JPH06343470A - Gene of proliferation factor originated from human hepatic cancer cell - Google Patents

Abstract

PURPOSE:To obtain a new DNA useful for the preparation of a proliferation factor originated from human hepatic cancer cell. CONSTITUTION:A DNA coding for a proliferation factor originated from human hepatic cancer cell and having the amino acid sequence of formula. The proliferation factor DNA originated from human hepatic cancer cell can be prepared by extracting mRNA from cultured HuH-7 cell originated from human hepatic cancer cell, synthesizing a double-stranded cDNA from the mRNA, amplifying a DNA fragment of a proliferation factor originated from human hepatic cancer cell by PCR method to design a probe of oligonucleotide for screening, integrating the cDNA into a vector DNA for procaryote to obtain a cDNA library and screening the probe for screening.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a gene encoding a human hepatoma cell-derived growth factor (Hepatoma-Derived GF), an expression vector containing the gene, and a trait obtained by transforming a host cell with the expression vector. The present invention relates to a transformant and a method for producing a human hepatoma cell-derived growth factor using the transformant.

[0002]

2. Description of the Related Art Hepatoma-Derived GF is a human hepatoma cell-derived cultured cell HuH-7 (Nakabayashi, H., Taketa, K., Mi.
yano, K., Yamane, T. and Sato, J. (1982) Cancer Res., 42,
3858-3863.) Was roughly purified as a fraction having a proliferative activity on Swiss3T3 cells (Nakamu
ra, H., Kanbe, H., Egawa, T., Kimura, Y., lto, H., Hayashi,
E., Yamamoto, H., Sato, J. and Kishimoto, S. (1989) Clini
ca Chimica Acta, 183,273-274). From this crude fraction, a protein with a molecular weight of about 25,000 was Hepatoma-Derived
It was extracted as GF and its N-terminal amino acid sequence was determined (see Japanese Patent Application No. 3-223158).

[0003]

[Problems to be Solved by the Invention] Hepatoma-Derived GF
Is obtained by extraction from the culture supernatant of cultured cells HuH-7 as described above, but the yield is low. Therefore,
If a large amount of this protein can be produced by studying the Hepatoma-Derived GF gene, various experiments using this protein will be easy.

The object of the present invention is to provide a gene encoding Hepatoma-Derived GF, an expression vector containing the gene,
It is intended to provide a transformant obtained by transforming a host cell with the expression vector, and a method for producing a human hepatoma cell-derived growth factor using the transformant.

[0005]

The human hepatoma cell-derived growth factor (Hepatoma-Derived GF) of the present invention is 240 amino acids of SEQ ID NO: 2 from the methionine (Met) at SEQ ID NO: 1 position.
It contains a nucleotide sequence encoding a peptide up to leucine (Leu) at position.

In a preferred embodiment, the gene has the amino acid sequence of SEQ ID NO: 2 which is serine (Ser) at SEQ ID NO: 2.
To the 240th position of leucine (Leu) are included.

[0007] In a preferred embodiment, the gene is the serine (Ser) at amino acid position 4 of SEQ ID NO: 2.
To the 240th position of leucine (Leu) are included.

In a preferred embodiment, the gene comprises the nucleotide sequence of SEQ ID NO: 2 from A at the nucleotide position 1 to G at the nucleotide position of 720.

[0009] In a preferred embodiment, the gene comprises the nucleotide sequence from T at the nucleotide position 4 of SEQ ID NO: 2 to G at the nucleotide position 720.

[0010] In a preferred embodiment, the above-mentioned gene has a nucleotide sequence of SEQ ID NO: 2 from T at the 10th position to G at the 720th position.
Including the base sequence up to.

In a preferred embodiment, the above gene is derived from human hepatoma cell-derived cultured cell HuH-7.

The expression vector of the present invention contains the above gene.

The transformant of the present invention can be obtained by transforming a host cell with the above expression vector.

The method for producing Hepatoma-Derived GF of the present invention comprises culturing the above transformant, and using Hepatoma-D from the culture supernatant.
Includes the step of collecting erived GF.

The present invention will be described in detail below in the order of steps.

(1) Human hepatoma cell-derived cultured cells HuH-7
Extraction of mRNA from mRNA of human hepatoma cell-derived cultured cells HuH-7. To do this, first destroy the cells and at the same time RN
a method using a reagent that denatures all proteins including ase, such as the phenol method (Paris
h, JH (1972) .Principles and Practice of Experiment
s with Nucleic Acids.Halstead Press), Guanidine Hydrochloride Method (Cox, RA (1968) .In Methods in Enzymology, 12B
p.120.) or the guanidine thiocyanate method (Chirgwin,
JMet el (1979). Biochem., 18, 5294.) etc. treated the cultured cell HuH-7 to give intracellular total RNA.
To extract.

Next, the extracted total RNA was oligo (dT)-
Affinity chromatography using Sepharose (Aviv, H., and Leder, P. (1972) .Proc.Natl.Acad.Sc
i. (USA), 69, 1408) to extract mRNA.

(2) cDNA synthesis DNA (cDNA) complementary to mRNA is synthesized. First, using the mRNA obtained in (1) as a template, the first strand of cDNA is synthesized by reverse transcriptase.
(Efstratiadis, A. and et al. (1976) Cell 7,279). As a primer for reverse transcriptase, oligo (dT) or random hexanucleotide can be used.

Next, the method of Gubler et al. (Gubler, U. and H
offman, BJ (1983) Gene 25, 263-269.) and the method of Okayama et al. (Okayama, H. and Berg, P. (1982) Mol.Cell.Bio.
l.2,161.) can be used to synthesize a second strand of cDNA to obtain a double-stranded cDNA.

(3) Amplification of human hepatoma cell-derived growth factor gene fragment by PCR.

As shown in FIG. 1 (A), 20 from the N-terminal of human hepatoma cell-derived growth factor (Hepatoma-Derived GF).
Amino acids have already been determined (Japanese Patent Application No. 3-2231)
No. 58).

The base sequence of DNA containing all codons corresponding to this amino acid sequence is deduced and the sequence of the mix primer is designed. For example, a DNA sequence containing all the codons corresponding to the 7 amino acids at the N-terminal of the determined 20 amino acids is used as a sense primer, and DN containing all codons corresponding to the 7 amino acids at the C-terminal is used.
A sequence complementary to the base sequence of A is used as an antisense primer (see FIG. 1 (B)).

Using this sense primer and antisense primer, a PCR reaction is carried out using the cDNA obtained in item (2) as a template. In this way, the N-terminal 19
The nucleotide sequence of the cDNA corresponding to the amino acid is amplified,
Obtained as an NA fragment. The obtained DNA fragment is T4D
The ends are blunted by treatment with a modifying enzyme such as NA polymerase and incorporated into a plasmid vector, after which the nucleotide sequence is determined by a conventional method such as the dideoxy method.

Of the base sequence thus obtained, the part excluding the sequence of the mix primer is Hepatoma-Derived GF
It is a DNA sequence uniquely determined on the cDNA. An oligonucleotide probe for screening can be designed based on this sequence (see FIG. 1 (C)).
.

(4) Human hepatoma cell-derived cultured cells HuH-7
Preparation of cDNA liparary of (2) The adapter ligation method (Haymerle, H. and et al. (1986) Nucl.Acid.Res.
14,8615.) Into a vector DNA for prokaryotes to prepare a cDNA library. The homopolymer method (Villa-Komaroff,
L. and et al. (1978) Proc. Natl. Acad. Sci. (USA) 75,372
7.), linker ligation method (Kurtz.DTand Nicod
emus, CF (1981) Gene 13, 145) can be applied.
Any prokaryotic vector may be used, and examples thereof include a plasmid vector and a bacteriophage vector. Specifically, for example, pUC1
8, pUC118, pBluescript, λgt10, λgt
There are 11 and so on.

(5) Human hepatoma cell-derived cultured cells HuH-7
Screening of the cDNA liparary of (3) The Hepatoma-DerivedGF cDNA can be obtained by screening the cDNA library obtained in (4) using the screening probe obtained in (3).

The synthesis of the oligonucleotide probe is as follows:
For example, it can be performed by a known method such as a triester method or a phosphoramidite method.

Screening is carried out by the plaque hybridization method or the colony hybridization method using the synthesized oligonucleotide as a probe, using the cDNA library prepared by the method of item (4).

Hybridization can be carried out by, for example, "Mole
cular Cloning 12,45-12,57 ″ (Cold Spring Harbor L
aboratory Press (1989)).

As a result, He was extracted from a cDNA library synthesized using random hexanucleotides as primers.
Approximately 0.9 kb that partially codes patoma-Derived GF
CDNA fragment (YKT1) can be obtained.

Furthermore, by screening a cDNA library synthesized with this YKT1 as a probe and oligo (dT) as a primer, Hepatoma
An approximately 2.2 kb cDNA fragment (YKT2) encoding -Derived GF can be obtained (see Fig. 5).

(6) Determination of the nucleotide sequence of human hepatoma cell-derived growth factor gene YKT1 and YKT2 obtained by the method of item (5)
The base sequence of is determined by a conventional method such as the dideoxy method. The full length of Hepatoma-Derived GF cDNA can be obtained by combining the nucleotide sequences of YKT1 and YKT2 (see FIG. 5). The entire base sequence thus obtained is shown in SEQ ID NO: 3. Further, of the obtained nucleotide sequences, the part encoding Hepatoma-Derived GF is shown in SEQ ID NO: 2, and the deduced amino acid sequence is shown in SEQ ID NO: 1.

The present invention relates to 1 of the nucleotide sequence of SEQ ID NO: 2.
A base sequence starting from A at position 4 to T at position 4 or T at position 10 is included, but even if a part of the sequence is modified, the polypeptide derived from the sequence is a human hepatoma cell-derived growth factor. When it has the activity of, the base sequence is also included in the scope of the present invention.

(7) Construction of Expression Vector A recombinant protein expression system using higher animal cells is
Post-translational modificati
It is widely used because it has features that other systems cannot obtain. D to higher animal cells
The introduction of NA depends on the length of time to be monitored. The transient expression method and the stable expression method (stab
le transformation)).

The Hepatoma-Derived GF cDNA of the present invention is expressed by a transient expression method which can expect high expression.
These are basically a method using a vector containing the SV40 origin of replication as a host in COS cells (Gluzman,
Y. (1987) Cell 23, 175.).

In the transient expression method, some vectors designed for obtaining high expression, for example, pcDLSRα296 vector having SRα promoter (fusion promoter with SV40 and HTLVI-LTR).
(Takebe, Y., Seiki, M., Fujisawa, J., Hoy, P., Yokota, K.,
Arai, Yoshida, M. and Arai, N. (1988) Mol. Cell. Biol. 8, 46
6-472.), A CDM8 vector having a human cytomegalovirus immediate early promoter (Seed, B. (1987) Nature 3).
29,840-842.), P91023 vector with adenovirus major late promoter (Wong.GG, Witek, JS, T)
emple, PA, Wilkens, KM, Leary, AC, Luxenberg.D.
P., Jones, SS, Brown, EL, Kay, RM, Orr, EC, Shoemak
er, C., Golde, DW, Kaufman, RJ, Hewick, RM, Wang.E.
A. and Clark, SC (1985) Science 228.810-815.).

The expression vector of the present invention is Hepatoma-Deriv.
It can be obtained by introducing edGF cDNA into these vector DNAs.

(8) Preparation of transformant and production of human hepatoma cell-derived growth factor The transformant of the present invention comprises transfection of the expression vector constructed by the method of (7) into an appropriate host. It is obtained by COS cells are preferably used as the host cells. Introduction of DNA into cells is performed by the calcium phosphate method (Graham, FLand van der Eb, AJ (1973) Virology 5
2,456; Chen, C. and Okayama.H. (1987) Mol.Cell.Biol.7,2
745-2752.) Or the Der Edextran method (McCutchan,
JHand Pagano, JS (1968) J.Natl.Cancer lnst.41,35
1; Varden, D. and Thorne, HV (1968)).

Hepatoma-Derived GF is obtained by culturing the above transformant and recovering it from the culture supernatant. The transformant is
For example, it is cultured in a medium containing 10% calf serum. The culture temperature is, for example, 37 ° C., and the culture time is, for example, 48 hours. Thereafter, the transformant is cultured, for example, in a serum-free medium. The culture temperature is, for example, 37 ° C., and the culture time is, for example, 24 hours. Hepatoma thus obtained
The culture supernatant containing -Derived GF is concentrated about 10-fold using a known method such as a membrane that cuts a molecular weight of 10,000 or less, and its proliferation activity is measured.

The Hepatoma-Derived GF proliferative activity was measured by
For example, the stimulation of DNA synthesis on Swiss3T3 cells is performed by the method of Gambarini et al. (Gambarini, A., G. and Aramerin,
H., A. (1982) J. Bio. Chem. 257, 9692-9697), by measuring uptake of ³ H-thymidine, which is a radioactive substance, into cells.

[0041]

EXAMPLES The present invention will be further described with reference to Examples.

(1) Human hepatoma cell-derived cultured cells HuH-
Extraction of mRNA from 7 Human hepatoma cell-derived cultured cells HuH-7 strain (Nakabayashi,
H., Taketa, K., Miyano, K., Yamane, T., Sato, J. (1982) Ca
ncer Res., 42,3858-3863.), 15 ml of RPM1 (Ro
Swell Park Memorial Institute) -1640 medium (Flow Laboratories) was cultured for 2 weeks, from which mRNA of human hepatoma cell-derived cultured cells HuH-7 was prepared by the following method.
Was extracted.

Extraction of Total RNA First, 11 HuH-7 flasks were prepared, and each flask was charged with PBS buffer (NaC1 8 g / l, KC1 0.2
/ L, Na ₂ HPO ₄ 1.15 g / l, KH ₂ PO ₄
It was washed twice with 0.2 g / l). Next, the cells were lysed with 2 ml of a guanidine thiocyanate solution (4M guanidine thiocyanate, 0.5% sarcosyl, 10 mM sodium citrate) to prepare a batch solution (about 25
ml). Take this solution into a disposable syringe,
No. High molecular weight DNA and the like was cut by passing through a 22 gauge needle twice.

This solution was overlayered on 2.5 ml of CsCl solution (5.7M CsCl, 0.01M EDTA (ethylenediaminetetraacetic acid disodium salt), and the rotor RPS40T of Hitachi Ultracentrifuge was rotated at 32000 rpm for 2 times.
An RNA pellet was obtained by centrifugation for 4 hours. This pellet contains 2.5 ml of TE-SDS solution [1
0 mM TrisHCl (Tris (hydroxymethylminomethane ch
loride), 1 mM EDTA, 1% SDS (Sodium dod
esyl sulfate)], and then phenol extraction, chloroform extraction, and ethanol precipitation are performed by a conventional method.
Was recovered. As a result, about 4.3 mg of Total RNA could be obtained.

Purification of mRNA Purification of mRNA from total RNA was performed using an mRNA extraction kit “mRNA separator” (Clontech). First, 3.8 mg of the above total RNA was added to 1 ml of TE buffer (10 mM TrisHCl, pH8.
It was dissolved in 0.1 mM EDTA), treated at 68 ° C. for 5 minutes, cooled on ice, and added with NaCl to 0.5 M. This solution was passed through an oligo (dT) -cellulose column that had been washed with 0.5 M NaCl / TE buffer in advance to adsorb mRNA. 0.25 ml of 0.5M N
twice with aCl / TE buffer, 0.25 ml of 0.1M
0.25m after washing 3 times with NaCl / TE buffer
The mRNA was eluted by passing 4 times 1 TE buffer. A total of 1 ml of the solution thus obtained was passed through an oligo dT cellulose column again under the same conditions to obtain 127 μg of highly pure mRNA.

(2) Synthesis of cDNA cDNA was synthesized using the mRNA extracted in (1) as a template. The synthesis of cDNA is performed by Gubler et al.
r, U. and Hoffman. BJ (1983) Gene 25, 263-269) was used as a cDNA synthesis kit "CDNA Synthesis System Plus" (Amersham) according to the protocol, and the procedure was as follows. Random hexanucleotide primers or oligos (d
T) was used.

(2) -1 cDNA synthesis using random hexanucleotide primer 5 μg of TE buffer containing 5 μg of mRNA obtained in (1)
To l, 10 μl of 5 × first strand synthesis reaction buffer, 2.5 μl of sodium pyrophosphate solution,
2.5 μl of human placental ribonuclease inhibitor,
5 μl of deoxynucleoside triphosphate mixture, and 5
μl (750 ng) of random hexanucleotide primer was added, and water was added to make the volume of this reaction solution 45 μm.
It was set to l. 5 μl of reverse transcriptase (20 units / μ
1) was added and the reaction was treated at 42 ° C for 1 hour and then placed in an ice bath.

93.5 μl of the second strand synthesis reaction buffer, 5 μl (4.0 units)
) E. coli ribonuclease H, 32.8 μl (11
5 units) E. coli DNA polymerase I was added and water was added to make the volume of this reaction liquid 248 μl. This was treated at 12 ° C. for 60 minutes, then at 22 ° C. for 60 minutes and then at 70 ° C. for 10 minutes. Here, the reaction solution was returned to an ice bath, 2 μl (10 units) of T4 DNA polymerase was added, and the mixture was treated at 37 ° C. for 10 minutes. To stop the reaction, 10 μl of 0.25 MEDTA (pH 8.0) was added.

The synthesized double-stranded DNA was phenol-extracted and chloroform-extracted by a conventional method. The nucleoside that was not incorporated was removed by ethanol precipitation in the presence of ammonium acetate as described below. 260 μl of 4M was added to the extracted cDNA solution.
Ammonium acetate, 1040 μl cold ethanol was added and the solution was left on dry ice for 15 minutes. The solution was returned to room temperature with gentle mixing and then centrifuged for 10 minutes in a micro high-speed cooling centrifuge to obtain a cDNA pellet. The pellet was washed by adding 125 μl of 2M ammonium acetate and then 250 μl of cold ethanol to the pellet, mixing gently at room temperature, and then centrifuging to remove the supernatant.

Further, the pellet was washed with 500 μl of ethanol and then dried in a vacuum desiccator for 3 minutes to recover DNA. As a result, about 2 μg of cDNA could be obtained.

(2) -2 cDNA synthesis using oligo (dT) primer In the item (2) -1, 2.5 μl (8) of oligo dT primer was used instead of the random hexanucleotide primer.
μg) cDNA synthesis was carried out in the same manner as in the above item (2) -1 except that it was used. As a result, about 2 μg of cDNA
I was able to obtain A.

(3) Amplification of Human Hepatoma Cell-Derived Growth Factor Gene Fragment by PCR The PCR amplification of the human hepatoma cell-derived growth factor gene fragment (Hepatoma-Derived GF) was carried out as follows in the steps shown in FIG. I went.

Design and synthesis of PCR primer Twenty amino acids have already been determined from the N-terminal of Hepatoma-Derived GF (Japanese Patent Application No. 3-223158,
See FIG. 1A). The nucleotide sequence of DNA containing all the codons corresponding to this amino acid sequence is deduced, and PCR (Po
lymeraze chainreaction) The sequence of the mix primer for amplification was designed. N of 20 determined amino acids
7 amino acids with round ends (Asn-Asn-Clu-Lys-Gln-Tyr-Lys
) Is used as the sense primer, and the C-terminal has 7 amino acids (Ph
A sequence complementary to the nucleotide sequence of DNA containing all codons corresponding to (e-Ala-Lys-Met-Lys-Gly-Tyr) was used as an antisense primer (see FIG. 1 (B)). HuUGFc with this sense primer and antisense primer
If DNA is amplified, it will be about 58 base pairs (bp: base p).
The DNA fragment of airs) will be amplified. These mixed oligonucleotides are used in a DNA automatic synthesizer G
It was synthesized by ENET-AIII (Zeon Corporation).

PCR reaction Using this sense primer and antisense primer, the cDNA obtained in (2) -1 above was used as a template for P
A CR reaction was performed. First, cDNA was synthesized in the same manner as in (2) -1 and dissolved in 50 μl of TE buffer. cDNA solution 5
100 μmol of each of the synthesized sense primer and antisense primer was added to μl, and 10 μl was further added.
10 times the concentration of antiprecipitation solution (50
0 mM KCl, 100 mM TrisHCl pH 8.3, 1
5 mM MgCl ₂ , 0.1% (W / V) gelatin) and 16 μl dNTPs mix (1.25 mM dA)
TP, 1.25 mM dGTP, 1.25 mM dCTP,
1.25 mM dTTP), water, and 0.5 μl of Taq DNA polymerase (5 units / μm).
1, Perkin Elmer Cetus) was added to make the volume of the reaction solution 100 μl. This reaction solution was placed at 94 ° C. for 3 minutes to denature the cDNA. This was further left at 94 ° C. for 1 minute for denaturation, left at 50 ° C. for 1 minute to anneal, and then the reaction solution was left at 72 ° C. for 2 minutes to carry out extension reaction, which was repeated 30 times. . Then 7
The extension reaction was completed by leaving it at 2 ° C. for 2 minutes.

Introduction into the plasmid The reaction product was desalted using a micro desalting tube "Suprec-02" (Takara Shuzo). The reaction product remaining on the membrane of the tube was recovered with 20 μl of TE buffer. This reaction product was added to 0.5 x TBE buffer (45 mM Tris-b
orate, 1mM EDTA), and separated by 8% acrylamide gel electrophoresis.
Band was obtained.

In order to introduce the obtained reaction product into a plasmid, it is necessary to increase the amount of this product. Therefore, a portion (1 μl) of this reaction product was taken and P
Perform CR amplification. This operation was performed 5 times, and the reaction product was desalted using a micro desalting tube "Suprec-02". 20μ of all reaction products remaining on the membrane of the tube
It was recovered with 1 l of TE buffer.

The whole amount of the obtained reaction product (DNA fragment) was blunt-ended with a modifying enzyme T4 DNA polymerase.
The reaction was performed using T4 DNA polymerase buffer (67 mM Tr
isHclpH 8.8, 6.7 mM MgCl ₂ , 16.
6 mM (NH ₄ ) ₂ SO ₄ 10 mM 2-mercaptoethanol, 6.7 μM EDTA, 0.0167% bovine serum albumin, each 330 μM dCTP, dATP,
dCTP, dTTP) and 30 units of T4 DNA polymerase at 37 ° C. for 5 minutes. Then, phenol extraction, chloroform extraction, and ethanol precipitation were carried out by a conventional method to recover DNA, which was dissolved in 40 μl of TE buffer.

Separately, 5 μg of plasmid vector pBluescript II KS (-) (Stratagene) was added to
50 μl of restriction enzyme Smal buffer (33 mM Tris-a
cetate pH 7.9, 10 mM Mg-acetate, 0.
5 mM dithiothreitol, 66 mM K-acetate)
Medium, 30 units with 20 units of restriction enzyme SmaI (Takara Shuzo)
After treatment at ℃ for 2 hours, the DNA is recovered by phenol extraction, chloroform extraction, and ethanol precipitation by the usual method.
This was dissolved in 40 μl TE.

2 μl of the plasmid vector pBluescript IIKS (-) digested with this restriction enzyme SmaI
And 20 μl of 2 μl of the PCR reaction product (DNA fragment) whose ends were treated with the modifying enzyme T4 DNA polymerase
T4 ligase buffer (66 mM Tris-HCl pH
7.6, 6.6 mM MgCl ₂ , 10 mM DTT,
The vector and the PCR reaction product were bound by treatment with 10 units of T4 ligase (Toyobo Co., Ltd.) in 15 nC for 15 hours in 66 nM ATP). This recombinant plasmid was prepared by Cohen's method (Cohen, SN, Chang.
ACYand Hsu, L. (1972) Proc. Natl. Acad. Sci. (USA) 69,2
110.) and introduced into E. coli JM109, 100 μl / ml
LB agar medium (1% bactopeptone, 0.5% yeast extract, 1% NaCl,
Cultured overnight on 1.5% agar).

One of the many colonies obtained was L
Cultivated in B-medium and the plasmid was "Molecular Cloning".
It was prepared in a large amount by the method of 1.33-1.34, 1.42-1.43 "and named as pPCR-1.
Using R-1, M13 reverse primer and M13 (-2
0) Primer (Stratascene) is used as a primer,
The base sequence of the PCR product was determined using the Sequenase 7-deaza-dGTP-sequencing kit (United States Biochemical Corp.).

As a result, pPCR-1 was identified as Hepatoma described later.
-Refer to the DNA sequence and amino acid sequence of Derived GF (SEQ ID NO: 2), the gene sequence encoding the polypeptide containing N-terminal 5 to 23 of Hepatoma-Derived GF is a restriction enzyme SmaI digested plasmid vector pBluescript. It was clarified that it was introduced in II KS (-).

However, the arginine of amino acid number 6 is different from the amino acid sequence of FIG. 1 (A) used for making the primer this time. This is based on an experimental error in determining the N-terminal amino acid sequence from the Hepatoma-Derived GF protein, and the amino acid sequence deduced from this cDNA is considered to be correct.

Synthesis of screening probe A screening primer was synthesized based on the determined nucleotide sequence of the PCR product (see FIG. 1 (C)).

(4) Human hepatoma cell-derived cultured cells HuH-7
Preparation of cDNA library of Phage cloning system is widely used for preparing cDNA library. This time, heimere method (Haymerle, H. and et al., (1986) N
ucl.Acid.Res.14,8615), a kit "cDNA cloning system λgt11 adapter method" (Amersham) and "cDNA cloning system λgt10 adapter" containing all reagents and protocols for preparing a cDNA library. Method "(Amersham) was used to prepare the following two types of cDNA libraries.

(4) -1 cDNA synthesized by using random hexanucleotide primers and cDNA by "cDNA cloning system λgt11 adapter method"
Creation of A library.

5 μl of TE buffer containing 1 μg of cDNA synthesized with the random hexanucleotide primer obtained by the EcoRI adapter ligation (2) -1 was added to 2 μl of ligation / kaination reaction buffer, 2.5 μl (250 pmoles ) Ec
The oRI-BamHI-KpnI-NcoI adapter was added and water was added to make the volume of this reaction solution 18 μl. 2 μl of T4 DNA ligase (2.5 unit
s / μl) and treated at 15 ° C. for 16 hours, to stop the reaction, 2 μl of 0.25M EDTA (p
H8.0) was added.

Next, in order to remove the unreacted adapter, the reaction solution was passed through a size fractionation column equilibrated with 0.25 × TE buffer to give 500 bp.
The above cDNA fraction was collected. This cDNA fraction was concentrated to about 200 μl with butanol by a conventional method.

40 μl of ligation / kaination reaction buffer, 10 μl (80 units)
) T4 nucleotide kinase was added, and the volume of this reaction solution was adjusted to 400 μl with water. This was treated at 37 ° C. for 30 minutes. The linker-added cDNA was recovered by phenol extraction, chloroform extraction, and ethanol precipitation by a conventional method. As a result, about 100 ng of c
The DNA could be recovered.

Dephosphorylation into the EcoRI Vector Arm
Ligation and in vitro packaging reaction T containing 40 ng of the above-mentioned linker-added cDNA
In 5 μl of E solution, 1 μl of ligation reaction buffer, 2 μl of dephosphorylated Eco RI digested λgt11
The vector arm was added and water was added to bring the volume of this reaction solution to 9 μl. To this, 1 μl of T4 DNA ligase (2.5 units / μl) was added and treated at 15 ° C. for 16 hours.

The recombinant phage obtained was one in which cDNA was introduced into the EcoRI site of the phage vector λgt11. To transform this recombinant phage into infectious phage particles, Collins' method (Collins,
Based on J. and Hohn, B. (1978) Proc.Natl.Acd.Sci.71,2442), an in vitro packaging reaction was performed as follows.

Immediately after adding 5 μl of the above-mentioned ligation reaction solution Packaging Extract A, 15
μl of Packaging Extract B was added and mixed gently. 0.42 ml after treatment for 2 hours at 20 ℃
SM buffer (10 mM NaCl, 8.11 mM M
gSO ₄ , 50 mM TrisHCl pH 7.5, 0.01
% Gelatin) was added to make a phage stock.

Titration of Phage Stock The resulting phage stock was diluted with SM buffer to 10
Diluted ⁴ times or 10 ⁵ times or 10 ⁶ times. To 100 μl of these phage solutions, 100 μl of host E. coli Y
1090 culture solution (OD = 0.5) and 4 ml of top agar melted at 48 ° C. (0.1% bactopeptone, 0.05% yeast extract, 0.1% Na)
Cl, 0.8% agar) was mixed and overlaid on an LB agar medium having a diameter of 82 mm and cultured at 37 ° C. for 8 hours to form plaques.

The phage titer was determined by counting the plaques thus obtained. As a result, 2 × 10 ⁶ pfu (plaque forming units) / μg
A λgt11 arm cDNA phage library could be obtained.

(4) -2 Preparation of cDNA library by cDNA synthesized by using oligo (dT) primer and "cDNA cloning system λgt10 adapter method"

CDNA using oligo (dT) primer
The library of A was also prepared according to the protocol attached to "cDNA cloning system λgt10 adapter method" in the same manner as in the above item (4) -1.

The phage titer of the obtained cDNA phage library was determined to be 1 × 10 ⁶ pfu /
A μg λgt10 arm could be obtained.

(5) Human hepatoma cell-derived cultured cells HuH-7
CDNA library screening (5) -1 random hexanucleotide primers Screening of the synthesized cDNA libraries using (4) synthesized human hepatoma cell derived cultures random hexanucleotide prepared -1 Section as primers Cell Hu
Screening of the H-7 cDNA library
Using the 20-mer oligonucleotide prepared in section (3) as a probe, the following procedure was performed.

First, 100 μl of the phage solution of the cDNA library prepared in (4) -1 and host E. coli Y1090
600 μl of the culture solution (OD = 0.5) and the melted top agar at 48 ° C. were mixed, and the mixture was overlaid on an LB agar medium having a diameter of 150 mm and cultured at 37 ° C. for 8 hours. In this way, eight plates were prepared on which about 40,000 plaques were formed. This plaque was transferred onto a nylon membrane Hybond N + (manufactured by Amersham) according to the attached instruction.

Separately from this, the 5'-end of the screening oligonucleotide of item (3) was labeled with ³² P-ATP and T4.
A kit using polynucleotide kinase, "MEGA
Radiolabeled with LABEL "(Takara Shuzo).

Using the above nylon membrane, 5xSSP
E solution (20xSSPE = 3.6M NaCl, 0.2M
phosphate buffer pH 7.7, 0.02M EDT
A) / 5 x Denharz solution (100 x Denharz = 2%
Polyvinylpyrrolidone, 2% Ficoll 400, 2% bovine serum albumin) /0.5% SDS / 20 μg / ml
Prehybridization was performed in denatured salmon sperm DNA at 50 ° C. for 6 hours.

The radiolabeled probe was treated at 100 ° C.
The prehybridization solution was added to the prehybridization solution at 1 × 10 ⁵ -1 × 10 ⁶ cpm / ml, and hybridized at 50 ° C. for 20 hours. After that, apply the membrane to 5xSSPE / 0.1
5% SSDS / 0.1% SD for 5 minutes at room temperature with% SDS
It was sequentially washed with S at 50 ° C. for 2 times for 10 minutes each. As a result of examining this by autoradiography, only one plaque that hybridized with the probe was obtained.

Introduction into plasmid From the obtained positive phage, cDNA was extracted according to the process of FIG. 3 and introduced into a plasmid as follows.

The obtained phage plaque was punched out with the tip of a sterilized Bastur pipette, suspended in 0.5 ml of SM buffer, and left at 4 ° C. for 2 hours. 10 of this suspension
0 μl, 100 μl of host Escherichia coli Y1090 culture solution (OD = 0.5), and 4 ml of top agar melted at 48 ° C. were mixed to form plaques on an LB agar medium having a diameter of 82 mm. Four such plates were prepared. Phage particles were collected by overlaying each plate with 4 ml of SM buffer on the surface of the plate and gently shaking for 12 hours. An equal amount of PE is added to this recovered SM buffer.
G / NaCl solution (20% polyethylene glycol 60
00,20 mM NaCl / SM buffer) was added and 4
The phage particles were precipitated by treating at 0 ° C. for 1 hour and collected as a pellet after centrifugation. The phage particles were suspended in 500 μl of TE buffer and subjected to phenol extraction, chloroform extraction, and ethanol precipitation by a conventional method to recover DNA. These are 100 μl of T
It was dissolved in E buffer to obtain a phage DNA solution.

20 μl of this phage DNA solution was added to 50
0 μl of restriction enzyme BamHI buffer (20 mM TrisH
Cl pH 8.5, 10 mM MgCl ₂ , 1 mM dithiothreitol, 100 mM KCl), 100 units
Treated with the restriction enzyme BamHI (Takara Shuzo Co., Ltd.) at 37 ° C. for 2 hours, followed by phenol extraction, chloroform extraction by a conventional method,
DNA is collected by ethanol precipitation and
l dissolved in TE buffer.

When the reaction product was separated by 0.5% TBE buffer by 0.7% agarose electrophoresis, a band of cDNA having an inserted about 0.9 k base pairs (bp) was obtained. It was This cDNA fragment was named YKT1.

Separately, 5 μg of the plasmid vector pBluescript II KS (-) (Stratagene) was added to
In 50 μl of restriction enzyme BamHI buffer, treated with 50 units of restriction enzyme BamHI (Toyobo Co., Ltd.) at 37 ° C. for 2 hours, followed by phenol extraction and chloroform extraction by a conventional method.
Ethanol precipitation was performed to recover the DNA, which was
l dissolved in TE buffer.

20 μl of 2 μl of the plasmid vector pBluescript II KS (-) digested with this restriction enzyme BamHI and 2 μl of the phage DNA treated with the above restriction enzyme BamHI were used.
The vector and cDNA were bound by treating with 10 units of T4 ligase (Toyobo Co., Ltd.) in 15 μl of T4 ligase buffer at 15 ° C. for 15 hours.

The recombinant plasmid obtained was pYKT1.
And was introduced into Escherichia coli JM109 by the method of Cohen. pYKT1 refers to the human hepatoma cell-derived growth factor DNA sequence (SEQ ID NO: 3) described below,
The nucleotide sequence 1 to 859 of A is introduced into pBluescript II KS (-) via an adapter.

(5) -2 Screening of cDNA Library Synthesized Using Oligo dT Primer Screening of the cDNA library prepared in (4) -2 is carried out by the DNA obtained in (4) -1 Fragment YKT1
Was used as a probe and was carried out as follows.

(4) 100 μl of phage solution of the cDNA library prepared in the section (2) -600 μl of host Escherichia coli L8
The culture broth of 7 (OD = 0.5) and the melted top agar at 48 ° C. were mixed and overlaid on an LB plate having a diameter of 150 mm, and cultured at 37 ° C. for 8 hours. In this way, 18 plates were formed on which about 40,000 plaques were formed.
I made one. This plaque is nylon membrane Hyb
Transfer was performed according to the instruction attached to ondN + (manufactured by Amersham).

Separately, Escherichia coli JM109 harboring the plasmid pYKT2 was transformed into "Molecular Cloning 1.3".
3-1.34, 1.42-1.43 "was prepared in a large amount. 50 µg of the obtained plasmid DNA
100 μl in 500 μl BamHI restriction enzyme buffer
It was treated with its restriction enzyme BamHI at 37 ° C. for 2 hours.
This reaction product was separated by 0.7% agarose electrophoresis in 0.5xTBE buffer, the YKT2 band was cut out, and "Molecular Cloning 6.28-6.29" was obtained.
According to the method described in (Cold Spring Houbor Laboratory Press 1989), DNA was recovered by electroelution in 0.5 × TBE buffer. This gives about 7 μg of DNA
Fragments were obtained and dissolved in 20 μl TE buffer.

25 n of YKT1 extracted from the plasmid
g is the Feinberg method (Feinberg, AP, and Vogelstei
n, B. (1984). Anal. Biochem. (137), 266-267) based on "Random Primer DNA Labeling Kit" (Takara Shuzo Co., Ltd.) for radioactive labeling with ³² P-dCTP.

A nylon membrane on which the above phage was transferred was treated with 5xSSPE / 5x Denhardt's solution / 0.5%.
In SDS / 20 μg / ml denatured salmon sperm DNA, 65
Prehybridization was carried out at 6 ° C for 6 hours.

The radiolabeled probe was treated at 100 ° C.
The prehybridization solution was added to the prehybridization solution at 1 × 10 ⁵ -1 × 10 ⁶ cpm / ml, and hybridized at 65 ° C. for 20 hours. After that, apply the membrane to 2xSSPE / 0.1
% SDS at room temperature for 5 minutes, 2x SSPE / 0.1% SD
S twice at 65 ° C for 10 minutes each and 1x SSPE
/ Washing with 0.1% SDS at 65 ° C for 15 minutes sequentially.
As a result of examining this by autoradiography, 32 plaques that hybridized with the probe were obtained.

Introduction into a plasmid DNA was recovered from the obtained positive phage in the same manner as in the above item (5) -1, and cut with the restriction enzyme EcoRI. These reaction products were added to 0.5 x TBE buffer,
Separation by 0.7% agarose electrophoresis gave a clone having a cDNA of about 2.3 kbp. This cDNA fragment was named YKT2 and was introduced into the EcoRI site of the plasmid vector pBluescript II KS (+) (Stratagene) according to the process shown in FIG.

The resulting recombinant plasmid is pYKT2
And was introduced into Escherichia coli JM109 by the method of Hanahan. Referring to the DNA sequence of Hepatoma-Derived GF (SEQ ID NO: 3) described below, pYKT2 is the cDNA having the nucleotide sequence from 89 to 2376 introduced into pBluescript II KS (+) via an adapter. .

(6) Determination of Nucleotide Sequence of Human Hepatoma Cell-Derived Growth Factor Gene Escherichia coli JM109 harboring plasmids pYKT1 and pYKT2 was transformed into "Molecular Cloning 1.33-1.3".
4, 1.42-1.43 ". A large amount was prepared according to the method of 1.41, 1.42-1.43". First, M13 reverse primer and M13 (-20) were used as primers using the obtained plasmid DNA.
Using a primer (Stratagene), a sequence of about 250 bases was determined for each primer by a sequencerase-7-deaza dGTP-sequencing kit based on the dideoxy method. A new primer was synthesized based on the determined about 250 bases and the base sequence was determined to determine the entire base sequence. Hepatoma-Derived GF c by combining the entire nucleotide sequences of YKT1 and YKT2
The entire nucleotide sequence of DNA was used. The precursor nucleotide sequence of the obtained cDNA is shown in SEQ ID NO: 3, and the amino acid sequence of the polypeptide translated by the nucleotide sequence is shown in SEQ ID NO: 2.

(7) Construction of expression vector, preparation of transformant and production of human hepatoma cell-derived growth factor Construction of expression vector (5) YKT2 obtained in the section 2 was used as a plasmid pcDLSRα296 (Takebe for expression in animal cells). , Y., Seiki, M., Fujisaw
a, J., Hoy, P., Yokota, K., Arai, K., Yoshida.M. and Arai,
N. (1988) Mol.Cell.Biol.8,466-472) was introduced into the EcoRI site according to the process shown in FIG.

E. coli J carrying the plasmid pYKT2
M109 for "Molecular Cloning 1.33-1.34,
The obtained plasmid DNA was treated with 100 units of restriction enzyme EcoRI in 500 μl of restriction enzyme EcoRI buffer for 2 hours at 37 ° C. for 2 hours. Were separated by 0.7% agarose electrophoresis in 0.5xTBE buffer, the YKT2 band was cut out, and "Mole
cular Cloning 6.28-6.29 "(Cold Spring Ho
ubor Laboratory press 1989)
DNA was recovered by electroelution in 0.5 × TBE buffer. This gave about 15 μg of DNA fragment,
It was dissolved in μl of TE buffer.

Separately, 5 μg of the expression plasmid vector pcDLSRα296 was added to 50 units of the restriction enzyme EcoRI buffer in 50 μl of the restriction enzyme EcoRI buffer.
(Toyobo Co., Ltd.) treatment at 37 ° C. for 2 hours, phenol extraction, chloroform extraction and ethanol precipitation were carried out by a conventional method to recover DNA, which was dissolved in 40 μl of TE buffer.

2 μl of this plasmid vector pcDLSRα296 for digestion with the restriction enzyme EcoRI and Y
The vector and YKT2 were ligated by treating 2 μl of the KT2 EcoRI fragment with 10 units of T4 ligase (Toyobo Co., Ltd.) in 20 μl T4 ligase buffer at 15 ° C. for 15 hours.

The resulting recombinant plasmid is pSRαU
It was named Y2. pSRαUY2 has a promoter with high expression efficiency called SRα as a drive unit for transcription, and Hepatoma-Derived G integrated downstream.
F cDNA can be expressed using COS-7 cells as a host.

Preparation of transformants The method of Chen-Okayama (Chen, C., Ok
ayama, H. (1987) Mol. Cell. Biol., 7, 2745-2752.), a transformant of COS-7 cells was prepared using the plasmid pSRαUY2 as follows.

COS-7 cells in the logarithmic growth phase were treated with trypsin by a conventional method, and 10 ml was added to a 10 cm diameter plate.
10% calf serum (Flow Laboratory), 60 μg
DME (Du containing / kanamycin (Meiji Seikasha))
5 × 10 ⁵ ce in lbecco's modified Eagle's medium
It was seeded so as to be 11 and cultured overnight at 37 ° C. in 5% carbon dioxide gas.

28 μg of plasmid DNA (15 μlT
E buffer) in 0.5 ml 0.25 M CaCl ₂ and 0.5 ml ₂ × BBS (50 mM BES (N, N-
bis [2-hydroxyethyl] -2-aminoethanesulfonic a
cid) / 280 mM NaCl / 1.5 mM Na ₂ H
PO ₄ , pH 6.95) and left at room temperature for 20 minutes. This solution was added drop by drop to the medium, the plate was well diffused, and then cultured at 37 ° C. for 16 hours in a carbon dioxide concentration of 5%. After that, the medium was removed, and COS-7 cells were
Wash twice with 0 ml PBS buffer station, 10% calf serum,
5 in DME medium containing 60 μg / ml kanamycin
The culture was continued overnight at 37 ° C. in a carbon dioxide concentration of%. (The cells were trypsinized by a standard method, diluted 4 times and diluted in DME containing 10% calf serum and 60 μg / ml kanamycin at 5% carbon dioxide concentration at 37 ° C.
The cells were cultured under the conditions of 48 hours. The transformant thus obtained was named COS (pSRαUY2), and was similarly transformed with the plasmid pcDLSRα296.
The S cell was named COS (pcDLSRα296).

Production of Hepatoma-Derived GF COS (pSRαUY2) and CO cultured in DME medium containing 10% calf serum and 60 μg / ml kanamycin.
The medium of S (pcDLSRα296) was replaced with DME medium containing 60 µg / ml of kanamycin, and the temperature was 37 ° C, 5%.
It was cultured in carbon dioxide gas for 24 hours. 4 such plates
A total of 40 ml of the collected medium was concentrated about 10 times with Centricut mini (molecular weight cut 10,000) (Kurashiki Spinning Co., Ltd.).

Measurement of Hepatoma-Derived GF Proliferative Activity The obtained Hepatoma-Derived GF proliferative activity was measured by Sw.
This was done by measuring the stimulation of DNA synthesis on iss 3T3 cells. Stimulation of DNA synthesis on Swiss 3T3 cells is performed by the method of Gambarini A., G. and Aramer.
in, H., A. (1982) J. Bio.Chem. 257, 9692-9697.),
Uptake of ³ H-thymidine, which is a radioactive substance, into cells was measured as follows.

Swiss 3T3 cells were maintained in 25 cm ² flasks in DME medium containing 10% calf serum, 60 μg / ml kanamycin, 37 ° C., 5% carbon dioxide.

The cells were treated with trypsin by a conventional method, ³ × 10 ³ cells were dispensed per well into a 96-well multiwell plate, and 200 μl of 10% calf serum, 60 μl
DME medium containing g / ml of kanamycin at 37 ° C,
The cells were cultured in 5% carbon dioxide gas for 48 hours. After that, the medium in each well was added to 150 μl of 0.2% calf serum, 60 μg / m 2.
37 ml of DME medium containing 1 kanamycin
The cells were cultured at 5 ° C. and 5% carbon dioxide gas for 36 hours. By this procedure, the cells could be brought into a serum-starved state.

20 ml of Hepatoma-Derived G in each well
The growth of Swiss 3T3 cells was stimulated by adding F sample and culturing at 37 ° C. in 5% carbon dioxide gas for 20 hours. Then add 0.5 μCi of ³ H-thymidine,
By culturing at 37 ° C. and 5% carbon dioxide gas for 4 hours,
³ H-thymidine was incorporated into cells.

³ H-thymidine incorporated into intracellular DNA was measured by a liquid scintillation counter after collecting cells on a glass filter by a cell harvester.

The results are shown in FIG. Control (vector p
COS (pSRαUY2) of the present invention compared to cDLSRα276 only in COS cells)
In the sample of Hepatoma-Derived GF, the uptake of ³ H-thymidine was clearly increased, and the proliferative activity could be confirmed. Therefore, it was revealed that Hepatoma-Derived GF was produced in COS cells having pSRαUY2.

[0113]

As described above, according to the present invention, a DNA sequence encoding a human hepatoma cell-derived growth factor (Hepatoma-Derived GF), an expression vector having the DNA sequence, and a transformant containing the expression vector. Hepatoma with
-A method for manufacturing Derived GF is provided. Hepatoma-Deriv
Conventionally, edGF is a human hepatoma cell-derived cultured cell HuH-7.
Although it was directly extracted from the culture supernatant of No. 1 and purified, the present invention made it possible to produce by genetic recombination.

[0114]

[Sequence list]

SEQ ID NO: 1 Sequence length: 240 Sequence type: Amino acid Topology: Linear Antisense: No Sequence type: Protein Origin: Human hepatoma cell culture cell Direct origin: JCRBO403, Cancer Research Foundation Cell bank SEQ ID NO: 2 Sequence length: 720 nucleotides in DNA Sequence type: DNA nucleotide sequence and corresponding amino acid sequence Number of strands: Double strands Topology: Linear Sequence type: cDNA Antisense: No Origin: Human Hepatoma Cell Culture Cell Direct Origin: JCRBO403, Cancer Research Foundation Cell Bank SEQ ID NO: 3 Sequence length: 2376 bases Sequence type: DNA base sequence Number of strands: Double strand Topology: Linear Sequence type: cDNA Antisense: No Origin: Human hepatoma cell culture cells Direct origin: JCRBO403, Foundation for cancer research Foundation cell bank arrangement GAGGAGGAGTGGGGACCGGGCGGGGGGTGG 30 AGGAAGAGGCCTCGCGCAGAGGAGGGAGCA 60 AATTGAATTTCAAACACAAACAACTCGACG 90 GCGCGCACCCACCGCGCCGGAGCCTTGCCC 120 CGATCCGCGCCCGCCCCGTCCGTGCGGCGC 150 GCGGGCGGAGACGCCGTGGCCGCGCCGGAG 180 CTCGGGCCGGGGGCCACCATCGAGGCGGGG 210 GCCGCGCGAGGGCCGGAGCGGAGCGGCGCC 240 GCCACCGCCGCACGCGCAAACTTGGGCTCG 270 CGCTTCCCGGCCCGGCGCGGAGCCCGGGGC 300 GCCCGGAGCCCCGCC 315 ATGTCGCGATCCAACCGGCAGAAGGAGTAC 345 MetSerArgSerAsnArgGlnLysGluTyr AAATGCGGGGACCTGGTGTTCGCCAAGATG 375 LysCysGlyAspLeuValPheAlaLysMet AAGGGCTACCCACACTGGCCGGCCCGGATT 405 LysGlyTyrProHisTrpProAlaArgIle GACGAGATGCCTGAGGCTGCCGTGAAATCA 435 AspGluMetProGluAlaAlaValLysSer ACAGCCAACAAATACCAAGTCTT TTTTTTC 465 ThrAlaAsnLysTyrGlnValPhePhePhe GGGACCCACGAGACGGCATTCCTGGGCCCC 495 GlyThrHisGluThrAlaPheLeuGlyPro AAAGACCTCTTCCCTTACGAGGAATCCAAG 525 LysAspLeuPheProTyrGluGluSerLys GAGAAGTTTGGCAAGCCCAACAAGAGGAAA 555 GluLysPheGlyLysProAsnLysArgLys GGGTTCAGCGAGGGGCTGTGGGAGATCGAG 585 GlyPheSerGluGlyLeuTrpGluIleGlu AACAACCCTACTGTCAAGGCTTCCGGCTAT 615 AsnAsnProThrValLysAlaSerGlyTyr CAGTCCTCCCAGAAAAAGAGCTGTGTGGAA 645 GlnSerSerGlnLysLysSerCysValGlu GAGCCTGAACCAGAGCCCGAAGCTGCAGAG 675 GluProGluProGluProGluAlaAlaGlu GGTGACGGTGATAAGAAGGGGAATGCAGAG 705 GlyAspGlyAspLysLysGlyAsnAlaGlu GGCAGCAGCGACGAGGAAGGGAAGCTGGTC 735 GlySerSerAspGluGluGlyLysLeuVal ATTGATGAGCCAGCCAAGGAGAAGAACGAG 765 IleAspGluProAlaLysGluLysAsnGlu AAAGGAGCGTTGAAGAGGAGAGCAGGGGAC 795 LysGlyAlaLeuLysArgArgAlaGlyAsp TTGCTGGAGGACTCTCCTAAACGTCCCAAG 825 LeuLeuGluAspSerProLysArgProLys GAGGCAGAAAACCCTGAAGGAGAGGAGAAG 855 GluAlaGluAsnProGluGlyGluGluLys GAGGCAGCCACCTTGGAGGTTGAGAGGCCC 885 GluAlaAlaThrLeuGluValGluArgPro CTTCCTATGGAGGTGGAAAAGAATAGCACC 91 5 LeuProMetGluValGluLysAsnSerThr CCCTCTGAGCCCGGCTCTGGCCGGGGGCCT 945 ProSerGluProGlySerGlyArgGlyPro CCCCAAGAGGAAGAAGAAGAGGAGGATGAA 975 ProGlnGluGluGluGluGluGluAspGlu GAGGAAGAGGCTACCAAGGAAGATGCTGAG 1005 GluGluGluAlaThrLysGluAspAlaGlu GCCCCAGGCATCAGAGATCATGAGAGCCTG 1035 AlaProGlyIleArgAspHisGluSerLeu TAGCCACCAATGTTTCAAGAGGAGC 1060 CCCCACCCTGTTCCTGCTGCTGTCTGGGTG 1090 CTACTGGGGAAACTGGCCATGGCCTGCAAA 1120 CTGGGAACCCCTTTCCCACCCCAACCTGCT 1150 CTCCTCTTCTACTCACTTTTCCCACTCCAA 1180 GCCCAGCCCATGGAGATTGACCTGGATGGG 1210 GCAGGCCACCTGGCTCTCACCTCTAGGTCC 1240 CCATACTCCTATGATCTGAGTCAGAGCCAT 1270 GTCTTCTCCCTGGAATGAGTTGAGGCCACT 1300 GTGTTCCTTCCGCTTGGAGCTATTTTCCAG 1330 GCTTCTGCTGGGGCCTGGGACAACTGCTCC 1360 CACCTCCTGACACCCTTCTCCCACTCTCCT 1390 AGGCATTCTGGACCTCTGGGTTGGGATCAG 1420 GGGTAGGAATGGAAGGATGGAGCATCAACA 1450 GCAGGGTGGGCTTGTGGGGCCTGGGAGGGG 1480 CAATCCTCAAATGCGGGGTGGGGGCAGCAC 1510 AGGAGGGCGGCCTCCTTCTGAGCTCCTGTC 1540 CCCTGCTACACCTATTATCCCAGCTGCCTA 1570 GATTCAGGGAAAGTGGGACAGCTTGTAGGG 1600 GAGGGGCTCCTTTCCATAAATC CTTGATGA 1630 TTGACAACACCCATTTTTCCTTTTGCCGAC 1660 CCCAAGAGTTTTGGGAGTTGTAGTTAATCA 1690 TCAAGAGAATTTGGGGCTTCCAAGTTGTTC 1720 GGGCCAAGGACCTGAGACCTGAAGGGTTGA 1750 CTTTACCCATTTGGGTGGGAGTGTTGAGCA 1780 TCTGTCCCCCTTTAGATCTCTGAAGCCACA 1810 AATAGGATGCTTGGGAAGACTCCTAGCTGT 1840 CCTTTTTCCTCTCCACACAGTGCTCAAGGC 1870 CAGCTTATAGTCATATATATCACCCAGACA 1900 TAAAGGAAAAGACACATTTTTTAGGAAATG 1930 TTTTTAATAAAAGAAAATTACAAAAAAAAA 1960 TTTTAAAGACCCCTAACCCTTTGTGTGCTC 1990 TCCATTCTGCTCCTTCCCCATCGTTGCCCC 2020 CATTTCTGAGGTGCACTGGGAGGCTCCCCT 2050 TCTATTTGGGGCTTGATGACTTTCTTTTTG 2080 TAGCTGGGGCTTTGATGTTCCTTCCAGTGT 2110 CATTTCTCATCCACATACCCTGACCTGGCC 2140 CCCTCAGTGTTGTCACCAGATCTGATTTGT 2170 AACCCACTGAGAGGACAGAGAGAAATAAGT 2200 GCCCTCTCCCACCCTCTTCCTACTGGTCTC 2230 TCTATGCCTCTCTACAGTCTCGTCTCTTTT 2260 ACCCTGGCCCCTCTCCCTTGGGCTCTGATG 2290 AAAAATTGCTGACTGTAGCTTTGGAAGTTT 2320 AGCTCTGAGAACCGTAGATGATTTCAGTTC 2350 TAGGAAAATAAAACCCGTTGATTACT (An) 2376

[Brief description of drawings]

FIG. 1 (A) Human hepatoma cell-derived growth factor (Hepatoma-D)
FIG. 2 is a sequence diagram showing the partially determined 20 amino acid sequence of erived GF). (B) It is a figure which shows the synthetic | combination oligonucleotide probe containing all the possible DNA base sequences in a gene deduced from the amino acid sequence underlined in (A). (C) is a view showing an oligonucleotide for screening.

FIG. 2 is a construction diagram of pPCR-1.

FIG. 3 is a construction diagram of a recombinant plasmid pYKT1.

FIG. 4 is a construction diagram of recombinant plasmid pYKT2.

FIG. 5 is a restriction enzyme digestion map of Hepatoma-Derived GF cDNA.

FIG. 6: Plasmid pSRαUY for expression in COS cells
It is a construction drawing of 2.

FIG. 7: Hepatoma-Derived GF expressed in COS cells
It is a figure which shows the proliferation activity of.

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁵ Identification number Office reference number FI technical display location C12N 5/10 C12P 21/02 C 8214-4B // (C12N 1/21 C12R 1:19) ( (C12N 5/10 C12R 1:91) (C12P 21/02 C12R 1:19) (C12P 21/02 C12R 1:91)

Claims (10)

[Claims] 1. A human hepatoma-derived growth factor (Hepatoma-Derived GF) having the amino acid sequence shown in SEQ ID NO: 1.
) Encoding DNA. 2. A human hepatoma cell-derived growth factor (Hepatoma-D).
The DNA according to claim 1, wherein the cDNA encoding erived GF) contains the base sequence of SEQ ID NO: 2 or is represented by a part thereof. 3. A recombinant DNA molecule in which the DNA base sequence according to claim 1 or 2 is incorporated into a vector used in a host-vector system of Escherichia coli. 4. Escherichia coli transformed with the recombinant DNA molecule according to claim 3. 5. A protein having the amino acid sequence shown in SEQ ID NO: 1. 6. A protein having an amino acid sequence in which one amino acid at the amino terminus of the amino acid sequence shown in SEQ ID NO: 1 is deleted. 7. A protein having an amino acid sequence in which the amino-terminal 3 amino acids of the amino acid sequence shown in SEQ ID NO: 1 are deleted. 8. A recombinant DNA molecule in which the DNA nucleotide sequence according to claim 1 or 2 is incorporated into a vector used in a host-vector system of animal cells. 9. An animal cell transformed with the recombinant DNA molecule according to claim 8. 10. A culture of the transformant according to claim 9,
A method for producing a protein, which comprises collecting the protein according to claim 5, 6 or 7 from a culture solution.