JPH07503128A - Synthesis and purification of truncated and mutant protein forms of human ciliary neuron tropism factor - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

[Detailed description of the invention] Human ciliary neuron affinity factor Synthesis and purification of truncated and mutant proteins The present invention utilizes recombinant DNA technology. Biological aspects of human ciliary neuron tropism factor (CNTF) obtained by surgery Active truncated and mutated protein forms (monomeric forms of these proteins) (including) synthesis and purification methods. According to the present invention, compared to the corresponding natural CNTF, It is also possible to obtain a human CNTF polypeptide with a small number of amino acids. these The new type of CNTF has different chemical and physicochemical properties than natural CNTF. It is useful for various medicinal applications.

Description of related technology A1 ciliary neuron affinity factor The ciliary ganglion (CG) contains two populations of neurons: the ciliary body and the choroid. However, both are cholinergic. CG neurons are located in the choroid, ciliary body and It innervates the eye's intrinsic muscular structures in the iris. During the development of a chick embryo, Between days E8 and E15 when their axons establish connections with innervated areas within the eye , about half of the CG neurons die.

This neuronal death is strongly enhanced by eye removal, whereas complementary eye bud transfer considerably disturbed by vegetation.

This observation suggests that the innervated areas are responsible for their own specific neurons. The hypothesis was that it contains nutritional factors.

Extracts obtained from liver tissues of various 8-day-old chicks were obtained from chicks at the same developmental stage. They differ from those of dissociated neurons obtained from embryonic ciliary ganglia. exerted its own nutritional activity (Adler et al. (1979) Science 204 +1434-1436).

This trophic activity was then associated with ciliary neuron tropism factor (CNTF). (Barbin et al. (1984) J, Neurochea+, 43:146 8-1478).

One-third of the total CNTF trophic activity in the embryo is observed in the eye, with most of it in the choroid. It was localized in the intraocular and intrinsic musculature of the eye.

Ion exchange chromatography, sucrose gradient ultracentrifugation and sodium dodecyl sulfate This protein was analyzed by polyacrylamide gel electrophoresis (SDS-PAGE). Purification of the protein shows that it has a molecular weight of approximately 21 Kd and a negative net charge. Ta. In E8 day chick CG neurons, E10 day chick DRG neurons, and the trophic activity exerted by purified proteins in sympathetic neurons on El1 day. The sex is on the order of 10" 10-12M, which is the spermatozoa from the submandibular gland of male mice. Another neuron-tropic factor produced is nerve growth factor (NGF) and , the same with respect to its neuronal DRG and sympathetic targets.

Enzyme thyronone hydroxylase and phenylethanolamine N-methyltran CTNF and NGF, although the extent of their effects on spherases differ. Similarly supports the growth of cultured chromaffin adrenal cells. CNTF is chick retinal cells It induces ChAT activity in culture and exhibits cholinergic neuronal responses. C.N. TF has no trophic effect on cholinergic neurons in the basal pontine region of the brain; This cannot be considered a cholinergic unionophilic factor.

CNTF has been shown to stimulate some sympathetic neurons, cranial ganglia, and medullary neurons in vitro. (Barbin et al. (1984) J. Neurocheo. 43:146 8), motor neurons of the spinal cord (Arakawa et al. (1990) J, Neuro sci, 10:3507; long et al. (1990) Soc, Neuro sci, ^bstr, 16:4W4: Hagal et al. (1 991) Devel, Brain Res, 63:141) and Hippocampus II, -o:/(Ip et al. (1991) J, Neurosci, P1: 3124). Also, oligodendrocytes and astrocytes Affecting the differentiation of progenitor glial cells known as 0-2A in vitro It has also been revealed that (Li11ien et al. (1988) Neuron 1: 48).

This protein is characterized by an isoelectric point of 5.8 and a molecular weight of 24 KDa. It is relatively easy for recombinant bacteria to produce up to 30% of the total protein as CNTF. However, due to its characteristics, it is difficult to obtain uniformly pure protein. Various chromatographic steps may need to be used. These various processes include Ion exchange chromatography, reversed phase chromatography, polyacrylamide Gel electrophoresis, ionic metal interaction chromatography and hydrophobic interaction chromatography Includes matography. Many of these processes cannot be performed at the industrial level. is difficult and therefore increases the production cost of this factor, so alternative The discovery of a refining method is strongly desired.

89 recombinant DNA technology Conventional techniques for isolating biologically active proteins include biological fluids or involves the isolation of proteins by purification from tissues; The amount of proteins produced does not necessarily make it possible to study their structure, function, and especially applications. not enough to make it possible.

Therefore, in order to obtain sufficient amounts of proteins, recombinant DNA technology can be used to It is possible to clone a gene encoding a protein into an expression vector. According to recombinant DNA technology, a series of vectors capable of expressing target proteins in large amounts are available. can be constructed. By using recombinant DNA technology, molecular biology Scientists can arrange and assemble DNA sequences to produce the desired protein. It is now possible to create hybrid molecules that can Restriction enzyme cleavage, and The resulting fragments are then ligated with gauze and the oligonucleotides to be assembled. chemical synthesis, and other methods devised by various laboratories working in this field. A variety of reactions are used. These techniques are described by Sambrook et al. (1989) llolecularCloning, A Laboratory 1lan ual (2nd edition, Cold Spring + Harbor Laboratory Press, 2nd edition) Cold Spring Laboratory, New York).

In order to obtain high expression levels, the DNA elements that must be assembled must contain several essential information. must contain information. These factors include, for example, origins of replication, a selection marker, an expression promoter, a transcriptional activator for the gene of interest, and Other control elements known to those skilled in the art are included. Functionally in transcriptional and translational regulatory elements The combination of these elements containing the linked gene of interest is called an expression plasmid. form a plasmid. Such expression plasmids or vectors cells (which may be of eukaryotic or prokaryotic origin) Facilitates expression of proteins in cells. Proteins are then purified by subsequent purification. can be obtained.

Promoters that naturally control the expression of genes such as growth factors are not very active. and is activated only under appropriate natural conditions, which are often left unexplored. It is knowledge. For this purpose, viruses obtained from viruses of the pavovavirus family are used. Promoters of known activity are often used, such as used if

The regulatory elements used to obtain high levels of gene expression are therefore interconnected. Various origins (true It is a combination of DNA from nuclear organisms, bacteria, viruses, etc. Gene transcriptional activity depends on the appropriate distance between the regulatory and coding sequences.

Conventional techniques for obtaining genes located in close proximity to regulatory sequences are based on their cloning. depending on the presence of suitable restriction endonuclease sites to facilitate Exists. If there are no matching parts nearby and only different parts, such restrictions Join each segment by synthesis of an oligonucleotide linker containing a restriction site. can be combined. This system is highly limiting for molecular biologists. already One method is to use PCR technology (Saiki et al. (1988) Sc ience 239:487-489). With this technology, gene segments can be amplified up to 1X10' times. The principle is two oligonucleos It is based on the use of oligonucleotides to amplify each of those oligonucleotides. can be precisely paired with one of the DNA strands. 2 regarding gene sequence The distance between the two oligonucleotides determines the size of the molecule produced. this The two oligonucleotides are separated by restriction sites that allow for subsequent cloning. Construct to exist within these arrays. This restriction site may be naturally occurring or or specifically constructed by degenerating a minimum number of nucleotides. part This method, known as directed mutagenesis, uses predetermined positions determined by molecular biologists. This allows restriction sites to be constructed at any location. Compatible with other gene segments The construction of a sequence not only facilitates cloning but also allows for the separation of different gene segments. It also allows for specific binding. This technique can be applied by direct mutagenesis. It can be defined as roning.

Alternatively, after inserting the modified gene into the appropriate expression vector mentioned above, the obtained The gene sequence can also be changed appropriately by increasing or decreasing the length of the gene. Ru. properties that are the same as or different from those of the protein encoded by the wild-type gene. It is possible to obtain peptides with specific properties. In other words, amino acids are more abundant than natural proteins. present in truncated polypeptides and wild-type protein sequences with fewer amino acids Deleted polypeptides lacking certain amino acid sequences can be obtained. These new New polypeptide forms have very different chemical and physical properties than natural proteins. can retain physical and biological properties. To obtain different types of polypeptides, By introducing mutations into the gene, it has the same biological activity as the natural type. A new type of polypeptide with fewer amino acids than natural proteins, or a natural protein. It is possible to obtain new types of polypeptides that allow blocking of natural protein receptors. Based on the above description, it is an object of the present invention to obtain uniformly truncated morphology and/or Hosting of mutated forms (defined as isoforms) of human ciliary neuron tropism factor Large amounts of expression and purification by principal cells. These new polypeptides alone , or other molecules or their derivatives or manufactured biomaterials. In combination, they can be used for therapeutic purposes.

Another object of the invention is to combine one or more isoforms of CNTF growth factor with a natural ganglionode, one of its derivatives or semisynthetic analogues, or a salt thereof; one or more of the new complexes between one or more of the phospholipids, the growth of the other factors, natural polymers (such as acidic polysaccharides) or chemically modified or transformed By providing a pharmaceutical preparation containing as an active substance an association with a biocompatible substance be.

The present invention also provides one of the natural ganglionodes, their derivatives or semi-synthetic analogues. isoforms and mutant proteins of the growth factor CNTF, or their salts. A new complex with hyaluronic acid or one of its derivatives, a growth factor All of the new complexes with isoforms and muteins of CNTF are described above. It also includes therapeutic use for indications. Subcutaneous injection, intramuscular injection or The daily dose for humans by intracerebral injection is 0.05 mg of active substance per kg of body weight. and 5 mg.

A further object of the present invention is to An object of the present invention is to provide a method for producing a CNTF mutant protein. this method fusion of the mutein to at least six histidine residues; Includes the presence of enzymatic or chemical cleavage sites in the polypeptide chain. These 6 The presence of histidine residues causes chromatographic effects due to interaction with metal ions. The CNTF mutant protein was isolated by chromatography through a host membrane. Enables one-step separation from complex protein mixtures produced by living organisms. make it possible. The mutant proteins isolated in this way are then chemically or enzymatically isolated. and recovered in pure form from the same column. This mutant protein is The first 14 amino acids starting from the amino terminus have been removed, and this The recombinant protein cannot become oxidized during purification and therefore its monomeric The only cysteine in CNTF is replaced with serine to maintain body shape. It is a polypeptide type of CNTF. After purification, this mutant protein is Maintains biological activity.

A further scope of the applicability of the invention will become apparent from the detailed description and drawings below. Will. However, the detailed description and specific examples indicate preferred embodiments of the invention. However, it should be understood that they are included for illustrative purposes only. should be understood. This is because various alterations and modifications that fall within the spirit and scope of the present invention are As will be apparent to those skilled in the art from this detailed description.

Brief description of the drawing The above objects and other objects, characteristics and advantages of the present invention are annexed with the detailed description below. will be better understood when considered in conjunction with the drawings. Tadako All these drawings are included for illustrative purposes only and are not intended to limit the invention. It's not.

Figure 1 shows the nucleic acid sequence encoding human CNTF.

FIG. 2 shows the amino acid sequence encoded by the nucleic acid sequence of FIG.

Figure 3 shows a human form of the human CN1”F molecule lacking the first 14 amino acids at the amino terminus. A nucleic acid sequence encoding CNTF is shown.

FIG. 4 shows the amino terminal end of the human CNTF molecule encoded by the nucleic acid sequence of FIG. Amino acid sequence of human CNTF lacking the first 14 amino acids at the end and other data shows the data.

Figure 5 shows a form of the human 1-CNTF molecule lacking the last 26 amino acids at the carboxy terminus. 1 shows a nucleic acid sequence encoding human CNTF.

FIG. 6 shows the carboxylic acid sequence of the human CNTF molecule encoded by the nucleic acid sequence of FIG. Amino acid sequence of human CNTF lacking the last 26 amino acids at the terminal end and others The following data is shown.

Figure 7 shows the first 14 amino acids at the amino terminus of the human CNTF molecule and the carboxylic acid of the molecule. encodes a form of human CNTF lacking both of the last 26 amino acids of the oxy-terminus. Nucleic acid sequences are shown.

FIG. 8 shows the amino terminal end of the human CNTF molecule encoded by the nucleic acid sequence of FIG. Both the first 14 amino acids at the end and the last 26 amino acids at the carboxine end of the molecule. The amino acid sequence and other data of human CNTF are shown.

Figure 9 shows the expression of a new truncated polypeptide form of human CNTF disclosed herein. The cloning method used to obtain the vector used is shown below.

Figure 10 shows the truncated form of human CNTF reported in Examples 1 to 3 and the one described in Example 5. This shows a truncated type with the sequence deleted.

Figure 11 shows the biological activity of the truncated polypeptide form of human CNTF compared to that of wild type human. It is shown in comparison with CNTF protein. This data is calculated as ED50. Indicates that the calculated specific activity is at least 5X10"1M for the various forms. are doing.

Figure 12 shows the structure of the expression vector CNTF(His)sΔ14Ser17CNTF shows.

Figure 13 shows the structure of the expression vector Δ14Ser17CNTF.

Figure 14 shows the bacterial starting material of Example 13 filled with Buffer A and washed with Buffers B and C. A diagram showing the elution characteristics of the substance is shown. Recombinant protein is eluted into a buffer solution.

Figure 15 shows the CNTF (H) of Example 13 after enzymatic cleavage with hydroxylamine. is)aAsnG]yD14ser17cNTF. mutation The protein GIyD14Ser17CNTF was eluted in buffer C and the mutant tag The protein CNTF(Hi5)sAsn is eluted into the buffer solution.

Figure 16 shows the mutant protein of Example 13 after enzymatic cleavage by enterokinase. Fig. 2 shows an elution characteristic diagram of the protein HisgD14Ser17CNTF. recombinant protein elutes in buffer C.

Detailed description of the invention The following detailed description of the invention is provided to assist those skilled in the art in practicing the invention. However, those skilled in the art are advised not to depart from the spirit or scope of this inventive discovery. Since changes and modifications may be made to the embodiments discussed in the specification, the following detailed description should not be considered as unduly limiting the invention.

The contents of each document cited in this specification are incorporated herein by reference in its entirety. Configure.

FIELD OF THE INVENTION The present invention is generally in the field of recombinant DNA technology. The present invention utilizes natural CNTF. specifically mutated forms (called isoforms) that contain their polypeptides. may differ from the corresponding native form due to the presence of one or more deletions in the sequence. as well as muteins of CNTF. These isoforms and mutations Proteins can retain the biological activity of the corresponding natural protein .

General recombinant DNA technology DNA cleavage with restriction enzymes was performed according to the manufacturer's instructions. Generally 20μm 1 μg of plasmid was cut with IU of enzyme in the reaction solution. temperature and ink The incubation time depends on the enzyme used, but is usually 1 hour at 37°C. And so. In all cases, after incubation, 40mM) Lysu HC ], LMP agarose (BRL) in 20mM sodium acetate, 1mM EDTA The plasmids and gene fragments were purified by electrophoresis through the gelatinizers (Japan, USA) and then GENECLEANR Kit (by 101st Inc. was eluted from the agarose using . ``The ligation was carried out using TJ at a concentration of 0.5 μg of DNA in a reaction volume of 20 μm. DNA ligase was used at 13°C for 12 hours. Confirm correct plasmid sequence For analysis, the ligation product was transfected into E. coli HBIOI. and cold in LB (Baline-Bertani) medium containing 50 μg/ml ampicillin. This was done by selecting transformed cells on top plates. collected fines Cells were grown in LB containing 100 μg/ml ampicillin and supplemented with Quiagen (Q uiagen.

Using a kit from Daigen GmbH, Düsseldorf, West Germany, Plasmids were purified for both small and larger preparations. Queer game Cloning vectors were prepared from bacterial cells by the method recommended by John.

Convert all oligonucleotides to 380B DNA Nonseizer (Applied) Biosystems, USA) according to the manufacturer's instructions.

These were treated in NH at 55°C for 12 hours and then centrifuged in a speed-vacuum centrifuge. Recovered. After resuspending these in 2.5M ammonium acetate, 3 volumes of cold It was precipitated with fresh ethanol (-20°C). Wash it again with cold 80% ethanol and resuspended in water. Oligonucleotide concentration was assessed spectrophotometrically. .

Amplification was performed using a Perkin Elmer Cirrus DNA thermal cycler. The reagents used are related DNA7&I ambrifire (Perkin Elmer (Nutas). Briefly, 100 μm in total mixture. ,5U 200 μM of each oligonucleotide, 0.5 μM of TAQ polymerase each nuclease cdATP, dTTP, dCTP, dGTP), 0.1 μg of human Use a mixture containing sample DNA and reaction buffer and store the reaction mixture to prevent evaporation. The reaction mixture was covered with liquid paraffin.

The amplification reaction was performed by setting the apparatus for 25 cycles under the following conditions29 Denaturation at 5°C for 1 min, sequencing at 45°C, extension at 72°C.

It has a partial amino acid sequence and a changed sequence compared to natural CNTF, and Proteins that possess different chemical and physicochemical properties than other proteins Special modifications to the wild-type CNTF gene sequence to obtain a coded gene added.

Human ciliary neuron tropism factor gene and protein Nucleic acids disclosed herein each of the sequences and polypeptides or biologically functional equivalents thereof. Can be used according to the invention. The term “biologically functional equivalent” The terms used herein may be the same as or refer to specific nucleic acid sequences and polypeptides discussed below. refers to nucleic acid sequences or polypeptides that exhibit similar biological activity.

for example, by substitutions, additions or deletions that render the molecule biologically functionally equivalent. The nucleic acid sequences described above can be modified. Due to the degeneracy of the genetic code, it is virtually impossible to Other DNA sequences encoding the same amino acid sequence may be used in the practice of the present invention. It's okay. These include physiologically functionally equivalent amino acid residues within the sequence. Substitution of a different codon that results in a code (this results in a silent change) A nucleus consisting of all or part of the CNTF gene described below modified by including, but not limited to, acid sequences. Similarly, the CNTF protein of the present invention The amino acid residue or its derivative has functionally equivalent amino acid residues in its sequence. modified that has been substituted (which results in a silent change) This includes those containing substantially all of the amino acid sequences described below, including the sequence, Not limited to those. For example, if one or more amino acid residues within a sequence Substituting other amino acids of similar polarity that act as functional equivalents to (silent) modification. Alternatives to certain amino acids in a sequence The amino acid can be selected from other members of the class to which the amino acid belongs. example Non-polar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, Includes proline, phenylalanine, tryptophan and methionine. very Neutral amino acids include glinone, serine, threonine, cysteine, thyronone, and Contains sparagine and glutamine. For positively charged (basic) amino acids, Includes arginine, rinone and histidine. negatively charged (acidic) amino Acids include aspartic acid and glutamic acid.

During or after translation, e.g. glycolylation, proteolytic cleavage, CN differentially modified, such as by binding to antibody molecules or other cellular ligands. TF fragments or derivatives thereof are also included within the scope of the invention. The examples described below are based on E. coli. Expression of biologically active recombinant CNTF isoforms or muteins in By illustrating the present situation, it is clear that the non-glycosylated form of CNTF is biologically active. This indicates that

Furthermore, the nucleic acid sequence of the invention encoding recombinant CNTF can be engineered to produce CNTF. can alter the processing or expression of. For example, code CNTF A signal sequence is inserted upstream of the binding sequence to enable secretion of CNTF, and Although this example can facilitate collection and bioavailability, this example is limited. It's not a coincidence.

Additionally, a given CNTF isoform or mutant protein can be tested in vitro. or by mutating in vivo, translation, initiation and/or termination. Create and/or destroy sequences or create mutations within coding regions and/or create a new restriction endonuclease site, or can destroy those already present and facilitate further in vitro modification. Wear. Techniques for mutagenesis known in the art include in vitro site-specific mutagenesis method (Hutchison et al. (1978) J, Biol, Ch. ew, 253:6551), use of TAB”l non-car (Pharmacia) Any can be used, including (but not limited to).

Human CNTF expression vector Vectors expected to be used in the present invention contain the necessary DNA sequences described below. Contains things that can be inserted with operational elements. Then such a base vectors can be transferred into host cells and allowed to replicate therein. preferred vector - have well-documented restriction sites and are preferred for transcription of the above DNA sequences. or contain necessary operating elements.

In some embodiments of the invention, one or more of the DNA sequences described herein Use the vector containing All of these vectors have some of the following characteristics Or it is preferable to have all: (1) retain a minimum number of host organism sequences; (2) to be stably maintained and propagated in the desired host; (3) to be stably maintained and propagated in the desired host; (4) have the ability to exist in a high copy number in the gene of interest; (5) having a regulatable promoter arranged to promote; selectable in a part of the plasmid that is separate from the part into which the DNA sequence is inserted (6) transcription Contains a DNA sequence capable of terminating.

Cloning vectors capable of expressing the DNA sequences of the present invention can be used in a variety of ways. Contains elements of action. These “operational elements” contain at least one promotion. at least one Nyain-Dalgarno sequence and an inishekhu codon and and at least one termination codon. These “operational elements” include: may include one or more of the following: at least one operation at least one resource for proteins to be exported from the intracellular space; at least one regulatory factor protein gene, a cloned C NTF Necessary or preferable for proper transcription and subsequent translation of DNA Other DNA sequences.

Some of these operational elements are present within each of the preferred vectors of the invention. It can exist. Identify the necessary additional operational elements and carry them out using methods known to those skilled in the art ( These can be obtained using methods such as those described in SaIIbrook et al. (supra). It is anticipated that vectors may be added.

regulatory factor Regulators act to prevent the expression of a DNA sequence in the presence of certain environmental conditions and prevent the expression of other In the presence of environmental conditions, the protein encoded by the CNTF DNA sequence This would enable the transcription and subsequent (expression) of proteins. In the absence of lopylthio-beta D-galactoside (IPTG), the DNA sequence Regulatory factors may cause no expression or the degree of expression may be reduced. Preferably, the segment is inserted into a vector. In this situation, the CNTF Containing the above DNA sequence prior to initiation of expression of the so-form or mutant protein. The transformed microorganisms can be grown to a desired density. desired thinness After reaching cell density, a small amount of a substance capable of causing the expression of the above DNA sequence is added. The expression of a desired protein can be induced by adding it to the biological environment. Ru.

promoter An expression vector is a vector that can be used by a host organism to express its own protein. It must contain a promoter that Lactose promoter system is commonly used used, but as other microbial promoters have also been isolated and characterized, Those skilled in the art can use them to express recombinant CNTF isoforms and muteins. can do.

Transcription termination zone The transcription terminator envisioned in the present invention functions to stabilize the vector. concrete Specifically, Rosenberg et al. (1979) Ann, Rev. Genet. 13:319-353 are contemplated for use in the present invention. It is.

untranslated sequences Coded to allow incorporation of 3° or 5° untranslated sequences into gene transcripts It may also be desirable to construct the 3' or 5' ends of the region. These untranslated sequences include , Schmeissner et al. (1984) J. Mol. Biol., 176: 39-53, which stabilize mRNA.

liposome binding site Microbial expression of foreign proteins requires operational elements including liposome binding sites It is. The liposome binding site is defined by Gold et al., Ann, Rev, Mic. robiol, 35:557-580 and Marquis et al. (1986) G Initiation of protein synthesis, as described in Ene 42:175-183. A sequence that is sometimes recognized and bound by liposomes. The preferred liposome binding site is GAGGCGCAAAAAA (ATG).

Leader sequences and translational coupling factors Furthermore, fatson, M, E, Nucleic Ac1ds Res, 12+5145-5163, transfer proteins from the host cytoplasm. If the secretory leader (signal) sequence is to be excreted, a DN encoding an appropriate secretion leader (signal) sequence Preferably, A is present at the 5' end of the above DNA sequence. Leader sequence DN In A, the leader sequence is immediately adjacent to CNTF, and the leader sequence is CNT. It must be in a position that allows the production of a fusion protein that is covalently linked to F. stomach. That is, there is a transcription or translation signal between the two DNA coding sequences. should not be done.

In some host microbial species, as in the case of some E. coli, a suitable leader The presence of the -sequence would allow transport of the completed protein to the periplasmic space.

In the case of certain strains of E. coli, Satucharomyces and Bacillus and Pseudomonas Appropriate leader sequences allow proteins to cross the cell membrane and enter the extracellular medium. will be transported to. In this situation, the protein is removed from the extracellular protein. can be purified.

Positioning an additional DNA sequence immediately before the DNA sequence encoding the CNTF isoform be able to. This additional DNA sequence can function as a translation co-factor. Ru. i.e., it binds all of the adjacent inhibitory RNA binding sites to the bosome. A DNA sequence that encodes an RNA that functions to position liposomes next to each other. be. Translation coupling factors are TA AA CG AA GG CG CA AA AA A A T G A A A A A GACAGCTATCGCGATCT It is related to the DNA sequence TGGAGGATGATTAAATG and translation cooperating factors. can be derived using methods currently known to those skilled in the art.

Translation end area The translation termination region contemplated by the present invention functions to terminate translation of mRNA.

These are from Kohli, J., Mo1. Gen, Genet, 18 2:430-439, or Pe Ttersson, R.F. (1983) Gene 24:15-17. It may also be synthetic as described.

In addition, it induces the expression of drug resistance markers and selectable traits by the host microorganism. Preferably, the cloning vector contains a selectable label, such as a label for . In one aspect of the invention, a gene for ampicillin resistance is included in the vector. . Other plasmids include genes for tetracycline resistance and chloramphenyl Genes for call resistance can be included.

Such drug resistance or other selectable markers facilitate the selection of transformants. do. Additionally, such a selectable label is present in the cloning vector. This can be helpful in inhibiting the growth of contaminating microorganisms in the culture medium. Ru. A pure culture of the transformed host microorganism will show the induced phenotype as necessary for survival. It is obtained by culturing the microorganism under the following conditions.

The operational elements discussed herein are in the light of the prior literature and the teachings contained herein. and easily selected by those skilled in the art. Common examples of elements for these operations are B. Levin (1983) Genes (Willey & Sons, New York). Various examples of suitable operational elements can be found in the vectors above. and publications discussing the basic characteristics of the vectors mentioned above. You can find it by looking at it.

Once all necessary and desired component moieties have been synthesized and isolated, those skilled in the art will Vectors can be assembled using the following methods. A vector like this Assembly is within the ordinary skill in the art and therefore requires no undue experimentation. It can be done without.

Multiple copies of the DNA sequences of the invention and their associated operational elements are added to each vector. can be inserted into. In such cases, the desired CNTF produced by the host organism The amount of isoform per vector will be increased. DN that can be inserted into the vector The number of multiple copies of the A sequence depends on the size of the resulting vector and the appropriate accommodation. by its ability to be transferred into the principal cell, replicated, and transcribed in that host cell. limited.

Other host microorganisms Vectors suitable for use with microorganisms other than E. coli are also contemplated for use in the present invention.

Such microorganisms include, for example, Bacillus, Neudomonas and yeast.

Also, the truncated and mutant proteins of human CNTF disclosed herein expression in mammalian cells (including e.g. Chinese hamster ovary cells) are also included within the scope of the present invention.

For expression in Bacillus, a preferred vector is an alpha-amylase protein. motor, subtilisin promoter, P-43 promoter or 5paC -126 promoter should be included. helpful The transcription termination region includes rrn, rrnBT, and T. Transcription start site and leader page B. amyloliquefaciens natural protease; B, amyloliquefaciens alpha amylase and B, The subtilisins of S. ubtilis can be selected from among the subtilisins of S. ubtilis. Yes Useful antibiotic labels are Kan' and Cam'. The ribosome binding site is B, a myloliquefacjens natural protease gene and B, a Obtaining from the alpha amylase gene of C. myloliquefaciens Can be done. A preferred expression system in a Bacillus host is the plasmid pUB110. Includes use as a cloning vehicle.

For expression in Pseudomonas, the promoters are Trp, Lac and T You can select from ac. Useful transcription start sites and leader peptides are boss It can be obtained from the holibase C gene and exotoxin A gene. useful anti Biological labels are for sulfonamides and streptomycin. helpful The ribosome binding site can be obtained from the E. coli Trp promoter. bird A particularly preferred vector uses plasmid R8FIOIO and its derivatives. Dew.

For yeast, useful promoters include Gal and 10. Adhl and 1 1, Pho 5 is included. The transcription terminator is CycSUna, alpha factor and You can select from Sac2. The transcription start site and leader peptide are Invertase gene, acid phosphatase gene and alpha factor gene Obtainable. Useful selection labels are Ura3, Leu2, Hjs3 and It is Tapl.

Finally, for expression in mammalian cells, truncated or mutant proteins of the invention The DNA encoding the protein mass CNTF has an excellent location for binding ribosomes. should have a column. For such sequences, Kozak has published Nucleic Ac1ds Research (1987) 15:8125-8132. ing. Guarente in Cell (198g) 52:303-305, Kadonaga et al. reported in Ce1l (1987) 51:1079-1090. Expression vectors containing transcriptional promoters and transcriptional enhancers as described A fragment encoding CNTF can be inserted into the molecule. desired or necessary If so, it can be regulated like the promoter in the Pharmacia plasmid pMSG. Any promoter that can be used can be used. Aubel et al. (1,987)” Current Protocols in Molecular Biolo gy-(U B The mRNA transcribed from the vector is properly processed as described in The vector should retain the complete polyadenylation signal so that the most Later, the vector was transformed into a vector such as pBR322 to enable replication and selection in E. coli. origin of replication obtained from a similar plasmid and a small number (both containing one antibiotic resistance marker). May have.

To select stable cell lines producing CNTF as described herein, Au5 As described by Uber et al. (supra), the expression vector can be selected for drug resistance tags, marker genes or complementary genes for defective cell lines (e.g. dhfr - the dihydrofolate reductase (dhfr) gene for transforming cell lines; etc.) can be retained. Alternatively, create a separate program that holds the selectable indicators. Lasmids can be co-transformed with expression vectors.

Vectors for mammalian cells include calcium phosphate:DNA co-precipitation, electronic mammals by several techniques including troporation or protoplast fusion. Can be introduced into mammalian cells. ＾Described by usubel (supra) Co-precipitation with calcium phosphate is the preferred method.

Preferred vectors include, for example, the PSVT7 eukaryotic expression plasmid.

Example 1 To obtain a form of CNTF lacking the first 14 amino acids, two oligonucleotides Synthesized chido. The first (A) is 5'AACATATGGACCTGTAGC It has the sequence CGCTCTATC3' and is the first oligonucleotide of the human CNTF sequence. The position begins at the 42nd oligonucleotide after the cleotide. subsequent One Ndel restriction site was added to facilitate cloning, and this gene was A methionine codon was added to initiate transcription.

5’TTGTCGACTCACATTTTCTTGTTGTTAGCAATAT 3' and is located in the opposite direction at the end of the CNTF-encoding sequence. By using the above oligonucleotide together with oligonucleotide (B), and plasmid pT7.7hCNTF (Negro et al. (1991) J, Neu rosci, Res, 29:270) to amplify the sequence shown in Figure 3. be able to.

A transcription of the amino acid sequence, molecular weight data, number of residues, and amino acid composition shown in Figure 4 was obtained. In order to and cloned into plasmid pT7.7 (Figure 9).

This polypeptide consists of the first 14 amino acids starting from the amino terminus of the naturally occurring polypeptide. Lacks amino acids. Methionine was introduced at the beginning of this amino acid sequence.

The isoelectric point (pl) of this new polypeptide type is 6.38 compared to that of the natural protein. In comparison, it is 6.05.

Example 2 To obtain a form of CNTF lacking the terminal 26 amino acids of carboquine, two ori- synthesized a oligonucleotide. The first (C) is 5’TTCATAGGCTTTTTA It has the sequence CTGAAGCATTCA3' and encodes the CNTF gene. The position begins at the beginning of the array. The second oligonucleotide (D) is 5°T TGTCGACTCAATGGATGGACCTTACTGTCCAC3' It has a similar sequence and is located in the opposite direction at the end of the CNTF gene. Furthermore, the last 17 at position 523 relative to the start of the gene so that the amino acid is removed. A stop codon was added to the end of the gene. To facilitate subsequent cloning A 5all restriction site was also added. Plus oligonucleotides (C) and (D) By use with mid-pT7.7hCNTF, the nucleotides shown in FIG. Sequences can be amplified.

To obtain the transcription of the amino acid sequence shown in Figure 6, this sequence was combined with Ndel and 5all. Cut and clone into plasmid pT7.7 using T4 DNA ligase. Ta.

This sequence lacks the last 26 amino acids of CNTF (so the polypeptide is 17 Consists of 4 amino acids. The obtained molecular weight is 20007 KDa. This new type The pl is 5.67.

Example 3 It lacks the first 14 amino acids at the amino terminus and the last 26 amino acids at the carboxy terminus. To obtain a polypeptide form of human CNTF lacking amino acids, two oligonucleotides were used. Otide (i.e. (A) in Example 1 and (D) in Example 2) and plasmids The sequence shown in Figure 7 was amplified using pT7.7hCNTF.

This sequence was combined with Ndel and 5aI to obtain the transcription of the amino acid sequence shown in Figure 8. Cut with I and clone into plasmid p77.7 using T4 DNA ligase. It became.

This sequence lacks the first 14 and last 26 amino acids of CNTF. However, This polypeptide has 161 amino acids, taking into account the methionine added at the beginning. Contains acid.

The resulting polypeptide has a molecular weight of 18476 KDa and an isoelectric point of 5.14. .

Example 4 FIG. 9 illustrates the use of human CNTF in the expression of new polypeptide forms disclosed herein. The cloning method used to obtain the vector is shown below.

Example 5 From the plasmid pT7.7hCNTF, 2 cells are selected as appropriate depending on the desired deletion. One oligonucleotide can be used to amplify the entire sequence.

Detailed below is a segmentation sequence relative to the wild-type human CNTF polypeptide sequence. This is a method for obtaining a polypeptide sequence in which points 137 to 150 are deleted.

The following oligonucleotides both contain a 5phI restriction site, which is It does not exist in Sumid.

AGCATGCGGATCTTGTATTCCAGGAGTTGCATGCTC TTTGAGAAGAAGCTGTThese two oligonucleotides have already been described Used in PCR technology. After cutting the purified DNA with 5phI, T4D Ligate with NA ligase.

This method allows one to obtain linear segments joined by ligase. can. The nucleotide distance between two selected oligonucleotides is suddenly changed. Determine the extent of the deletion in the variant.

Figure 10 shows all of the truncated types of human CNTF reported in Examples 1 to 3, and Examples It represents a type lacking the sequence produced as described in Section 5.

Mutated plasmid pT77 RCN TF (Negro et al. (19 91) E. coli containing J. Neurosci, Res. 29:251) BL21 (D3) colonies were treated with 200 tt g/m + ampinoline. Inoculate 5 ml of LB medium. As previously described, each cell line has its expression vector. polypeptide sequence encoded by a gene sequence inserted into a vector Express.

All constructions were performed in E. coli HBIOI. To obtain protein expression, C A plasmid containing a truncated or deleted NTF was added to BL21(D3). were introduced into different E. coli hyphae containing.

Cells were grown overnight at 30°C. A portion contains 200μg/ml of anpinlin. It was diluted to 1/100 with M9 medium. Absorption at 590μm is 0.80 Cells were grown until D. At this point, isopropyl thiogalactoside ( IPTG) was added at a final concentration of 4mM. Cells were grown for an additional 3 hours and centrifuged. When separated and resuspended in Tris-HCI (pH 8,0), 10mM EDTA, Ready for further extraction.

Example 7 The pellet obtained after centrifugation was mixed with 50mM Tris (pH 7,4) and 50mMNa. Washed 3 times with C1 (C). After each wash, centrifuge at 600 rpm for 10 minutes. The pellet was recovered by heart separation.

Resuspend the final pellet in buffer and test at least twice at 800 ps. The sample was passed through Montain Gaulin.

The resulting material was centrifuged again at 600 rpm for 10 minutes and diluted with 8M urea, 50mM resuspended in Squirrel (pH 7.4), 1mM PMSF, 2mM EDTA at room temperature. .

After centrifugation at 600 rpm for 10 min, the soluble material was dialyzed against 1M urea. .

The supernatant obtained after further centrifugation for 15 min at 600 rpm was Based on protein pl < MonoQ color properly equilibrated at pH < The column was packed into an ion exchange column such as a column.

Under these conditions, the recombinant protein was incubated with 11°C of 10mM to 1.0M NaCl. It was eluted. The resulting material was dialysed against 50mM ammonium acetate and subjected to reverse phase carbonation. Filled the ram.

The column used was Vydac C187 μm (0.46 x 26 cm). ), and the solvents used were (A) 0.05% TFA (in water) and (B) 0.05% TFA (in acetonitrile).

The column was equilibrated with A and 10% B and loaded with protein.

In this way a gradient was created in which the percentage of buffer (B) was 60 min in 60 min. 0% was reached, after which the column was washed with 100% (B) for 10 minutes.

Recombinant protein eluted from this column as a single peak.

The activity of the polypeptides obtained as described in Examples 1.2 and 3 was determined by Their ability to maintain dorsal root neuron cells in day chick embryos in culture Evaluated by. These cells were removed from the chick embryo on the EIO day and injected with tryptochemistry. dissociated with non-alcoholic acid and concentrated by a subsequent pre-incubation step.

The neurons were then seeded into 96-well tissue culture dishes and polyornithine (15 m 100 u g/m in M borate buffer (pH 8,4) and laminin (10 μg/ml). Neurons were incubated at a concentration of 4000 nylon per well. The culture medium was 100μg/mI Beningsin, 2mM L-glutamic acid. Dalhesoko minimal essential medium (DMEM) containing And so. After 24 hours of culture, the surviving knees were counted (Skaper (1985) Dev, Brain Res, 24:39-46).

Figure 11 shows truncated polypeptide forms compared to wild type human CNTF protein. shows an example of the biological activity of The results of this experiment were calculated as ED50 Showing that the specific activity was at least 5 × 10 N4 for the various forms There is.

Human CNTF sequence (Negro et al. (1991) J, Neurosci, Re s, 29:251), the following oligonucleotide was constructed. I 1eTrpHi sHi sHi stl i ski sHi 5Asn G 1yAspLeuSerSerArgSerl le This nucleotide is contains a Bgl11 site in its 5' region. There are 6 His codons, then followed by the CNTF sequence starting from the 15th codon. In addition, /stay The 17th codon (TGT) encodes serine (TCT) Replaced with. In the presence of nosteine, two CNTF molecules coalesce to form a dimer. This modification was necessary because it reduces biological activity. This o oligonucleotide at 5°AGGTCGACTACATTTTCTGTTGTT It was used in PCR with oligonucleotide 5alI having the sequence AG3°. increase The width product was cut with BglII and 5all, and the plasmid pT77　h　CNT　F (Negro et al. (1991) J, Neurosci, Res, 29+2 70) was cloned between the BamH1 site and the Sal site. BamHI and B gllI is a compatible restriction site.

Figure 12 depicts this expression vector. This is resistance to ampinrin (A MP'), T7 promoter, restriction site Nde, Nh (Nhel), B ( B amHI), Bg (BgI II) and 5 (Sal I).

The location of the cleavage site (H) for histidine (M) and hydroxylamine is also shown. ing.

The fusion protein containing the chemical cleavage site H is shown below. 6 histidines and another C by the amino acids asparagine and glinone A CNTF molecule fused to an NTF molecule. These two amino acids are hydroxy Represents the cleavage site for ruamine.

Human CN TF (Negro et al. (1991) J, Neurosci, R es, 29:25]), construct the following oligonucleotide. Ta 5°TCTAGATCTCTCTAGCCGCTCTAT3'AspLeuSe rSerArgSerIIe This oligonucleotide has B in its 5' region. A gllll restriction site is present.

Furthermore, the 17th codon (TGT) that encodes the amino acid protein is (TCT) encoding phosphorus. This oligonucleotide It was used for PCH with the oligonucleotide 5ail described above. Bgll the amplified product Restriction of the expression plasmid pR3ETB (in vitro ann) by cutting with I and 5all Sites BamHI and XhoI (these are compatible with BgllI and 5all, respectively) was cloned during

Figure 13 shows the expression vector. This is resistance to ampicillin (AMP) ), T7 promoter, restriction sites N (Ndel), B (BamHI), Bg (B glII), 5 (Sall) and X (Xhol). More hiss The locations of the cleavage sites for tidine (M) and enterokinase are also indicated.

The first amino acid of this fusion protein is: Met-^rg-G 1 y-3er-His-H1s-11i s-Hi 5-Hi 5-Hi 5 -Gl　y-Met-^1a-3er|Met-Thr-Gly-Gly- Gln-Gln-Met-GIY-^rg-^5p-Leu-Tyr-^sp- ^sp-^sp-^5p-Lys-Aspl 5-Leul@6-3erl 7 − As can be seen, the transcribed protein has six human molecules in its amino-terminal region. Contains stidine, followed by enterokinase between Lys and Asp, 5 This is a fusion protein followed by a cleavage site called Asp-Asp-Asp-As. Facilitates cleavage of p-Lys-Asp+s sequence after lysine .

Bacterial growth was as described in Example 6.

The pellet obtained after centrifugation was mixed with buffer (50mM Tris (pH 7,4), 50mM Wash the pellet at least three times with NaC] and remove the pellet by centrifugation after each wash. Recovered. Resuspend the final pellet in the above buffer and at least 800 ps i. He also passed Montein Galarin twice. The obtained material was again heated at 600 rpm for 1 Centrifuge for 0 minutes, add buffer A (6M guanidine, O, IM NaH2PO4,1 00mM Tris, pH 8). Centrifuge it again as before and Fill the supernatant into an IMAC-NTA chromatography column (Quian) This allowed it to interact with metal ions. Add nickel to 8ml of NTA resin. Filled and washed with 70 ml of buffer A. Buffer the above supernatant using a spiral pump It was filled into liquid A at a rate of 30 to 50 ml/hour. Next, the column was washed with buffer B ( 8M urea.

After washing with 0.1M Na82PO4, 10mM Tris, pH 8), 40ml Buffer C (8M urea, 0.IM NaH2PO4, 10mM Tris, pH 6, 3) and washed again. The recombinant mutein was transferred to buffer D (8M urea, O, I It was eluted with M NaHzPo 4, 10mM), pH 4,5).

Mutant protein CNTF(His)6AsnGlyD14Ser17CNT F was dialyzed against water and the precipitate was purified with 6M guanidine and 2M hydroxylamine. resuspended in. When the polypeptide is incubated at 37°C for 12 hours, , during this period hydroxylamine divides the polypeptide into two parts (CN TF(His)6Asn and GIyD14Ser17CNTF).

On the other hand, the mutant protein His6D14Ser17CNTF was mixed with 50mMCa ( Dialyzed against 12,50mM Tris-HCI (pH 8) and diluted with 1:500 enzyme group. Digested with enterokinase (Boehringer) for 12 hours at 37°C using a .

During this period, the polypeptide has two parts (His6 and D14Ser17CN TF). The mutated protein thus digested is placed in a buffer solution. The solution was dialyzed and loaded into the column described above.

The best version of the polypeptide CNTF(His)aAsnGIyD14ser17cNTF The end product is represented by the following mutein: G]yD14Ser17C NTF (,:, this elutes in buffer C) and CNTF (H45)aAsn (this This will elute into the buffer).

The final product of polypeptide His6D14Ser17CNTF was dissolved in buffer C. The mutant protein D14Ser17CNTF is released.

Two recombinant mutant proteins obtained by this method are shown in the following flowchart. refine as Mutant protein: CNTF(+1is)6AsnG1yD14Ser17 CNTF bacterial pellet Solubilization in buffer A Washing of IMAC-NTA column with packing buffer B in buffer A (non-histidine) Washing with buffer C1 (containing proteins) (bacterial proteins with a trace of histidine) Washing with buffer (mutant protein CNTF (His)a^5nG 1yD14ser17cNTF) Dialysis centrifugation beret Solubilization buffer with 6M guanine non-2M hydroxylamine, 37°C, 12 hours. Dialysis with solution A Washing the IMAC-NTA column in buffer A with packing buffer B Washing with buffer C (G1yD14Ser17CNTF) Washing with buffer C (G1yD14Ser17CNTF) CNTF (His)aAsn) mutant protein (His)sDI4ser 17cNTF bacterial pellet Solubilization in buffer A Packing of IMAC-NTA column Washing with buffer B (no histidine-containing protein) Washing with buffer C (no protein) Bacterial protein with histidine) Washing with buffer solution ((His)sD1 4ser17cNTF) Dialysis Digestion with enterokinase, 1:500.3″ buffer for 12 hours at 1°C, dialysis Packing of IMAC-NTA column Washing with buffer B Washing with buffer C (D14Ser17CNTF) Washing with buffer C ((Hi s)6) Figure], 4 shows the solution of bacterial starting material packed in buffer A and washed with buffers B and C. The output characteristic diagram is shown. Recombinant protein is eluted into a buffer solution.

Figure 15 shows CNTF(Hi5)6A after enzymatic cleavage with hydroxylamine. The elution characteristic diagram of snGIyD14ser17cNTF is shown. mutant protein GIyD14Ser17CNTF eluted into buffer C and mutein C NTF (His) and Asn are eluted into the buffer solution.

Figure 16 shows the mutant protein His6 after enzymatic cleavage by enterokinase. The elution characteristic diagram of D14ser17cNTF is shown. This recombinant protein is It elutes in C.

It is also possible to purify the mutein under non-denaturing conditions. In this case, I A MAC column (Farmana) can be used. At various stages there are 30 Bacterial growth at °C, mutant protein in phosphate buffer (pH 7,4) including solubilization and loading into the column under non-denaturing conditions. Proteins are denatured It elutes at the same pH value as shown for the case.

Using an Applied Pion Stems automatic protein sequencer model 477A The amino-terminal sequence of the recombinant mutant protein was determined by Edman degradation. did. Phenylthiohydantoin derived from amino acids was determined using the instrument.

The first 10 amino acids starting from the N-terminal amino acid of GlyD14Ser17CNTF The sequence of the amino acid is Gly-Asp-Leu-5er-5er-Arg-8er-I 1e-Trp-L　e　u-A　]]a-, Ar　g, and D14Ser1 Asp-Leu-5er-5er-Arg-5er-I for 7CNTF There was Ie-Trp-Leu-Ala-Arg-LysT. This sequence is Gly The first 14 amino terminal amino acids are absent in D14Ser17CNTF and glino There is an amino-terminal amino acid, and stein at position 17 is replaced with serine. This corresponds to the CNTF arrangement (Fig. 2) when

For D14Ser17, the first 14 amino acids are deleted and the cysteine at position 17 is replaced with serine.

Embryonic neuron cells isolated from the dorsal ganglion of chicks at day EIO are maintained in culture. Based on the mutein's ability to produce recombinant muteins, Physical activity was evaluated. Cells were extracted from chick embryos on the EIO day, dissociated, and serially enriched by a pre-incubation step. The neurons were then placed in a 96-well plate for tissue culture. Polyornithine (1-00 μg/ml. borate buffer (pH 8) 4)) and laminin (10 μg/ml). 1 neuron The inoculation was carried out at a concentration of 4000 N/L. Culture medium is 100μg/ml of penicillin, 2mM L-glutamine and 10% inactivated fetal calf serum. Lubetzko minimal essential medium (DMEM) was used. Culture the surviving neurons for 24 hours. Counted after hours (Skaper et al. (1985) Dev, Brain Res, 24:39-46).

The single mutant proteins had the following specific activities calculated as ED50:

CNTF(His)6AsnG]yD14Ser17CNTF 20%g/ml GIyD14Ser17CNTF　0.25%g/m1CNTF(Hi　5)6 Asn 0.5 μg/m] (Hi 5) 6D14Sc r 17CNTF 0. 4μg/l1lID14Ser17CNTF 0.12%g/ml pharmaceutical composition Ganglionodes, phospholipids, hyaluronic acid or their derivatives, semi-synthetic analogs or with or without one of their salts, the human C of the invention. For formulating a pharmaceutical composition containing a solution of NTF molecules, an effective amount of CNTF molecules can be formulated. The drug administered to the patient is mixed in a mixture with a pharmaceutically acceptable excipient. Well known methods for preparing pharmaceutically acceptable compositions are included.

Suitable excipients and their formulations, including other proteins, are described, for example, in “Remingt. on’s Pharmaceutical 5cicnces (1985)- (Masokbi Babrinongφ Company, Edited by Easton.

described in the United States). Such excipients include injectable "depot" formulations. be caught. On this basis, the present pharmaceutical formulation has a suitable pH buffer that is isotonic with physiological fluids. with one or more of the pharmaceutically acceptable excipients or diluents contained in the solution. This includes, but is not limited to, solutions of CNTF growth factor or their lyophilized powders. It's not like that. In the case of lyophilized preparations, mannitol, grits, etc. (these include Supporting excipients (without limitation) can be used to moderate the desired pH. Add the desired volume of the appropriate buffer solution to obtain an isotonic buffer solution. desired volume Using similar solutions for pharmaceutical compositions of the present CNTF molecules in isotonic solutions of to consistently obtain isotonic pharmaceutical preparations of desired pH (e.g. neutral pH). use of physiological buffer solutions containing appropriate concentrations of phosphate or citrate. includes, but is not limited to.

Orally, topically, rectally, parenterally, topically, inhaled, intracerebrally or intranasally. Pharmaceutical preparations can be used. Therefore, these are solid or semi-solid types, For example, gunpowder, tablets, creams, gelatin capsules, capsules, suppositories, soft gels latin capsules, gels, membranes, non-woven products, tubelets, threads, microspheres and It can be a sponge, etc. For parenteral and intracerebral use, intramuscular or Shaped tubes can be used for subcutaneous administration, infusion, intravenous injection or intracerebral injection. Forms for injections can be used and therefore these forms can be used for Suitable as a solution or for use as described above and having an osmotic pressure compatible with physiological fluids The active ingredient should be mixed with one or more pharmaceutically acceptable excipients or diluents. The compound can be prepared as a lyophilized powder. For topical use, Preparations in the form of creams and ointments or in the form of sprays for topical use can be used. For inhalation, use a spray form such as calculation spray. A preparation can be used. For use with polymers, membranes, ponzi, non-woven products, tubulella), threads, microspheres, nanospheres and nanocapsules Preparations in the form of bottles can be used.

The preparations of the invention can be used for administration to humans or animals. these is preferably 0.01% for solutions, sprays, ointments and creams. containing from 1% to 10% of active compound, in the case of solid preparations from 1% to 100%. % (preferably 5% to 50%) of active compound. Dose to be administered depends on individual needs, desired effect and chosen route of administration.

The pharmaceutical preparation may contain lipophilic excipients (e.g. water-soluble excipients, glycogelatin). Also included are suppositories for rectal administration with milk-producing excipients such as It is not limited to this. In these preparations, between 0.01 and 0.01 of the total excipients The CNTF may be present in amounts up to 1% by weight. Suppositories contain an appropriate amount of acetyl saline. may include, but are not limited to, lithylates. This pharmaceutical formulation includes: Microspheres, nanospheres, nanocapsules for nasal, inhalation and intramuscular administration Also included. Furthermore, depending on their intended use, the above formulations may be used, e.g. Other specialized forms such as pistons, tubes, guideways, etc. may also be included.

Active substance μg 0.5-1 (2500BU) Sodium chloride mg 16 Citrate buffer pH = 7 ml 2 Adequate amount of water for injection Preparation number 22 ml vial contains 5 to 10 μg of active substance ( 25000BU) Sodium chloride mgl, 6 Citrate buffer pH = 7 ml 2 Adequate amount of water for injection Preparation number 32 ml vial contains active substance 0.5-1 μg (2500BU) Sodium chloride mg 16 Canglionod sodium salt mg 100 citrate buffer pH = 7 ml 2 Adequate amount of water for injection Preparation number 42 ml vial contains 5 to 10 μg of active substance ( 25000BU) Monosodium salt mg 16 Gashigeri 5th.・Donato) Noum salt mg 50 citric acid buffer pH = 7 ml 2 Adequate amount of water for injection Preparation number 52 ml vial contains the following substances t1 active substance tlg 0.5 ~1 (2500BU) Sodium chloride mg 16 Monoalotetrahexone lucagonide (GMI) sodium salt mg 1 00 citrate buffer pH = 7 ml 2 Adequate amount of water for injection Preparation number 6 2 ml vial contains 5-10 μg of active substance (25000BU) Sodium chloride mg 1.6 Monoalotetrahexonorgangliod (GMI) sodium salt mg 1 00 citrate buffer pH = 7 ml 2 Adequate amount of water for injection Freeze-dried active substance μg 2-4 (100OOBU) Gritsuji mg 30 b) A 2 ml solvent ampoule contains 16 mg of sodium chloride Citrate buffer in water for injection 2 ml lyophilized active substance μg 2 to 4 (], 0000BLl) Sodium chloride mg 16 Citrate buffer in water for injection 2 ml lyophilized active substance μg 5-10 (25000BtJ) Sodium chloride mg24 Citrate buffer in water for injection 3 ml lyophilized active substance μg 5-10 (25000BU) Gangliondo Sodium Salt mg 100 Sodium Chloride Thorium mg 24 Citrate buffer in water for injection 3 ml lyophilized active substance μg 5-10 (25000BU) Ganglio/Donodium Salt mg 50 Sodium Chloride Rium mg 24 Citrate buffer in water for injection 3 ml lyophilized active substance μg 0.5-1 (2500BU) monoalotetrahexosyl ganglioside (GM I) Sodium salt mg 100 Sodium chloride mg 24 Citrate buffer in water for injection 3 ml lyophilized active substance μg 5-10 (25000BU) monoalotetrahexosyl ganglioside (GM I) Sodium salt mg 100 Sodium chloride mg 24 Citrate buffer in water for injection 3 ml lyophilized active substance μg 5-10 (25000BU) 3-sn-vosfatin lucerin mg 50 rec Chin mg 15 Mannitol mg 101 00b) 4 solvent ampoules containing mannitol mg 60 Appropriate amount of water for injection to make 4ml Lyophilized active substance μg 5-10 (25000BU) Mannitol mg 60 b) A 3 ml solvent ampoule contains: Sodium chloride 24 mg Citrate buffer in water for injection 3 ml lyophilized material μg 2. 5-5 (12500BU) Sodium chloride mg 16 Citrate buffer in water for injection - appropriate amount to make 2 ml C) Example of suppositories for rectal administration Preparation number 17 Active substance μg 5-10 (25000BU) Cocoa butter mg 2.5 Preparation number 18 Active substance μg 5-10 (25000BU) Carbowax 1540g 1 ．． 75 Carboisox 6000 g 0.75 Preparation No. 19 Active substance μg 5-10 (25000BU) Active substance μg 5-10 (25 000BU) Gelatin g 0.25 Preparation number 21 It is a cream containing a partial ester of hyaluronic acid with benzyl alcohol. Therefore, 100g of the active substance contains 10-20 μg (50 μg) of the following substances: 000BU) Partial ester of hyaluronic acid with benzyl alcohol go, 2 Polyethylene glycol monostearate 400g 10.000 Cetiol V g 5.000 Lane Sote SX g 2.000 Methyl paraoxybenzoate g 0.075 Propyl paraoxybenzoate g 0.050 Sodium dehydroacetate g 0.100 Glycerin F, U, g 1.500 Sorbitol 70g 1.500 Test cream g 0.050 Water for injection: 100.000 g Preparation number 22 A cream containing all esters of hyaluronic acid with benzyl alcohol, , 100 g of which contains the following substances: active substance 10-20 μg (5000 0BU) Total esters of hyaluronic acid with benzyl alcohol g 0.2 Polyethylene glycol monostearate 400g 10.000 Cetiol V g 5.000 Lanetute SX g 2.000 Methyl paraoxybenzoate g O,075 Propyl paraoxybenzoate g 0.050 Sodium Dehydroacetate　g O,100g'JSe'J'F,U, g 1.500 Sorbitol 70 g 1.500 Test cream g 0.050 Water for Injection: Appropriate amount to make 100.000 g Since the present invention has been described herein, the present invention It will be obvious that various variations are possible. Such changes do not fall within the spirit and scope of the invention. Modifications which should not be considered as a departure from the are construed as falling within the scope of the following claims.

! HAGGGCCTGAACAA[;AAf:ATCAAACCTG[;AC-C DingGCGGATGGGATGCTCCCG Acr TGT TCT TGT AGT TGG ACCTGA GAC[;CCTACCCT ACG435 CAG TGG CAA GCA CTG ATCAGT GGA GTG AGCTi;A CCG AGG CAG AGCGTCACCGTT CGT GACTAG TCA CCT CACTCG ACT GGCTCCGTC TCG226TGGCCAGGCTCTTAGAAGACCAGCAGGding GC ATTTTACCCAACCGACCGGT CCG AGA ATCTTC T[;G TCG TCCACG TAA AAT GGG GTT GGC2 71AAGGTGACTTCCATCAAGC ding^TACATACCCTTCT TCTCCAAGTCGTTCCACTGAAGGTAGTTCGATATGT ATGGGAAGAAGAGGTTCAGC316C-dingGCCTTTGCATA CCAGATAG＾GGAGTTAATG＾■＾CTCCTGGAATGACG GAAACGTATGGTCTATCTCCTCCAATTACTATGAGGA CC Ding Ding A361ACAAGATCCCCC[)CAATGAGGCTGA Ding G GGATGCCT＾DingTAATGTTGGTGT　TCT　AGG　G[;G　C GT TACTCC[;ACTACCCT ACG SAT AAT TACA AC406GAGATGGTGGTCTCTTTGAGAAGAAGCTGTG GGGCCTAAAGGTGCCTCTACCACCAG AGA AACTC T　TCT　TCG　ACA　CCCCG[;　ATT　TCCACG451T GCAGGAGCTTTCACAGTGGACAGTAAGGTCCATCCA TGACCTTCACGTCCTCGAAAGGTCACCTGTC CAGG-Af; GTACTl; GAAG541 ATT A-A Ding-TG I JA ACA ACA A[;A AAA TGT GAG TCG ACA ATAATATAACGArTGTTGTTCTTTTACACrCAGCdingG Ding TFig, 3 1BIIANNKKM Number of residues = 187 Molecular weight: 21400 Amino acid composition 361 TACIJG ATA GAG GAG TTA ATG ATA C TCCTG　GAA　TACAAG　ATCCCC＾TG　GTCTAT　CT CCTCAAT TACTAT GAG GACCTT ATG TTCTAG GGG406 CGCAAT GAG GCT GAT GGG ATG C CT ATT AAT G-T GGA GAT GG-GGTGCG TTA CTCCGA CTA CCCTACGGA TAA TTA CAA CC T CTA CCA CCAFig, 5 Number of residues: 161° Molecular weight 19476 1g1O Ai-X'l/Otsuro 1 piece Fig12 Fig13 Eluate (ml) Continuation of front page (51) Int, C1,' Identification symbol Internal office reference number C12N 1/21 7236-4B C12P 21102 C9282-4B//CC12N 1/21 C12R1:19) (C12P 21102 C12R1:19) (81) Designated countries EP (AT, BE, CH, DE.

DK, ES, FR, GB, GR, IE, IT, LU, MC, NL, SE), 0A (BF, BJ, CF, CG, CI, CM, GA, GN, ML, MR, SN, TD , TG), AU, BB, BG, BR, CA, C3, FI, HU.

JP, KP, KR, LK, MG, MN, MW, No, PL, RO, RU, SD, US I

Claims (40)

[Claims] 1. The amino terminus of wild-type human ciliary neuron tropism factor (CNTF) Both lack one amino acid or at least one carboxy terminus of wild-type human CNTF. lacking amino acids or the amino and carboxy termini of wild-type human CNTF encodes a truncated form of human CNTF lacking at least one amino acid of both A nucleic acid sequence consisting of a sequence. 2. Polypeptides with biological activity functionally equivalent to the amino acid sequence shown in Figure 4 2. The nucleic acid sequence of claim 1, comprising a sequence encoding tide. 3. A polypeptide having biological activity functionally equivalent to the amino acid sequence shown in Figure 6. 2. The nucleic acid sequence of claim 1, comprising a sequence encoding tide. 4. A polypeptide having biological activity functionally equivalent to the amino acid sequence shown in Figure 8. 2. The nucleic acid sequence of claim 1, comprising a sequence encoding tide. 5. at least one amino terminal of human ciliary neuron tropism factor (CNTF) lacking an amino acid and containing at least one amino acid substitution within the CNTF. A nucleus consisting of a sequence encoding a truncated mutant protein form of human CNTF Acid sequence. 6. biological activity functionally equivalent to the amino acid sequence of D14Ser17CNTF. 6. The nucleic acid sequence of claim 5, consisting of a sequence encoding a polypeptide having a polypeptide comprising: 7. from the nucleic acid sequence shown in Figure 3 or its variants according to the degeneracy of the genetic code. 3. The nucleic acid sequence of claim 2. 8. from the nucleic acid sequence shown in Figure 5 or its variants according to the degeneracy of the genetic code. 4. The nucleic acid sequence of claim 3. 9. from the nucleic acid sequence shown in Figure 7 or its variants according to the degeneracy of the genetic code; 5. The nucleic acid sequence of claim 4. 10. Nucleic acid sequence or genetic code encoding D14Ser17CNTF 7. The nucleic acid sequence of claim 6, consisting of variants thereof according to degeneracy. 11. Having the amino acid sequence shown in Figure 4 or a functionally equivalent biological activity A truncated form of human ciliary neuron affinity factor consisting of an amino acid sequence. 12. Having the amino acid sequence shown in Figure 6 or a functionally equivalent biological activity A truncated form of human ciliary neuron affinity factor consisting of an amino acid sequence. 13. Having the amino acid sequence shown in Figure 8 or a functionally equivalent biological activity A truncated form of human ciliary neuron affinity factor consisting of an amino acid sequence. 14. Amino acid sequence or biological equivalent of D14Ser17CNTF The apical deletion of the human ciliary neuron affinity factor consists of an amino acid sequence with therapeutic activity. Lost mutant protein type. 15. At least the amino terminus of human ciliary neuron tropism factor (CNTF) lacking one amino acid or at least one amino acid at the carboxy terminus of human CNTF or at least both the amino and carboxy termini of human CNTF. A set comprising a nucleic acid sequence encoding a truncated form of human CNTF that lacks one amino acid. A recombinant expression vector for expressing the human ciliary body in transformed prokaryotic or eukaryotic cells. A recombinant expression vector capable of expressing the truncated form of neuron tropism factor. Tar. 16. The nucleic acid sequence comprises a nucleotide sequence as defined in any of claims 2, 3 or 4. 16. The recombinant expression vector of claim 15, having a column. 17. the nucleic acid sequence has the nucleotide sequence set forth in any of Figures 3, 5 or 7; 16. The recombinant expression vector of claim 15. 18. At least the amino terminus of human ciliary neuron tropism factor (CNTF) lacking one amino acid and containing at least one amino acid substitution within said CNTF a nucleic acid sequence encoding a truncated mutant protein form of human CNTF that A recombinant expression vector that allows human hair to be expressed in transformed prokaryotic or eukaryotic cells. Ability to express the tip-deleted mutant protein form of the neuron tropism factor. A recombinant expression vector with 19. 19. The recombinant method of claim 18, wherein said nucleic acid sequence encodes D14Ser17CNTF. expression vector. 20. Claim that the vector is CNTF(His)6Δ14Ser17CNTF Recombinant expression vector of Item 18. 21. 19. The recombinant expression vector of claim 18, wherein said vector is Δ14Ser17CNTF. ctor. 22. A prokaryotic or eukaryotic cell transformed with the vector of claim 15. 23. A prokaryotic or eukaryotic cell transformed with the vector of claim 18. 24. Cough cells contain Escherichia coli, members of the genus Bacillus, members of the genus Pseudomonas, 23. The cell of claim 22, which is a yeast or mammalian cell. 25. The cell is E. coli, a member of the genus Bacillus, a member of the genus Pseudomonas, 24. The cell of claim 23, which is a yeast or mammalian cell. 26. a pharmaceutically acceptable carrier or diluent and the method of claim 11, 12 or 13. and an effective neurotherapeutic amount of any human ciliary neuron-tropic factor. . 27. a pharmaceutically acceptable carrier or diluent and the human ciliary neuron of claim 14. and an effective neurotherapeutic amount of an affinity factor. 28. Natural gandariosides or derivatives and semisynthetic analogs of the gangliosides 28. The pharmaceutical composition according to claim 26 or 27, further comprising a salt. 29. Claims further comprising a natural polysaccharide or a derivative or semi-synthetic analogue of said polysaccharide The pharmaceutical composition of item 26 or 27. 30. 30. The pharmaceutical composition of claim 29, wherein the polysaccharide is hyaluronic acid. 31. Treating neurological disorders by preserving, restoring, or preventing loss of neurological function 14. A method comprising human ciliary neurons according to any of claims 11, 12 or 13. A method comprising administering to a patient an effective amount of an affinity factor. 32. Treating neurological disorders by preserving, restoring, or preventing loss of neurological function 15. A method comprising administering to a patient an effective amount of the human ciliary neuron-tropic factor of claim 14. A method consisting of administering. 33. Treating neurological disorders by preserving, restoring, or preventing loss of neurological function 29. A method comprising administering to a patient an effective amount of the pharmaceutical composition of claim 28. Method. 34. Treating neurological disorders by preserving, restoring, or preventing loss of neurological function 30. A method comprising administering to a patient an effective amount of the pharmaceutical composition of claim 29. Method. 35. Neuropathology caused by aging of the nervous system or diseases affecting the immune system 14. A method for treating a physiological condition, wherein the human hair follicle according to any one of claims 11, 12 or 13 A method comprising administering to a patient an effective amount of a somatic neuronophilic factor. 36. Neuropathology caused by aging of the nervous system or diseases affecting the immune system A method for treating a medical condition, comprising the human ciliary neuron affinity factor of claim 14. A method consisting of administering to a patient an effective amount. 37. Neuropathology caused by aging of the nervous system or diseases affecting the immune system 29. A method of treating a medical condition, comprising administering to a patient an effective amount of the pharmaceutical composition of claim 28. A method consisting of things. 38. Neuropathology caused by aging of the nervous system or diseases affecting the immune system 30. A method of treating a medical condition, comprising administering to a patient an effective amount of the pharmaceutical composition of claim 29. A method consisting of things. 39. The amino-terminal region of human ciliary neuron tropism factor (CNTF) Both of them lack one amino acid, and the remaining part of the CNTF has at least one amino acid. Mutant proteins of human CNTF consisting of forms of CNTF containing amino acid substitutions A method of producing a type of human CNTF, the method comprising the following steps: (a) wild type human CNTF; at least one codon encoding an amino acid present in the amino-terminal region of encodes an amino acid that is missing and not present in wild-type human CNTF. a form containing at least one modified codon in the remainder of the CNTF. a first nucleic acid sequence encoding human CNTF, the first nucleic acid sequence comprising at least six histylnucleotides; a second core consisting of a sequence encoding a gin residue and a chemical or enzymatic cleavage site; expressing in a host cell a nucleic acid sequence comprising: fused to an acid sequence; (b) producing an extract of the host cell; (c) by immobilized metal affinity chromatography (IMAC) Purifying the extract; (d) recovering the recombinant mutein CNTF; (e) recovering the CNTF of step (d); incubating the TF with a chemical or enzymatic cleaving agent; (f) Metal affinity chroma immobilizing the reaction product generated in step (e) (g) the mutant protein of CNTF. Collect the texture mold. 40. The person according to claim 39, wherein the mutant protein is D14Ser17CNTF. Law.