JPH05507622A - Novel vectors for producing biologically important peptides - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

[Detailed description of the invention] biologically important peptides New vectors to produce Technical field of invention In this patent application, we describe the Escherichia coli (E. coli) enterotoxin Co. We described the construction of a novel secretion vector based on the coding sequence. We know that the toxin gene It is clear that the pre- and pro-regions are absolutely essential for the extracellular secretion of stable toxins. It showed. We also included the nucleotide coding sequence of the heterologous peptide in the st gene. Fuse at the end of the pro region of the gene in an ill frame matching state and the generated vector in the E. coli host contains correctly processed heterologous peptides. We have shown with specific examples that it is secreted extravesicularly. This application further describes this genetic This includes the construction of suitable vectors that can be used together. a) Recombinant DNA technology and b ) with site-directed in vitro mutagenesis A method for creating such fusions has also been described. A general method for purifying heterologous peptides is also included in this application. Described. This novel vector system enables large-scale production and small-scale production of biologically important peptides. Can be used for extravesicular secretion.

BACKGROUND OF THE INVENTION AND PRIOR ART Secreted proteins and many membrane proteins initially carry a signal peptide at their N-terminus. Synthesized as a transitional intracellular preprotein bound to This signal pepti allows the protein to cross the inner membrane barrier. This process The protein is divided into mature proteins that normally reside in the periplasmic space. released.

There are some exceptions to this mechanism; the signal peptides of some membrane proteins are cleaved. (S, Leten-hardt, et al, Prot ein Engineering, Application 1nScience e, Medfcine and Industry, M, Inouye and R , edited by Sharwa, 1986 ^ academic Press, Inc. ,’.

157-171). Some prokaryotic proteins or peptides are signal It is synthesized as a large precursor having a peptide (pre-region) and a pro-region. both sides The fragment is cleaved to produce the mature protein or peptide. For example, dried grass Bacillus 5ubtilis subtilin 219-226) is listed. can be lost. Toxigenic E. coli (ETEC) strains are thermolabile (LT) and thermostable. The production of extracellular toxins, classified as ST-type toxins, is harmful to humans. causing diarrhea (R,N, Greenberg and R,L, Guerrant) (1981).

Pharmacol, Ther,' It, 507-537; Fumoto, D, G11l and M. Woolkalis 1985. Iris 1crobial toxin s and diarrhoeal diseses, C1ba Founda tion symposium 112. Pitman.

London, 57-73). ST toxins have this type, i.e. methanol. methanol-soluble toxins (STI) and methanol-insoluble toxins (STn). S TI is further divided into three groups according to its origin: STh (human), sT It is divided into 5Tb (pig) and 5Tb (cow). For both LT and ST The genes for this are also encoded on plasmids. ST gene nucleotides The sequence is shown in Fig. 1 (P.

Dwarakanath et al, 1989. Gene 81. 219 -221) o 72 amino acids from the nucleotide sequence and translated amino acid sequence The acid peptide is the precursor of ST, which is post-translationally processed to form the carboxy-terminus. It is concluded that the end releases a 19 amino acid peptide as a bioactive toxin (P.

Dwarakanath et al, 1989. Gene, 81. 219 -226).

The “signature” of naturally secreted proteins is used to construct recombinant vectors that secrete heterologous proteins. Many groups have attempted to utilize the "null array" part.In many cases, Synthetic signal sequences are also utilized in some cases. In all these cases, recombinantly produced The substance is localized within the supracellular fraction. A specific example is: Gray et. In Nili's patent (U.S. Pat. No. 4.755.465, July 5, 1988) The inventors have demonstrated positive results in E. coli and Pseudomonas. A vector that promotes secretion of properly processed human growth hormone (hG) I) The company is said to have built a The “signal sequence” included in the patent claim is E. coli It is very different from the stable toxin “signal sequence.”

Il, Itakura et al.'s second patent (U.S. Pat. No. 4,704.36) 2, November 3, 1987), the fusion product of β-gal and somatosfutin microorganisms that are produced and then processed in vitro to give the final product. A recombinant cloning vehicle for expressing a product polypeptide is described.

One example where an enterotoxin signal sequence is specifically used is Gray et al. No. 4,680,262 (1985), in which the inventors et al. developed a methanol-insoluble stable toxin (STn) “signal sequence” into human growth hormone. mon (hG■) gene and localizes the product to the periplasmic region of the host cell. made it exist. Interestingly, the inventors specifically expressed recombinant proteins. It uses an expression vehicle that localizes intracellularly. The 5tII signal sequence is stl It bears no resemblance to the signal sequence and is therefore considered a different structure.

In this patent application, the inventors utilize both the pre and pro areas of STI. The nucleotide sequence encoding the peptide is decoded at the end of the pro region using A recombinant vehicle was created that was fused in frame. As a result of the expression of all genes, the set The modified peptide was secreted extracellularly and it was processed correctly. this A schematic diagram of the principle is shown below: The advantage of this system is that the cells that have taken up the recombinant vector can grow in a synthetic medium. Therefore, the secreted peptides constitute the main peptides present in the culture filtrate. Purification of recombinant products is greatly simplified. Such recombinant heterologous peptides A general method for the purification of de(angiotensin I) is described herein.

overview Pre- and pro-E. coli StI genes of the human variety region to ensure that both peptides are properly processed and distributed outside the cell. A new recombinant vector was constructed to secrete This process This is done by fusing the coding sequences. Such recombinant peptides are herein A general method for purifying Tido is described.

The present invention is summarized as follows: 1. Vector for secretion of heterologous proteins. MKKSILMIFLS (when written with a - character code) for computer development VLSFSPFAQDAKPVESS[El[ITKES8CNIAKKSNK Methods of using the E. coli st presilo sequence encoding SGPESII.

2. Vector pARC01 old, writing number NCTB 40115゜3, Section 2 listed E. coli host containing the vector pARC0101.

4. pARC0101 described in Section 2 for constructing an expression vector for a heterologous protein How to use.

5. A vector containing the E. coli st prescillo sequence described in item 1.

6. Baa+HI-Hindm sequence of E. coli st Brecillo sequence described in item 1 The vector according to item 5, which contains the vector.

7. An E. coli host containing the vector according to any one of paragraphs 5 and 6.

8. The E. coli host described in paragraph 7 is grown by standard methods and the protein of interest is grown. heterologous protein in E. coli by isolating the product by standard methods. manufacturing method.

9. The method according to item 8, wherein the protein product is secreted extracellularly.

10. Angiotensin! E. coli fused in frame-matched coding sequence Construct pARC0726° containing the st Brescillo sequence 11. Construct pARC0 according to item 11 for expressing angiotensin I How to use 726.

12, an E. coli host containing the construct pARC0726 according to paragraph 10.

13. Growing the E. coli host described in paragraph 12 and isolating the protein product of interest. A method for producing angiotensin I, comprising the steps of:

14. The method according to paragraph 13, wherein the protein product is secreted extracellularly.

15, created by using an alternative codon for 5er55 of the mature ST peptide. Construct pARC0801° containing an internal EcoRI site was created. 16. Transfer the heterologous or homologous gene sequence to the EcoR1 site of the pARC0801 construct. Clause 15 as a starting material for producing a second construct by fusing with Methods of using the first construct pARC0801 described above.

17. E. coli st prescillo sequence 11KKsILMIFLsVLSFSPFAQ DAKPVESSKEKITKESKKCNI ＾KKSNKSGPESII Facilitates the secretion of heterologous proteins expressed in host cells, including DNA encoding A vector that can be

18. The fifth molecule fused to the DNA encoding the target protein in an open reading frame-matched state. A construct consisting of the vector described in item 6 or 17.

19. The construct according to item 18, wherein the DNA encodes angiotensin I.

20. The construct according to item 18, wherein the DNA encodes insulin A chain.

21. The construct according to item 18, wherein the DNA encodes insulin B chain.

22. E. coli st fused in open reading frame alignment with the insulin A chain coding sequence Construct pARC0726° containing the presillo sequence 23. E. coli st fused in open reading frame alignment with the insulin B chain coding sequence Construct pARC0726° containing the Brecillo sequence 24. An E. coli host containing the vector or construct described in the preceding sections.

25. Growing the E. coli host described in Section 24 and isolating the expressed protein. A method for producing a protein heterologous to Escherichia coli, comprising:

26. The method according to item 25, wherein the protein is secreted extracellularly.

27. The method according to paragraph 25 or 26, wherein angiotensin ① is isolated.

28. The method according to paragraph 25 or 26, wherein insulin chain A is isolated.

29. The method according to paragraph 25 or 26, wherein insulin chain B is isolated.

30, DNA encoding the protein to be expressed in any of items 1 to 11 consisting of fusing in open reading frame alignment with the E. coli st presillo sequence described in , a method for facilitating secretion from a host cell of a protein expressed in the host cell.

31. By fusing the sequence of interest into the EcoRI site of the pARC0801 construct. How to form a construct consisting of:

detailed description of the invention Identification and cloning of the human species E. coli stI gene by P. Dwarakan. detailed in ath et al. (1989, Gene, 81. 219-226). It is. Briefly, a plasmid of about 10 [MDa] containing the st gene is It was identified in E. coli strain 86cal.

Baa■■ library of 10011Da plasmid of E. coli 86cal is pB l? 322, and the st gene-containing clone was used as a DNA probe hive. Identified by redization.

This st gene was further added to M13mp19 with BamHI-HlndI[I fragment. and the complete fragment was sequenced by Sanger method. .

st gene transcription reading frame (open reading frame; O1? A part of the sequence containing F) is shown in Fig. 1. ORF encoded pepti The carboxy-terminal 19aa of the peptide corresponds to the sequence of the STh peptide (Aimot o et Nili 1982.　Eur, J., Biochem.

129, 257-263), 4 nucleotides preceding the start codon, a putative Sequences suggestive of liposome binding sites can be identified. Coding sequence followed by a pair a stop codon (TAA) and a bisymmetrical (dyad) possibly indicating a transcription stop signal. A 15 nucleotide stretch with sya+l1etry) follows. ORF is It encodes a 72 amino acid peptide, of which 19 amino acids have the carboxy terminus. It is a biologically active peptide. The N-terminal 19 or 20 amino acid stretch Two basic residues following the ether methionine [Lys2, Lys3], Consensus sequences for hydrophobic amino acid stretches and signal breakpoints constitutes a signal peptide with

The exact cleavage point of the signal peptide from the pro ST region is unknown. Professional The ST region extends to Met53, where it is finally cleaved to form Asn54. The N-terminus of the mature peptide yields a biologically active peptide that is secreted outside the cell.

The STh concentration in the culture medium was evaluated using a competitive ELISA method. This ELI SA performed routines throughout this study to assess STh levels in the culture medium. Used for chin. Overexpression of the st gene is achieved by converting the gene fragment into a T7 promoter-containing This was done by subcloning into a vector. In such an overexpression system Overexpression is induced by the inducer IPTG (isopropylthiogalactin). (Toside) Purification of ST peptide (wild type/mutant) The team is P, Dwarakanath et al (1989; Gene 81.219--Misaki Koyo Ikkyou-1-11■-■----■■■■■■--226) The method described by was followed. Amino acid sequence analysis of peptides is available at ^pplie d　Biosystem＾m1no　Ac1d　5equence　Anal yser (model 477A). Standard method (Das et al. 1989. Proc, Natl, Acad, Sci, U, S, ^, 8 6°496-499) using in vitro site-directed mutagenesis. to generate mutations in the pro region and mature region of the toxin peptide coding sequence. Ta. Similarly, by in vitro site-directed mutagenesis, the complete mature ST Petido coding region to angiotensin ■ (^ngI) coding sequence The secretion of oral GL was monitored by radioimmunoassay (RIA). I tarred. The results are described in the experimental data section.

STh was an ETEC colon that was shown to have taken up a 100 MDa plasmid. It was detected in the culture supernatant of 86 cal of bacterial isolate. Escherichia coli 86 BawHI library of 10011 Da plasmid of cal in pBR322. and recombinant clones were checked for the st gene. those groups One of the recombinant clones contained the st gene as a 1.9 Kb BatmHI fragment (pA I'1c074). Obtained from pARC074 Cloned the IKb BamHI-Hindl[I fragment into pBR322. Plasmid pAI? c0101 was obtained. This plasmid pARC01 01 is the starting material for all further experiments. This plasmid is part of the Budapest Treaty. National Co11e-ction of Industry l Bacteria, Aberdeen, Scotland (MCI8 The date of deposit is February 15, 1989. p The culture supernatant of E. coli HB101 containing ARC0101 was used in young mice. Elicit a positive biological response for ST.

Construction of M13mp19ss DNA7 y-di containing I [, st insert 1, IKb BamHI-Hindl containing the gene [[The fragment was pARCo isolated from lol. M1 cut with Baa+HI and Ilindm 3mp19RF. recombinant replicative forv ; RF) was transformed into JM 101, and X-Ga1 and Plated in the presence of IPTG. The white plaque of the transformant was linked to the st gene. and one such phage clone was designated φ192. (Fig. 2), and when grown in Iml1, the culture supernatant release stable toxins inside. φ192 has all described in vitro mutations It is the starting material for induction experiments.

φ192 or its mutants were grown in JM 101 and grown in standard Sumid purification protocol (T, Maniatis1, 198211o1 ecular Cloning, A Laboratory Manual.

Co1d Spring Harbor Laboratory, Cade After overnight growth of the bacteria according to Spring Harbor, NY) RF was isolated. 1. Isolate the BaIIll-Hindl fragment of IKb and T7 such that its promoter is oriented in the same direction as the transcription direction of the st gene. Subcloned as a BataHI-Hindm fragment into a promoter-containing vector. It became. The overexpression plasmid containing the wild-type st gene was designated pARC0601. (Fig. 3).

■Example demonstrating the indispensability of the professional domain for extracellular secretion To demonstrate that the pro-region is essential for Two localized st gene mutants were created. In the first example, the process The φ Met53 was changed to l1e53 using 192 as a template. create this change It was used for suno. This primer (GD21) was annealed to the template and Extended in the presence of Sequenase and four types of dNTPs. Ta. The extended strands were ligated using 74 DNA ligase and this in vitro synthesis JMIOI was transformed using the double-stranded DNA. DN transformant plaques A-sequencing was performed and mutant clones were identified. one Such a mutant clone (φGD21) was plaque purified and experimental data subcloned into overexpression vectors by the method outlined in section ■ of the data. It became. The obtained plasmid pARC0701 was used to transform E. coli HBIOI. Converted. - The production of extracellular ST (M53→■53) in the night culture was Comparisons were made with that of pARC0601 grown in B101. The results are shown below: Plasmid ST generation in HBOI (unit lIg/mari pARC06017 pARC07011 This experiment demonstrated that a conservative change in the pro region (ile53→l1e53) is a stable toxin. It was shown to reduce secretion levels by more than 85%.

Construction of an st deletion mutant in which the deletion extends from Set4g to 5er52 in the pro region Then, the attenuation of STh secretion was more obvious. The experimental protocol is Mutagenic primers the same as those described in the section, but used is the sequence 5'GCAAA^^AAAGTAATA^^ATGAATAGTAGC^ ＾T　T　A　C3' (GD-11). Kono mutation st (Del , 5er48-Ser52) containing overexpression plasmid was designated pARC0702. called. When this plasmid was propagated in IIBIOI, the resulting clone was It did not produce any detectable extracellular ST. Therefore these examples (let-” 11e53 and Del, 5et48-+5er52), the extracellular STh fraction It was clearly shown that secretion requires the presence of a complete professional region.

ST peptide N-terminal residue for ST peptide processing and extracellular secretion Two mutants of st were created to examine the effects of this group. In the first example, STh^5h5 while strictly following the method described in the experimental data section ■. 4 was changed to G1n54. The mutagenic primer is 5'GAAAA G CA T G CA G A G T A G CA A T 3’(＾T T-CAG). Containing mutation st Ash54-”G1n54 The overexpression plasmid was designated pARC0732. This plasmid is large pARC0 when grown in S. enterica HBIOI or overexpression strain BL21-DEa. those produced by strains HBIOI or BL21-DE3 incorporating 601 produced an equivalent amount of extracellular toxin. Mutant ST secreted extracellularly (^5 h54→G1n54) to determine the processing site of the mutated gene. and essentially P, Dwarakanath et + (1 989, Gene 81.219-226). Tido was purified. The FIPLC purification profile is shown in Fig. 4. This pep The N-terminal sequence of Tide is Gln-3er-3er-^5n-Tyr. .

Another similar experiment was performed in which ^5h54 of STh was changed to His54. sudden change The resulting plasmid containing the different st was designated pARC0716. st Ash After overexpression of 54→l1e54 and peptide purification, determine the N-terminus of the peptide did. The sequence data is (1) His-Ser-3er-Asn-Tyr---o and (2) Ser-3er-^5n-Tyr...2 having the N-terminal sequence showed the presence of two peptides. Fi the HPLC purification profile of this peptide. g, shown in 5.

These examples demonstrate that the N-terminus (Ash54) of the STh peptide is involved in post-translational processing and clearly demonstrate that it is not important for secretion of the peptide and its peptides.

■Example demonstrating the versatility of secretion vectors based on stable toxins Secretion vectors based on st To test the versatility of mature ST peptides (i.e. Ash54-Tyr7 2) was inserted into the angiotensin I code in the st gene. Replaced with the ding sequence. Angiotensin I is produced by renin protease. IOmer peptide converted from the larger precursor angiotensinogen It is. Angiotensin ■ furthermore has the last two cals of angiotensin I. “Angiotensin convertase that deletes the boxyl terminal residue (His-Leu)” ” to produce angiotensin■.Angiotensin■ is a powerful It is known to be a vasoconstrictor. ST cocoding sequence in st gene The substitution of Ang I coding sequence by the Kunkel method (T, A, Kunk el, 1985 Proc, Natl.

Acad, Sci, USA 82.488-492) with some modifications. It was. 5’ GTGGTCCTGAAAGCATGGACCGGGTGTACA TACACCCCTTCCACCTCTTAAT^^T A T A A A A A mutagenic primer (GD9) with the sequence G G G 3' was combined. accomplished. This 62-mer primer was amplified with CJ236 ss0192D N^ Annealed to the template. The annealing reaction temperature was 55°C. −times opposite The amount of template used for this application was 31g, while the primers used were Long. It was. After annealing, the extension reaction was carried out using 8 units of sequenase and four different 4 hours at 37°C in the presence of dNTPs (the final concentration of each dNTP was 1 μl). Ivy. The extension reaction mixture also contains 4 Contains 1 unit of T4 DNA ligase. Using this complex, E. coli J. MIOI was transformed and putative clones were identified by DNA sequencing. . Ang I coding sequence concatenated st subcloned into overexpression plasmid and the plasmid was designated pARC0726. This plasmid is When grown in BIOI or overexpression strain BL21-DE3, plasmid-carrying The strain produced the ^ngI peptide extracellularly, which was detected by RIA. pARC0 After overexpression of 726 in BL21-DEa in M9 medium, the peptide was Purified for sequencing.

The purification scheme will be described later. This purification scheme is general for other peptides. It seems that it can be applied to

BL21-DE3 cells containing pARC0726 were grown in M9 medium (250 l× 4) Grown inside. When the culture solution reaches A600tv=0.86, IP Cells were induced by the addition of TG (final concentration 0.5 mm). 2.5 hours from induction After that time, cells were collected and 410 ml of culture supernatant was added to ^mberliteX for 3 h. It was mixed with AD-4 and left at room temperature overnight. After washing the resin thoroughly with water, bind the peptide. Elute with 99% ethanol 71% acetic acid, then 80% ethanol 71% acetic acid. Ta. The eluate was concentrated by flash evaporation and the concentrate was SP 5ephadex C pre-equilibrated with sphate buffer (pH 6,4) -25 column (1011A'). Prior to elution, the column was washed with water. . Elution was performed using 50-triethylamine. Adjust the pH of the eluate with acetic acid. It was set at 6.0. The eluate was lyophilized and the dry powder was reconstituted in 1/1 volume of water. accomplished. The preparation was subjected to HPLC on an RP-8 column using an acetonitrile gradient. [Solvent A: 0.1% TFA, Solvent B: 0.1% TFA/95% acetonyl] Trill: Flow rate 1/min. The gradient was 10-50% B in 40 minutes].

The ^ngI peak was detected at 29% B (Fig. 6).

The purified peptide was sequenced and the sequence was confirmed using the native sequence.

This example shows that a completely heterologous peptide coding sequence can be linked to the st pro region. , and after propagation of such constructs in a suitable E. coli host, properly processed We have clearly demonstrated that peptides can be detected extracellularly and are suitable for Ronin. Introduction of a coding site into the mature peptide coding region can be performed as follows. Controlled: Controlled within or in close proximity to the mature peptide-coding region. To introduce the restriction site, D representing the amino acid sequence of Met53 to 5er55. Select NA stretch 5' ATGAATA G T 3'. 5er55 code By changing the nucleotide sequence of the amino acid codon (AGT) to the alternative codon TCT, We were able to create an EcoRI site without changing the amino acid residues. Shown below: Met53 Asn54 5er55 ATG AAT TCT EcoR1 site Mutations are induced in the single-stranded (ss) φ192 ONA template by the method described above.

The mutagenic primer (GD13) had the same nucleotide sequence. Heterogeneous This EcaR serves as a suitable site for insertion of protein and peptide coding sequences. One site can be used to construct a universal overexpression vector system. Overexpression pla Cut pET7 with EcoRI and BaFII and isolate the large fragment. Ru. φ192(GD13)RF was isolated and incubated with BamHI and EcoRI. disconnect. After CIP (calf intestinal phosphatase) treatment of the digestion products, 620 bp Isolate the fragments. This fragment is ligated with the large fragment of pE77. The resulting recombinant plastic Sumido as ρAI? Name it C0801.

Plasmid pARC0801 is licensed under the Budapest Treaty as a Nati-onal C o11ection of Industrial and Marine B acteria.

Deposited in Aberdeen, 5cotland as NCIIIB 40417. It is. The date of deposit is April 29, 1991.

(Fig, 7) This plasmid can be used as a general-purpose secretion vector. Ru. Any heterologous peptide or protein such as angiotensin 11 bovine Coding of peptides such as fibroblast growth factor (bFGF) and insulin Sequences can also be inserted into the EcoR1 site (insertion site).

When this plasmid is expressed in an E. coli host, the peptide or protein is Secreted into purifiable medium. Peptides produced from this recombinant plasmid will have one additional amino acid residue (Set) at its amino terminus. It should be noted that

Angiotensin! In particular, the ability to produce insulin is an important aspect of the present invention. This is an important aspect. Purified insulin A chain and insulin B chain are used for the production of insulin. It can be used for.

The following example demonstrates the versatility of secretion vectors based on stable toxins. Hitoi Thunsulin consists of two polypeptide chains A (21 amino acids) connected through SH bonds. (residues) and B (30 amino acid residues). These Kabura are in- can be separated in vitro by reduction and obtain the A and B chains in pure form. Ru. Under appropriate conditions, purified A and B chains can be reoxidized to produce immunoreactive biological activity. Human insulin can be formed. Human insulin A and B chain genes The sequences were fused separately to the end of the ST Brecillo sequence. actively growing E. coli host The recombinant plasmid incorporated into the cell shows immunoreactivity with human insulin antibodies. The substance was secreted into the medium. The human insulin antibody is combined with authentic insulin A and When incubated with B chain, recombinant A and B chains were expected to be produced. was competitively inhibited in each case, which was expected. It shows that the product was produced in each case. Recombinant plasmid experiment Data was constructed using a method similar to that described in ■. l113mp19 Based on the first round of mutagenesis, recombinant phage DNA (φGD24) was It was used as a mold for φGD24 clones the ST gene with M13ptq multiple cloning. It was inserted as a BamHI-tlindm fragment into the coding site. this particular The ST insert places ^5n54 into GIY54 at the N-terminal end of the mature toxin peptide. It had a missense mutation that caused the change. To introduce the first round of mutations The mutagenic primers used were 5' CCTGAAAGCATGGGTATCGTGGAGCAGTGCTGT ACATCTATCTGCTCACTGTATTAAT＾＾T　AT　A　A It had the nucleotide sequence A3'.

This mutagenesis results in a DN corresponding to the N-terminal 1-14 residues of the insulin A chain. Phage φGD26, in which the A sequence is fused with the ST Brecillo region in an open reading frame-matched state, is Obtained. GD26 DNA was used as a template for the second round of mutagenesis.

Mutagenic primers are 5'　TGCTCACTGTATCAGCTAGAGAACTACTGCAAC It had the nucleotide sequence TAATAATATAA^3'.

After mutagenesis, the complete A chain gene was inserted into the C-terminal section of the ST presilo region. A fused GD28 was identified.

In short, two rounds of mutagenesis resulted in complete deletion of the insulin A chain gene. The cleotide sequence is fused to the 3' end of the ST Brecillo sequence in open reading frame alignment; and thereby completely replaced the mature toxin gene sequence. However, ST The remainder of the 3' end sequence of the gene was kept intact in the final construct. The recombinant fiber GD28 was grown in JMIO1 and RF was isolated. The RF is Ba Cut with 5HI-Hindm and 1. 1Kb fragment into pET7 with BatHI -tlindln fragment was cloned to obtain pARC0750. excessive firing The current E. coli strain BL21-DE3 was transformed with pARC0750. Similarly, The insulin B chain was also synthesized and fused to the 3' end of the ST Brecillo region. first casting The mold used was GD23 having an ST insert N54F. First mutagenesis plate The nucleotide sequence of the primer is 5’　GGTCCTGAAAGCATGTTTGTGAATCAGCATCTT TGCGGAAGTCATCTGGTTGAGGCTCTTTATTAATAA After TAT mutagenesis, the DNA sequence corresponding to insulin B chain residues 1-16 was Mutant clones fused to ST prescillo sequences in open reading frame alignment were identified. (φGD32). φGD32 ss as template for second round mutagenesis I used DNA. The nucleotide sequence of the mutagenic primer is 5’ GTTGAGGCTCTTTATCTTGTATGTGGTG ＾ ＾ CGTGGTTTCTTCTATAC＾CCT＾＾＾GACATAAT＾ ＾　TATA　＾　＾　GGG3′ Met.

After mutagenesis, the complete B chain gene sequence is fused to the 3' end of the ST Brecillo sequence. The mutant phage φGD33 was isolated. This fusion gene insert is φGD 33 as a BamHI-Hindm fragment and subcloned into pET7. pARC0759 was obtained. E. coli overexpression strain BL21-DE3 was pA RC0759 and transformed clones were tested for the presence or absence of the plasmid. Screened. Clones pARC0750 and pARC0759 are Culture supernatants were tested directly to test whether they secreted A and B chains, respectively. We have developed an ELISA method that allows The essential features of this EIJSA method are as follows: Human insulin was purchased from Novo Industries. it is high purity This was confirmed by reverse phase HPLC analysis. Alifort's This pure insulin was quantitatively reduced with DTT and then converted using iodoacetamide. Ruboxyamidation formed stable A and B chains. produced against human insulin Direct ELIS^ and inhibition for A and B chain detection using engineered antibodies The formula ELIS^ was developed. pARC0750 and pARC0750 in the BL21-DE3 host AI? c0759 was grown separately in M9 medium and grown as described in the previous example ( Induced with IPTG. After induction, the culture was centrifuged and the supernatant was separated from A and B chains. We checked for the presence or absence of A and B chains evaluated by direct ELIS^ The yield is approximately 16μg/iris each! and 30 pv/ml. Inhibition type EL ISA tests also confirmed quantitative evaluation or secretion levels of A and B chains, respectively.

The subject matter contained in each of the following claims should be read as part of the detailed description of the invention. Should.

220ro++ absorbance CH3CN (%) Retention time (min) ST (N54→H54) Peptide Purification C> 220nm absorbance Summary book In this patent application, we based on the E. coli enterotoxin coding sequence The construction of a novel secretion vector was described. We believe that the extracellular secretion of stable toxins involves the toxin residue. It has been clearly shown that a lack of communication and a professional field are absolutely necessary. Also We added nucleotides encoding the heterologous peptide sequence to the progenitor of the st gene. If fused to the end of the region in open reading frame alignment, the generated vector in the E. coli host will be correctly generated. With specific examples showing the secretion of processed heterologous peptides to the outside of the cell. Indicated. This application also encompasses the construction of suitable vectors capable of making this gene fusion. do. Furthermore, a) recombinant DNA techniques and b) site-directed in vitro mutagenesis A general method for creating such fusions involving the use of alloinduction is also described. . This application also describes a general method for purifying heterologous peptides.

This novel vector system can be used for overproduction and extracellular secretion of biologically important peptides. Can be used.

Submission of translation of written amendment (Article 184-8 of the Patent Law) December 14, 1992

Claims (30)

[Claims] 1. Code for [there is a sequence] which is the E. coli st play pro sequence. Facilitates the secretion of heterologous proteins expressed in host cells containing DNA that Vector that can. 2. BamHI-HindIII sequence of E. coli st prey sequence according to claim 1. 2. The vector according to claim 1, which contains the vector. 3. Vector pARC 0101, accession number NCIB 40115. 4. A DNA that is fused to the DNA encoding the target protein in an open reading frame consistent state. A construct comprising a vector according to any of the claims. 5. 5. The construct according to claim 4, wherein the DNA encodes angiotensin I. 6. 5. The construct of claim 4, wherein the DNA encodes insulin A chain. 7. 5. The construct of claim 4, wherein the DNA encodes insulin B chain. 8. E. coli fused with angiotensin I coding sequence in reading frame alignment Construct pARC0726 containing the st prepro sequence. 9. E. coli st fused to the insulin chain A coding sequence in open reading frame alignment. Construct pARC0726 containing the prepro sequence. 10. E. coli s fused to the insulin chain B coding sequence in open reading frame alignment. Construct pARC0726 containing the tprepro sequence. 11. The above request is made substantially as set forth above with reference to the experimental data and drawings. A vector or construct according to any of the claims. 12. E. coli containing a vector or construct according to any of the above claims host. 13. Growing the E. coli host of claim 12 and isolating the expressed protein. A method for producing a protein heterologous to Escherichia coli, comprising the steps of: 14. 14. The method according to claim 13, wherein the protein is secreted extracellularly. 15. 15. The method according to claim 13 or 14, wherein angiotensin I is isolated. 16. 15. The method according to claim 13 or 14, wherein insulin chain A is isolated. 17. 15. The method according to claim 13 or 14, wherein insulin chain B is isolated. 18. Claim 13 substantially as hereinbefore described with reference to the experimental data and drawings 18. The method according to any one of 17 to 17. 19. Any of claims 1 to 11, wherein the DNA encoding the protein to be expressed is It is constructed by fusing in open reading frame alignment with the E. coli st playpro sequence described in A method for facilitating secretion of a protein expressed in a host cell from the host cell. 20. Claim 19 substantially as hereinbefore described with reference to the experimental data and drawings. Method described. 21. Contains the complete E. coli st gene sequence and contains Ser5 of the mature ST peptide. Contains an internal EcoRI site created by using an alternative codon for 5. Construct pARC0801 with pARC0801. 22. Fusing the sequence of interest to the EcoRI site of the pARC 0801 construct A method of forming a construct consisting of. 23. Claim 22 substantially as hereinbefore described with reference to the experimental data and drawings. Method described. 24. [Sequence available] code for developing vectors for secreting heterologous proteins. How to use the E. coli st plate pro sequence. 25. Vector pARC 0101 for constructing expression vectors for heterologous proteins , deposit number NCIB 40115, how to use it. 26. Angiotensin I codein for expressing angiotensin I A construct containing the E. coli st playpro sequence fused in frame alignment with the sequence How to use pARC0726. 27. Contains the complete E. coli st gene sequence and Ser55 of the mature ST peptide Contains an internal EcoRI site created by using alternative codons for Eco of the pARC 0801 construct of the first construct pARC 0801 Producing a second construct by fusing a heterologous or homologous gene sequence to the RI site. How to use it as a starting material for 28. Insulin chain A coding sequence for expressing insulin chain A Construct pARC containing the E. coli st prepro sequence fused with a reading frame matching flag. How to use 0726. 29. Insulin chain B coding sequence for expressing insulin chain B Construct pARC containing E. coli st playpro sequences fused in open reading frame alignment. How to use 0726. 30. Construct pARC 0801, accession number NCIMB 40417.