JPS63270697A - Human tumor necrosis factor related protein - Google Patents

Abstract

NEW MATERIAL:A protein which is deficient in eight amino acid residues from hundredth Gln to 107th Al a from the amino end of human tumor necrosis factor shown by the formula, in 2-8 amino acid residues from the amino end of Ser, in both the amino acids or a protein whose 99th Cys from the amino end is replaced with Ser. USE:A carcinostatic agent. PREPARATION:For example, cDNA to code human tumor necrosis factor shown by the formula is cleft with a proper restriction enzyme and a necessary part is bonded with DNA polymerase to give DNA to code human tumor necrosis factor related protein. Then the DNA is integrated into a proper vector to give a recombinant plasmid, which is inserted into a host such as Escherichia coli, which transformed and the host cell is cultivated and the human tumor necrosis factor related protein is obtained from the supernatant liquid of the culture solution.

Description

[Detailed description of the invention] 〔Technical field〕 The present invention relates to human tumor necrosis factor-related proteins.

[Prior art]

Carswell et al.
They found that the serum of mice infected with calmette Guerin (BCG) and then treated with endotoxin contained a substance that caused necrosis of transplanted Meth A sarcoma cancers, and named this substance tumor necrosis factor. [Proceedings of the National Academy of Sciences U, S, A, Mutual,
3666 (1975)).

Tumor necrosis factor is considered to be a physiologically active substance released from macrophages, and its characteristics are () when administered to tumor-bearing animals, it causes necrosis and treatment of certain types of cancer; (ii) in vitro. (iii) It damages certain cancer cells (e.g., mouse cancer cells, human cancer-derived A-549 cells), but has almost no harmful effect on normal cells;
It is known that its effects are not species specific.

Because of these characteristics, tumor necrosis factor is expected to be clinically applied as a new type of anticancer agent.

There are examples of human tumor necrosis factor and its production method as described below. A method for producing human tumor necrosis factor by culturing human-derived cells is described, for example, in JP-A-60-36420, and a method for producing human tumor necrosis factor using recombinant DNA technology using the human tumor necrosis factor gene is described, for example. JP-A-60-252496, JP-A-61-5092
In addition to the 3rd prize, T., 5hirai et al. [Nature, 313
．． 803 (1985)), D. Penn1ca et al.
Nature+, 312.724 (1984)), A.
W. Wang et al. [Science, '228, 149 (19
85)), A. Narmenout et al. [European Journal of Biochemistry, 15
2.515 (1985)), M. Yamada et al. [Journal of Biotechnology, Main, 141 (1
There is a report by 985)).

(Structure and Effects of the Invention) As a result of extensive research aimed at developing anticancer proteins, the present inventors succeeded in obtaining a novel tumor necrosis factor-related protein and completed the present invention.

That is, the present invention provides the amino acid sequence Ser Ser Ser Arg Thr Pro S
er Asp Lys Pro 10Val Ala
His Val Val Ala Asn Pro
Gln Ala 20Glu Gly Gln Le
u Gln Trp Leu Asn Arg Arg
308 Ia Asn Ala Leu L
eu Ala Asn Gly Val G
lu 40Leu Arg Asp Asn
Gln Leu Val Val Pro
Ser 50 Glu Gly Leu Tyr
Leu Ile Tyr Ser Gln Val
60Leu Phe Lys Gly Gln Gl
y Cys Pro Ser Thr 7011is
Val Leu Leu Thr His Thr
Ile Ser Arg 8011e Ala
Val Ser Tyr Gln Thr
Lys Val Asn 90Leu Leu
Ser Ala lie Lys Ser Pro
Cys Gln 1100Ar Glu Thr
Pro Glu Gly Ala Glu
Ala Lys 110Pro Trp Tyr
Glu Pro Ile Tyr Leu Gly
Gly 120Val Phe Gln Leu G
lu Lys Gly Asp Arg Leu 13
0Ser Aha Glu Ile Asn Arg
Pro Asp Tyr Leu 140Asp
Phe Ala Glu Ser Gly Gln V
al Tyr Phe 150Gly Ile I
(1) Eight amino acid residues from the 100th Gln to the 107th Ala from the N-terminus of the human tumor necrosis factor expressed as le Ala Leu were deleted or (
2) Either 2 to 8 amino acid residues were deleted from the N-terminal Ser, or (3) 8 amino acid residues from the 100th Gln to the 107th Ala from the N-terminus and 2 to 8 amino acid residues from the N-terminal Ser were deleted. A human tumor necrosis factor-related protein in which 8 to 8 amino acid residues have been deleted or (4) Cys at position 99 from the N-terminus has been replaced with Ser, and a D encoding the protein.
A method for producing human tumor necrosis factor-related protein using NA, a plasmid containing this DNA, a host cell containing this plasmid, and this host cell.

The human tumor necrosis factor-related protein of the present invention was designed by the present inventors based on the amino acid sequence of human tumor necrosis factor, its secondary structure and hydrophilicity analysis, and was created using recombinant DNA technology. Yes, amino acid sequence Table 1 Ser Ser Ser Arg Thr Pro S
er Asp Lys Pro 10Val ALa
His Val Vat Ala Asn
Pro Gln Ala 20Glu
Gly Gln Leu Gln Trp
Leu Asn Arg Arg 30AL
a Asn ALa Leu Leu ALa Asn
Gly Val Glu 40Leu Arg As
p Asn Gln Leu Val Val Pro
Ser 50 Glu Gly Leu Tyr Le
u lie Tyr Ser Gln Vat 60
Leu Phe Lys Gly Gln
Gly Cys Pro Ser Thr
701(is Val Leu Leu Thr t
lis Thr Ile Ser Arg 80Ti
e Ala Val Ser Tyr Gl
n Thr Lys Val Asn 9
0Leu Leu Ser Ala lie Lys
Ser Pro Cys Gln 1100Ar G
lu Thr Pro Glu Gly A
la Glu Ala Lys 110Pro
Trp Tyr Glu Pro Ice Tyr
Leu Gly Gly 120Val Phe Gl
n Leu Glu Lys Gly Asp Arg
Leu 130Ser ALa Glu Il
e Asn Arg Pro 8sp Ty
r Leu 140Asp Phe Ala Gl
u Ser Gly Gln Val Tyr Ph
e 150Gly Ile Ile Ala
A specific amino acid sequence of Leu has been deleted, or a specific amino acid residue has been substituted with another amino acid residue. Specifically, in the N-terminal region of the amino acid sequence shown in Table 1 above, each Ser-5er
-1Ser-5er-Ser-Arg-1Ser-5e
r-5er-8rg-Thr-Pro-15et-Se
r-Ser-8rg-Thr-Pro-3er-1Se
r-5er-Ser-Arg-Thr-Pro-3et
TNFD 2 with deletion of the amino acid sequence of -Asp-
, TNFD 4 , TNFD 6 , TNFD 7, T
NFD8 is mentioned. Also, 100 from the N-terminal Ser
~10707th amino acid sequence Gln-Arg-Gl
TNFD19 with u-Thr-Pro-Glu-Gly-Ala- deleted, the amino acid sequence Ser-Ser
-5er-Arg-Thr-Pro-3er-Asp-
and the 100th to 10707th amino acid sequence from the N-terminal Ser, Gln-Arg-Glu-Thr-Pro-Glu-
TNFD819 and N deleted with Gly-Ala-
T in which the 99th Cys from the terminal Ser is replaced with Ala
NFD99 is also a specific example of the present invention. The above-mentioned human tumor necrosis factor-related protein of the present invention has higher stability than conventionally known human tumor necrosis factors, and has excellent stability in the body, so that the therapeutic effect is highly durable. year)
It has the following characteristics.

The human tumor necrosis factor-related protein of the present invention can be produced as follows.

(1) Preparation of tumor necrosis factor mRNA To obtain tumor necrosis active substance mRNA, first, human monocytic leukemia cell line THPP-1 (International
Journal of Cancer, 261, 171. (1
980)) is cultured and grown in a medium using a method commonly used for cell culture.

The culture is carried out, for example, in a medium at a cell density of 0.5 to 5 × 1
05 cells/+d, about 30-4
This can be carried out by performing spinner culture at 0°C. As a medium, for example, RPMT-1640 medium [Journal of American Medical Association, υ9.519 (1967)], Dulbecco's Modified Eagle's Medium [Pyrolocy, 12,185 (1960)]
)), Ham's medium [Experimental Cell Research, published, 515 (1963)], etc. can be used. Good results can also be obtained by appropriately adding animal serum (e.g., fetal bovine serum, etc.) or antibiotics (e.g., kanamycin, penicillin, streptomycin, etc.) to the culture medium. ~20%, usually 0.05-1mg/for antibiotics
- is appropriate.

The proliferated human monocytic leukemia cells are then collected and cultured in a suspension of fresh medium or by adding a differentiation inducer, endotoxin, and a reticuloendothelial system activating substance to the cell culture medium.

Examples of differentiation-inducing agents include phorbol esters and retinoic acid, and examples of phorbol esters include 12-0-tetradecanoylphorbol-13-acetate. It is preferable to use these alone, more preferably in combination, and add each at a concentration of 50 to 500 nM. Culture at about 30-40℃ for about 12
It is appropriate to carry out the test for ~36 hours.

Next, a reticuloendothelial system activating substance was added to this culture, and 16-36
Continue culturing for 2 to 1 hour, then add endotoxin for 2 to 1 hour.
Continue culturing for 0 hours. As the reticuloendothelial system activating substance, for example, water-soluble peptide glucomannan SPGM-1 derived from Propionibacterium acnes cells and yeast
4-7878), and endotoxins include Escherichia coli, Salmonella typhimurium, and Noripobolisancalide derived from S. marcescens, with a final concentration of 1 to 50 μg.
/mR is preferable.

After the culture is completed, the culture solution is centrifuged to collect the cells, and total RNA is extracted from the cells.

RNA can be extracted using conventional methods, such as the method of Chirgwin et al. [Biochemistry, ■, 5294 (1979)]
), the cells are disrupted in a guanidine isocyanate solution, the disrupted cell solution is layered on a 5.7M cesium chloride solution in a centrifuge tube, and the RNA is precipitated by centrifugation. Detection of tumor necrosis factor mRNA from the obtained total RNA can be performed by purifying the total RNA according to a conventional method.

For example, total RNA can be purified with poly(A) by adsorption column chromatography using oligo(dT)cellulose or poly(U)Sepharose or batch processing.
Tumor necrosis factor mRNA can be concentrated and purified by separating the RNA fraction and treating this poly(A) RNA fraction with sucrose density gradient centrifugation or acid urea agarose gel electrophoresis.

Adsorption column chromatography treatment using oligo (dT) cellulose or poly (U) Sepharose, etc.
Batch processing, sucrose density gradient centrifugation, and acid urea agarose gel electrophoresis can all be carried out by conventional methods.

(2) Cloning of tumor necrosis factor c DNA (1)
) was used as a template, and the method of Okayama and Barb [Molecular and Cellular Biology, 1.16H1982)] or the method of Gubler and Hoffman [Jean, Yushi, 263 (1983)] was used.
) etc. to create a cDNA bank. For example, using mRNA as a template and oligo(dT) as a primer, complement the mRNA with reverse transcriptase (e.g., reverse transcriptase derived from avian myeloid leukemia virus) in the presence of dATP, dGTP, dCTP, or dTTP. Synthesize first strand cDNA.

Next, using this first strand cDNA as a template, E. coli-derived R
While decomposing and removing mRNA with NaSeH, the second strand c was prepared using E. coli DNA polymerase and E. coli DNA ligase.
Synthesize the DNA and obtain two 1fNAs. These two tM
A terminal transferase is applied to the CD N A in the presence of dGTP to add a poly (d G) homopolymer tail. Apart from this, plasmid pBR322
is cleaved with the restriction enzyme EcoRV, and a poly(dC) homopolymer tail is added with terminal transferase in the presence of dCTP. cD operated in this way
After mixing and annealing NA and the DNA of plasmid pBR322, host cells [for example, E.

coli χ 1776 (ATCC 31244), etc.) for transformation, and selection (E. coli χ 1776
A cDNA bank can be created by selecting ampicillin-resistant strains.

Colony hybridization test using the plus/minus method for this cDNA bank [Gene, ■, 6
3 (1980)) to screen the clone of interest. That is, using mRNA as a template, 32p
A labeled cDNA is synthesized and used as a guiding plus probe. At this time, mRNA was extracted and concentrated from a mouse-derived macrophage cell line cultured in the presence of a reticuloendothelial system activating substance and thiouridine as an induction plus probe, and thiouridine-containing mRNA was purified by adsorption chromatography. 32P standard j%cDN using as a template
A synthesized version of A may also be used.

Separately, 3Zp-labeled cDNA was prepared using mRNA extracted and concentrated from cells of mouse-derived macrophage cell line J774.1 cultured in the absence of reticuloendothelial system-activating substances as a template.
Synthesize A and use it as an inductive minus probe. A clone that strongly binds to the induced plus probe and hardly binds to the induced minus probe is selected from the cDNA bank by colony hybridization method.

Plasmid DNA is separated from the clones thus obtained, heated or denatured with alkali to obtain 1ic DNA, and fixed on a nitrocellulose filter. An mRNA fraction containing cancer necrosis factor mRNA is added to this and hybridized. The bound mRNA is then eluted and collected and injected into African frog mother cells to test whether it produces tumor necrosis factor (Hybridization Translation XM).

cD encoding human tumor necrosis factor by the above method
A transformed strain containing a recombinant plasmid incorporating an NA fragment can be obtained.

Furthermore, by cutting out the cloned DNA fragment of this transformed strain with an appropriate restriction enzyme and labeling it with 3Zp as a probe, it is also possible to select a larger cDNA by rescreening the cDNA bank described above. I can do it. The thus obtained cloned cDNA
The base sequence of the A fragment was analyzed by the method of Mesosing et al. [Nucrets Acid Research, Main, 309 (1981)] or the method of Maxam et al. [Methods in Enzymology, Flash, 499 (2980)], By determining the base sequence encoding the amino acid sequence of the N-terminal portion of tumor necrosis factor and finally selecting a cDNA containing the base sequence corresponding to the entire translated region of tumor necrosis factor, the amino acid sequence of tumor necrosis factor was encoded. A cloned cDNA having the base sequence can be obtained.

] 3) Expression of tumor necrosis factor cDNA O form To produce tumor necrosis factor using the cloned CDNA of tumor necrosis factor obtained in (2) above, first, the substantial sequence of the cloned CDNA is inserted into an appropriate expression vector. to create a recombinant plasmid for tumor necrosis factor production. Next, a culture composition containing tumor necrosis factor can be obtained by introducing this recombinant plasmid into a suitable host cell and culturing the transformed strain in a medium.

When expressing the substantial base sequence of the cloned tumor necrosis factor cDNA, combinations of cultured host cells derived from a wide range of prokaryotes, eukaryotes, or multicellular organisms and expression vectors can be employed. can. When using a prokaryote as a host cell, for example, E, belonging to the C01iK12 strain, coli
11776 strain (ATCC31244), E. coli
MM294 strain (ATCC33625), E, co I
tJM103 strain [Nucreitsk Acid Research,
Degree, 309 (1981)), E, c.

1i JM105 strain [Protein/nucleic acid/enzyme, 1 unit.

294 (1981)] is preferred. In addition, E
, coli strain W3110 (8TCC27325),
Enterobacteriaceae such as E. coli B strains, Salmonella typhimurium, Serratia marcescens or Bacillus subtilis can also be used.

In addition, the expression vector contains a replicon and a regulatory function compatible with the above-mentioned host cell, and a promoter necessary for the host cell to express its own protein, or has been improved to contain it. Preferably.

Specific examples of each of these combinations are shown below.

The host cell is E. coli α Sakai Imakami plasmid pBR322 (Gene, Muscle, 95, (
(1977) ), β-lactamase promoter, lactose (1ac) promoter [
Nature, Dan, 544 (1979)), the l-lyptophan (trρ) promoter [Nuclide Acid Research, Eng., 4057 (1980)) and the tank (tac) promoter [Proceedindus.
National Academy of Sciences [1]
, S.A., Kawa, 21 (1983)). Such expression vectors include, for example, pUclB (8TCCU7253).
UC vector [Method in Enzymology, denv-120 (1983)] or pKK223-3
(Pharmacia, Sweden) or pUclB as prepared by the present inventors and described in the Examples.
Expression vector pU incorporating the tank (tac) promoter and rrnB terminator of 223-3 into
Examples include T18 and the ATG expression vector pUATG.

Construction of a recombinant plasmid for producing tumor necrosis factor using host cells and expression vectors as described above involves cleaving and repairing the isolated vector DNA and cloned CDNA, and using oligonucleotides as necessary to induce tumor necrosis. This can be carried out by effectively linking a nucleotide sequence encoding a factor to a promoter sequence within a gene expression vector. DNA cleavage occurs in buffer at 37°C for approximately 1
It is sufficient to treat the DNA with restriction enzymes for ~3 hours, allowing cleavage D
NA can be obtained by deproteinizing by phenol and chloroform extraction and precipitating with ethanol from the aqueous fraction. Then, the cleaved DNA is treated with dATP and dGT.
In the presence or absence of PSdCTP, dTTP,
After treatment with DNA polymerase (Flenow fragment), protein was removed by phenol and chloroform extraction.
Repair DNA by precipitation with ethanol from the aqueous layer
can be obtained. DNA polymerase treatment is approximately 1
It is appropriate to carry out the reaction at 5°C for about 15 minutes.

Furthermore, in the present invention, an oligonucleotide can be added after the promoter to facilitate translation.

The thus obtained DNAs are ligated so that the ends of each of the above-mentioned DNAs, that is, the vector DNA and the cloned cDNA, and the nucleotide sequences after ligation match correctly, and if desired, when oligonucleotides are used, the oligonucleotides are This can be carried out by treating with a mixture of equimolar amounts of shiri gauze.

The recombinant plasmid thus obtained can be introduced into host cells by conventional methods.

When the host cell is a prokaryotic cell, a method using calcium chloride treatment [Proceedings of the National Academy of Sciences U, S, 8].

Deaf, 2110 (1972)) can be used.

The thus obtained host cells containing the recombinant DNA molecules for producing tumor necrosis factor (hereinafter referred to as recombinant cells) can be cultured aerobically in a liquid medium. Examples of media include normal nutrient media containing polypeptone, yeast extract, salt, glucose, etc., as well as Davis' minimal medium [Journal of Bacteriology, Vol. 17].
(1950)) can be used. Culture is approximately 3
Preferably, it is carried out at 0 to 40°C.

c encoding human tumor necrosis factor obtained in the previous section (3)
After cutting the recombinant plasmid containing DNA with an appropriate restriction enzyme to obtain linear DNA, nuclease Ba131 (
Molecular Cloning, 135-139, published by Cold Spring Harbor Laboratory] to excise the cDNA.

Then, after treating with DNA polymerase I (Flenow fragment) to make the ends blunt, it is ligated to an ATG expression vector. In this way, a DNA encoding a human tumor necrosis factor-related protein in which the amino acid residues in the N-terminal region of human tumor necrosis factor have been deleted and a plasmid for expressing its expression can be created.

In addition, the plasmid containing the cDNA encoding human tumor necrosis factor obtained in the previous section (3) was cut with an appropriate restriction enzyme, and the DNA fragment containing the cDNA was converted into the M13 vector [Method in Enzymology, Vol. 101, 20-7
8 pages (1983), published by Academic Press].
Cloning. Thereafter, a site-directed mutagenesis method using chemically synthesized oligonucleotides [Procedures of the National Academy of Sciences U,S.

A9, Main 2, 488-492 (1985) and Method in Enzymology, Vol. 100, 468-50
0 (1983) published by Academic Press] or by substituting a partial region of the cDNA fragment with chemically synthesized RNA, deletion mutations or amino acid substitution mutations were created in the central region of the cDNA of human tumor necrosis factor as designed. In addition, it is possible to obtain a DNA encoding a human tumor necrosis factor-related protein in which amino acid residues in the central region of human tumor necrosis factor are deleted or amino acid substituted. An expression plasmid for human tumor necrosis factor-related protein can be created by excising the thus obtained DNA encoding human tumor necrosis factor-related protein with an appropriate restriction enzyme and ligating it to an expression vector.

(5) Production of human tumor necrosis factor-related protein Transform Escherichia coli, such as JMIO5, with the expression plasmid for human tumor necrosis factor-related protein created in the previous section (4), and culture the recombinant as follows to produce a human tumor. Necrosis factor-related proteins can be produced. Cultivation can be carried out aerobically in a liquid medium. In addition, during culture, culture of the recombinant can be made more efficient by adding an appropriate inducer to the medium depending on the promoter used, for example, in the case of the lac promoter, isopropyl-β-D-diogalactoside. This is preferable because it can be done.

The desired tumor necrosis factor is isolated from the recombinant thus obtained by using a culture composition, cell extract, ammonium sulfate fractionation, ion exchange chromatography, gel filtration, reversed phase chromatography, polyacrylamide gel electrophoresis, and affinity chromatography. It can be carried out by appropriately combining conventional methods for separation and purification such as, and extremely high purity can be obtained.

Note that the following abbreviations are used in the present invention.

A: Adenine C: Cytosine G Nigeanine T: Thymine Ala: Alanine Arg: Arginine Asn: Asparagine Asp: Aspartic acid Cys Nidistine Gln: Glutamine Glu: Glutamate Gly Nigericine His: Histidine 11e: Isoleucine Leu: Leucine Lys: Lysine M e t: Methionine Phe: Phenylalanine Pro Nibroline Ser: Serine Thr: Threonine Trp:) Liptophan Tyr: Tyrosine Val: Valine DNA: Deoxyribonucleic acid cDNA: Complementary DNA RNA: Ribonucleic acid mRNA: Messenger RNA dATP: Deoxyadenosine triphosphate dCTP: Deoxycytidine dGTP triphosphate: Deoxyguanosine triphosphate dTTP: Deoxythymidine triphosphate dNTPs: dATP, dCTP, dGTP and dTTP Oligo(dC): Oligodeoxycytidylate oligo(d
C,): Oligodeoxyguanylate oligo(dT)
: Poly oligodeoxythymidylate (A): Poly polyadenylate (U): Poly polyuridylate (dA): Poly polydeoxyadenylate (dC
): polydeoxycytidylate poly(dG): polydeoxyguanylate poly(dT): polydeoxythymidylate NAD: nicotine adenine dinucleotide'ATP:
Adenosine triphosphate EDTA: Ethylenediaminetetraacetic acid EGTA: Ethylene glycol bistetraacetic acid To simplify the description of the examples, frequently used methods are abbreviated to short words or phrases as follows.

"Digestion" of DNA refers to cutting DNA with restriction enzymes. Various restriction enzymes used in the present invention are commercially available, and reaction conditions such as reaction temperature and reaction solution composition were according to the instructions of the restriction enzyme supplier. Then, usually 1 to 2 units of restriction enzyme was applied per 1 μg of DNA in 20 μl of buffer. After the reaction, proteins are extracted with phenol and chloroform, and the digested DNA is recovered from the aqueous layer by ethanol precipitation.

"Binding" of DNA refers to the formation of a phosphodiester bond between two double-stranded DNAs, and commercially available T4D
NA ligase was purified under the reaction conditions specified by its supplier.
Act on the NA mixture.

Typically, 10 units of T4 DNA ligase are used per 0.5 μg of approximately equimolar DNA to be ligated.

"Preparing" DNA from a transformant refers to isolating plasmid DNA from a microbial culture using the alkaline/SDS method [T., Maniatis et al., Molecular Cloning (1982), Cold Spring Harbor.・Laboratory publication] was adopted. 'Transformation' means introducing DNA into cells,
It means that the DNA is replicated as an extrachromosomal element. The method is the calcium chloride method (T, Mania
tis et al., Molecular Cloning, 1982.
Published by Cold Spring Harbor Laboratory]
It was adopted.

Hereinafter, the present invention will be explained in more detail with reference to Examples and Experimental Examples.

Example 1 (1) Isolation and purification of mRNA from human monocytic leukemia IB cell line TIIP-IC International Journal of Cancer, 21, 17
1-176 (1980), 10% fetal bovine serum, 100 units of penicillin/IR1, and 50μ of streptomycin.
suspended in tLE PRM l-1640 medium containing g/mi? r: J (cell number: 1×10S cells/ml). The suspension was mixed with 5% CO2-9 in a commercially available polystyrene flask.
Culture at 37°C in 5% air for 4 days. After culturing, the cell suspension is centrifuged (1000 rpm, 5 minutes) to collect the cells. The cells are resuspended in the above PRM 1-1640 medium and transferred to a spinner flask (Belco, USA). While being stirred (60 rpm), the cells are cultured at 37°C for 5 days.

After culturing, the cell suspension was centrifuged (1000 rpm, 5
(min) and collect the cells. After suspending 3 x 10' of the obtained cells in serum-free PRM l-1640 31, 12-0-tetradecanoylphorbol-13-
160 each of acetate and retinoic acid
nM, add to 400 nM and transfer to spinner flask. After culturing at 37°C for 24 hours with stirring (60 rpm), dry cells of Propionibacterium acnes were added at a concentration of 30 μg/ml. After further culturing for 24 hours, E. coli-derived Noribopolysancalide was added at a concentration of 10 μg/ml and cultured for 5 hours.

The culture solution thus obtained was centrifuged for 1ifl? (1000
1 x 109 cells obtained by
Add a solution of M guanidine isocyanate, 5mM sodium citrate buffer (pH 7.0), 0.1M 2-mercaptoethanol, and 0.5% sodium sarcosinate to approximately Repeat suction and discharge 10 times to destroy cells. Cesium chloride is added and dissolved in the homogenate thus obtained at a rate of 1 g per 2.5 rn. The solution was transferred to a centrifuge tube (SW 40, manufactured by Beckman, USA).
5.7M cesium chloride-0 in Ti rotor)
It is layered on 2.5i of 1 MEDTA (pH 7,5) solution and centrifuged at 3300 rpm for 16 hours to precipitate RNA. After removing the supernatant by suction, cut off the upper part of the tube leaving 2 cm from the bottom. After drying the tube wall, R
Precipitate the NA in 50mM containing 5mM EDTA and 1% SDS.
Dissolve in 1-M Tris-HCl buffer (pH 7,4). This is mixed with phenol, chloroform and isoamyl alcohol saturated with the same buffer? & (25:24:1), shake well, and centrifuge at 110,000 rpm for 10 minutes to collect the aqueous layer. After repeating this operation, add an equal amount of chloroform:isoamyl alcohol (24:1) to the aqueous layer, stir, and centrifuge (10,000 rpm++,
10 minutes) and collect the aqueous layer. Then, 0.1
Add 1 volume of 3M ammonium acetate (pH 5.2) and 2.2 volumes of ethanol, let stand at -20°C for 5 hours to precipitate RNA, and then centrifuge (10,000 rpm, 10 minutes) to precipitate RNA. get.

The RNA thus obtained was dissolved in sodium chloride 0.5M,'
20mM1 containing EDTA1mM and 5DSO, 1%
-Dissolve in 5 ml of Lis-HCl buffer (pH 7,6).

The solution was treated at 65°C for 5 minutes and cooled, followed by 4 ml of oligo(dT) cellulose (manufactured by Pharmacia, Sweden, type 7) equilibrated with the same buffer as above.
conducts to the column. The effluent was treated again at 65° C. for 5 minutes, cooled, and then passed through a column labeled “2” to adsorb RNA. Next, the column was exposed to ultraviolet light (wavelength:
Wash until absorption at 260 nm) disappears. EDTA
An eluate containing RNA is obtained by passing a 20mM Lis-HCl buffer containing 1mM and 0.05% of 5DS through the column and collecting the effluent having ultraviolet (wavelength: 260nm) absorption. Add 0.1 volume of 3M sodium acetate (pH 5,2) and 2.2 volumes of ethanol to the eluate and mix for 20 minutes.
The RNA was precipitated by standing at ℃ and then centrifuged (10,000 rpm).
pm for 10 minutes) to obtain RNA. In this way, 50 μg of mRNA encoding the desired human tumor necrosis factor is obtained.

(2) cDNA bank qSynthesis of single-stranded cDNA 15 pg of mRNA obtained in (1) above, 50mM
Tris-HCl buffer (pH 18,3), 100mM potassium chloride, 10mM magnesium chloride, 10mM dithiothreitol, 2.5mM dNTPs, 15μcic
x-32P-dCTP (specific activity 800Ci/mmol
), 0.5μg :t'J':f(dT)
20μ containing +z-In and 40 units of RNA5IN (trade name, Promega Biotic, USA)! 1 in a solution of
After adding 00 units of avian myeloid leukemia virus-derived reverse transcriptase and reacting at 42°C for 60 minutes, 0.5 MEDTA was added.
Add an aqueous solution to a final concentration of 20 mM to stop the reaction. Extract with a phenol:chloroform:isoamyl alcohol mixture (25:24:1) and collect DNA from the aqueous layer by ethanol precipitation to obtain 2 μg of cDNA-mRNA complex.

■Synthesis of double-stranded cDNA 2μg of cDNA-mRNA complex obtained in ■20100
mM potassium chloride, 5 μg raw serum albumin, 0.15
mM β-NAD, 40 μM dNTPs.

1oarn solution containing 0.005% bovine serum albumin
1 unit of RNase H12 units of Escherichia coli D
12 units of NA ligase and 25 units of DNA polymerase
After reacting for 60 minutes at °C and then for 60 minutes at 22 °C, the reaction is stopped by adding 0.5M EDTA to a final concentration of 20mM. The reaction solution was mixed with phenol:chloroform:isoamylalcohol solution (
25:24:1), and 4M ammonium #acid and ethanol are added to the aqueous layer to precipitate double-stranded cDNA.

This precipitate is collected, dissolved in 120 μl of water, and ethanol is added to precipitate double-stranded cDNA. Collect this precipitate and
Wash with 0% ethanol to obtain 1.4 μg of duplicate tlcDNA.

■Preparation of oligo(dG)-tailed cDNA The double-stranded cDNA obtained in step (■) above was mixed with reaction buffer (140mM sodium cacodylate, 30mM Tris-HCl buffer (pH 6).
, 8), 1mM cobalt chloride, 0.2mM dithiothreitol, 0.07mM dGTP.

7μCiα-”P-dGTP (specific activity 800Ci/
Dissolve in 320 μl of a solution containing mmo 1), add 22 units of terminal deoxynucleotidyl transferase, and react at 37° C. for 20 minutes. 0.5 to this
The reaction was stopped by adding MEDTA to 20 mM, the reaction solution was extracted with a phenol-chloroform-isoamyl alcohol mixture, ethanol was added to the aqueous layer, the resulting precipitate was collected, washed with 70% ethanol, and then dried under reduced pressure. to obtain oligo(dG) tailed cDNA.

100 μg of plasmid pBR322 DNA was digested with restriction enzyme EcoRV, and the resulting DNA was mixed with 10 mM Tris-HCl (pH 7,5), 0.2 M sodium chloride,
Dissolve in 100 μl of buffer containing 1 mM EDTA. The solution was mixed with a density gradient of 5-25% sucrose [0.2% sucrose]
M Sodium Chloride, 50ff 1M containing 1mM EDTA
Tris-HCl buffer (dissolved in pl+7.5)
and centrifuged (38,000 rpm, 17 hours, 4°C) using a 5W40Ti rotor (manufactured by Beckman, USA). After centrifugation, it is fractionated to collect a linear pBR322 DNA fraction with a low transformation frequency, and the DNA is recovered by ethanol precipitation. 6 μg of recovered DNA
was used in the aforementioned oligo(dG) tail addition (however, dCT was used instead of dGTP and α-”P-dGTP).
22 units of terminal deoxynucleotidyl transferase were added and reacted at 37°C for 8 minutes to obtain approximately 10 to 15 dCTP.
Incorporate G residue. The reaction solution is extracted with a phenol-chloroform-isoamyl alcohol mixture, and the oligo(dC) tailed plasmid pBR322 DNA is recovered from the aqueous layer by ethanol precipitation.

■ Preparation of recombinant plasmid 1 Preparation of recombinant plasmid solution Oligo(dG) tailed cD obtained in (2)-○ above
NA was added to 10 mM 'j-Lis-HCl buffer (pH 7,
5) Dissolve in an aqueous solution containing 1mM EDTA and 100mM sodium chloride at a concentration of 170ng per ml.

In addition, the oligo(dC) tailed plasmid pBR322 DNA obtained in (2)-■ above was mixed with 30mM Tris-HCl buffer (pH 6,8), 140mM sodium cacodylate, 1mM cobalt chloride, 0.2mM dithiothreitol, 0.07mM. mMd CTP, 7pCi
ex -”P-dCTP (specific activity 8001J Ci
/mmol) in an aqueous solution containing 1.7 μg/mmol).

Mix 30 μl of each of these solutions and incubate at 65°C for 5 minutes.
Annealing is performed by heating at 8° C. for 90 minutes to prepare a recombinant plasmid solution.

■ E, co, using the recombinant plasmid solution obtained above.
The liz1776 strain (ATCC3124,4) is transformed and ampicillin-resistant bacteria are selected to create a cDNA bank.

(3) Selection and death of human tumor necrosis factor cDNA (2)
32 to select a transformed strain containing cDNA encoding human tumor necrosis factor for the cDNA bank in section ).
A colony hybridization test using a P-labeled mouse tumor necrosis prisoner cDNA fragment as a probe was carried out at 1 la.
The method of Nahan et al. [Gene, 10. 63.
(1980) ).

That is, a cloned DN encoding mouse tumor necrosis factor
A was prepared, digested with the restriction enzymes Taql and 5acI, and then subjected to agarose gel electrophoresis elution [Molecular Cloning (1982), published by Cold Spring Harbor Laboratory] to extract the region encoding mouse tumor necrosis factor. DNA fragment corresponding to (approximately 0.3 kb
) is isolated. This DNA fragment was extracted using the nick translation method (T.

Maniatis, Molecular Cloning (19
82), published by Cold Spring Harbor Laboratory] with 32P, and using the obtained labeled DNA fragments, the cDNA bank prepared in section (2) above was subjected to a colony hybridization test [Gene, 10.63
(1980)). From approximately 100,000 colonies, 16 clones having base sequences that strongly bind to this labeled probe were selected, these clones were further purified, and a colony hybridization test was performed again in the same manner as above to determine hybridization. The reproducibility was confirmed. From these 16 clones,
Rapid plasmid isolation method [molecular cloning,
p368 (1982) published by Cold Spring Harbor Laboratory], extract each plasmid DNA, digest with the restriction enzyme Bam HI, and excise the recombinant plasmid (pHTNF-7) with the longest cDNA fragment. Select one clone with . Escherichia coli HB 101 is transformed using this recombinant plasmid pHTNF-7, and the resulting transformant is cultured in LB Pros to obtain bacteria. Plasmid DNA is prepared from this bacterial cell. 40 μg of this plasmid DNA
was digested with the restriction enzyme BamHI, and a cloned cDNA fragment (approximately 1.8
kb), and this cloned cDNA fragment was transformed into vectors M13mplO and mpH and host E. coli J
Mesotank cloning system using M103 [Method in Enzymology, 101゜20, (19
83)) and dideoxy method [Proceedings of the National Academy of Sciences]
Science U, S, A, 74.5463 (1977
) ) to determine its base sequence. The substantial base sequence is as shown in Table 2.

Table 2 TCA TCT TCT CGA ACCCC
G AGT GACAAG CCTGTA G
CCCAT GTT GTA CCA 8ACC
CT CAA GCTGACGGGG CAG CT
CCAG TGG CTG AACCGCCGGGCC
AAT GCCCTCCTG GCCAAT G
GCGTG GAGCTG AGA GAT AAC
CAG CTG GTG GTG CCA TCAGA
G GGCCTG TACCTCATCTACTCCC
A, G GTCCTCTTCAAG GGCCAA G
GCTGCCCCTCCCACCCAT GTG C
TCCTCACCACACCATCAGCCGAC
CGCCGTCTCCTACCAG ACCAAG
GTCAACCTCCTCTCTGCCATCA
AGAGCCCCTGCCAGACCGAG A
CCCCA GAG GGG GCT GAG
GCCAAGCCCTG TAT GAG
CCCATCTAT CTG GGA GGG
GTCTTCCAG CTG GAG AAG GGT
GACCGA CTCAGCGCT GAG
ATCAAT CGG CCCGACTAT CT
CGACTTT GCCGAG TCT GGG
CAG GTCTACTTTGGG ATCA
TT GCCCTG TGA (4) Creation of human tumor necrosis factor expression plasmid ■ Creation of high expression vector 1 μg of pUc18 DNA and pK K223-3
DNA1 pg with restriction enzymes Sca I and HindlJ
and agarose gel electrophoresis elution method.
．． A 8kb, 0.8 Kb DNA fragment is isolated. Both D
Mix and combine the NA fragments. In this reaction solution, E. coli J
M105 was transformed, a recombinant plasmid was prepared from the resulting transformant, and 5cal-Hindll of pKK223-3 containing the rrnB terminator gene [
Recombinant plasmid pTRM1, in which the fragment has been integrated into plasmid vector pUc18, is selected. Furthermore, p K
K223-3 is digested with restriction enzyme B am Hr and DNA is recovered by ethanol precipitation.

Transfer this DNA to 20 μl of buffer containing 50 mM dNTPs.
Dissolve in DNA polymerase ■ (Flenow fragment) 3
．． After adding 3 units and reacting at 30° C. for 30 minutes and heating at 68° C. for 15 minutes, a BamHI fragment of pK K223-3 with blunted ends is obtained by ethanol precipitation. This DNA is digested with the restriction enzyme EcoRV, and a DNA fragment of approximately 0.25 kb containing the tank (tac) promoter gene is isolated by agarose gel electrophoresis elution.

Furthermore, this DNA fragment and pTRMI were digested with restriction enzyme Pvu.
A high-expression plasmid vector pUT1B capable of inducible expression is prepared by ligating a DNA fragment of about 1.8 kb that has been digested with 1I and EC0RI and isolated by agarose gel electrophoresis elution (see Figure 1).

A human tumor necrosis factor expression plasmid is prepared using the thus obtained pUT18, chemically synthesized oligonucleotide, and human tumor necrosis factor cDNA, and human H tumor necrosis factor is produced by the method described below.

■Synthesis of oligonucleotide 5'-AATTCATGTCTTCTTCTCGTAC
T-3' and 3'-GTACAGAAGAAGAGC
Two types of oligonucleotides each consisting of ATGAGGCT-5' are synthesized. That is, an automatic DNA synthesizer (
After synthesis using Applied Biosystems, USA, Model 380A), protective groups other than the dimethyltrityl group were removed, and reverse phase HPLC (conditions: ShimpacK CL) was performed.
Using C-ODS column, 100mM1 as mobile phase.
- in ethylamine acetate buffer (pH 7,5),
Purify using a density gradient solution consisting of acetonitrile]. Next, the dimethyltrityl group was removed using a mixture of 80% acetic acid and 20% acetonitrile, and then subjected to reverse-phase HP
Purify the DNA by LC.

1 ug each of the synthetic oligonucleotides thus obtained, 5
0mM) Lis-HCl buffer (pH 7,6) 10mM
Magnesium chloride, 5mM dithiothreitol, 0.1
mM spermidine, 0.1mM EDTA, 2mM ATP
, a mixture of 2 units T4 polynucleotide kinase B, 3
The 5' end was phosphorylated by reacting at 7°C for 30 minutes, and annealed by further heating at 58°C for 1 hour, resulting in the base sequence 5'-AATTCATGTCTTCTTCTCGT.
ACT-3'3'-GTACAGAAGAAG
An oligonucleotide linker designated AGCATGAGGC↑-5' is obtained.

■ Treatment of expression vector pUT18 50mM) Liss-HCl buffer (pH 7.4), 10mM
Magnesium sulfate, 1mM dithiothreitol, 100
mM sodium chloride, 10 μg pKK223-3.10
After reacting a mixture of unit restriction enzymes EC0RI and HindlII at 37°C for 5 hours,
Isolate and purify using low melting point agarose and RDP mini column in the same manner as in 3) double-stranded cDNA fractionation,
Prepare vector DNA of approximately 2.6 Kbp.

■ Treatment of human tumor necrosis factor cDNA pHTNF-7 isolated and purified in Example 1-(3) above
10 μg of DNA, 10 mM) in Lis-HCl buffer (pH 7)
, 4) After reacting a mixture of 10mM magnesium sulfate, 1mM dithiothreitol, 50mM sodium chloride, and 10 unit restriction enzymes AvaI and HindIIr at 37°C for 5 hours, the double strand of Example 1-(3) was prepared. c.
A cDNA fragment of about 0.6 kb is prepared by isolation and purification using low melting point agarose and an RDP minicolumn in the same manner as for DNA fractionation.

■Preparation of human tumor necrosis factor expression plasmid and recombinant Oligonucleotide linker DNA obtained in the above (■)
．． 1 μg, pUT18 vector DNA obtained in step ① above
A mixture of 1 μg of cDNA obtained in the previous section ① and 2 units of T4 DNA ligase is reacted at 16° C. for 15 hours to ligate, and then E. coli strain JM105 is transformed in the same manner as in Example 1 (4). By selecting an ampicillin-resistant strain, a recombinant containing the human tumor necrosis factor expression plasmid pUT)IT-1 is obtained.

The thus obtained recombinant JM 105 (pUTI
IT=1) encodes human tumor necrosis factor encoded by the base sequence shown in Table 3 below.

Table 3 ATG TCT TCT TCT CGA ACCCC
G AGT GACAAG CCTGTA GCCCA
T GTT GTA GCA AACCCT CAA
GCT GAGGGG CAG CTCCAG TGG
CTG AACCGCCGG GCCAATGCC
TCCTG GCCAAT GGCGTG GA
G CTG AGA GATAACCAG C
TG GTG GTG CCA TCA G
AG GGCCTG TACCTCATCTACT
CCCAG GTCCTCTTCAAG GGCC
AAGGCTGCCCCTCCACCCAT GTG
CTCCTCACCACACCATCAGCCGCA
TCGCCGTCTCCTACCAG, ACCAA
G GTCAACCTCCTCTCTGCCAT
CAAG AGCCCCTGCCAG AGG
GAG ACCCCA GAG GGG GC
T GAG GCCAAG CCCTGG T
AT GAG CCCATCTAT CTG
GGA GGGGTCTTCCAG CTG G
AG AAG GGT GACCGA CTC
AGCGCT GAG ATCAAT CGG
CCCGACTATCTCGACTTTGCCG
AG TCT GGG CAG GTCTAC
TTT GGG ATCATTGCCCTG ■ Production of human tumor necrosis factor by recombinant JMI O5 (
pUTHT-1) and E. coli JM105 (abbreviated as JM105 (pUT18)) containing plasmid pU'r''18 were cultured in T medium (1% Batato tryptone, 0.5%
Sodium chloride, 1100tr/-ampicillin) 20
(Incubation with shaking at 37°C in 1+f, absorbance (660n)
m) is 0.3, the final concentration of IPTG is 0.1mM.
and culture with shaking for an additional 17 hours.

The culture solution is then centrifuged (6000 rpm, 15 minutes) to collect bacterial cells and suspended in 50-phosphate buffered saline (hereinafter abbreviated as PBS).

The cells were collected by centrifugation again, and the suspension in PBS containing 0.1 mM phenylmethylsulfonyl fluoride was sonicated (900011z, 5
After centrifugation (100,000 x g,
After 1 hour at 4°C), the supernatant was collected to obtain a bacterial cell extract. Using this bacterial cell extract, in vitro cancer cytotoxic activity, which is an indicator of tumor necrosis factor activity, was measured using mouse-derived fibroblast cell line L-929 as described in the literature [Journal of Immunology, 126.1279 (1981)].
The study was conducted according to the method described.

That is, L-929 cells (2.5 x 10
After culturing for 24 hours, 0.1 ml of supernatant Q, 1 mf or its dilution containing the cancer cytotoxic substance obtained above and actinomycin D (1 μ
g/ml> and incubate at 37°C for 24 hours. A 0.003% neutral red solution is added to this culture solution, and after culturing is continued for an additional hour, the culture solution is removed and the cells are washed with a new medium. Then 50% ethanol-0
When 1M sodium hydrogen uniphosphate is added, neutral red taken up by living cells is eluted, and this is measured colorimetrically (540 nm).

Cancer cytotoxic activity is calculated by the following formula: the amount of cancer cytotoxic active substance required to show 50% of the cytotoxic activity is 1
It was taken as a unit.

Injurious activity (%) = (1 - absorbance when active substance is added /
Absorbance in the case of no additives) x 100 ■Results The results are as shown in Table 4, and the transformed strain JMI O
It is clear that JMI O5 (pUTl 8) does not produce any tumor necrosis factor while 5 (pUTHT-1) produces tumor necrosis factor.

Table 4 Furthermore, a small amount of the above bacterial cell extract was analyzed by 5DS-polyacrylamide plate gel electrophoresis according to Laemmli's method. As a result, 2Mi recombinant DNA molecule pUTHT-1
The molecular weight of the expressed protein was approximately 17,000, which was consistent with the calculated value for the polypeptide having the amino acid sequence shown in Table 2 above. Moreover, the production amount reached about 20 to 30% of the protein in the bacterial cell extract.

Example 2 Introducing a specific beat mutation in a test tube using leotide 1) Cloning of human tumor ring cDNA into M13mplO Human tumor necrosis factor expression plasmid (obtained in Example 1-(5)) pUTIIT-1) 60μg of restriction enzyme Ec
.

After digestion with R1 and Hindm, the DNA fragment containing the cDNA encoding human tumor necrosis factor was isolated by agarose gel electrophoresis elution, and a DNA of approximately 0.6 kb was obtained.
Approximately 5 μg of A fragment was obtained. M13mplO phage DNA
0.4 μg was digested with restriction enzymes EcoRI and HindI[I. Using this reaction solution and about 0.2 μg of the human tumor necrosis factor cDNA fragment isolated as described above, both D.
conjugated with NA. By transforming JM105 strain using this reaction solution, recombinant phage mP10-hT
Obtain bacteria infected by NF.

(2) - Preparation of tree tU DNA Recombinant phage mP of JM105 strain obtained in (1)
10- The culture supernatant obtained by culturing hTNF-infected bacteria in YT medium (tryptone 8 g/e, yeast extract 5 g/I!, and sodium chloride 5 g/l) is used as a phage solution.BW313 strain (T, A, Kunkel, Proceedings of the National Academy of Sciences U.S.A., Vol. 82, pp. 488-492 (19
85)] was inoculated into YT medium and cultured at 37°C until the absorbance (660 nm) reached approximately 0.1.

Y containing 25 μg/12 of uridine was collected from the culture solution.
Suspend in T medium, add phage solution to this so that moi=5, and culture at 37°C for 5 hours to obtain a culture supernatant.

400 ttl of PEG/NaC in the above culture supernatant 21n1
l solution (20% polyethylene glycol 6000.2.
5M sodium chloride) and let stand at room temperature for 30 minutes. An equal volume of phenol:chloroform:isoamyl alcohol (25:24:1) mixture is added to this eluate, mixed, and centrifuged to collect the aqueous layer. After repeating this operation, chloroform:isoamyl alcohol (24:
, 1) Extract with a mixed solution. 1/10 volume of 3 M sodium acetate and 3 volumes of ethanol are added to the collected aqueous layer, and the mixture is allowed to stand at -70°C for 15 minutes, and then centrifuged.

The precipitate is washed with 70% ethanol and dried under reduced pressure to obtain 3 μg of recombinant phage mplo-hTNF uridine-containing end-strand DNA.

3'-TCCAGGAGAAGTTCCGGACG
An oligonucleotide consisting of GTCTCCTCT-5' was synthesized and purified according to Example 1-(4)-0, and the terminal was phosphorylated.

0.5 pmol of recombinant phage mplo-hTNF uridine-containing end-strand DNA and 15 pmol of the phosphorylated oligonucleotide obtained above were mixed with 0.2 M Tris-HCl (
1 μl of a solution consisting of pH 7.5), 0.1 M magnesium chloride, 0.5 M sodium chloride, and 0.01 M dithiothreitol was added to bring the total volume to 10 μl. This is mixed, heated at 100° C. for 3 minutes, and then left at 0° C. for 10 minutes to anneal. This was added with 0.02M) lithium-hydrochloric acid (p
H7,5), 0.01M magnesium chloride, 0.01M
Dithiothreitol, 2mM dNTPs, 2mM AT
P, 0.3 units/I! Add 10 μl of a solution consisting of T4 DNA ligase. Furthermore, 2.5 units of Flenow fragment of DNA polymerase I was added and mixed, left at 0°C for 5 minutes, and then reacted at 15°C for 20 hours. This reaction solution was used to transform JMI05 strain, phage DNA was extracted from the resulting infected bacteria, and selection was performed by restriction enzyme digestion and electrophoretic analysis to obtain the desired mutant recombinant phage D. N Amp-DEI, 19 is obtained.

Mutant recombinant phage DN AmplO-DEL1
Approximately 20 μg of 9 was added to the restriction enzymes ECORI and Hind.
III, and a DNA fragment corresponding to about 0.6 Kb is isolated from this reaction solution by agarose gel electrophoresis elution method. The expression vector pUT18 of 50 Mg was digested with EC0RI) (indl'll) in the same manner as above, and the DNA fragment was isolated to obtain a vector DNA of approximately 2.6 kb.
Obtain A fragment. Mix 0.2 μg of each of the above DNAs,
Combine the two. By transforming JMIO5 strain using this reaction solution, &II recombinant JM105 (
pUDEL19) is obtained.

Example 3 TNFD2, TNFD4, TNFD6, TNFD
7, co-DNA sequence of TNFD8 and pU718 obtained in Example 1-(5)
25 μg of DNA was treated with the restriction enzyme EcoRI) (indl
EcoR1% of pUT18 from the reaction mixture digested with lr.
A 2.6 kb HindnI cleavage fragment is isolated by agarose gel electrophoresis elution.

On the other hand, a DNA linker having the following base sequence and structure was prepared as follows.

(+) 3 straight 5' -AATTCCATGGCC
CGGG8-3.

(-) chain 3'-GGTACCGGGCCCCTTC
GA-5'' First, the above (+) chain and (-) chain oligonucleotides were synthesized and purified in the same manner as described in Example 1-(4)-■, and only the (+) chain was phosphorylated. ,
Phosphorylated (+) chain 0.2 μg and (-) chain 0.2 μg, 1
0mM Tris-HCl (pH 7,5), 1mM EDTA
, 10μ! containing 150mM sodium chloride! After heating the buffer solution at 55° C. for 1 hour, it is left to stand at room temperature for annealing to obtain a DNA linker having the above structure.

Next, EcoRI and Hi of pUT18 obtained above
0.3 pg of the ndlll cleavage fragment and the above DNA linker
After binding the two using 0.1 μg of the reaction mixture, Escherichia coli JM105 was transformed with this reaction solution, and Anhu X7 I)
Obtain resistant colonies. Plasmid DNA was prepared from this colony culture and the ATG expression vector pUAT was prepared.
Get G.

3 μg of DNA obtained by digesting 50 Mg of the human tumor necrosis factor expression plasmid (pUTHT-1) described in Example 1-(5) with the restriction enzyme Ec ORI was
Buffer solution 50 consisting of 1IIM Tris-HCl (pH 8,0), 12mM calcium chloride, 12mM magnesium chloride, 600mM sodium chloride, lmM EDTA
Dissolve in μp.

Add 0.25 units of nuclease Ba131, react at 16°C, and after 1 minute add 5 μl of 0.2M EG'TA solution to stop the reaction. This reaction solution is extracted with a mixture of phenolchloroform and isoamyl alcohol, and DNA is recovered from the aqueous layer by ethanol precipitation. 2 μg of the recovered DNA was blunt-ended in the same manner as in Example 1-(4)-0, and recovered by ethanol precipitation.

The blunt-ended DNA was digested with the restriction enzyme HindII and the DNA was recovered.

As described above, 2 μg of a DNA fragment lacking the terminal region of human tumor necrosis factor cDNA is obtained.

30μg of pUATG DNA obtained in (1) was added with restriction enzyme N.
The 2.7 kb NcoI fragment of pUATG DNA is separated and purified from this reaction solution by agarose gel electrophoresis elution method. Obtained DNA10μ
10 μg of the NC0I fragment of pUATG DNA with blunt ends according to Example 1-(4)-① was obtained using 10 μg of the NC0I fragment of pUATG DNA. This DNA was digested with restriction enzyme 1 (indIII), and about 2
．． A 7 kb fragment is isolated.

1 μg of the pUATG-derived DNA fragment obtained in this manner and 1 μg of the DNA fragment obtained in (2) are used to combine both. E. coli JMIO5 was transformed with a portion of the reaction solution, and a plate containing ampicillin (100 μg/ml) (1% trypsin, 0.5% yeast extract, 0.5% sodium chloride, 1.5% agar) was transformed. ), approximately 1200 ampicillin-resistant strains were isolated.

From the ampicillin-resistant strains obtained in this way, a transformed strain containing a recombinant plasmid incorporating a DNA encoding a human tumor necrosis factor-related protein lacking the N-terminal region of human tumor necrosis factor was selected by selecting a transformant strain containing a recombinant plasmid containing a DNA encoding a human tumor necrosis factor-related protein lacking the N-terminal region of human tumor necrosis factor. N of
Single-strand synthetic oligonucleotide complementary to the terminal sequence 5'-TCGGAGTACGAGAAGAAGAC
ATG-3” (hereinafter N not probed) and tumor necrosis factor c
Single-strand synthetic oligonucleotide 5'-CAGGGCAATGATCCCA complementary to the sequence of the C-terminal portion of DNA
-3" (hereinafter referred to as C-unprobe) as a probe. In other words, a recombinant plasmid containing a DNA fragment in which the N-terminal portion of tumor necrosis factor cDNA was deleted did not bind to N-unprobe at all. This can be obtained by selecting colonies that do not bind or bind weakly to C and that bind strongly to unprobed C.

First, the above two types of single-stranded synthetic oligonucleotides, 23
mer and 16mer are synthesized according to Example 1-(4)-〇. These two types of synthetic single-stranded oligonucleotides are labeled with P at their 5' ends using T4 polynucleotide kinase and P-ATP according to Example 2-(3). Next, these two types of 32p-labeled oligonucleotides are A colony hybridization test was performed on 500 of the 1200 ampicillin-resistant strains using nucleotides as probes using the method of Hanahan et al. [Gene, ■, 63 (
(1980)).

From the 500 colonies, 186 transformants were selected that had a recombinant plasmid containing a base sequence that did not bind at all or weakly to the N-unprobe and strongly bound to the C-unprobe. Next, among these transformants, there was no frame shift in the DNA sequence below the ATG start codon, and a transformant having a recombinant plasmid capable of encoding a polypeptide with the N-terminus deleted was selected as a transformant. Example 1-(4)
)-■, screening was carried out using this as an index, and 36 transformants whose cell-free extracts exhibited in vitro cancer cell-toxicity activity were selected.

Furthermore, m-recombinant plasmid DNA was prepared from each of the resulting 36 transformants, and the digested product obtained by digesting these recombinant plasmid DNAs with restriction enzymes EcoRI and pvuII was diluted with 5% polyacrylamide. It was investigated by gel electrophoresis. The degree of deletion near the N-terminus of human tumor necrosis factor cDNA was determined from the chain length of the EC0RI-PvuII DNA fragment, and recombinant JMI O5 (p
ND placement 2), JM105 (ρNDEL4), J
M 105 (pNDEL6), J M 105 (
pNDEL7) and JM105 (pNDEL8) were selected. Next, plasmid DNA was prepared from the culture fluid of these five recombinant strains, and
NDEL4, pNDE+, 6, pNDE17,
It was named pNDEL8. The base sequence of the DNA encoding the N-terminus of these plasmids and the amino acid sequence of the human tumor necrosis factor-related protein encoded thereby are: TNFD2-Met Ser Arg Th
r Pro 5er (N-terminal amino acid sequence of TNFD2) TNFD4 -Met Thr Pro S
er Asp Lys (N-terminal amino acid sequence of TNFD4) (N-terminal amino acid sequence of TNFD6) TNFD7 -Met Asp
Lys Pro Val Ala (TNFD7
N-terminal amino acid sequence of TNFD8-Met Lys Pro Va
l^la 1lis (N-terminal amino acid sequence of TNFD8) pNDEL8 -ATG AAG CCT G
The GMF was determined to be TA GCCCAT by determining the base sequence using the dideoxy method in the same manner as in Example 1-(3).

That is, p N D E +-2 is 2 from the N-terminal Ser to the second Ser of adult μ) type human tumor necrosis factor.
p N D E +, 4 is the N-terminal 4 amino acid sequence deleted, starting from the third Ser.
pNDEL6 is the N-terminal 6 amino acids,
pNDEL7 deleted the N-terminal 7 amino acids, pNDEL8 deleted the N-terminal 8 amino acids, and the third Se
r, 5th Thr, 7th Ser, 8th A
sp, it was confirmed that it started from the 9th Lys.

Example 4 NM819) pUDEL19100 pg was digested with restriction enzyme PvuII, and a DNA fragment of about 2.4 Kb corresponding to about 0.21 Kb was obtained from the reaction solution by agarose gel electrophoresis elution method.
Isolate μg. In addition, 40 μg of pNDEL8 was digested with the restriction enzyme PvulI, and DNA corresponding to approximately 3 kb was extracted from the reaction solution by agarose gel electrophoresis.
Approximately 20 μg of fragment is isolated. pUDEL19th fragment 0.
15 μg and 0.4 μg of pNDEL8 fragment are mixed and the two are combined. By transforming the JM105 strain using the reaction solution, a recombinant JM105 (p
NM819) is obtained.

Example 5 DNA sequence encoding TNFD99 and recombinant plasmid containing this DNA sequence Mutant human tumor necrosis factor in which Cys at position 99 in LΔ-cleaved human tumor necrosis factor was replaced with Ser (abbreviated as TNFD99)
To obtain , use the following method.

First, as a chemically synthesized oligonucleotide, the sequence shown below (
A and B) are synthesized and purified according to Example 1-(4)-〇.

A: AGG GTCACCCTCTTA AGT
GCA ATCAAA AGCCCG TCG CAG
AGG GAG ACCCCA GAG GGCGC
CGAG GCCAAG CCA TGGB
: GAG TCG CTCACCCTTC
TCGAG CTG AAA TACCCCCC
CGAG GTA GAT GGG CTCA
TA CCA TGGCTT GGCCTCGG
After phosphorylating 1 μg each of CA and B DNA according to Example 1-(4)-■, annealing was performed at 60° C. for 30 minutes.

Add dNTPs to this to a level of 100μ and add DNA
Add 4.5 units of polymerase■ (Flenow fragment) and add 3
React for 30 minutes at 37°C in 0 μβ. Thus two t
NDNA extension is performed to obtain double-stranded DNA having the following base sequence.

5'-AGG GTCACCCTCTTA AGT
GCA ATCAAA AGCCCG TC
G CAG AGG GAG ACCCCA
GAG GGCGCCGAG GCC8ΔG
CCA TGG TAT GAG CCCAT
CTACCTCGGG GGG GTA TTT
CAG CTCGAG AAG GGTGA
G CGA CTC-3' Treat the resulting double-stranded DNA with restriction enzymes +44 n c II
Mix with pUc18 DNA digested with and combine with pUc18 DNA.

E. coli JM105 is transformed with the reaction mixture, and a recombinant plasmid containing the double-stranded DNA is selected. This recombinant plasmid DNA was prepared, and this DNA was treated with restriction enzyme Hi.
ncl] and BstE II, and the target DNA fragment (approximately 1 kb) is isolated using a 5% acrylamide gel according to agarose gel electrophoresis elution method.

Next, pUTllT-1 was combined with the restriction enzyme EC0RI) (i
After digestion with ndlI, a DNA fragment of about 0.6 kb was isolated by agarose gel electrophoresis elution to obtain a human tumor necrosis factor cDNA fragment. Further, this DNA fragment is digested with restriction enzymes H3ncfl and BstE II, and DNA fragments of about 0.24 Kb and about 0.25 Kb are isolated using a 5% acrylamide gel according to an agarose gel electrophoresis elution method.

The above approximately 0.11Kb, approximately 0.24Kb and approximately 0.25K
Three DNA fragments of b and restriction enzymes EcoRI and Hind
The mixture was mixed with pU718 DNA digested with 1ll and ligated. Escherichia coli JM105 is transformed with this reaction solution to obtain a Mi recombinant, JM 105 (pTNFf199).

Example 6 Recombinant JM105 (pUD) obtained in Example 2-(4)
EL19) in T medium (1% Bactodributon, 0.5χ
Sodium chloride, 100 μg/- ampicillin) 300
- Culture with shaking at 37C in medium temperature, and when the absorbance (660 nm) reaches 0.3, add IPTG to a final concentration of 0.1 mM, and culture with shaking for an additional 17 hours. The culture solution was then centrifuged (6000 rpm, 15 minutes) to collect the bacterial cells, and then diluted with 50 d of phosphate saline (hereinafter referred to as PBS).
abbreviated as) to turbid. Centrifuge again to remove bacterial cells,
Suspend in 30 bottles of PBS containing 0.111M phenylmethylsulfonyl fluoride. This suspension is subjected to ultrasonication (9000B!, 5 minutes, 0°C), and then centrifuged (10000xg, 1 hour, 4°C) to collect the supernatant to obtain a bacterial cell extract.

(2) Cell elimination activity of TNFD19 grown in the above culture As shown in Table 5 below, JM 105 (pUD
When the cancer cytotoxic activity in the extract of the culture of El, 19) was measured according to Example 1-(4)-■, high cytotoxic activity was observed, and human qM tumor necrosis prisoner-related protein was detected by Escherichia coli JM105. It can be seen that was produced.

Table 5 ■ The bacterial cell extract obtained by separation (1) by ion exchange chromatography was added to Tris-HCl buffer (pH 8,
Add to DEAE-5P column (preparative) equilibrated with 0). After washing the column with the same buffer, remove the adsorbed protein to 0.
Elute and fractionate using a linear concentration gradient of 0.5M sodium chloride. Example 1-(4) Cytotoxic activity of each component was measured.
-Measure according to ■ to obtain the active peak fraction.

■ Separation by gel filtration ■ Concentrate the active fraction obtained by ultrafiltration and equilibrate it with PBS TSK3000 (IIPLc)
Add to column. Perform gel filtration using PBS,
After fractionation, the cytotoxic activity of each fraction is measured, and the active peak fraction is used as a partially purified sample. This yields 7.5 XIO3 units of a partially purified preparation of TNFD19.

Example 7 Recombinant JM105 (pNDE) obtained in Example 3-(3)
L2), JM 105 (pNDEL4), JM
105 (pNDEL6), JM 105 (pND
EL7) and JM 105 (pNDEL8) were cultured in the same manner as described in Example &-(1), and a bacterial cell extract was obtained from each bacterial cell. L in the obtained bacterial cell extract
-Example 1-(4)
) - Measured according to 〇. The results are shown in Table 6 below.

As is clear from this table, high cytotoxic activity was observed in the culture extract, indicating that E. coli JM105 produced H. tlffi tumor necrosis factor-related protein.

Example 8 Production example 4 using positive image JM105 of TNFD819
The recombinant JM 105 (pNM819) obtained in Example 7 was treated in the same manner as in Example 7, and the cytotoxic activity was measured. The results are shown in Table 7 below.

Table 7 Example 9 Production of TNFD99 using positive JM105 The recombinant JM105 (pTNFD99) obtained in Example 5 was treated in the same manner as in Example 7 to measure cytotoxic activity. The results are shown in Table 8 below.

Experimental Example 1 Incubation of animals (experimental method) Partially purified TNFD19 obtained in Example 6 or partially purified recombinant human tumor necrosis factor was added to various pl+ buffers at 1150 ml.
The solution was added to give a protein concentration of about 5 μg/tolerance. This was treated at 0° C. for 6 hours, and the cytotoxic activity of the treatment solution against L-929 cells was measured. O,1 for pH 3,9, pH 5,5
M sodium acetate buffer to pH 7.4, PBS to p
A 0.05M glycine-sodium hydroxide buffer was used for H8.7, pH 10.0.

(Results) TNFD19 showed significantly higher stability than human tumor necrosis factor on the acidic side, and showed stability comparable to human tumor necrosis factor on the neutral and alkaline sides.

Experimental Example 2 Effect of TNFD19 in vivo (experimental method) After intravenously administering 2×10 units of TNFD19 and human tumor necrosis factor obtained in Example 10 to ddy mice,
Fundus blood was collected over time to measure the cytotoxic activity remaining in the serum. The measured values are shown in Table 9 below.

(Results) The half-life of TNFD19 in the blood is 68 minutes, which is significantly longer than that of human tumor necrosis factor (42 minutes), indicating that TNFDi9 has a higher therapeutic effect than human tumor necrosis factor. .

Experimental Example 3 Tumor destruction of TNFD19 Active BAL [103 Me in the abdomen of l/c mice]
thA sarcoma cells are transplanted, and after 7 days the transplanted tumor has a diameter of 7 to 81 I1 m, and mice are selected that have tumors with good blood circulation without hemorrhagic necrosis. The TNFD19 and human tumor necrosis factor obtained in Example 6 were administered to these mice in an amount of 6 x 10' units per mouse, and the necrosis reaction was measured 24 hours later.

The results were as shown in Table 10 below.

Table 10 [Note] The second criterion is as follows.

(-): No change +): Faint hemorrhagic necrosis (++): Moderate hemorrhagic necrosis (From the middle of the graft surface to more than 50%) necrosis) (+++): Significant hemorrhagic necrosis (Severe necrosis in the center of the transplanted cancer, A small amount of surrounding cancer tissue remained situation)

[Brief explanation of drawings]

FIG. 1 shows the construction of high-expression plasmid hector-pUT18. Procedural amendment (method) 1. Indication of the case Patent Application No. 108379 filed in 1988 2. Name of the invention Human tumor necrosis factor-related protein 3. Person making the amendment Relationship to the case Patent applicant postal code 541 Higashi, Osaka City, Osaka Prefecture 3-21 Doshomachi, Ward (295) Tanabe Pharmaceutical Co., Ltd. Representative Keiji Adachi 4 Agent postal code 532 3-16-89-5 Kashima, Yodogawa-ku, Osaka-shi, Osaka Date of amendment order (Japan Patent Office dispatch date) ) July 28, 1986 6, Drawing subject to amendment 7, contents of amendment as per attached sheet

Claims (1)

[Claims] 1. Amino acid sequence [There is an amino acid sequence] [There is an amino acid sequence] (1) Eight elements from the 100th Gln to the 107th Ala from the N-terminus of human tumor necrosis factor Either the amino acid residue of (
2) Either 2 to 8 amino acid residues were deleted from the N-terminal Ser, or (3) 8 amino acid residues from the 100th Gln to the 107th Ala from the N-terminus and 2 to 8 amino acid residues from the N-terminal Ser were deleted. A human tumor necrosis factor-related protein in which 8 to 8 amino acid residues have been deleted, or (4) Cys at position 99 from the N-terminus has been replaced with Ser. 2. DNA encoding the human tumor necrosis factor-related protein according to claim 1. 3. A recombinant plasmid in which the DNA according to claim 2 is integrated into a replicable vector DNA. 4. A host cell transformed with the recombinant plasmid according to claim 3. 5. Cultivating the host cell according to claim 4, producing and accumulating a human tumor necrosis factor-related protein in the culture, and separating the human tumor necrosis factor-related protein from the culture or an extract thereof; A method for producing human tumor necrosis factor-related protein to be recovered.