissolved. 20 μl of each was applied to a disc, dried, set on a protein primary structure analyzer PSQ-1 (manufactured by Shimadzu Corporation), and subjected to sequencing. Wakopak WS-PTH (manufactured by Wako Pure Chemical Industries, Ltd.), which had been equilibrated with a PTH-amino acid eluent in advance, was loaded and analyzed at a flow rate of 1.0 ml / min. Detection was performed at a wavelength of 269 nm. As a result, the purified enzyme had the amino acid sequence shown in SEQ ID NO: 1 at the N-terminus.

[0014]

[Experimental Example 1-2 Partial amino acid sequence] Lyophilized purified enzyme (purified enzyme obtained in Example 6 of JP-A-7-255473) was added to 2 mg of 8 M urea and 50 mM Tris-HCl buffer (pH 9.
0) 200 μl was added and incubated at 37 ° C. for 1 hour, then 5 μg of lysyl endopeptidase and 600 μl of 50 mM Tris-HCl buffer (pH 9.0) were added, and the mixture was incubated at 37 ° C. for 12 hours to partially hydrolyze the enzyme. The hydrolyzate was lyophilized to stop the reaction, and dissolved in an appropriate amount of 0.1% (v / v) trifluoroacetic acid. The dissolved hydrolyzate is
Reversed-phase high-performance liquid chromatography column equilibrated with 0.1% (v / v) trifluoroacetic acid (MCI GEL
ODS IMU (Mitsubishi Kasei). A fraction containing the peptide fragment eluted about 56 minutes after the start of the flow is collected,
Vacuum dried. Thereafter, analysis was performed in the same manner as in Experimental Example 1-1. As a result, the peptide fragment had the amino acid sequence shown in SEQ ID NO: 2 in the Sequence Listing.

Next, based on the partial amino acid sequences clarified in Experimental Examples 1-1 and 1-2, a DNA synthesizer (model manufactured by Applied Biosystems Japan) was used.
The chemically synthesized oligonucleotides as a probe by 381A), commercially available DNA polymerase into the genomic DNA of Gurifora-Furondosa (DNA polymerase I, T4d
Double-stranded DN prepared by reacting NA polymerase
As a result of extensive search for A, three DNA fragments comprising a total of about 8,200 base pairs, including the base sequence shown in SEQ ID NO: 4 in the Sequence Listing, were obtained. Next, oligonucleotides chemically synthesized based on the signal peptide sequence and poly-A tail identified in Example 3 were used as probes to obtain Glyphora freon.
Dosa (CM-236, FERM BP No. 35) mRNA in commercially available reverse transcriptase, etc. (RNA-dependent DNA polymerase, D
NA polymerase I, T4 DNA polymerase, etc.)
A cDNA fragment comprising about 2,200 base pairs containing the nucleotide sequence shown in SEQ ID NO: 5 in the sequence listing was obtained. Decoding the nucleotide sequence revealed that trehalose phosphorylase produced by the microorganism had the amino acid sequence shown in SEQ ID NO: 3 consisting of 707 amino acids. Furthermore, when the nucleotide sequences of cDNA and genomic DNA were compared and examined, it was found that they had several introns.

A series of steps leading to elucidation of the amino acid sequence and the base sequence shown in SEQ ID NOs: 3, 4 and 5 are summarized as follows. (1) Trehalose phosphorylase was isolated from a culture of a donor microorganism, and after highly purification, the N-terminal amino acid sequence was determined. On the other hand, after the purified enzyme was partially hydrolyzed with lysyl endopeptidase, a peptide fragment was isolated from the hydrolyzate and its amino acid sequence was determined. (2) Liquid nitrogen was added to the filtrate of Grifola frondosa , homogenized quickly, SDS solution was added, and total DNA was extracted from the centrifuged supernatant. (3) Based on the amino acid sequence obtained in (1) above, Hind II
Oligonucleotide probes with linkers having appropriate restriction enzyme cleavage sites such as I and Pst I were prepared.
A commercially available DNA synthase (DN) was added to the DNA obtained in (2).
A polymerase I, T4 DNA polymerase, Takara Shuzo, etc.)
To obtain DNA presumed to be a part of trehalose phosphorylase. (4) The DNA obtained in (3) was inserted into an appropriate vector such as pUC18 plasmid or bacteriophage λ, and then transformed into an appropriate strain such as Escherichia coli JM109.
Recombinant DNA was obtained from the transformant by the alkali method, and after annealing with the primer, the primer was extended by the action of DNA polymerase, and the base sequence of the obtained complementary strand DNA was determined by the Sanger method. The amino acid sequence deduced from the nucleotide sequence was compared with the N-terminal amino acid sequence and the partial amino acid sequence, and it was confirmed that the nucleotide sequence encodes trehalose phosphorylase.

(5) Recombinant DNA is extracted from the transformant obtained in the above (4) by an alkaline method, and HindIII, Pst
The recombinant DNA was cleaved with an appropriate restriction enzyme such as I, and subjected to gel electrophoresis to obtain a target DNA fragment of trehalose phosphorylase. (6) The DNA obtained in the above (2) was cut with an appropriate restriction enzyme, gel electrophoresis was performed, and a Southern hybridization method using the DNA fragment obtained in the above (5) as a probe was performed. It was found that a DNA fragment containing the trehalose phosphorylase gene of about 4500 bases was obtained by digestion with the restriction enzyme SacI. (7) The DNA obtained in the above (2) was cut with restriction enzyme SacI, and after performing gel electrophoresis, DNA around 4500 bp was extracted and inserted into an appropriate vector such as pUC18 plasmid or bacteriophage λ. . Using this vector having the DNA, an appropriate strain such as Escherichia coli JM109 was transformed. The colony containing the target DNA was selected by colony hybridization using the DNA fragment obtained in the above (5) as a probe, and a transformant containing the DNA encoding trehalose phosphorylase was selected.

(8) Recombinant DN from transformant of (7)
A, and after annealing with primers, DN
The primer was extended by the action of A polymerase, and the resulting complementary strand DNA was analyzed by the Sanger method to determine the nucleotide sequence. The amino acid sequence deduced from the nucleotide sequence is compared with the N-terminal amino acid sequence and the partial amino acid sequence to confirm that the nucleotide sequence encodes trehalose phosphorylase and that the C-terminal sequence is missing. did. (9) The recombinant DNA obtained in (8) above was
After digestion with an appropriate restriction enzyme such as I, gel electrophoresis was performed to obtain a C-terminal DNA fragment of trehalose phosphorylase. (10) The DNA obtained in the above (2) was cut with an appropriate restriction enzyme, gel electrophoresis was performed, and a Southern hybridization method using the DNA fragment obtained in the above (9) as a probe was performed. About 1700 by cutting with restriction enzyme PstI
DNA containing base trehalose phosphorylase gene
It was found that a fragment was obtained.

(11) The DNA obtained in the above (2) is digested with the restriction enzyme PstI and subjected to gel electrophoresis.
The nearby DNA was extracted and inserted into an appropriate vector such as pUC18 plasmid, bacteriophage λ. The DNA
A suitable strain such as Escherichia coli JM109 strain was transformed using the vector having E. coli. The colony containing the target DNA was selected by colony hybridization using the DNA fragment obtained in (9) as a probe, and a transformant containing the DNA encoding the trehalose phosphorylase C-terminal was selected.

(12) Recombinant D from the transformant of the above (11)
After obtaining NA and annealing with primers, D
The primer was extended by the action of NA polymerase, and the resulting complementary strand DNA was analyzed by the Sanger method to determine the nucleotide sequence. The nucleotide sequence was compared with the nucleotide sequence of (8) above, and it was confirmed that the nucleotide sequence encodes trehalose phosphorylase. However, since it was expected that the entire nucleotide sequence of the enzyme was insufficient, it was necessary to further obtain a C-terminal DNA fragment. (13) The recombinant DNA obtained in the above (12) was converted into SacI, Ps
After digestion with an appropriate restriction enzyme such as tI, gel electrophoresis was performed to obtain a C-terminal DNA fragment of trehalose phosphorylase. (14) The DNA obtained in the above (2) is cut with an appropriate restriction enzyme, gel electrophoresis is performed, and then the DN obtained in the above (13) is cut.
The Southern hybridization method using the A fragment as a probe was performed. Approximately 30 by cutting with the restriction enzyme SacI
It was found that a C-terminal DNA fragment containing the 00 base trehalose phosphorylase gene was obtained.

(15) The DNA obtained in the above (2) is cut with a restriction enzyme SacI, gel electrophoresis is carried out, DNA around 3000 bp is extracted, and an appropriate vector such as pUC18 plasmid, bacteriophage λ, etc. Incorporated in. Using this vector, an appropriate strain such as E. coli JM109 was transformed. Selection of colonies containing the target DNA is performed as described in (1) above.
Transformants containing DNA encoding trehalose phosphorylase C-terminal were selected by colony hybridization using the DNA fragment obtained in 3) as a probe. (16) Recombinant DNA was obtained from the transformant of the above (15), and after annealing with the primer, the DNA polymerase was allowed to act to extend the primer, and the resulting complementary-stranded DNA was subjected to base sequence determination by the Sanger method. . The nucleotide sequence was compared with the nucleotide sequence of the above (12), and it was confirmed that the nucleotide sequence encoded the C-terminal including the stop codon of trehalose phosphorylase.

(17) Next, liquid nitrogen was added to the filtrate of Glyphora frondosa , homogenized quickly, guanidine thiocyanate and phenol solution were added, total RNA was extracted from the centrifuged aqueous layer, and the biotinylated oligo (dT ) An mRNA fraction having poly A was collected using a probe. (18) In the mRNA obtained in the above (17), a specific upstream primer and a specific downstream primer having an appropriate restriction enzyme site such as BamHI, a commercially available reverse transcriptase and a DNA synthase
(RNA-dependent DNA polymerase, DNA polymerase I
, T4 DNA polymerase, Takara Shuzo, etc.) to obtain double-stranded cDNA. (19) The cDNA obtained in the above (18) was inserted into an appropriate vector such as a pUC18 plasmid or bacteriophage λ, and the vector was used to transform an appropriate strain such as Escherichia coli JM109. The colony containing the target cDNA was selected by colony hybridization using the above (13) as a probe, and a transformant containing cDNA encoding trehalose phosphorylase was selected.

(20) Recombinant DNA was obtained from the transformant, and after annealing with the primer, the primer was extended by the action of DNA polymerase, and the nucleotide sequence of the obtained complementary strand DNA was determined by the Sanger method. The amino acid sequence deduced from the nucleotide sequence was compared with the N-terminal amino acid sequence and the partial amino acid sequence to confirm that the nucleotide sequence encodes trehalose phosphorylase. Also, DNA of trehalose phosphorylase
Was found to have several introns.

The trehalose phosphorylase gene of the present invention can be converted into a trehalose phosphorylase expression vector by further treating the trehalose phosphorylase gene with various regulators required for expression of the gene, such as a promoter. The vector can be used to transform a suitable host cell to produce trehalose phosphorylase by the host cell. Thus, a technique for mass-producing trehalose phosphorylase by genetic engineering techniques is established.

In constructing the trehalose phosphorylase expression vector into which the gene of the present invention has been introduced,
Normal operations and methods in gene recombination technology can be adopted. This includes DNA digestion with various restriction enzymes, Sl nuclease, etc., and DN using T4 DNA ligase, etc.
A ligation treatment, DNA isolation / purification treatment by agarose gel electrophoresis, polyacrylamide gel electrophoresis, etc., and DNA recovery / purification treatment by phenol extraction etc. are included. In addition, the confirmation that the plasmid vector exists in the host cell can be performed by the alkaline SDS extraction method (HC
Birnboim, and J. Doly, Nucletic Acids Res., 7 ,
1513 (1979)), and the like, and then treating with various restriction enzymes, and examining the presence or absence of these restriction enzyme recognition sites and the length of the generated DNA fragment. In addition, for example, the Sanger method
(F. Sanger, et al., Proc. Natl. Acad. Sci., US
A., 74 , 5463 (1977)) can confirm the above. As a source vector used for the construction of a recombinant, pUC18 and various plasmid vectors derived therefrom are suitable, but are not particularly limited thereto, and various conventionally known vectors such as bacterium Various viral vectors, including various viruses, animal and plant viruses, various plasmids, cosmids and the like may be used.

The vector carrying the gene of the present invention is used in order to allow the transformant obtained by introducing the vector to express the desired trehalose phosphorylase. For example, it is necessary to have factors for transcription, such as a promoter, a transcription termination signal, a poly-A chain addition signal (when eukaryotic cells are used as host cells), and translation factors, such as a ribosome binding site.
Such regulators are well known depending on the host cell. For example, as a promoter, in E. coli,
For Bacillus subtilis, such as trp promoter, lac promoter, recA promoter, λPL promoter, lpp promoter, tac promoter, SP01 promoter, SP02
In yeast and other eukaryotic cells such as promoters and pen promoters, PH05 promoter, GAL1 promoter, GAL7 promoter, PGK promoter, GAP promoter, ADHl promoter, SV40- derived promoter and the like can be exemplified. When constructing an expression vector, these regulatory elements are incorporated into an appropriate vector by selecting a plasmid containing them as a source vector, or isolating or chemically synthesizing them from a plasmid containing them according to a conventional method. Thereby, each can be made to exist in a vector, and thus a desired trehalose phosphorylase expression vector can be obtained. When Escherichia coli is used as a host cell, the expression system vector includes both a system for directly expressing the target trehalose phosphorylase in the cells and a system for secreting and expressing the target trehalose phosphorylase in the periplasmic layer.

The host cell used in the above is not particularly limited, and may be, for example, any of Gram-negative bacteria such as Escherichia coli, Gram-positive bacteria such as Bacillus subtilis, actinomycetes, yeast, and animal and plant cells. Preferably
Among them, YPH250 (IFO 10502, ATCC96519) of Saccharomyces cerevisiae (Saccharomyces cerevisiae) is preferable. The above-described method of introducing the expression vector into the host cell and transforming the host cell by a generally used method, for example, a method of treating a host cell in an aqueous solution containing lithium and adding a solid to the solution (H. Ito, Y.Fukuda, K.Mur
ata, A. Kimura: J. Bacteriol., 153, 163 (1983)).

The above transformant can be cultured using a normal cell culture medium. As a medium that can be used for culture,
For example, a YPD medium, L-broth medium, E medium, M-9 medium and the like can be exemplified. Further, these media may further contain various commonly known carbon sources, nitrogen sources, inorganic salts, vitamins, natural product extracts, physiologically active substances, and the like. The cultivation can be carried out by various methods employing conditions such as pH, temperature, aeration and stirring suitable for the growth of the host cells.
For example, in the case of yeast, the pH is in the range of about 5 to 7.5, preferably about pH
The range of 6.0 to 7.0 is suitable, and it is desirable to culture at a temperature of about 16 to 37 ° C, preferably in a range of about 25 to 35 ° C under aeration and stirring conditions. In order to increase the expression level of the target protein or to promote or suppress secretion of the target protein, the medium composition, culture conditions, and the like can be appropriately changed depending on the purpose.

Thus, the trehalose phosphorylase produced and accumulated can be separated and purified according to a conventional method. According to the use of the gene of the present invention, trehalose phosphorylase can be efficiently produced in large quantities by genetic recombination technology, and the obtained trehalose phosphorylase can be produced, for example, by high performance liquid chromatography (HPLC) or polyacrylamide gel electrophoresis (PAGE). And the like, and the same means as the structural analysis of ordinary polypeptides or proteins,
For example, identification can be performed by molecular weight analysis by SDS-PAGE, isoelectric point measurement by isoelectric focusing, measurement of amino acid composition by amino acid analyzer, analysis of amino acid sequence by amino acid sequencer, and the like.

The recombinant trehalose phosphorylase is collected from the culture by centrifugation, filtration, concentration, salting out, dialysis, fractional precipitation, ion chromatography, gel filtration chromatography, hydrophobic chromatography, affinity chromatography, Usually, at least one of the means for collecting the enzyme from the culture, such as electrophoresis, is used. After the collection, the enzyme is purified as necessary using these means.

Next, the present invention will be specifically described with reference to examples of the present invention. The techniques used in these examples are known per se, and are described in detail in, for example, J. Sambrook et al., "Molecular Cloning A Laboratory Manual", 2nd edition, published by Cold Spring Harbor Laboratory in 1989. Have been.

[0032]

Example 1 Preparation of genomic DNA Glyph was added to glucose 4%, yeast extract 0.75%, malt extract 0.2%, potassium dihydrogen phosphate 0.5%, magnesium sulfate 0.05% (pH 5.5).
O La Furondosa (CM-236, FERM BP-35) was inoculated, it was 2 weeks rotary shaking culture at 25 ℃ by a conventional method. After 50 ml of the culture solution was centrifuged and washed with water, liquid nitrogen was added to the cells obtained by suction filtration, and the cells were ground in a mortar. The milled material is
100 mM sodium chloride, 5% SDS (w / w) and 5 mM EDTA
Was dissolved in a 50 mM Tris-HCl buffer (pH 7.6) containing, and centrifuged. Sodium chloride was added to the centrifugation supernatant to a final concentration of 0.5M, and the mixture was further centrifuged. 10 ml of centrifuged supernatant
Was further overlaid with 6 ml of 2-propanol and incubated at room temperature for 30 minutes. The precipitated DNA was transferred to a tube containing 70% ethanol (v / v) using tweezers for washing and desalting, and the DNA was further transferred to a tube containing ethanol using tweezers for washing and desalting. The ethanol was pipetted off and the DNA was vacuum dried for about 1 minute.
To this crude genomic DNA, 2 ml of 10 mM Tris-HCl buffer (pH 8.0) (hereinafter abbreviated as TE) containing 1 mM of EDTA was added and dissolved, 2 μg of ribonuclease was added, and the mixture was incubated at 37 ° C. for 15 minutes to react. Was. Chloroform in reaction
2 ml was added, gently stirred and centrifuged. Further, transfer the supernatant to a new tube, add 2 ml of chloroform, gently mix and centrifuge, transfer the supernatant to a new tube,
Sodium chloride was added to 0.5M. To this 2-
1.2 ml of propanol was overlaid and incubated at room temperature for 30 minutes. The precipitated DNA was transferred to a tube containing 70% ethanol (v / v) using tweezers for washing and desalting, and the DNA was further transferred to a tube containing ethanol using tweezers for washing and desalting. The ethanol was pipetted off and the DNA was vacuum dried for about 1 minute.
The purified genomic DNA thus obtained was dissolved by adding 200 μl of TE, and the solution was stored frozen at -80 ° C.

[0033]

Example 2 Synthesis of Probe DNA Sequence Listing SEQ ID NO: 1
Gly-Tyr-Thr-Ser-Leu-Thr-Pr of the partial amino acid sequence shown in
5'-GGGTACACC based on the sequence represented by o-Met-Trp-Ala
Probe 1 of the nucleotide sequence represented by AGCCTGCAGCCCATGTGGGC-3 'and Thr-Tr of the partial amino acid sequence represented by SEQ ID NO: 2
Based on the nucleotide sequence represented by p-Asn-Ser-Val-Ile-Lys,
Probe 2 having the nucleotide sequence represented by the complementary chain 5′-GGCAAGCTTGATGACCGAGTTCCAAGT-3 ′ was synthesized. Using these probes 1 and 2, polymerase chain reaction (P
The DNA was amplified by the (CR) method. 1 µl (about 0.2 µg) of the genomic DNA solution prepared in Example 1 and 1 µl of each probe
l (about 20 pmol / μl), TaKaRa Taq 0.5 μl, 10 × PCR Buff
er (10 μl of 100 mM Tris-HCl buffer (pH 8.3) containing 500 mM potassium chloride and 15 mM magnesium chloride), dNT
8 μl of P mixture (2.5 mM each) and sterile distilled water 78.
5 μl was added to a 0.2 ml microtube, and the reaction was carried out at the following temperature using PCR system 2400 (manufactured by PerkinElmer). After reacting at 94 ° C for 5 minutes, 95 ° C for 1 minute, 50 ° C for 1 minute
For 25 minutes at 72 ° C. for 2 minutes. Obtained reactant 5
μl was subjected to agarose gel electrophoresis and DN
The A-amplified product was confirmed.

This DNA was cut out from an agarose gel and recovered using a Ginclean kit (manufactured by Bio 101) as follows. A NaI solution three times the amount of the cut gel was added, and the gel was dissolved by incubating at 55 ° C. for 5 minutes. 5 μl of glass milk was added and mixed by inversion. After incubating on ice for 10 minutes, the mixture was centrifuged at 15000 × g for 5 seconds, the supernatant was removed, and 500 μl of a new solution was added, mixed by inversion, and then centrifuged again at 15000 × g for 5 seconds.
The same operation was performed three times, and 10 μl of TE was added to the obtained precipitate, mixed by inversion, and incubated at 55 ° C. for 15 minutes. next
Centrifuge at 15000 xg for 30 seconds and collect the resulting supernatant
The solution was used. To 5 μl (about 0.1 μg) of the recovered DNA solution, about 10 units of each of the restriction enzymes Hind III and Pst I were added, and the mixture was added at 37 ° C.
For 1 hour to cut the DNA, 0.1 volume of 3M sodium acetate solution (pH 5.2) and 2.5 volumes of ethanol were added, and the mixture was frozen at -80 ° C. The frozen material was centrifuged to obtain a precipitate. Separately, plasmid vector pUC18 (Takara Shuzo)
0.1 μg, and Hind III and Ps
After cleavage by the action of t I, the DNA fragment obtained above
0.1 μg and 20 units of T4 DNA ligase were added, and the mixture was allowed to stand at 4 ° C. overnight to ligate to a DNA fragment. To the obtained recombinant DNA, competent cell JM109 manufactured by Takara Shuzo
After adding 30 μl of the mixture, the mixture was allowed to stand at 42 ° C.
YT broth (pH 7.0) was added, and the mixture was incubated under shaking at 37 ° C. for 1 hour to introduce the recombinant DNA into E. coli.

The transformant thus obtained was treated with 5-bromo
-4-Chloro-3-indolyl-β-D-galactopyranoside 4
0 μg / ml, 10 μg of isopropyl-β-D-thiogalactoside
/ ml and ampicillin 50 μg / ml agar plate medium (pH 7.
0), and cultured at 37 ° C. for 18 hours.The transformed white colonies were collected and contained 100 μg / ml of ampicillin.
× YT broth (pH 7.0) was inoculated into 2 ml. After culturing with shaking at 37 ° C. for 18 hours, the cells were collected from the culture by centrifugation at 15,000 × g for 20 seconds after completion of the culture. 100 μl excluding supernatant
Solution 1 (25 mM containing 50 mM glucose and 10 mM EDTA)
mM Tris-HCl buffer (pH 8.0)), mixed by vortexing, and allowed to stand on ice for 5 minutes. Further, 200 μl of Solution 2 (0.2 N aqueous sodium hydroxide solution containing 1% (w / w) of SDS) was added, mixed by inversion, and allowed to stand on ice for 5 minutes. Then 5
150 μl of a mixture of 60 ml of M potassium acetate, 11.5 ml of glacial acetic acid and 28.5 ml of water was added, mixed by inversion, and left on ice for 10 minutes, followed by centrifugation at 15000 × g for 5 minutes. Collect the supernatant, 4
After adding 50 μl of phenol: chloroform = 1: 1 (v: v) and stirring vigorously, the mixture was centrifuged at 15000 × g for 5 minutes to collect the supernatant. To this supernatant was added 1 ml of ethanol,
The mixture was allowed to stand for 30 minutes in a freezer at 80 ° C., and centrifuged again at 15,000 × g for 5 minutes to collect a precipitate. The precipitate is washed with 70% (v / v) ethanol, air-dried, and 50 μl of RNase containing 0.5 μg.
Dissolved in TE and incubated at 37 ° C. for 30 minutes. The incubated solution was polyethylene glycol 6000 20
% (W / w) of a 2.5 M sodium chloride solution was added, and the mixture was allowed to stand on ice for 1 hour. The mixture was centrifuged at 15000 × g for 10 minutes, and the precipitate was washed with 70% ethanol, air-dried, and dissolved in 50 μl of TE. To this solution was added 50 μl of phenol: chloroform = 1: 1 (v / v), and the mixture was stirred vigorously.
The supernatant was recovered by centrifugation at for 5 minutes, and 0.1 volumes of 3 M sodium acetate solution (pH 5.2) and 2.5 volumes of ethanol were added.
Frozen at 80 ° C. The frozen material was centrifuged to obtain a precipitate.

The precipitate is dissolved in 50 μl of TE, and the method is described in “Takara Taq Cycle Sequencing Kit for Shimadzu DNA Sequencer Ver.2 Manual” published by Takara Shuzo, pages 1 to 4 (1995). The following reaction was carried out. A, G, C, T d in microcentrifuge tube
Dispense 2 μl of each / ddNTP mixture. 1 μl of pUC18 solution containing DNA fragment, 1 μl of M13-forward fluorescent primer or M-13 reverse fluorescent primer
l, TaKaRa Taq 1μl, 5x cycle buffer 5.4μ
and 9.6 μl of sterile water, and add 4 μl to the above tube.
Dispense l at a time. Each tube is manufactured by PerkinElmer
The reaction was performed at the following temperature on a PCR system 2400. After reacting at 94 ° C for 3 minutes, 94 ° C for 30 seconds, 50 ° C for 30 seconds and 72 ° C for 1 minute
Fifteen cycles were performed, followed by 15 cycles of 94 ° C. for 30 seconds and 72 ° C. for 1 minute. After the reaction was completed, 4 μl of a stop solution was added thereto, and heat denaturation was performed at 94 ° C. for 5 minutes, followed by rapid cooling. The electrophoresis was performed on a 4% Long Ranger ™ gel (AT Biochem), and 3 μl of the heat-denatured sample was loaded.
At this time, the edge control solution was simultaneously loaded next to the samples at both ends, and Shimadzu Fluorescent Sequencer DSQ-1000 was used.
(Manufactured by Shimadzu Corporation). Since the DNA fragment encoded the amino acid sequence represented by SEQ ID NO: 1 in the sequence listing, it was determined to be trehalose phosphorylase DNA. This DNA contained a Pst I recognition site inside, and it was found that two fragments of about 600 bp and about 200 bp were obtained by treating a plasmid vector containing the DNA with restriction enzymes Hind III and Pst I. Next, about 10 units of each of the restriction enzymes HindIII and PstI were added, and the mixture was treated in a conventional manner, followed by agarose electrophoresis. 600bp and 200b
Cut p amplified DNA from agarose gel,
A DNA fragment obtained by a conventional method was used as a probe.

[0037]

Example 3 Preparation of Trehalose Phosphorylase DNA 5 μl of the purified genomic DNA solution prepared in Example 1 (approx.
1 μg), about 20 units of the restriction enzyme SacI was added thereto, and reacted at room temperature overnight to partially cut the genomic DNA.
A 0.1 volume sodium acetate solution (pH 5.2) and 2.5 volume ethanol were added, and the mixture was frozen at -80 ° C. The frozen material was centrifuged to obtain a precipitate. The precipitate thus obtained is 10
It was dissolved in μl of TE and subjected to agarose gel electrophoresis.
The agarose gel was immobilized on a nylon membrane according to the method described in "ECL Kit Protocol", pp. 23-28 (1993), published by Amersham, by the following method. 0.25
The gel was allowed to stand in N 2 hydrochloric acid for 10 minutes, washed with water, and then shaken in a 0.4N sodium hydroxide solution for 20 minutes. After shaking, the DNA was adsorbed from the gel onto a nylon membrane by capillary action using a 0.4N sodium hydroxide solution. Nylon membrane is 2x
After washing with the SSC solution for 5 seconds, the plate was immersed in a hybridization buffer containing sodium chloride (0.5 M) and a blocking agent (5% w / v) and shaken at 42 ° C. for 1 hour. Separately,
Amersham “ECL Kit Protocol” 11th to 2nd
Labeling was performed according to the method described on page 2 (1993) by the following method. About 0.2 μg of the probe DNA prepared in Example 2 was taken, boiled for 5 minutes, rapidly cooled on ice, and allowed to stand for 5 minutes. The solution was centrifuged at 15000 × g for 2 seconds to drop the solution to the bottom. Add 20 μl of the labeling reagent and stir.Add 20 μl of glutaraldehyde solution and stir.
After reaction at 10 ° C. for 10 minutes, the mixture was stored on ice. After adding the labeled probe to the buffer containing the nylon membrane and shaking at 42 ° C. overnight, the nylon membrane was taken out, and the primary wash buffer (urea 6M, SDS 0.4% (w / v), 0.5
× SSC), shaken at 42 ° C for 20 minutes, discarded the buffer, immersed again in primary wash buffer,
Shake at ℃ for 20 minutes. The buffer was discarded, immersed in 2 × SSC, and shaken at room temperature for 5 minutes. After discarding the buffer, it was immersed again in 2 × SSC and shaken at room temperature for 5 minutes. Discard the buffer, place a nylon membrane on Klewrap (trade name), place a 2 ml mixture of detection reagents 1 and 2 on the nylon membrane, allow the solution to stand for 1 minute, discard the solution, wrap it in Clerap and fix it. And an X-ray film were contacted and allowed to stand for 3 minutes. As a result of development, a band showing remarkable association was observed at around 4500 bp. Then, 10 μl (about 2 μg) of the genomic DNA solution prepared in Example 1 was cleaved with the restriction enzyme SacI according to the above-mentioned method, and then subjected to agarose gel electrophoresis. This DNA around 4500 bp was cut out from an agarose gel and recovered. Separately, plasmid vector pUC18
0.1 μg (manufactured by Takara Shuzo) and use the restriction enzyme Sac
After the cleavage with the action of I, the DNA fragment
1 μg and 20 units of T4 DNA ligase were added, and the mixture was allowed to stand at 4 ° C. overnight to ligate to a DNA fragment. Competent cell JM109 manufactured by Takara Shuzo Co., Ltd.
l Add and leave for 30 minutes under ice-cooling.
Broth (pH 7.0) was added, and the mixture was incubated under shaking at 37 ° C. for 1 hour to introduce the recombinant DNA into E. coli.

The transformant thus obtained was treated with 5-bromo
-4-Chloro-3-indolyl-β-D-galactopyranoside 4
0 μg / ml, 10 μg of isopropyl-β-D-thiogalactoside
/ ml, 50 μg / ml ampicillin agar plate medium (pH 7.0)
After culturing at 37 ° C for 18 hours, about 3,000 white colonies were collected using Amersham's “ECL Kit Protocol” No. 31
To 34 pages (1993), colony blotting was performed by the following method. An appropriately sized nylon membrane was placed on a blank agar medium, wetted on both sides, and carefully placed on a colony-formed agar medium. Both the nylon membrane and the medium were marked with a sterile needle to indicate colony orientation. After one minute, the nylon membrane was peeled off, and the colony was placed on a filter paper soaked in a denaturing solution (sodium chloride 1.5 M, sodium hydroxide 0.5 M) with the colony side facing up, and allowed to stand for 7 minutes. With the nylon membrane facing the colony facing up, place the neutralizing solution (sodium chloride 1.
0.5M Tris-HCl buffer containing 5M and 1mM EDTA
(pH 7.2)), allowed to stand for 3 minutes, and repeated using a new filter paper that had been freshly dampened with a neutralizing solution. The nylon membrane was washed with 2 × SSC, colony side up, placed on dry filter paper and air-dried. Next, let stand for 20 minutes on a filter paper impregnated with 0.4 M sodium hydroxide,
The plate was washed by shaking with SSC for 10 to 60 seconds and fixed on a nylon membrane. Separately, about 0.1 μl of the probe DNA prepared in Example 2.
g was labeled with an “ECL kit” (manufactured by Amersham) and hybridized to a colony of the transformant strain immobilized on the nylon membrane to select one transformant showing a remarkable association.

This transformant contained 100 μg / ampicillin /
2X YT broth (pH 7.0) containing the same, and incubate with shaking at 37 ° C for 18 hours.After completion of the culture, cells were collected from the culture by centrifugation, and the recombinant DNA was isolated by the usual alkaline method.
Was eluted out of the cells. Processed products are various restriction enzymes (EcoR
I, Sac I, Kpn I, Sma I, BamH I, Xba I, SalI
, Acc I, Hinc II, Pst I, Sph I, Hind III, Spe
I, Bln I, Fba I, Eco T22I, Bgl II, Xho I), cut in a conventional manner, reinserted into plasmids pUC18 and pUC19, purified and analyzed, and the cloned DNA was obtained.
Consisted of about 4500 bp. The 4500 bp DNA has about 2100 bp of DN from the N-terminus of trehalose phosphorylase on the 3 ′ side.
A was coded.

Further, in order to obtain C-terminal DNA, 1 μg of the recombinant DNA containing 4500 bp was added with about 10 units of each of the restriction enzymes Sac I and Sma I, and reacted at 30 ° C. for 2 hours to cut the DNA, followed by agarose gel electrophoresis. It was subjected to electrophoresis. SacI and SmaI digested DNA of about 500 bp was purified from agarose gel by a conventional method and used as a probe.

Purified genomic DNA solution prepared in Example 1
Take 5 μl (approximately 1 μg), add about 20 units of restriction enzyme Pst I, react at room temperature overnight, partially cut genomic DNA, 0.1-fold volume sodium acetate solution (pH 5.2) and
2.5 volumes ethanol was added and frozen at -80 ° C. After freezing, the mixture was centrifuged to obtain a precipitate. The precipitate thus obtained was dissolved in 10 μl of TE and subjected to agarose gel electrophoresis. The agarose gel was fixed on a nylon membrane by a conventional method. Separately, Sac I and Sma I cleavage probe DNA
Take about 0.1μg and use “ECL Kit” (Amersham)
And hybridized to the chromosomal DNA immobilized on the nylon membrane. As a result, a band showing a remarkable association was observed around 1700 bp. Then, the first embodiment
10 μl (approximately 2 μg) of the genomic DNA solution prepared in 1) was cleaved with the restriction enzyme PstI according to the method described above, and then subjected to agarose gel electrophoresis. This DNA near 1700 bp was cut out from an agarose gel and collected. Separately, 0.1 μg of plasmid vector pUC18 (manufactured by Takara Shuzo Co., Ltd.) was taken, digested with the restriction enzyme Pst I in a conventional manner, and the DNase
Add 0.1 μg of A fragment and 20 units of T4 DNA ligase and add
And left overnight to ligate to the DNA fragment. 100 μl of competent cell JM109 (manufactured by Takara Shuzo) is added to the obtained recombinant DNA, left still for 30 minutes under ice cooling, heated to 42 ° C., added with 2 × YT broth (pH 7.0), and shaken. Below, at 37 ℃ 1
After incubation for a time, the recombinant DNA was introduced into E. coli.

The transformant thus obtained was treated with 5-bromo
-4-Chloro-3-indolyl-β-D-galactopyranoside 4
0 μg / ml, 10 μg of isopropyl-β-D-thiogalactoside
plate containing agar / ml and 50 μg / ml ampicillin (pH
7.0), and after culturing at 37 ° C for 18 hours, about 2000 white colonies were fixed on a nylon membrane. Separately, Sac I, Sma
About 0.1 μg of I-cleaved probe DNA
(Amersham), and hybridized with the transformant colonies fixed on the nylon membrane to select one transformant that showed a remarkable association.

This transformant contained 100 μg / ampicillin /
2X YT broth (pH 7.0) containing the same, and incubate with shaking at 37 ° C for 18 hours.After completion of the culture, cells were collected from the culture by centrifugation, and the recombinant DNA was isolated by the usual alkaline method.
Was eluted out of the cells. When the treated product was purified and analyzed by a conventional method, the cloned DNA was composed of about 1700 base pairs, and did not contain the complete nucleotide sequence up to the C-terminus.

Further, to obtain C-terminal DNA, 1 μg of the recombinant DNA containing 1700 bp was added with about 10 units of each of the restriction enzymes Sac I and Pst I, and reacted at 37 ° C. for 1 hour to cut the DNA, followed by agarose gel. It was subjected to electrophoresis. 500bp
The nearby Sac I and Pst I digested DNA was purified from an agarose gel by a conventional method and used as a probe.

The purified genomic DNA solution prepared in Example 1
Take 5 μl (approximately 1 μg), add about 20 units of restriction enzyme Sac I, react at room temperature overnight, partially cut genomic DNA, and add 0.1-fold volume sodium acetate solution (pH 5.2), 2.5
Double volume ethanol was added and the mixture was frozen at -80 ° C. Frozen material
The precipitate was obtained by centrifugation. The precipitate thus obtained was dissolved in 10 μl of TE and subjected to agarose gel electrophoresis. The agarose gel was fixed on a nylon membrane by a conventional method. Separately, Sac I and Pst I cleavage probe DNA
0.1 μg was taken, labeled with an “ECL kit” (manufactured by Amersham), and hybridized to the genomic DNA fixed on the nylon membrane. As a result, a band showing a remarkable association at about 3000 bp was observed. Then, 10 μl (about 2 μg) of the genomic DNA solution prepared in Example 1 was cleaved with the restriction enzyme Sac I according to the method described above, and then subjected to agarose gel electrophoresis. This DNA near 3000 bp was cut out from an agarose gel and recovered. Separately, 0.1 μg of plasmid vector pUC18 (manufactured by Takara Shuzo Co., Ltd.) was taken, digested with the restriction enzyme Sac I in a conventional manner, and then the DNA obtained above was obtained.
The fragment was ligated to the DNA fragment by adding 0.1 μg of the fragment and 20 units of T4 DNA ligase and allowing to stand at 4 ° C. overnight. Competent cells JM109 (Takara Shuzo) obtained from the recombinant DNA
100 μl of the mixture, left for 30 minutes under ice-cooling, heated to 42 ° C., added 2 × YT broth (pH 7.0), and incubated with shaking at 37 ° C. for 1 hour to transfer the recombinant DNA to E. coli. Introduced.

The transformant thus obtained was treated with 5-bromo
-4-Chloro-3-indolyl-β-D-galactopyranoside 4
0 μg / ml, 10 μg of isopropyl-β-D-thiogalactoside
/ ml and ampicillin 50 μg / ml agar plate medium (pH 7.
0), and after culturing at 37 ° C. for 18 hours, about 2500 white colonies were fixed on a nylon membrane. Separately, Sac I, Pst
About 0.1 μg of I-cleaved probe DNA
(Amersham) and hybridized to the transformant colonies fixed on the nylon membrane to select one transformant showing a remarkable association.

This transformant contained 100 μg / ampicillin /
2X YT broth (pH 7.0) containing the same, and incubate with shaking at 37 ° C for 18 hours.After completion of the culture, cells were collected from the culture by centrifugation, and the recombinant DNA was isolated by the usual alkaline method.
Was eluted out of the cells. When the treated product was purified and analyzed by a conventional method, the cloned DNA was composed of about 3000 base pairs and contained a C-terminal nucleotide sequence. The genomic DNA of trehalose phosphorylase consists of about 2750 bp, and is about 50 to 60 bp from the trehalose phosphorylase start codon ATG.
There is a TATA box (RNA polymerase binding site) upstream of bp, and a CT box that is present in yeast and filamentous fungi and is important for determining the transcription start site is located about 10 to 45 bp upstream from the start codon, and introns are present in several places. Turned out to be inserted. In addition, the base sequence represented by SEQ ID NO: 4
It became clear that there was no mHI site, and it was used for the following experiments.

[0048]

Example 4 Preparation of trehalose phosphorylase mRNA
Glucose 4%, Yeast extract 0.75%, Malt extract 0.2
%, Gurifora-Furondo in medium consisting of 0.5% potassium dihydrogen phosphate and 0.05% magnesium sulfate (pH 5.5)
Then, the cells were inoculated, and cultured with rotation and shaking at 25 ° C. for 3 days by a conventional method. After centrifuging 300 ml of the culture solution, the cells were washed with sterilized water, liquid nitrogen was added to 6 g of cells obtained by suction filtration, and the mixture was ground in a mortar. Milled material is "RNAgents Total RN" issued by Promega
Extraction was carried out by the following method according to the method described in "A Isolation System Technical Bulletin", pp. 3-7 (1993). Add 4 ml of cold guanidine thiocyanate denaturing solution to the trituration, stir for 1 minute,
Further, 400 μl of 2M sodium acetate solution (pH 4.0) and phenol: chloroform: isoamyl alcohol = 25:
4 ml of a 24: 1 (v: v: v) solution was added, mixed by inversion, stirred for 10 seconds, and then centrifuged at 15000 × g at 4 ° C. for 10 minutes to collect 4 ml of an aqueous layer. Again, add 4 ml of a solution consisting of phenol: chloroform: isoamyl alcohol = 25: 24: 1, stir for 30 seconds, centrifuge at 15000 × g at 4 ° C. for 10 minutes, and add 3.8 ml of isopropanol to 3.8 ml of the collected aqueous layer. The mixture was allowed to stand at -20 ° C for 1 hour. After standing 15000 × g, 4
The pellet was collected by centrifuging at 70 ° C. for 1 minute, washed with 70% ethanol, dried, and dissolved in 100 μl of water.
About 1 mg of RNA was obtained.

Next, 420 μl of sterilized water was added to 80 μl of the RNA solution. The solution is “PolyAT tract” issued by Promega.
mRNA Isolation System Technical Manual "
Purification was carried out according to the method described on pages 4 to 7 (1992) by the following method. After heating the solution at 65 ° C for 10 minutes, a biotinylated oligo (dT) probe (50 pmol / μ
l) 3 μl and 13 μl of 20 × SSC were added, mixed by inversion, and allowed to stand at room temperature for 10 minutes. Add this solution to Streptavidin MagneSpher
0.5 × including e Particles (hereinafter referred to as SA-PMPs)
It was added to 0.1 ml of SSC, mixed by inversion, and incubated at room temperature for 10 minutes. After incubation, the SA-PMPs were captured on a magnetic stand and the supernatant was removed without disturbing the SA-PMPs pellet. 0.1 × SSC 0.3ml in SA-PMPs for washing
After adding and inverting to completely disperse the mixture, SA-PMPs were caught by a magnetic stand, and the operation of removing the supernatant without disturbing the SA-PMPs pellet was performed four times. Next, 100 μl of sterile water was added to the SA-PMPs pellet, and the mixture was completely dispersed by inversion and mixed. The SA-PMPs were caught by a magnetic stand, and the supernatant was recovered without disturbing the SA-PMPs pellet. Further, 150 μl of sterilized water was added and the same operation was repeated to obtain a total of 250 μl of the mRNA solution. To this solution was added 25 μl of a 3 M sodium acetate solution and 275 μl of isopropanol, and the mixture was allowed to stand at −20 ° C. overnight.
Centrifuge at 4 ° C for 5 minutes to collect the pellet, 70%
After washing with ethanol, the pellet was dried and dissolved in 10 μl of sterile water. 1 μl of the mixture was placed on an agar plate containing ethidium bromide, and irradiated with ultraviolet light to confirm the presence of mRNA.

[0050]

Example 5 Trehalose phosphorylase double chain cDN
Synthesis of A] Double-stranded cDNA is available from Takara Shuzo “RNA LA PCR
It was synthesized according to the method described in "Kit Instruction Manual", pp. 2-11 (1995). That is, 4 μl of 25 mM magnesium chloride and 10 × RNA P were placed in a 0.2 ml microtube.
2 μl of CR buffer, 8 μl of 2.5 mM dNTP mixture,
RNase inhibitor 0.5μl, specific downstream PCR primer (5'-CGGGGATCCTTTTTTTTTTTTTTTTTT-3 'polyA not present in trehalose phosphorylase DNA
1 μl (50 pmol / μl) of Bam HI site), 1 μl of the mRNA purified in Example 4, and 2.5 μl of sterilized water were sequentially added to make a total volume of 19 μl. 5 units (1 μl) of reverse transcriptase was added thereto, and the mixture was incubated at 42 ° C. for 30 minutes to synthesize a first strand.

Next, 25 mM magnesium chloride 12
μl, 10 × LA PCR buffer 8 μl, specific upstream PCR primer (5'-CACTGGATCCATGGCTCCTCCCCACCAGTTCCAGTCC-
Gene of the genomic DNA sequence shown in SEQ ID NO: 4 in the 3 'sequence listing
A probe having a nucleotide sequence represented by 5'-ATGGCTCCTCCCCACCAGTTCCAGTCC-3 'was combined with 1 µl (20 pmol / µl) of Bam HI site not present in trehalose phosphorylase DNA) and 58.5 µl of sterilized water to make a total volume of 99.5 µl. TaKa
After 2.5 units (0.5 μl) of Ra LA Taq were sequentially added and incubated at 95 ° C. for 2 minutes, the following steps 1 to 3 were repeated for 40 cycles to amplify the second strand and cDNA. Step 1: 95 ℃, 30 seconds Step 2: 67
° C, 30 seconds Step 3: 72 ° C, 3 minutes 30 seconds. Reaction solution 20μ
When l was subjected to agarose gel electrophoresis, one band was obtained at around 2200 bp.

The cDNA of about 2200 bp was cut out from an agarose gel, recovered, and digested with a restriction enzyme BamHI by a conventional method. Separately, take 0.1 μg of plasmid vector pUC18 (Takara Shuzo) and use the restriction enzyme BamHI
After the cleavage, the cDNA fragment obtained above and T4
After adding 20 units of DNA ligase, the mixture was allowed to stand at 4 ° C. overnight to ligate to the cDNA fragment. Obtained recombinant cDN
100 μl of competent cell JM109 (Takara Shuzo) was added to A, allowed to stand under ice cooling for 30 minutes, heated to 42 ° C., 2 × YT broth (pH 7.0) was added, and the mixture was shaken at 37 ° C. After incubating for 1 hour, the recombinant DNA was introduced into E. coli.

The thus obtained transformant was treated with 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside at 40 μg / ml and isopropyl-β-D-thiogalactoside.
Agar plates containing 10 μg / ml and 50 μg / ml ampicillin
(pH 7.0), and after culturing at 37 ° C. for 18 hours, about 20 white colonies were fixed on a nylon membrane. Separately, Sac I, Ps
About 0.1 μg of tI-cleaved probe DNA is
(Amersham) and hybridized to the transformant colonies fixed on the nylon membrane, and 18 transformants showing remarkable association were selected.

This transformant contained 100 μg / ampicillin /
2X YT broth (pH 7.0) containing the same, and incubate with shaking at 37 ° C for 18 hours.After completion of the culture, cells were collected from the culture by centrifugation, and the recombinant DNA was isolated by the usual alkaline method.
Was eluted out of the cells. The treated product was purified and analyzed by a conventional method. The results are as shown in SEQ ID NOs: 3 and 5 in the Sequence Listing, and 1 to 75 of the nucleotide sequence (amino acid sequence 1 to 25)
Indicates a signal peptide, and 76 to 2196 (amino acid sequences 26 to 732) encode a mature trehalose phosphorylase polypeptide.

[0055]

Example 6 Construction of Expression Vector To 12 μg of pUC18 in which the trehalose phosphorylase cDNA obtained in Example 5 was cloned, about 12 units of the restriction enzyme BamHI were added.
After cutting at 30 ° C. for 1 hour, 0.1 volume sodium acetate solution (pH 5.2) and 2.5 volume ethanol were added,
Frozen at ° C. The frozen material was centrifuged to obtain a precipitate. The precipitate thus obtained was dissolved in 10 μl of TE and subjected to agarose gel electrophoresis. A band of about 2200 bp was excised from the agarose gel and recovered by a conventional method.

Separately, 1 μm of pYES2.0 (manufactured by Invitrogin)
g, add about 12 units of restriction enzyme Bam HI, react at 30 ° C for 1 hour, cut, and add 0.1 volume sodium acetate solution (pH
5.2), 2.5 volumes of ethanol were added, and the mixture was frozen at -80 ° C. The frozen material is centrifuged to obtain a precipitate, and the DN obtained above is centrifuged.
Add about 0.3 μg of the A fragment and 12 units of T4 DNA ligase,
It was ligated to the DNA fragment by allowing to stand at ℃ overnight. The obtained recombinant DNA was named "pYGT1" (FIG. 1), and the competent cell Saccharomyces cerevisiae (Saccharomyces cerevisiae) YPH250 (IFO 10502, ATCC96519) was used.
After adding 100 μl and standing at 30 ° C. for 30 minutes, 700 μl of TE containing lithium thiocyanate 0.1M and 30% (w / v) polyethylene glycol 3350 was added, and the mixture was incubated with shaking at 30 ° C. for 1 hour to obtain “pYGT1”. Was introduced into yeast.

The transformant thus obtained was lysin 30
μg / ml, tryptophan 100μg / ml, adenine 30μg / m
1, 30 μg / ml of leucine and 30 μg / ml of histidine were inoculated on an agar plate medium, cultured at 30 ° C. for 72 hours, and then 7 colonies were selected.

[0058]

Example 7 Production of Recombinant Enzyme by Transformant A 20-cm long, 1.8-cm inner diameter A test tube was charged with 10 ml of a liquid medium consisting of 2.5% glucose, 1% yeast extract, 2% bactopeptone and water at 121 ° C. And autoclaved for 20 minutes. After cooling, the above transformant was inoculated into this medium, and cultured with shaking at 30 ° C. for 2 days by a conventional method. 10 ml of the culture was collected by centrifugation. Next, 3% of galactose, 1% of yeast extract, and bactopeptone were placed in a test tube of 20cm in length and 1.8cm in inner diameter.
Add 10 ml of a liquid medium consisting of 2% and water.
After sterilizing and cooling in an autoclave for 1 minute, the collected transformants were resuspended and cultured with shaking at 30 ° C. for 2 days by a conventional method. 10 ml of the culture was collected by centrifugation. This cell is
Trehalose 200 mM, Glutathione 10 mM and EDTA 0.16
300 μl of 40 mM potassium phosphate buffer (pH 7.0) containing mM
After suspension, about 100 mg of glass beads were added, and the mixture was crushed with an automatic mixer S-10 (manufactured by Taiyo Kagaku Kogyo). The crushed product was centrifuged at 15000 × g for 10 minutes, and the supernatant from which the precipitate was removed was used as a crude enzyme solution.

[0059]

Example 8 Method for measuring activity of crude enzyme solution The following reaction solution was prepared for measuring trehalose phosphorylase activity. Potassium phosphate 40 mM (pH 7.0), trehalose 200 mM, glutathione 10 mM, EDTA 0.16 mM, NADP 1 mM, magnesium chloride
1.3 mM, α-glucose-1,6-diphosphate 0.067 mM, phosphoglucomutase (Boehringer Mannheim) 1.
100 μl of the crude enzyme solution was added to 1900 μl of a reaction solution consisting of 1.75 units / ml and sterile water at 55 units / ml, glucose-6-phosphate dehydrogenase (Boehringer Mannheim), and heated at 30 ° C.
The NADPH produced in one minute was measured at a wavelength of 340 nm. Trehalose is converted to glucose and α-glucose-1-phosphate by trehalose phosphorylase. The generated α-glucose-1-phosphate is added α
-It is converted to α-glucose-6-phosphate and α-glucose-1,6-diphosphate by phosphoglucomutase added together with glucose-1,6-diphosphate. The generated α-glucose-6-phosphate and the added NADP correspond to the added glucose.
6-Phosphogluconolactone and NADPH are formed by -6-phosphate dehydrogenase.

The control was a yeast YPH250 having only pYES2.0 without trehalose phosphorylase cDNA.
Was cultured in the same manner as above using a liquid medium having the same composition as above. The control strain NADPH production was 1.12
× 10 ^-3 μmol / ml / min. On the other hand, 7 transformants were 4.00 × 10 ⁻³ , 4.61 × 10 ⁻³ , 4.29 × 10 ⁻³ , 3.68 × 1
0 ^-3 , 3.20 × 10 ^-3 , 4.81 × 10 ^-3 , 2.80 × 10 ^-3 μmol / ml / mi
n, which was significantly higher than the control, about 3.5 times. The specific activities of these strains are 4.10 × 10 ^-3 , 4.55 × 10 ^-3 ,
4.34 × 10 ^-3 , 3.96 × 10 ^-3 , 3.25 × 10 ^-3 , 6.44 × 10 ^-3 , 2.
It was 74 × 10 ⁻³ U / mg-protein (Table 1).

As described above, D-glucose and α-D-
A gene for an enzyme that converts glucose 1-phosphate to trehalose and trehalose to D-glucose and α-D-glucose 1-phosphate was found. The present invention has created this enzyme by applying recombinant DNA technology. The recombinant enzyme referred to in the present invention is a recombinant D
It refers to all enzymes created by NA technology that convert D-glucose and α-D-glucose 1-phosphate to trehalose and convert trehalose to D-glucose and α-D-glucose 1-phosphate. The recombinant enzyme of the present invention usually has an amino acid sequence elucidated by the present inventors,
For example, the amino acid sequence shown in SEQ ID NO: 3 in the sequence listing or an amino acid sequence homologous thereto can be used. A variant having an amino acid sequence homologous to the amino acid sequence shown in SEQ ID NO: 3 can be prepared without substantially changing the desired properties.
Can be obtained by substituting, deleting or adding one or more of the constituent amino acids in the amino acid sequence of the above with another amino acid. In addition, even if it is the same DNA,
The components of the nutrient medium used for culturing the transformant containing the DNA, the culturing temperature,
Depending on culture conditions such as pH, or D
Due to modification after the expression of NA, the desired properties are retained, but one or more amino acids near the N-terminal and C-terminal in the amino acid sequence shown in SEQ ID NO: 3 are deleted, or the N-terminal May produce a variant in which one or more amino acids have been newly added. Such mutants are also included in the recombinant enzyme of the present invention as long as they have the desired properties.

The recombinant enzyme according to the present invention has a specific DN
A can be collected from a culture of a transformant containing A. The transformant used in the present invention can be obtained, for example, by appropriately introducing into a host a DNA having the nucleotide sequence shown in SEQ ID NO: 5 in the Sequence Listing, a nucleotide sequence homologous thereto, or a nucleotide sequence complementary thereto. . In addition, one or two or more bases may be replaced with other bases by using the degeneracy of the genetic code without changing the amino acid sequence to be encoded. Also, in order for the DNA to actually express the production of the recombinant enzyme in the host,
It goes without saying that one or more bases in the base sequence encoding the recombinant enzyme or a homologous mutant thereof can be appropriately replaced with another base.

The DNA used in the present invention does not matter whether it is naturally derived or artificially synthesized, as long as it has the above-mentioned sequence. Natural sources include, for example, Grifola frontosa (CM
-236, Micro-engineering Kenjiro No. 35). From the cells of these microorganisms, for example, mRN encoding the amino acid sequence shown in SEQ ID NO: 3 in the Sequence Listing
A is obtained. That is, such a microorganism is inoculated into a nutrient medium, cultured for about 1 day to 1 month under aerobic conditions, and then the cells are collected from the culture and subjected to cell lysing enzymes such as lysozyme and β-glucanase, grinding and the like. The mRNA is eluted out of the cells by ultrasonic treatment. At this time, a protein hydrolase such as a protease may be used in combination with the cell wall lysing enzyme, or a surfactant such as SDS may be coexistent or freeze-thawed when the cells are subjected to ultrasonic treatment. The target DNA can be obtained by purifying the mRNA from the thus-treated product by a conventional method and using reverse transcriptase or the like. on the other hand,
In order to artificially synthesize DNA, for example, the DNA is chemically synthesized based on the nucleotide sequence shown in SEQ ID NO: 5 in the Sequence Listing, or the DNA encoding the amino acid sequence shown in SEQ ID NO: 3 is inserted into an appropriate autonomously replicable vector. Then, a transformant obtained by introducing the recombinant DNA into a host as appropriate is cultured, a cell is collected from the culture, and a plasmid containing the DNA is collected from the cell.

The DNA is usually introduced into a host in the form of a recombinant DNA. Recombinant DNA usually comprises a DNA and a vector capable of autonomous replication, and once the DNA is available, it can be prepared relatively easily by ordinary recombinant DNA techniques. An example of such a vector is pB
R322, pUC18, Bluescript II SK (+), pkk223-3, pET
16b, pUB110, pTZ4, pC194, HV14, TRp7, YEp7, pBS
7, plasmid vectors such as pYES2.0, λgt ・ λC,
Phage vectors such as λgt · λB, ρ11, φ1, φ105 and the like. Among them, pBR322, pUC18, luescript II SK (+),
pkk223-3, pET16b, λgt.λC, λgt.λB are preferable, and expressed in Bacillus subtilis, pUB110, pTZ4, pC194,
ρ11, φ1 and φ105 are preferred, whereas for expression in yeast, pYES2.0 is preferred. pHV14, TRp7, YE
p7 and pBS7 are useful when replicating recombinant DNA in more than one host.

To insert DNA into such a vector,
General methods commonly used in the art are employed. Specifically, first, a gene containing DNA and an autonomously replicable vector are cut with a restriction enzyme or ultrasonic waves,
Next, the generated DNA fragment and the vector fragment are ligated.
Restriction enzymes that specifically act on nucleotides in the cleavage of genes and vectors, especially type II restriction enzymes, in particular
Sau3A I, EcoR I, Hind III, BamH I, SalI, Xba I,
If Sac I, Pst I or Bgl II is used, DN
It becomes easy to ligate the A fragment and the vector fragment. DN
To ligate the A fragment and the vector fragment,
After annealing both, DNA in vivo or in vitro
A ligase may be applied. The thus obtained recombinant DNA can be replicated indefinitely by appropriately introducing it into a host to form a transformant and culturing the transformant.

The replicable recombinant DNA thus obtained can be introduced into an appropriate host microorganism such as Escherichia coli, Bacillus subtilis, actinomycetes and yeast. When the host is Escherichia coli, the host may be cultured in the presence of recombinant DNA and calcium ions.On the other hand, when the host is yeast, the competent cell method, protoplast method or electroporation method may be used. Good. When the host is Bacillus subtilis, a competent cell method, a protoplast method or an electroporation method may be applied.

When the transformant thus obtained is cultured in a nutrient medium, the recombinant enzyme is produced inside and outside the cells.
The nutrient medium is usually a carbon source, a nitrogen source, minerals and, if necessary, a general liquid medium supplemented with micronutrients such as amino acids and vitamins, and as the individual carbon sources, for example, starch, Sugar sources such as starch hydrolyzate, glucose, fructose, sucrose and trehalose, and nitrogen sources include, for example, ammonia, ammonium salts, urea, nitrate, peptone, yeast extract, defatted soybean, corn steep liquor and meat extract And nitrogen-containing inorganic or organic substances. The transformant is inoculated into such a nutrient medium, and the nutrient medium is heated to a temperature of 20 to 50 ° C.
By culturing for about 1 to 6 days under aerobic conditions such as aeration and stirring while maintaining the pH at 2 to 9, a culture containing the recombinant enzyme can be obtained. This culture can be used as it is as an enzymatic agent.However, prior to use, usually, if necessary, the cells are crushed with ultrasonic waves, vortex or cell lysing enzyme, and then the enzyme is filtered, centrifuged, etc. Is separated from the cells or the crushed cells and purified. For purification, a general method for purifying an enzyme can be employed.For example, concentration into a culture from which bacterial cells or crushed bacterial cells have been removed, salting out, dialysis,
One or a combination of two or more of fractional precipitation, gel filtration chromatography, ion exchange chromatography, hydrophobic chromatography, affinity chromatography, gel electrophoresis, isoelectric focusing and the like may be applied.

As described above, the recombinant enzyme of the present invention converts D-glucose and α-D-glucose 1-phosphate into trehalose, and converts trehalose into D-glucose and α-D-glucose.
It has the effect of converting to glucose 1-phosphate. Trehalose has a mellow and elegant sweetness and does not have a reducing group in the molecule, and thus has a great advantage that a food can be sweetened without fear of coloring or deterioration. By utilizing this property of the recombinant enzyme, it can be converted to trehalose having high added value.

[0069]

As described above, the present invention converts D-glucose and α-D-glucose 1-phosphate into trehalose, and converts trehalose into D-glucose and α-D-glucose 1-phosphate. It opens the way to produce large scale and efficient enzymes by converting recombinant enzymes to recombinant DNA technology. Trehalose has a mellow and elegant sweetness and does not have a reducing group in the molecule, so that foods and drinks can be sweetened without fear of coloring or deterioration. In addition, the recombinant enzyme of the present invention is an enzyme whose amino acid sequence has been revealed,
It can be used with confidence in the production of trehalose, which is premised on its use in foods and drinks and pharmaceuticals.

[0070]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 21 Sequence type: Amino acid Topology: Linear Sequence type: Peptide Fragment type: N-terminal fragment Sequence Lys Arg Pro Asn Ile Pro Gly Tyr Thr Ser Leu Thr Pro Met Trp Ala 15 10 15 Gly Ile Ala Gly Ala 20

SEQ ID NO: 2 Sequence length: 9 Sequence type: amino acid Topology: linear Sequence type: peptide Fragment type: middle fragment Sequence Lys Gly Thr Trp Asn Ser Val Ile Lys 15

SEQ ID NO: 3 Sequence length: 732 Sequence type: amino acid Topology: linear Sequence type: polypeptide Signal peptide: from Met 1 to Ser 25 Sequence Met Ala Pro Pro His Gln Phe Gln Ser Lys Pro Ser Asp Val Ile Arg 1 5 10 15 Arg Arg Leu Ser Ser Ala Val Ser Ser Lys Arg Pro Asn Ile Pro Gly 20 25 30 Tyr Thr Ser Leu Thr Pro Met Trp Ala Gly Ile Ala Gly Ala Val Val 35 40 45 Asn Asn Asn Thr Gln Phe Glu Val Ala Ile Ser Ile His Asp Ser Val 50 55 60 Tyr Asn Thr Asp Phe Ala Ser Ser Val Val Pro Tyr Ser Pro Asn Glu 65 70 75 80 Pro Glu Ala Gln Ala Gly Ile Ile Glu Lys His Val Leu Glu Thr Leu 85 90 95 Arg Lys Phe Ser Thr Glu His Met Cys Lys Phe Leu Gly Ala Gly Val 100 105 110 Thr Val Ile Leu Leu Arg Glu Ala Pro Asn Leu Cys Thr Arg Leu Trp 115 120 125 Leu Asp Met Asp Ile Val Pro Ile Val Phe Asn Ile Lys Pro Phe His 130 135 140 Thr Asp Ser Ile Thr Arg Pro Asn Val Arg His Arg Ile Ser Ser Thr 145 150 155 160 Thr Gly Ser Tyr Val Pro Ser Gly Ala Gl u Thr Pro Thr Val Tyr Tyr 165 170 175 Asp Pro Ala Gln Leu Gln Asp Pro Asn Lys Leu Ser Ala Asn Val Gln 180 185 190 Thr Arg Leu Pro Ile Pro Arg Thr Val Asp Glu Gln Ala Asp Ser Ala 195 200 205 Ala Arg Lys Cys Ile Met Tyr Phe Gly Pro Gly Asn Asn Pro Arg Leu 210 215 220 Gln Ile Gly Pro Arg Asn Gln Val Ala Val Asp Ala Gly Gly Lys Ile 225 230 235 240 His Leu Ile Asp Asp Ile Asp Glu Tyr Arg Lys Thr Val Gly Lys Gly 245 250 255 Thr Trp Asn Ser Val Ile Lys Leu Ala Asp Glu Leu Arg Glu Lys Lys 260 265 270 Ile Lys Ile Gly Phe Phe Ser Ser Thr Pro Gln Gly Gly Gly Val Ala 275 280 285 285 Leu Met Arg His Ala Ile Ile Arg Phe Phe Thr Ala Leu Asp Val Asp 290 295 300 Ala Ala Trp Tyr Val Pro Asn Pro Ser Pro Ser Val Phe Arg Thr Thr 305 310 315 320 Lys Asn Asn His Asn Ile Leu Gln Gly Val Ala Asp Pro Ser Leu Arg 325 330 335 Leu Thr Lys Glu Ala Ala Asp Asn Phe Asp Ser Trp Ile Leu Lys Asn 340 345 350 Gly Leu Arg Trp Thr Ala Glu Gly Gly Pro Leu Ala Pro Gly Gly Val 355 360 365 Asp Ile Ala Phe Ile Asp Asp Pro Gln Met P ro Gly Leu Ile Pro Leu 370 375 380 Ile Lys Arg Ile Arg Pro Asp Leu Pro Ile Ile Tyr Arg Ser His Ile 385 390 395 400 Glu Ile Arg Ser Asp Leu Val His Val Lys Gly Ser Pro Gln Glu Glu 405 410 415 Val Trp Asn Tyr Leu Trp Asn Asn Ile Gln His Ser Asp Leu Phe Ile 420 425 430 Ser His Pro Val Asn Lys Phe Val Pro Ser Asp Val Pro Leu Glu Lys 435 440 445 Leu Ala Leu Leu Gly Ala Ala Thr Asp Trp Leu Asp Gly Leu Ser Lys 450 455 460 His Leu Asp Ala Trp Asp Ser Gln Tyr Tyr Met Gly Glu Phe Arg Asn 465 470 475 480 Leu Cys Val Lys Glu Lys Met Asn Glu Leu Gly Trp Pro Ala Arg Glu 485 490 495 Tyr Ile Val Gln Ile Ala Arg Phe Asp Pro Ser Lys Gly Ile Pro Asn 500 505 510 Val Ile Asp Ser Tyr Ala Arg Phe Arg Lys Leu Cys Val Asp Lys Val 515 520 525 Met Glu Asp Asp Ip Pro Gln Leu Leu Leu Cys Gly His Gly Ala Val 530 535 540 Asp Asp Pro Asp Ala Ser Ile Ile Tyr Asp Gln Val Leu Gln Leu Ile 545 550 555 560 His Ala Lys Tyr Lys Glu Tyr Ala Pro Asp Ile Val Val Met Arg Cys 565 570 575 Pro Pro Ser Asp Gln Leu Leu Asn Thr Leu M et Ala Asn Ala Lys Phe 580 585 590 Ala Leu Gln Leu Ser Thr Arg Glu Gly Phe Glu Val Lys Val Ser Glu 595 600 605 Ala Leu His Ala Gly Lys Pro Val Ile Ala Cys Arg Thr Gly Gly Ile 610 615 620 Pro Leu Gln Ile Glu His Gly Lys Ser Gly Tyr Leu Cys Glu Pro Gly 625 630 635 640 Asp Asn Ala Ala Val Ala Gln His Met Leu Asp Leu Tyr Thr Asp Glu 645 650 655 Asp Leu Tyr Asp Thr Met Ser Glu Tyr Ala Arg Thr His Val Ser Asp 660 665 670 Glu Val Gly Thr Val Gly Asn Ala Ala Ala Trp Met Tyr Leu Ala Val 675 680 685 Met Tyr Val Ser Arg Gly Val Lys Leu Arg Pro His Gly Ala Trp Ile 690 695 700 Asn Asp Leu Met Arg Thr Glu Met Gly Glu Pro Tyr Arg Pro Gly Glu 705 710 715 720 Pro Arg Leu Pro Arg Gly Glu Leu His Val Gln Gly 732 725 730

SEQ ID NO: 4 Sequence length: 2817 Sequence type: nucleic acid Topology: linear Sequence type: genomic DNA SEQ TGTCCCTATA TAACGTCCGT TATCTCCCCT TTCCCCTCCT CTCCCTCTCC CTCCGCACTT 60 TCAAGATGGC TCCTCCCCAC CAGTTCCAGT CCAAACCCTC CGATGTCATC CGCCGCAGGC 120 TCTCCAGCGC AGTCTCAAGC AAGCGTCCCA ATATCCCAGG GTACACCAGC CTCACTGTGA 180 GTCAATCTCC CACACATCGA GCCGCATCGT CGATCCATCT CACATCCGAT TGCTGCTAGC 240 CCATGTGGGC GGGTATCGCT GGAGCCGTGG TCAACAACAA TACCCAATTC GAAGTTGCTA 300 TCTCCATCCA CGACTCCGTT TACAACACGG ACTTTGCGTC GTCCGTTGTC CCGTACTCTC 360 CCAATGAGCC GGAGGCGCAG GCCGGTATCA TCGAGAAGCA TGTCCTCGAG ACTCTCCGCA 420 AGTTCTCCAC GGAGCATATG TGCAAGTTCC TGGGCGCCGG TGTTACTGTG ATCCTTCTCA 480 GAGAGGTGCG CAGTCTGACG TTCTTCCCTG TAACCATTGT TTGACATCCT GATGCCCCTC 540 GCACCAGGCC CCGAATCTGT GCACTCGTCT CTGGCTAGAC ATGGATATCG TTCCCATCGT 600 GTTCAACATC AAGCCTTTCC ACACAGACTC GATTACCAGG CCCAATGTCA GGCACCGCAT 660 CTCTTCCACC ACTGGTTCTT ACGTCCCGTC TGGAGCCGAG ACGCCGACTG TGTATTATGA 720 CCCCGCGCAG CTGCAAGACC CCAACAAACT GTCGGCCAAC GTGCAGACGC GGCTGCCGAT 780 ACCTCGCACA GTCGACGAAC AGGCAGACTC GGCAGCACGG AAGTGCATCA TGTATTTTGG 840 TCCTGGAAAC AAC CCGCGCC TGCAGATCGG CCCGCGCAAC CAAGTTGCGG TCGACGCTGG 900 CGGGAAGATC CACCTCATCG ACGACATCGA CGAGTACCGC AAGACGGTGG GCAAGGGCAC 960 TTGGAACTCG GTCATCAAGC TTGCCGACGA ACTGCGCGAG AAGAAAATCA AGATTGGCTT 1020 CTTCTCCTCG ACGCCGCAAG GAGGTAAGCG CCGTCCCGTT TTGGATGCGG GGTAGCTCGG 1080 CTTCCCCACA TCGTCGTGCG GAGTTTGATT GCTTCTTTTC TTTCTCATTG GACGGTCGGA 1140 CCTATTATCG GCCTTTTCAG GAGGAGTTGC CCTTGTGAGT GTTCTCGTCC GGCCGGCTCT 1200 ACCTCCGGAG ATGCTGAATA TTTGACAGAT GCGTCATGCG ATCATCCGTT TCTTCACCGC 1260 GCTCGATGTC GATGCCGCCT GGTCAGTTCT TTCTTCTCTC CGTACTCTGC GGAGGTCGAG 1320 ATATCCGTGT TAACCGTCCC GATGTGGCAG GTATGTGCCG AACCCTTCAC CGTCCGTCTT 1380 CCGGACGACC AAGAACAACC ACAACATCCT CCAGGGTGTG GCTGATCCGA GTCTTCGCCT 1440 CACCAAGGAG GCGGCAGACA ACTTCGATTC CTGGATTCTC AAGAATGGGC TCCGTTGGAC 1500 TGCGGAAGGC GGACCTCTTG CCCCGGGCGG GGTCGATATT GCCTTCATTG GTTAGTCCGT 1560 TCTGCAAGCT CAGGATTTAG GTTAGCTTCC GTGTCGTGCG GTGTTGATTG CCCCGCAGAT 1620 GACCCTCAAA TGCCGGGCCT TATCCCGCTC ATCAAGCGCA TCCGGCCGGA CCTCCCGATC 1680 ATATACCGCT CGCACATCGA GATCCGAAGC GATCTTGTCC ATGTAAAGGG CTCGCCACAG 1740 GAGGAGGTGT GGAACTATCT CTGGAACAAC ATCCAACATT CGGATCTCTT CATCAGCCAC 1800 CCCGTCAACA AATTTGTTCC AAGCGATGTC CCGCTCGAGA AGCTTGCCCT CCTGGGTGCT 1860 GCTACCGACT GGTGTGTCCT ATCTATTGAC TTCTTACCTT GACGTGATAG CTAAACATGC 1920 TGTCGCAGGT TGGATGGACT GAGCAAGCAT CTCGACGCAT GGGACTCGCA GTACTACATG 1980 GGGGAGTTCC GCAACTTGTG CGTAAAAGAG AAGATGAACG AGCTCGGATG GCCTGCACGC 2040 GAATATATCG TGCAGATCGC TCGCTTCGAC CCGTCCAAGG GTATCCCGAA CGTGATCGAC 2100 TCGTACGCGC GCTTCCGGAA GCTCTGCGTC GACAAGGTCA TGGAAGACGA CATCCCACAG 2160 CTCCTGCTCT GTGGTCACGG CGCCGTGGAC GACCCCGACG CGAGCATCAT CTATGACCAG 2220 GTCTTGCAGC TGATCCACGC TAAATATAAG GAGTACGCGC CCGACATCGT CGTGATGCGC 2280 TGTCCGCCGA GTGATCAGTG TAAGTAGACT TACCCCAAGT TCGGAATGAT ACTGATGTTC 2340 TCTGTTTTGT ATACAGTACT GAACACACTC ATGGCCAATG CGAAGTTCGC GCTACAGCTC 2400 TCGACGCGTG AGGGCTTCGA AGTAAAGGTT TCAGAGGCCT TGCACGCAGG CAAGCCCGTC 2460 ATCGCATGTC GCACGGGCGG CATCCCGCTG CAGATTGAGC ATGGAAAGAG CGGATACCTC 2520 TGCGAGCCGG GCGACAACGC AGCAGT TGCG CAGCACATGC TCGACTTGTA CACGGACGAG 2580 GACCTGTATG ACACGATGAG CGAGTACGCG CGCACGCACG TCAGCGACGA GGTGGGCACC 2640 GTGGGCAACG CGGCTGCGTG GATGTACCTC GCTGTCATGT ACGTGAGTCG CGGCGTCAAG 2700 CTCCGCCCGC ACGGCGCGTG GATCAACGAC CTGATGCGTA CGGAGATGGG CGAGCCATAC 2760 CGGCCTGGAG AGCCCCGCCT CCCGCGCGGC GAACTGCATG TGCAGGGATG AGAATAG 2817

SEQ ID NO: 5 Sequence length: 2199 Sequence type: Nucleic acid Topology: Linear Sequence type: cDNA Start codon: 1-3 ATG Stop codon: TGA sequence of 2197-2199 ATGGCTCCTC CCCACCAGTT CCAGTCCAAA CCCTCCGATG TCATCCGCCG CAGGCTCTCC 60 AGCGCAGTCT CAAGCAAGCG TCCCAATATC CCAGGGTACA CCAGCCTCAC TCCCATGTGG 120 GCGGGTATCG CTGGAGCCGT GGTCAACAAC AATACCCAAT TCGAAGTTGC TATCTCCATC 180 CACGACTCCG TTTACAACAC GGACTTTGCG TCGTCCGTTG TCCCGTACTC TCCCAATGAG 240 CCGGAGGCGC AGGCCGGTAT CATCGAGAAG CATGTCCTCG AGACTCTCCG CAAGTTCTCC 300 ACGGAGCATA TGTGCAAGTT CCTGGGCGCC GGTGTTACTG TGATCCTTCT CAGAGAGGCC 360 CCGAATCTGT GCACTCGTCT CTGGCTAGAC ATGGATATCG TTCCCATCGT GTTCAACATC 420 AAGCCTTTCC ACACAGACTC GATTACCAGG CCCAATGTCA GGCACCGCAT CTCTTCCACC 480 ACTGGTTCTT ACGTCCCGTC TGGAGCCGAG ACGCCGACTG TGTATTATGA CCCCGCGCAG 540 CTGCAAGACC CCAACAAACT GTCGGCCAAC GTGCAGACGC GGCTGCCGAT ACCTCGCACA 600 GTCGACGAAC AGGCAGACTC GGCAGCACGG AAGTGCATCA TGTATTTTGG TCCTCGACGAC GG CCCGCGCAAC CAAGTTGCGG TCGACGCTGG CGGGAAGATC 720 CACCTCATCG ACGACATCGA CGAGTACCGC AAGACGGTGG GCAAGGGCAC TTGGAACTCG 780 GTCATCAAGC TTGCCGACGA ACTGCGCGAG AAGAAAATCA AGATTGGCTT CTTCTCCTCG 840 ACGCCGCAAG GAGGAGGAGT TGCCCTTATG CGTCATGCGA TCATCCGTTT CTTCACCGCG 900 CTCGATGTCG ATGCCGCCTG GTATGTGCCG AACCCTTCAC CGTCCGTCTT CCGGACGACC 960 AAGAACAACC ACAACATCCT CCAGGGTGTG GCTGATCCGA GTCTTCGCCT CACCAAGGAG 1020 GCGGCAGACA ACTTCGATTC CTGGATTCTC AAGAATGGGC TCCGTTGGAC TGCGGAAGGC 1080 GGACCTCTTG CCCCGGGCGG GGTCGATATT GCCTTCATTG ATGACCCTCA AATGCCGGGC 1140 CTTATCCCGC TCATCAAGCG CATCCGGCCG GACCTCCCGA TCATATACCG CTCGCACATC 1200 GAGATCCGAA GCGATCTTGT CCATGTAAAG GGCTCGCCAC AGGAGGAGGT GTGGAACTAT 1260 CTCTGGAACA ACATCCAACA TTCGGATCTC TTCATCAGCC ACCCCGTCAA CAAATTTGTT 1320 CCAAGCGATG TCCCGCTCGA GAAGCTTGCC CTCCTGGGTG CTGCTACCGA CTGGTTGGAT 1380 GGACTGAGCA AGCATCTCGA CGCATGGGAC TCGCAGTACT ACATGGGGGA GTTCCGCAAC 1440 TTGTGCGTAA AAGAGAAGAT GAACGAGCTC GGATGGCCTG CACGCGAATA TATCGTGCAG 1500 ATCGCTCGCT TCGACCCGTC CAAGGGT ATC CCGAACGTGA TCGACTCGTA CGCGCGCTTC 1560 CGGAAGCTCT GCGTCGACAA GGTCATGGAA GACGACATCC CACAGCTCCT GCTCTGTGGT 1620 CACGGCGCCG TGGACGACCC CGACGCGAGC ATCATCTATG ACCAGGTCTT GCAGCTGATC 1680 CACGCTAAAT ATAAGGAGTA CGCGCCCGAC ATCGTCGTGA TGCGCTGTCC GCCGAGTGAT 1740 CAGTTACTGA ACACACTCAT GGCCAATGCG AAGTTCGCGC TACAGCTCTC GACGCGTGAG 1800 GGCTTCGAAG TAAAGGTTTC AGAGGCCTTG CACGCAGGCA AGCCCGTCAT CGCATGTCGC 1860 ACGGGCGGCA TCCCGCTGCA GATTGAGCAT GGAAAGAGCG GATACCTCTG CGAGCCGGGC 1920 GACAACGCAG CAGTTGCGCA GCACATGCTC GACTTGTACA CGGACGAGGA CCTGTATGAC 1980 ACGATGAGCG AGTACGCGCG CACGCACGTC AGCGACGAGG TGGGCACCGT GGGCAACGCG 2040 GCTGCGTGGA TGTACCTCGC TGTCATGTAC GTGAGTCGCG GCGTCACGCT CCGCCCGCAC 2100 GGCGCGTGGATCGACGCGACGATCGACGCGACGATCGACGCGCGACGATCGACGCGCGCGCGACGACGCGCGACCGGACGCGCGACCGGACGCGACGACGCGCGCGCGCGCGCGCGCGCGCGCGGACGCGTCGACGCGTCGACGGATCGACGTAG

[Brief description of the drawings]

FIG. 1 shows a restriction map of an expression vector pYGT1 of Example 6 of the present invention.

[Table 1]

──────────────────────────────────────────────────の Continued on the front page (51) Int.Cl. ⁶ Identification symbol FI // (C12N 1/19 C12R 1: 865) (C12N 1/21 C12R 1:19) (C12N 9/12 C12R 1:19) (C12N 9/12 C12R 1: 865) (Title of the Invention) Gene encoding recombinant trehalose phosphorylase, vector containing the gene, transformant transformed with the gene and transformant For producing recombinant trehalose phosphorylase using

Claims (21)

[Claims] 1. A gene encoding trehalose phosphorylase having an amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 as a partial amino acid sequence or an amino acid sequence homologous to the amino acid sequence. 2. A gene encoding trehalose phosphorylase comprising the amino acid sequence shown in SEQ ID NO: 3 or an amino acid sequence homologous to the amino acid sequence. 3. The gene according to claim 1, comprising the nucleotide sequence shown in SEQ ID NO: 4, a nucleotide sequence homologous to the nucleotide sequence or a nucleotide sequence complementary to the nucleotide sequence. 4. The gene according to claim 1, which comprises a base sequence shown in SEQ ID NO: 5, a base sequence homologous to the base sequence or a base sequence complementary to the base sequence. 5. Encoding the amino acid sequence shown in SEQ ID NO: 3 based on the degeneracy of the genetic code, and replacing one or more bases in the base sequence shown in SEQ ID NO: 4 with another base The gene according to claim 3. 6. Encoding the amino acid sequence shown in SEQ ID NO: 3 based on the degeneracy of the genetic code, and replacing one or more bases in the base sequence shown in SEQ ID NO: 5 with another base The gene according to claim 4. 7. An oligonucleotide probe prepared based on the base sequence shown in SEQ ID NO: 4 or 5 or in the amino acid sequence shown in SEQ ID NO: 3 under stringent conditions. The gene according to claim 1, which is soybean. 8. The gene according to claim 1, which encodes a polypeptide that is at least 50% identical to the polypeptide having the amino acid sequence shown in SEQ ID NO: 3 in the sequence listing. 9. The gene according to claim 1, wherein the gene sequence comprises a cDNA sequence derived from mRNA, a genomic DNA sequence, a synthetic DNA sequence, or a gene sequence obtained by combining these gene sequences. . 10. A recombinant trehalose phosphorylase comprising the amino acid sequence shown in SEQ ID NO: 1 or 2 as a partial amino acid sequence or an amino acid sequence homologous to the amino acid sequence. 11. The amino acid sequence represented by SEQ ID NO: 3 in the Sequence Listing
11. The recombinant trehalose phosphorylase according to claim 10, comprising the amino acid sequence shown in (1) or an amino acid sequence homologous to said amino acid sequence. A recombinant trehalose phosphorylase encoded by the gene according to any one of claims 1 to 9. An autonomously replicable vector comprising a gene encoding the recombinant trehalose phosphorylase according to claim 10 or 11. 14. An autonomously replicable vector comprising a gene encoding the recombinant trehalose phosphorylase according to claim 12. 15. The autonomously replicable vector according to claim 13, wherein the autonomously replicable vector is a plasmid vector pYES2.0. 16. A transformant obtained by introducing an autonomously replicable vector containing the gene encoding the recombinant trehalose phosphorylase according to claim 13 into a host. 17. A transformant obtained by introducing an autonomously replicable vector containing the gene encoding the recombinant trehalose phosphorylase according to claim 14 into a host. 18. The transformant according to claim 16, wherein the autonomously replicable vector is a plasmid vector pYES2.0. 19. The host according to claim 16, 17 or 1, wherein the host is a bacterium, actinomycete, yeast, filamentous fungus or other eukaryote.
9. The transformant according to 8. 20. A recombinant trehalose phosphorylase, wherein the transformant according to claim 16 is cultured, the recombinant trehalose phosphorylase is expressed in the culture, and the trehalose phosphorylase is collected. Manufacturing method. 21. The recombinant trehalose phosphorylase in the culture is subjected to centrifugation, filtration, concentration, salting out, dialysis, fractional precipitation, ion chromatography, gel filtration chromatography, hydrophobic chromatography, affinity chromatography and electrophoresis. 21. The method for producing a recombinant trehalose phosphorylase according to claim 20, which is collected using at least one means.