JPH03297388A - New tnf variant, production thereof and antitumor agent containing the same variant as active ingredient - Google Patents

Abstract

NEW MATERIAL:A TNF variant having sequence of amino acid residue of L body expressed by the formula (X is Val or Arg; Y is Asn or Gly; Z is Arg, Glu or Gln except when X is Val and Y is Asn and Z is Arg). EXAMPLE:An antiulcer agent. USE:A host cell is transformed by a recombinant vector in which DNA having a base sequence in which a translation initiation codon is bound to 5' end of the base sequence coding a TNF variant expressed by the formula and a translation termination codon is bound to 3' end thereof is integrated into a manifestation vector and then the transformed host cell is cultured in a culture medium.

Description

DETAILED DESCRIPTION OF THE INVENTION [Industrial Application Field] The present invention relates to a novel TNF mutant, a method for producing the same, and an antitumor agent containing the same as an active ingredient.

[Conventional technology]

TNF (tumor necrosis factor) was developed by Carsw in 1975.
It is a physiologically active substance discovered by el et al. (
E., A., Carswell et al., Proc., Na.
tl, Acad, Sci.

USA, 72.3666 (1975)), i
It has been characterized as a substance that exhibits strong cytotoxic activity against various types of cancer cells in vitro cell culture systems, and causes necrosis in transplanted tumors in vivo (L, J, Old, Cancer). Res,,
4L 361 (1981)).

TNF is found in many animals such as mice, rabbits, and humans, exhibits activity without species specificity, and has almost no harmful effects on normal cells, so it can be used as an anticancer drug. It has been expected.

Later, in 1984-1985, the human TNF gene was isolated, and human TNF gene was isolated in microorganisms using genetic engineering techniques.
Reports on the production of TNF have been made one after another (D,
Penca et al., Nature, 312.724 (
1984); T. 5hirai et al., Nature
, 313.803 (1985); A.M.
Wang et al., 5science, 228.149 (
1985); M, Yamada et al., J, Bio
Technology, 3.14H1985)], and as pure human TNF becomes available in large quantities, the diversity of its biological activities is becoming clearer. Some of them have effects that are considered undesirable when TNF is used as an anticancer agent. For example, cachectin, which was identified as a causative agent of cachexia seen in patients with terminal cancer or severe infections, using its activity to inhibit lipoprotein lipase production in adipocytes as an indicator, is the same substance as TNF. It has been suggested that side effects such as hyperlipidemia may occur as a result of advanced catabolism of adipocytes due to TNF administration. TNF is also considered to be one of the major mediators of endotoxin-induced toxicity (B, Beutler et al., 5cien.
ce, 229.869 (1985); V, Leh
Mann et al., J. ExpoMed, 165 65
7 (1987)], various side effects have been reported when administered to actual experimental objects (Isis C, Kettelhut
et al + Proc, Natl.

Acad, Sci, tlsA, 84.4273
(1987): l.

On the other hand, with the advancement of genetic recombination technology, research has been actively conducted on proteins in which the amino acid sequence of human TNF has been arbitrarily changed (hereinafter sometimes abbreviated as TNF mutants). No. 119692 and Japanese Unexamined Patent Publication No. 1-277488 disclose TNF mutant inυiv
The findings regarding the relationship between antitumor activity and side effects in patients with cancer are shown. However, there are problems with the use of these TNF variants as medicines in terms of side effects.

(Problems to be Solved by the Invention) The object of the present invention is to obtain DNA encoding novel TNF mutants.
A, a plasmid containing the DNA, a host cell transformed with the plasmid, a new TN using the host cell
The object of the present invention is to provide a method for producing the F variant and an anti-III tumor agent containing the F variant as an active ingredient with reduced side effects.

[Means for solving problems]

In order to solve the above-mentioned problems, the present inventors developed a three-dimensional structure model (E,
Y. Jones et al., Nature, 338 22
5 (1989)), the results of examining the biological activity of TNF mutants obtained by converting amino acid residues thought to be located on the molecular surface of TNF using genetic engineering techniques. , TNF mutants in which specific amino acid residues of human TNF are changed are shown in vivo.
The present invention was completed based on the discovery that TNF retains superior antitumor activity despite having fewer side effects than human TNF.

That is, the present invention provides (1) the following formula: % formula % (wherein, X represents an amino acid residue represented by Val or Arg (in the formula, X represents an amino acid residue represented by Val or Gly; Z represents Arg, Represents an amino acid residue represented by Glu or Gly.However, X is Val, Y is Asn, and Z is A
(2) A TNF variant having a sequence of L-configured amino acid residues represented by <, ) except for the combination rg (2) having a nucleotide sequence encoding a TNF variant represented by formula (I) described above DNA (3) A DNA having a base sequence in which a translation start codon is bound to the 5" end of the base sequence encoding the TNF variant represented by formula (I) described above, and a translation stop codon is bound to the 3" end of the base sequence ( 4) A recombinant vector in which the above-mentioned DNA is integrated into an expression vector. (5) A host cell transformed with the above-mentioned recombinant vector. (6) The above-mentioned host cell is cultured in its growth medium. (7) A method for producing a TNF mutant represented by the formula (I) described above, wherein the present invention relates to an antitumor agent containing the TNF mutant represented by the formula (I) described above as an active ingredient.

The content of the present invention will be described in more detail below, but in order to simplify the description, abbreviations based on common abbreviations in the field will be used. Examples of these are listed below. Note that for substances that have optical isomers (for example, amino acids, etc.), they are in the L form unless otherwise specified.

[omitted number]

Ala: alanine, Arg: arginine, Asn: asparagine, Asp: aspartic acid, Cysnidistine, Gln: glutamine, Glu: glutamic acid, Gl
y nigericin, His: histidine, He: isoleucine, Leu: leucine, Lys: lysine, Met: methionine, Phe: phenylalanine, Pr
o Nibroline, Ser: Serine, Thr: Threonine, Trp:) Ributophane, Tyr
: Tyrosine, Val: Valine, A: Adenine, Gnigeanine, C: Cytosine, T: Thymine, dATP: Deoxyadenosine triphosphate, dGTP
: deoxyguanosine triphosphate, ac'rp: deoxycytidine triphosphate, dTTP: deoxythymidine triphosphate, dNTPs: dATP, dC; TP, dCTP
and dTTP, ATP: adenosine triphosphate, SDS
Sodium nidodecyl sulfate, SD sequence: Shine-Dalgarno sequence, KD: kilodalton, bp = base pair The production of a novel TNF variant (1) involves the use of an expression vector into which a DNA having a base sequence encoding it is integrated. This can be done by culturing a transformant into which has been introduced in an appropriate medium.

(A) [Novel TNF variant (I)] In the novel TNF variant (1) of the present invention, X can include amino acid residues represented by Val, Arg, Glu, Gly, etc. ; Preferably Val
, Arg, etc. are preferable.

Examples of Y include amino acid residues represented by Asn, Gly, Ala, Ser, etc.; preferred are amino acid residues represented by Asn, Gly, etc.

Z includes Arg, Glu, Gln, and Asp.

Examples include amino acid residues represented by Asn; preferred are Arg and Glu.

Amino acid residues such as Gln are preferred.

(However, in the above combination of χ, Y and Z, X is V
al, Y is Asn, and Z is Arg. ) TNF variant (I) is an appropriate combination of amino acid residues representing X, Y, and Z as described above (however, X
:Val, Y:Asn, Z:Arg. ); A preferred combination of X, Y and Z is (X:Arg.

Y: Asn, Z: Arg), (X: Val.

Y: GIy, Z: Glu), (X: Val.

Y: Gly, Z: Gln), (X: Val.

Y: Asn, Z: Glu), (X: Val.

Y: Asn, Z+G1n), (X: Arg.

Y: Asn, Z: Glu), etc. are preferable.

TNF mutant (I) has high antitumor activity even when amino acids are removed one by one from the N-terminus, up to the 9th Ser residue (high antitumor activity is due to N Since it is present in the portion consisting of the 10th amino acid residue from the end and beyond, the portion 1 to 9 from the N-terminus is not an important portion for the expression of high antitumor activity.

), such TNF mutants lacking 1 to 9 amino acid residues from the N-terminus, and TNF mutants in which 1 to 9 amino acid residues from the N-terminus are substituted with other amino acid residues are also included in the present invention. It also includes those in which 1 to 9 other amino acid residues (for example, Met residues) are bonded to the N-terminus.

(B) (DNA having the base sequence of TNF variant (I)
[Transformants into which the expression vector into which the DNA having the base sequence of TNF variant (I) has been introduced] The transformants into which the expression vector into which the DNA having the base sequence of TNF variant (I) has been introduced are able to transfer the human TNF gene into the host cell. The human TNF gene on the human TNF-type expression vector obtained by integrating it into a suitable expression vector so as to have the appropriate base sequence is converted into DNA with the base sequence encoding the TNF variant (I). It can be produced by introducing the vector thus obtained into its host cell.

■(DNA of base sequence encoding TNF variant (I)
The DNA of the base sequence encoding the TNF variant (1) is the DNA of the base sequence encoding the TNF variant (1) shown in (A) above.
NA, for example: % formula % (3) () C where α represents GTC or CGG; β represents AAT or CCC; T represents CGG, GAG or CAG.

However, this excludes the case where α is CTC, β is AAT, and T is CGG.

) etc. can be mentioned.

DNA of the base sequence encoding TNF variant (I) (
n) is a suitable combination of base sequences showing α, β, and T as described above (however, α: GTC, β:
AAT, γ: Not CCC. ) can be expressed as: preferred α.

As a combination of β and γ, (α:CGG.

β: AAT, γ: CGG), (α: GTC.

β: GGC, r: GAG), (α: CTC.

β: GC, C, r: CAG), (α: GTC.

β: AAT, γ: GAG), (α: CTC.

β: AAT, r: CAG), (α: CGG.

β: AAT, γ: GAG), etc. are preferable.

The expression vector into which the DNA having the nucleotide sequence of the TNF variant (1) has been incorporated is the 5'' end of the DNA having the nucleotide sequence encoding the TNF variant (1) (represented by the above formula (n)). flanked by a translation initiation codon (ATC)
It has a translation stop codon (e.g., TGA, etc.) adjacent to the 3' end, and the promoter and SD sequence are arranged so that it has an appropriate base sequence at the 5' end of the translation start codon. have.

The above-mentioned nucleotide sequence (II) can be produced by a method of converting a nucleotide sequence at an arbitrary position of the known human TNF gene into a desired nucleotide sequence using a method well known in the technical field. can.

That is, (i) a method in which a DNA fragment containing the desired base sequence to be converted is removed by restriction enzyme cleavage, and a chemically synthesized oligonucleotide adapter containing the desired base sequence is incorporated in place of the DNA fragment; (ii) a chemically synthesized oligonucleotide Site-directed mutagenesis method using (J, W, Taylor et al. + Nu
cl.

Ac1ds Res, 13.8749 (1985
): J, Itl, Taylor et al.

Nucl, Ac1ds Res, 13.8764
(1985); in Naka+5aye and
F, Eckstein, Nucl, ^cid3Re
s,, 14.9679 (1986); J, R, 5
ayer et al., Nucl.

Ac1ds Res,, 16.791 (198B)
), etc.

For example, in method (ii), if single-stranded DNA can be prepared from a human TNF-type expression vector, that vector is used as it is as a template for site-directed mutagenesis, and the base of the human TNF gene is DNA having the novel base sequence (n) of the present invention is integrated by performing site-directed mutagenesis using a synthetic oligonucleotide that can convert the sequence into the novel base sequence (n) of the present invention. It is possible to create a gene expression vector. - If it is not possible to prepare single-stranded DNA from the human TNF expression vector, the DNA fragment containing the human TNF gene on the human TNF expression vector is converted into the terminal strand DNA.
After subcloning into a vector capable of preparing the human TNF gene, the DNA fragment containing the human TNF gene is converted into a DNA fragment containing the novel base sequence (II) of the present invention by site-directed mutagenesis using the vector as a template. By recombining the DNA fragment thus obtained with the DNA fragment containing the human) TNF gene on the human) TNF-type expression vector, the novel TNF mutant (1) of the present invention can be obtained.
) expression vectors can be created.

By the way, the human TNF gene for constructing the human TNF trait expression vector is based on the amino acid sequence of human TNF (D,
It can be obtained by selecting codons suitable for the host cell from among the codons encoding the constituent amino acids of Pen1ca et al., supra, and chemically synthesizing them.

When designing it, h) the TNF gene should be combined with multiple DNA
In order to synthesize the fragment as a fragment and clone it into an appropriate vector, an appropriate restriction enzyme cleavage site is provided in the base sequence. In addition, h) has a translation initiation codon adjacent to the 5'' end side of the codon encoding the N-terminal amino acid of TNF;
It should have a translation stop codon adjacent to the 3' end of the codon encoding the terminal amino acid, and appropriate restriction enzyme sites at the 5' end of the translation start codon and the 3' end of the translation stop codon. . In this way, the human TNF gene can be cloned into a suitable vector in translatable form. An example of the base sequence of such a human TNF gene is shown in FIG.

Methods for constructing the TNF gene as shown in Figure 1 from chemically synthesized oligonucleotides include: (ij) dividing each complementary strand into several oligonucleotides, chemically synthesizing them, and connecting them; (tv) After annealing a part of the oligonucleotide, a complementary strand is synthesized by a DNA complementary strand extension reaction,
An example is a method in which DNA fragments obtained by cleaving both ends with an appropriate restriction enzyme are ligated.

In the case of (iv), for example, four DNA fragments constituting the human TNF gene can be obtained using oligonucleotides as shown in FIG.

Each oligonucleotide can be synthesized in high yield by the fluoramidite method using an automatic DNA synthesizer, and purification of the synthesized oligonucleotides can be performed by gel filtration, ion exchange chromatography, gel electrophoresis, and reverse chromatography. This can be carried out by phase column chromatography or the like.

The obtained DNA fragment is divided into two fragments, one containing the base sequence encoding the N-terminal amino acid sequence of TNF and the other containing the base sequence encoding the C-terminal amino acid sequence, and , pUc118 (J,
Vieira and J, Messing.

Methods in F, nzymology+15
After partial cloning into a vector such as 3+3 (1987)), it can be used for human TNF gene construction.

A specific example of a plasmid in which a DNA fragment corresponding to the N-terminal amino acid sequence of human TNF has been cloned is pUHTNl, and a specific example of a plasmid in which a DNA fragment corresponding to the C-terminal amino acid sequence has been cloned. An example of this is ρUHTC2.

A human TNF expression vector can be obtained by integrating the DNA fragment for human TNF gene construction cloned as described above into an expression vector suitable for a host cell so as to have an appropriate sequence.

Examples of such expression vectors include plasmid vectors or phage vectors that contain a replicon compatible with the host cell and a promoter necessary for the expression of the human TNFJpTNF variant (1) in the host cell. However, plasmid vectors are preferred.

Examples of host cells include prokaryotes (E. coli, etc.).

Bacillus subtilis, etc.), eukaryotes (yeast, etc.), cultured cells derived from multicellular organisms, etc., but prokaryotes such as Escherichia coli are preferable.

Promoters in plasmid vectors include, for example, in the case of E. coli, the lac promoter, t
The ac promoter, the trp promoter PL promoter, the colicin E1 promoter, etc. can be mentioned, and the tac promoter is preferable.Specific examples of human TNF expression vectors containing such a tac promoter include, for example, the human TNF expression vector. C
p
Examples include plasmid vectors (e.g., pTH73) produced by incorporating a DNA fragment containing the tac promoter derived from DR540 (manufactured by Pharmacia), an SD sequence, and a DNA fragment corresponding to the N-terminal side of human TNF. , the human TNF gene on the human TNF expression vector is combined with the novel nucleotide sequence (n) of the present invention.
Specific examples of expression vectors for the TNF mutant (I) converted into pTR91, pTGE1378,
．． pTGQ1378. pTE138. pTQ13
8 etc. can be mentioned.

Furthermore, for the purpose of improving the efficiency of expression of the TNF mutant (I), a transcription terminator that functions efficiently in E. coli can be linked downstream of the base sequence (U).

Examples of such transcription terminators include tpp terminator, trpA terminator + rrnB terminator, etc., but preferably rr
nB terminator is good.

A specific example of such a expression vector for TNF mutant (I) containing a tac promoter and an rrnB terminator is, for example, a DNA containing an rrnB terminator derived from pKK223-3 (manufactured by Pharmacia).
A plasmid vector (for example, pAMR9
1, pAMGE137B, pAMGQ137B, p
AME13B.

pAM port 138. pAMRE9138, etc.).

■ [Transformant into which the vector has been introduced] Transformation is carried out by
This can be carried out by introducing the expression vector for the novel TNF variant (1) described in item (1) above into an appropriate host cell (for example, the host cell described in item (2) above) using a conventional method. For example, when the host cell is E. coli, the calcium chloride treatment method (S, N. Cohen et al., Proc.

Natl, ^cad, Sci,, USA, 69.
2110 (1972)), transformants can be obtained.

(C) [Production of novel TNF mutant (I)] The obtained transformant was grown in an appropriate growth medium [for example, I XYT medium (
0.8% Batacributone, 0.5% yeast extract, 0.
5% NaCj] and culture conditions (e.g., 24 to 28 hours at 37°C, aeration with shaking, stirring, etc.), the target protein, a novel T.
It is possible to produce NF mutant (I) or one with Net bound to its N-terminus.

During culture, it is desirable to add a drug for selecting transformants (e.g., ampicillin, etc.) as necessary. Also, depending on the promoter used, an appropriate inducer (e.g., isopropyl-β- D-thiogalactopyranoside, etc.) at an appropriate stage of culture (e.g., 0 Di
io':Q, about 3 early exponential growth phase, etc.), the promoter can be made to function efficiently.

Purification of the target protein produced by the transformant is carried out by separating it from the extract of the transformant if it is produced within the transformant, or from the culture composition if it is produced outside the transformant.・It can be carried out by appropriately combining conventional purification methods (salting out, ultrafiltration, gel filtration, ion exchange chromatography, electrophoresis, affinity chromatography, etc.), and the TNF variant (I) can be purified with extremely high purity. can be taken as a thing.

(D) [Anti-tumor agent] The TNF mutant (I) obtained as described above is 2n
Cytotoxic activity against mouse LM cells in υ1tro (S, Yaw+azaki et al., Jpn, J.
Med, Sci.

Biol, 39.105 (1986)) and in
Tumor necrosis effect and tumor growth inhibition effect of Meth A sarcoma-grafted mice in vivo [E, A, Carswe
ll et al., supra]. On the other hand, the lethal effect on experimental animals (e.g. mice) in vivo
- It is an anti-tumor active substance with significantly lower side effects than TNF.

The antitumor agent of the present invention is this highly purified TNF mutant (I).
The active ingredient is one or more of the following.

Although TNF variant (I) can be used alone by being dissolved in an appropriate solvent (for example, physiological saline), it can also be used as an injection according to a conventional method.

It can be made into single spread tablets, capsules, etc.

The effective dose of the antitumor agent of the present invention varies depending on the symptoms, age, etc., but is appropriately selected from within the range of 0.1 to 100 mg/kg per day, divided into one to several doses, orally or non-administered. Can be administered orally.

〔Example〕

Hereinafter, the present invention will be illustrated by reference examples and examples.

Note that these Examples do not limit the scope of the present invention.

Reference Example 1 [H] Preparation of TNF expression plasmid]
Chemical Synthesis H) Cloning of TNF Gene] (i) Chemical Synthesis of Oligonucleotides The human TNF gene was cloned from the eight oligonucleotides (OL-1 to 0L-8) shown in FIG. 1 as shown in FIG. 4
DNA fragments (Fr-A+ Fr-B, Fr-C+
It was constructed by synthesizing Fr-D) and connecting them.

Oligonucleotides were synthesized using a fully automatic DNA synthesizer (Model 381A manufactured by Applied Biosystems) using the phosphoramigit method, and after removing protecting groups other than the dimethoxytrityl group, reverse-phase HPLC (conditions , using a 0DS-12OA (manufactured by TOSOH) column and elution with acetonitrile gradient elution in 0.5% ammonium formate buffer as the mobile phase.Next, it was reacted in 80% acetic acid at 25°C for 30 minutes. After removing the dimethoxytrityl group, reverse phase HPL was performed again.
A synthetic oligonucleotide purified product was obtained by purification using C.

(ii) Cloning of human TNF gene Synthetic oligonucleotides (OL-1 to 0L-8) prepared in (i) above
), to synthesize the four DNA fragments that make up the human TNF gene, 0L-1, 0L-2, and 0L-3, which are complementary in their 3'-terminal 20 to 30 bases, are
and 0L-4, 0L-5 and 0L-6, 0L-7 and 0L-8
A method was used in which complementary strands were synthesized by annealing each of the strands by a DNA chain elongation reaction, and then both ends of the strands were cleaved with a restriction enzyme (see Figure 3).

The reaction conditions such as reaction temperature and reaction solution composition during restriction enzyme cleavage were in accordance with the instructions of the restriction enzyme supplier. Also,
During complementary strand synthesis, Taq DNA polymerase, which can perform elongation reactions at high temperatures, was used to avoid loop formation and nonspecific annealing in the -main strand portion. That is, 0L
-1 (100 pmol) and 0L-2 (100 pmol)
100μf of 10mM Tris-HCj! (pH8,
3), 50mM MC1,1,5mMMgCfz,
0.01% (w/v) gelatin.

Dissolved in a 200uM dNTPs aqueous solution, added 2.5 units of Taq DNA polymerase (Zen Shuzo Co., Ltd.), heated at 94°C for 3 minutes, left to stand at 60°C for 3 minutes for annealing, and then heated to 72°C for annealing. Incubated for 15 minutes. After the reaction is completed, the reaction solution is subjected to 5% polyacrylamide gel electrophoresis to obtain the desired size (approximately 180 bp) detected by ethidium bromide staining.
The band portion was cut out from the gel, and the DNA fragment was recovered by electrophoretic elution. This DNA is BamHI
(manufactured by Zenshuzo) and recovered by ethanol precipitation,
Ban 1 (manufactured by TOYOBO) cleavage reaction was performed. After the reaction was completed, 5% polyacrylamide gel electrophoresis was performed.
BamHI-Ban of about 150 bp in the same manner as above
1 fragment (Fr-A) was recovered. Similarly, 0L-
3 and 0L-4 to Ban1. Ban I-Hlnc of about 130 bp after cutting with HincII (manufactured by Zenshuzo)
H fragment Fr-B) from 0L-5 and 0L-6
incI [, BstPI (manufactured by Zenshuzo Co., Ltd.) approximately 1 when cleaved
The 10 bp Hinc II-BstP l fragment (Fr
-C) from 0L-7 and 0L-8 to BstPI, P
stl (manufactured by Zenshuzo) Bst of approximately 100bp when cut
A P I -Pst I fragment (Fr-D) was prepared.

On the other hand, after pUcllB (manufactured by Zenshuzo) was digested with HincII, the DNA was recovered by ethanol precipitation, and the D
After 1/2 amount of NA was cleaved with BamHI, 1.2% agarose gel electrophoresis was performed, and about 3. I
The Hinc I [Bawl I fragment of Kbp was recovered.

In addition, from the remaining 1/2 amount, after cutting with PstI, approximately 3. The old ncll-Pstl fragment of IKbp was recovered.

Previously obtained Fr-A and Fr-B, and Ba of pUcllB
Mix the mHl-H1ncII fragments and after ethanol precipitation, add 30 ui of 66mM Tri 5-HC1pFI7
．． 6), 6.6mM MgC1z, 10mM dithiothreitol.

300 units of 74 in 0.4mM ATP aqueous solution
Add DNA ligase (manufactured by Zenshuzo) and incubate at 16°C.
The ligation reaction was carried out for 5 hours. Using this DNA aqueous solution,
E. coli strain 701 was transformed using a method known per se, plasmid DNA was prepared from the obtained ampicillin-resistant colonies using a conventional method, and the restriction enzyme cleavage map was analyzed. Plasmid pUHTN1 (approximately 3.4 Kbp
) was confirmed.

Fr-A, Fr-B cloned into pUHTNl
The nucleotide sequence of was obtained using the method of Vieira et al.
ra and J, Messing.

Methods in Enzymology, 153
．． Single-stranded DNA prepared according to 3 (1987))
using the dideoxy method (S, Tabor and
C.C.Richardson, Proc.

Natl, Acad, Sci,, USA
, 84. 4767 (1987)) and confirmed that the base sequences were Fr-A and Fr-B shown in FIG.

In addition, the old n of Fr-C and Fr-D and pUcllB
Using the cIr-PstI fragment, put (plasmid plJ into which the gene corresponding to the C-terminal side of human TNF was cloned by the same method as for TNI production) IT
C2 (approximately 3.4 Kbp) was produced. In Figure 3, pUH
The method for producing TNl and pUHTC2 was shown.

■ [Preparation of expression plasmid] The pUHTNl obtained in (ii) above was mixed with BamHI and H
Cut with incII, perform 5% polyacrylamide gel electrophoresis, and perform 5% polyacrylamide gel electrophoresis.
A DNA fragment of about 280 bp containing the gene corresponding to the end was recovered.

In addition, the pUHTc2 obtained in (ii) above was treated with EcoRI.
(manufactured by Takara Shuzo) and HincI [cut with 1.2%
After agarose gel electrophoresis, pUc
A DNA fragment of about 3.3 Kbp containing most of 118 and a gene corresponding to the C-terminal side of human) TNF was recovered.

On the other hand, plasmid pDR540 (manufactured by Pharmacia) containing the E. coli tac promoter and SD sequence was
After digestion with Hi and EcoRI and 5% polyacrylamide gel electrophoresis, a DNA fragment of approximately 390 bp containing the tac promoter and SD sequence was recovered in the same manner as above.

The approximately 280 bp DNA fragment and approximately 390 bp DNA fragment thus obtained
The DNA fragment and the approximately 3.3 Kbp DNA fragment were mixed, and after ethanol precipitation, ligation reaction using T4 DNA ligase was performed according to the method (ii) above.

E. coli strain 701 was transformed using the reaction solution, and the transformants were selected to create a human TNF expression plasmid pTHT3 (approximately 4.0 Kbp) in which the human TNF gene was linked downstream of the tac promoter and SD sequence. Acquisition confirmed.

Human TNF gene of pTHT3 and SD sequence and tac
The base sequence of the promoter region was confirmed by the same method as in (ii) above. In addition, when analyzing the base sequence of the gene region corresponding to the N-terminal side of TNF, the SD sequence, and the tac promoter, an oligonucleotide having the base sequence of 5'-GCTCTTGATGGCAGAGA-3'' was used as a primer. This primer is the human T
It anneals to base numbers 281 to 297 in the NF gene base sequence.

Next, the above plasmid pTHT3 was transformed into Pstl and 5ca
I (manufactured by Takara Shuzo) and subjected to 1.2% agarose gel electrophoresis, followed by method (ii) above to obtain approximately 2.6
A DNA fragment of Kbp was recovered. Furthermore, plasmid pKK223-3 (manufactured by Pharmacia) containing the rrnB transcription terminator was cut with PstI and ScaI, and 5%
After polyacrylamide gel electrophoresis, approximately 830 bp of D containing the rrnB transcription terminator was extracted in the same manner as above.
NA fragments were collected.

The approximately 2.6 Kbp DNA fragment thus obtained and approximately 830
Using a bpDNA fragment, r was inserted downstream of the human TNF gene in pTHT3 using the same method as when constructing pTHT3.
A human TNF expression plasmid pAMHT4 (approximately 3.4 Kbp) to which the rnB transcription terminator was linked was prepared. FIG. 4 shows the method for producing pTHT3 and pAMHT4.

Reference Example 2 [Manufacture of human TNF] Escherichia coli strain 701 transformed with pAM) lT4 obtained in Reference Example 1-■ was grown in IXYT medium (0.8% Bactodributon, 0.5% yeast extract, 0.5% NaC1.

100 μg/d ampicillin) at 37°C,
When the absorbance (660 nm) reached 0.3, the final concentration of isopropyl-β-D-thiogalactopyranoside was 0.
．． The solution was added to a concentration of 7mM, and the culture was continued for an additional 24 hours.

Bacteria were collected by centrifugation and diluted with 20mM Tris-HCl.
After washing with (pH 7.5), the cells were suspended in the same buffer, crushed using a high-pressure homogenizer (American Instrument Company) under cooling, and the remaining cells were removed by centrifugation. , a bacterial cell/crude extract was obtained.

Polyethyleneimine was added to this crude extract at a concentration of 0.2%, the resulting precipitate was removed by centrifugation, and the resulting supernatant was subjected to ammonium sulfate precipitation to collect a 30-55 saturated ammonium sulfate fraction. .

This is 10mM Tri 5-HCJ! (p)! 8.0
) and then equilibrated with the same buffer.
After adding it to a Kgel DEAE-5PW (manufactured by TOSOH) column and thoroughly washing with the same buffer, the adsorbed protein was dissolved in O~0.5M NaCj! Elution and fractionation were performed using a linear concentration gradient.

Approximately 17 by 5DS-polyacrylamide gel electrophoresis analysis
Collect the fractions containing KD protein and add 10mM Tri
After dialyzing against s-HCit (pH 7,0), TSKgel 5P-5P11 (manufactured by TOSOH)
Column chromatography (0-0.5M Na(Il)
Elution was carried out using a linear concentration gradient) and percentages were collected in the same manner as above.

After concentrating this by ultrafiltration, TSKgel G3000SW (manufactured by TO5OH) was equilibrated with PBS (-).
Gel filtration was performed using a column using PBS (-) to obtain a purified human TNF sample. When this was subjected to 5DS-polyacrylamide gel electrophoresis, a single band was observed at a position of about 17 KD, confirming that it was a highly purified sample.

Example 1 [Production of novel TNF mutant] ■ [Novel TN
Production of F mutant R91] (i) Production of expression plasmid by site-directed mutagenesis method In the novel TNF mutant (1), a protein having an amino acid sequence in which X is Arg, Y is Asn, and Z is Arg. (hereinafter referred to as R9+) was an in vitro site-specific site-directed mutagenic product prepared using the single-stranded DNA of the human TNF-type expression plasmid pTHT3 as a template.

That is, from pTHT3 obtained in Reference Example 1-■, Reference Example 1-
■-(ii) Vieira et al.'s method [J,
Vieira and J, Messing + supra]
-Heavy chain DNA was prepared according to.

On the other hand, h) chemically synthesized oligonucleotide 5'-TGGCAGAGAGGAGGTTCCGCT for converting TNF gene into R9+ gene;
GTAGGAG-3' in TGGTCT, Reference Example 1-■
-Synthesized and purified according to method (i). This oligonucleotide anneals to base numbers 255 to 289 in the TNF gene base sequence in Fig. 1, converting GTC at base numbers 271 to 273 to CGG, and other oligonucleotides on the template DNA. It has been confirmed that the complementarity with the part is 60% or less.

This oligonucleotide was added to 50μ2 of 50mM T
ris-HCII (pH 7,6), 10mM
gC1,t, 5mM dithiothreitol.

Add 5 units of T4 polynucleotide kinase (manufactured by Zenshuzo) to a 2mM ATP aqueous solution and incubate at 37°C for 60 minutes.
The reaction was allowed to proceed for minutes, and the 5' end was phosphorylated.

Using the thus obtained pTflT3-heavy chain DNA and the 5'-terminal phosphorylated oligonucleotide, a reagent kit for site-directed mutagenesis (Oligonucleotide-directed
in vitr.

A mutagenized double-stranded DNA solution was prepared using E. utagenesis 5ystea+3 (manufactured by Amajam) according to the protocol attached to the kit. Using this DNA solution, Escherichia coli strain 701 was transformed by a method known per se, and the pT described in Reference Example 1-■ was transformed.
As in the case of HT3, the plasmid carried by the transformant was analyzed by nucleotide sequence analysis, and the
Plasmid pT in which the NF gene was converted to the R9+ gene
Acquisition of R91 (approximately 4.0 Kbp) was confirmed.

Next, using pTR91 and pKK223-3, pAMHT4 was produced according to the method for producing pAMHT4 described in Reference Example 1-■.
L+ expression plasmid pAM in which rrnB transcription terminator is ligated downstream of R91 gene of TR91
R91 (approximately 3.4 Kbp) was produced. In Figure 5, pT
The method for producing R91 and pAMR91 was shown.

(it) Production of (R,)] Using E. coli strain 701 transformed with pAMR91 obtained in Example 1-■-(i), according to the method for producing h) TNF described in Reference Example 2. Culture and purify 7.
A highly purified R1+ purified sample was obtained that showed a single band in DS-polyacrylamide gel electrophoresis.

■ [Novel TNF mutant Gl! ? Production of E1311] (
i) Preparation of expression plasmid In the novel TNF mutant (I), a protein having an amino acid sequence in which X is Val, Y is Gl)F, and Z is Glu (hereinafter referred to as GI2?Ell).
Plasmid pTGE1378 (approximately 4.0K
bp) is pTI (T3-terminus DNA and 5'-terminal phosphorylated synthetic oligonucleotide 5'-GTCGAGATAGTCGGGCTCGCC
It was produced using GATCTCAGCGCTGAG-3' according to the method for producing pTR91 described in Example 1-■-(i). This oligonucleotide is annealed to base numbers 394 to 429 in the human TNF gene base sequence shown in Figure 1, and AA of base numbers 409 to 414 is annealed.
This converts TCGG to GGCGAG.

Next, using pTGE1378 and pKK223-3,
GI3? of pTGE1378 was prepared according to the method for producing pAMHT4 described in Reference Example 1-■. G+fft with rrnB transcription terminator linked downstream of E13S gene
E+! s expression plasmid pAMGE1378 (approximately 3.4 Kbp) was prepared. In Figure 6, pTGE137
8 and pAMGE1378 were shown.

(!!) Production of G137EI31 Using Escherichia coli strain 701 transformed with pAMGE1378 obtained in Example 1-■-(i), culture and purification according to the method for producing TNF described in Reference Example 2. Highly purified G13?, which showed a single band in 5DS-polyacrylamide gel electrophoresis. A purified sample of EI31 was obtained.

■ [Novel TNF mutant Gl! ? QI: Production of II] (
i) Preparation of expression plasmid A protein having an amino acid sequence in which X is Val, Y is cty, and z is Gly in the novel TNF mutant (I) (hereinafter referred to as GI3'IQ131)
Plasmid pTGQ1378 (approximately 4.0K
bp) was prepared using pTHT3-heavy chain DNA and a 5° terminal phosphorylated synthetic oligonucleotide.
pTR91 was produced according to the method for producing pTR91 described in ).

Oligonucleotide used 5'-GTCGAGATAGTCGGGCTGGCC
GATCTCAGCGCTGAG-3° is annealed to base numbers 394 to 429 in the human TNF gene base sequence shown in Figure 1, resulting in ^A at base numbers 409 to 414.
This converts TCGG to GGCCAG.

Next, using pTGQ1378 and po223-3, GI3? QI! Plasmid p in which rrnB transcription terminator is linked downstream of l gene
AMGQ1378 (approximately 3.4 Kbp) was produced.

(!I) Production of CG+ztQ+3e] Example 1-
Using E. coli strain 101 transformed with pAMGQ1378 obtained in (i), culture and purification were carried out according to the method for producing h) TNF described in Reference Example 2, and 5DS
- A highly purified G+3tQ+is purified specimen was obtained which showed a single band in polyacrylamide gel electrophoresis.

■ [Production of novel TNF mutant EI:ll+] [i) Production of expression plasmid pTR91 and -pA described in Example 1-■-(i)
According to the production method of MR91, a novel TNF mutant (1
), a plasmid pTE138 (approximately 4.5 mm) for expressing tectorial white matter (hereinafter referred to as E, 33) has an amino acid sequence in which X is Val, Y is Asn, and Z is Glu.
0 Kbp) and pAM2138 (approximately 3.4 Kbp)
was created. Oligonucleotide used 5”-GTC
GAGATAGTCGGGCTCATTGATCTCA
GCGCT-3'' is annealed to base numbers 397 to 429 in the TNF gene base sequence in Figure 1.
It converts CGG with base numbers 412 to 414 into GAG.

(ii) (Production of E+zs) Using E. coli strain 701 transformed with pAME138 obtained in Example 1-■-(i), culture and purify according to the method for producing human TNF described in Reference Example 2. and
A highly pure EI 3° purified sample was obtained which showed a single band in 5DS-polyacrylamide gel electrophoresis.

■ [Production of novel TNF mutant Qllll] (i) Production of expression plasmids pTR91 and pAM described in Example 1-■-(i)
According to the production method of R91, a novel TNF mutant (I)
, plasmid pTQ138 (about 4.5%) is used to express a protein (hereinafter referred to as Ql:Il+) having an amino acid sequence in which X is Val, Y is Asn, and Z is Gly.
0 Kbp) and pAMQ138 (approximately 3.4 Kbp)
was created. Oligonucleotide used 5”-GTCGAGATAGTCGGGCTGATTG
ATCTCAGCGCT-3' is human TNF in Figure 1.
Annealing to base numbers 397 to 429 in the gene base sequence and CA CCC of base numbers 412 to 414
This converts it into G.

(ii) (Production of El:Is) Using E. coli strain 701 transformed with pAMQ138 obtained in Example 1-■=(i), culture according to the method for producing human TNF described in Reference Example 2.・Perform purification, 5
A highly purified E138 purified sample was obtained that showed a single band in DS-polyacrylamide gel electrophoresis.

■ [Production of novel TNF mutant R91EI31a] (i
) Preparation of expression plasmid A plasmid for expressing fluorescent substance (hereinafter referred to as R91EI: Il+) having an amino acid sequence in which X is Arg, Y is Asn, and Z is Glu in the novel TNF mutant (1) is , was produced by the method shown in FIG.

In the same manner as in Example 1-■, Example 1-(i)
An approximately 780 bp DNA fragment obtained by cutting pAMR91 obtained in Example 1 with EcoRI and BstP I;
-■- pAME138 obtained in (1) was treated with EcoRI and B
Using the approximately 2.6 Kbp DNA fragment obtained by cutting with stPI, ligation reaction, transformation, and selection of transformants were performed.
An R91E138 expression plasmid pAMRE9138 converted into 8 genes was obtained.

(!!) Production of Rq+E+ffi Using Escherichia coli strain 701 transformed with pAMRE9138 obtained in Example 1-■-(i), a purified standard was prepared according to the method for producing human TNF described in Reference Example 2. I got it.

Example 2 [Evaluation test of novel TNF mutant as an antitumor agent] ■ (Evaluation of antitumor activity in tn vitro) Human TN
The in vitro antitumor activity of F and the novel TNF mutant (1) was demonstrated in mouse-derived LM cells (ATCC, C
The cytotoxic activity against CL1, 2) was evaluated.

h) Samples o and i In1 prepared by sequentially diluting TNF or TNF variant (I) purified specimen in culture medium and 0.1 d of LM cell suspension (IXIO' cells/d) were added to 96 wells of tissue. The cells were added to a culture microplate (manufactured by Falcon) and cultured for 48 hours at 37°C in air containing 5% carbon dioxide. Eagle's Minimum Essential Medium (manufactured by Flow Laboratory) containing 1% fetal bovine serum was used as the medium. After culturing, glutaraldehyde aqueous solution 20μ! After fixing the cells, the microplate was washed and dried, and a 0.05% methylene blue solution was added for 0.1 d to stain the fixed living cells. After washing away excess methylene blue and drying, the remaining methylene blue was extracted with 0.36N hydrochloric acid, and the 660N
The absorbance at m was measured with a microplate photometer (corona electric type, MTP-12 type). This absorbance is proportional to the number of surviving cells. 5 of LM cells
Define the active concentration required to kill 0% as 1 unit)/d, calculate the dilution rate of the sample that corresponds to 50% of the absorbance of the control without adding the sample, and calculate the reciprocal of that dilution rate. It was defined as the activity of the sample (units/relatives).

The protein concentration of each purified sample was determined using a protein assay kit (Bio-Rad) using a solution prepared from lyophilized purified human TNF as a standard, and the cytotoxic activity (units/l11) was determined. The cytotoxic specific activity (units/■) of each protein was calculated from the protein concentration of each purified sample. The results are shown in Table 1.

(Hereinafter, blank space) First, the results were evaluated. Further, 7 days after administration, Sohmura
[Y, Sohmura et al., Int, J.
Immunopharmac.

Measurement of tumor size according to Nail 3), 357 (1986)).

The tumor growth inhibition rate was calculated. The results are shown in Table 2. From these results and the results in Table 1 of Example 2-■, the novel TNF mutant (I) of the present invention has stronger in vitro antitumor activity than in vitro cytotoxic activity. It turned out that there was.

■(Evaluation of antitumor activity in vivo) Hi1-TN
The in vivo antitumor activity of F and the new TNF mutant (I) was evaluated as follows.

2 x 10' MethA sarcoma cells were added to BALB/
c Transplanted into the abdomen and internal organs of mice (6-8 weeks old, female), and using mice whose tumors reached a diameter of 6-10 mm 7 days after implantation, a predetermined amount of human TNF or a new TNF mutant was administered. (I
) The purified preparation was administered via the tail vein.

24 hours after administration, Carswell et al.'s criteria [E
, A., Carswell et al., supra], tumor necrosis effect (hereinafter referred to as margin) (iii) Evaluation of side effects The side effects of human 1-TNF and the new TNF mutant (I) were evaluated in terms of their lethal effects on mice.

1. Using ddY mice (5 weeks old, female). predetermined amount of heat)
Purified specimens of TNF or TNF variant (1) were administered through the tail vein, and survival or death was determined 48 hours later. The results are shown in Table 3.

The lethal effect of the novel TNF variant (I) is significantly reduced compared to human TNF, and together with the results of Example 2-■, the TNF variant (1) of the present invention has excellent in v
It was shown to have ivo antitumor activity and to have reduced side effects compared to human TNF.

(Hereinafter, blanks) [Effects of the Invention] According to the present invention, the present invention has strong antitumor activity in υivo,
In addition, a novel TNF variant with fewer side effects than conventional human TNF can be provided.

[Brief explanation of the drawing]

FIG. 1 shows the nucleotide sequence of the designed human TNF gene and the amino acid sequence encoded thereby. Base numbers are given above the base sequence, and amino acid numbers are given below the amino acid sequence. Fr-A, Fr-B, Fr-C, and Fr-D are DNA fragments used when cloning the human TNF gene, and the restriction enzyme cleavage sites used at that time are also shown. FIG. 2 shows the base sequence of a chemically synthesized oligonucleotide for constructing the human TNF gene. human TNF
The annealing region and restriction enzyme cleavage site used in the synthesis of DNA fragments for gene cloning are also shown. Figure 3 shows human TNF derived from chemically synthesized oligonucleotides.
This figure shows an outline of the process of synthesizing and cloning DNA fragments for gene construction. FIG. 4 shows human TNF expression plasmid pTHT3.
2 shows an outline of the steps for producing pAMHT4. FIG. 5 shows an outline of the steps for producing R9+ expression plasmids pTR91 and pAMIl191, which are one of the TNF mutants (I). Figure 6 shows Gl 37, one of the TNF mutants (I).
EI 31 expression plasmid pTGE1378. This figure shows an outline of the steps for producing pAMGE1378. Figure 7 shows R9, one of the TN, F mutants (I).
This figure shows an outline of the steps for producing the 1E131 expression plasmid pAMRE9138.

Claims (7)

[Claims] (1) The following formula: (N-terminal side) [There is a gene sequence. ] (C-terminal side) (In the formula, X represents an amino acid residue represented by Val or Arg; Y represents an amino acid residue represented by Asn or Gly; Z represents an amino acid represented by Arg, Glu, or Gln (However, this excludes the combination in which X is Val, Y is Asn, and Z is Arg.) A TNF variant having an L-form amino acid residue sequence shown in the following. (2) A DNA having a base sequence encoding a TNF variant represented by formula (I) according to claim 1. (3) A DNA having a base sequence in which a translation start codon is bound to the 5' end of the base sequence encoding the TNF variant represented by formula (I) according to claim 1, and a translation stop codon is bound to the 3' end. . (4) A recombinant vector in which the DNA of claim 3 is integrated into a gene expression vector. (5) A host cell transformed with the recombinant vector of claim 4. (6) T expressed by formula (I) according to claim 1, characterized in that the host cell according to claim 5 is cultured in its growth medium.
Method for producing NF mutants. (7) An antitumor agent containing the TNF variant represented by formula (I) according to claim 1 as an active ingredient.