JPH04501204A - Methods for stabilizing heterologous protein expression and vectors used therein - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

[Detailed description of the invention] The present invention generally relates to methods for stabilizing heterologous protein expression and methods for use therein. Concerning the field of physical engineering. In particular, the present invention provides protein expression and Recombinant DNA for increasing the yield of mammalian polypeptides that are not well expressed in Concerning the field of technology.

Oimuyu! look Many eukaryotic proteins are expressed in measurable yields in E. coli. foreign proteins by the host, and even if detectable, It cannot be expressed at commercial recovery levels due to degradation. Small protein (e.g. C. Peptide hormones (with less than 100 amino acids) seem to be particularly sensitive to degradation. Ru. The degree of proteolysis varies depending on the host and protein. E, c The highest possible expression level of eukaryotic proteins in olt is Therefore, it was observed that it was expressed in about 60% of all cellular proteins. eukaryotic protein Achieving high expression levels of is rare. Because in cells, they Collectively, they are called inclusion bodies or refractite bodies. (For example, bovine growth hormone G5 Choner et al. (1985), Bioteeth bile u3:15L-154) o In such a form, eukaryotic proteins are difficult to degrade.

In the body, even though proteins do not become insoluble, other proteins such as prokaryotic proteins When combined with Pak, it may form inclusion bodies. A small number of prokaryotic proteins are For example, E. coli 1acZ, mE, and re cA gene and λ211 gene.

Chloramphenicol acetyltransferase (CAT) is a selectable eukaryotic cells from different promoters (chloramphenicol resistance). is easily assayed to monitor the efficacy of expression in cells and prokaryotic cells. Enzyme (Delegeane, A. M. et al. (1987) Mol Ce1l Biol 7:3994-4002), regulatory sequences and/or liposomes. The mature protein is used as a protein binding site, as well as eukaryotic protein-encoding sequences. The nucleotide sequence encoding natural CAT (Buckley and Hayashi (1986) Mol Gen Genet 204:120-125; 1 (European Patent Application Publication No. 161.937, published November 21, 985) is a moiety that binds to the carboxy-terminal fragment of CAT (which usually retains CAT activity). Used for gene fusion.

In the literature, fusion proteins are useful for expressing heterologous proteins in bacteria, and It has been described that the natural CAT gene sequence is used for such purposes. However, amyloid protein A4-751 insertion sequence, glucagon-like peptide 11 Adipsin/D and other species such as pulmonary surfactants 5P-B and spc To express mammalian proteins at recoverable yields or to increase their yields, There is no record of any attempt made to use CAT in the form of a form. many important proteins that are not very well expressed in bacteria in commercially recoverable yields. Considering the fact that bacterial expression and recovery of such proteins cannot be It is necessary to develop a system for

i child One aspect of the invention stabilizes heterologous protein expression in prokaryotic hosts, including: Regarding the method: (a) Amyloid protein A4-751 insertion sequence, glucagon-like peptide, a Gypsin/D, lung surfactant protein 5P-B and lung surfactant protein 5p-c a heterologous gene sequence and sequence encoding a mammalian polypeptide selected from the group consisting of 3'-truncated chloramphenicol acetyl fused within the frame transferase (CAT) gene sequence of CAT gene and heterologous gene. constructing a hybrid gene comprising the polypeptide in sequence; conditions, which cannot be recovered in bacterial expression systems and, upon translation, the high The BRID gene produces the fusion protein in recoverable yield; (b) providing a vector for the expression of said hybrid gene; (C) culturing the prokaryotic host transformed by the expression vector; Beauty (d) recovering the fusion protein;

A second aspect of the invention provides non-stable, bacterially produced heterologous polypeptides. The present invention relates to a bacterial expression vector capable of increasing the expression level of. This expression vector - amyloid protein A4-751 insertion sequence, glucagon-like peptide ■, a Gypsin/D, lung surfactant protein 5P-B and lung surfactant protein 5p-c a heterologous gene sequence encoding a mammalian polypeptide selected from the group consisting of The 3'-truncated CAT gene sequence fused within the CAT gene frame and a heterologous gene (wherein the polypeptide under normal conditions cannot be recovered in bacterial expression systems), thereby The truncated CAT gene sequence allows the resulting fusion protein to be digested with proteolytic enzymes. It is possible to make it resistant to solutions.

In preferred embodiments of the methods and vectors of the invention, up to 180 amino acids , preferably using CAT encoding an amino acid sequence between 73 and 180. do. The resulting CAT protein is substantially reduced compared to native CAT protein However, surprisingly, the truncated form of the CAT protein was substantially contributes to the quality and thus recovers the desired heterologous protein with increased yield It has been discovered that this is possible.

In other aspects of the invention, non-stable, bacterially produced heterologous polypeptides Improved bacterial expression vectors are provided that are capable of increasing expression levels.

Here, the vector has a modified 3'-truncated form linked to a heterologous gene sequence. A hybrid containing the CAT gene sequence in the order of the CAT gene and the heterologous gene. Contains genes. This improved vector addresses potential chemical cleavages within the CAT protein. One or more DNA copies of the truncated CAT gene to remove the cleft site. Including converting don.

Other aspects of the invention will be apparent to those skilled in the art from the following description and examples.

Two iΔ! Hoshiku Seyuyu Figure 1 shows the endoproteinase Glu-C protease containing the cleavage site. 41 amino acids (aa) CAT-hANP hybrid protein The amino acids and corresponding nucleotide sequences are shown. This hybrid protein The amino terminal encodes the first 210 amino acids of CAT, and its sequence is Mentioned throughout the invention.

Figure 2 shows the cloning and CAT-hANF hybrid protein of the present invention. A series of vectors and synthetic fragments used for expression and expression are shown. Figure 2A shows E, colt m promoter operator description, liposome binding site and downstream The EcoRI-Pst1 synthetic fragment containing the cloning site is shown. Figure 2B shows Restriction site and function map of plasmid pTrp233. Figure 2C shows the Restriction site and function map of lasmid pcAT21. Figure 2D shows the end hANP (102-1 26) KashiRI-old nd II encoding gene [synthetic fragment. 2nd E From the figure to Figure 2G, plasmids phNF75, pchNF109 and and the restriction sites and functions of pchNFIZl. East 2H map is Nde Synthetic CAT gene of 1-73 amino acids contained in the l-Hindl + fragment Indicates an array. Figure 2I shows the restriction sites and functional map of plasmid pChNF142. and replaces residues 16 and 31 of the CAT gene with Tyr and Sar codons. Site-directed mutagenesis has been used to make each substitution.

Figure 3 shows two differently prepared 5DS-polyacrylamide gels. Figure 3A is 5DS-polyacrylamide of CAT-A4-751i hybrid protein. It is Midgel. Lane 1 = molecular size standard; Lane 2; induced W3110 ( pcAPi132); Lane 3 = Induction! 3110 (pTrp83) vector Control; lane 4 = uninduced W3L10 (pcAPi136); and L/-75 = induced W3110 (pcAPi136).

Figure 3B shows the 5DS-polyacrylate of CAT-GLP-1 hybrid protein. It is an amide gel. Lane 1; Molecular size standard; Lane 2z non-induced W3110 (pcGLP139); L/-73=induced W3110 (pCGLPi 39); and lane 4 = induced W3110 (pTrp83) vector control roll.

FIG. 4 shows the CAT-A4-751i hybrid protein of the present invention and CAT - Amino acids and corresponding nucleotides for GLP-1 hybrid proteins The sequence is shown. Figure 4A shows the synthetic A4-751i gene following chemical cleavage. The first 7 encode the amino terminus of the CAT protein bound in frame. The three codons and the site encoded by Asn-Gly are shown. Figure 4B is inserted in frame into the synthetic GLP-1 gene preceded by a Met codon. The first 73 codons encoding the amino terminus of the bound CAT protein are shown. vinegar.

FIG. 5 shows two pulleys 57. Mid, pCAT73 and pCAT210 are shown. , the gene for tetracytalline resistance was reverted in these CAT expression vectors. are doing.

Figure 6 shows the nucleotide sequence of 5P-B expression construct 21 (IsP-H). and the corresponding amino acid sequence of EcoR preceding the phantom 1 promoter region. 1 site to the former ndl11 site, which contains the translation stop codon. here , CAT, linker and SP-8M regions are respectively indicated by arrows.

Figure 7 shows the preparation of 5DS-polyacrylamide gel for CAT:5P-B fusion protein. It is le. Lane A = molecular size standard; Lane B = pTrp233 vector Guidance including controls! 3110 cells; and L/-7 (= induced pc210 sP-B/W3110 cells.

Figure 8 shows the 251-residue CAT:5P-C fusion protein plasmid pC210. The nucleotide and corresponding amino acid sequences from SP-C are shown. here, The CAT gene, linker sequence and 5P-B gene are indicated by arrows in this sequence. is shown.

FIG. 9 shows the determination of the molecular weight of each of the CAT:5P-C fusion proteins. Re Lane A - molecular size standard; Lane B = pTrp233 vector control Induced W3110 cells containing: lane C = induced pc106sP-C; lane-7D -pc149sP-C; lane y E = pC179SP-C; and lane F = pc210sP-C.

Figure 10 shows the cDNA and amino acid sequence of human adipsin/D.

This place to spend the day A.11 As used herein, the term "stabilize protein expression" refers to stabilizing protein expression by recombinant host cells. Refers to the properties of a fusion protein that prevents the degradation of foreign proteins.

"Insoluble" as referred to for proteins means that the protein is This refers to a state that can only be recovered by extraction using a tropic agent. usually, Insoluble proteins are formed as a result of intracellular assembly of cloned gene products. It will be done.

“High protein expression” or “enhanced protein expression” means that the fusion protein , the expression level may comprise 10% or more of the total protein produced by each cell. I mean. A preferred range of high protein expression levels is 1% of total cellular protein. 0-20%.

As used herein, "unrecoverable" means that the desired protein cannot be recovered using sensitive techniques. i.e. can be detected using Western blot analysis, but the protein S-polyacrylamide gel electrophoresis, gel filtration, ion exchange chromatography hydrophobic chromatography, affinity chromatography, etc. Not commercially recoverable using conventional purification techniques such as electrofocusing , refers to the expression level.

"Mammal" refers to all mammalian species, including rabbits, mice, dogs, cats, and primates. and humans. Preferably it is a human.

As used herein, the term "heterologous" protein refers to It refers to a protein that is foreign to a host cell that has been transformed into a host cell. Therefore, the inn Principal cells generally do not produce such proteins themselves.

Contains B1% co1 CAT encodes a 219-amino acid mature protein, and the gene spans its entire length. suitable for testing gene fusions for high level expression. Multiple restriction endonuclease sites (5°-PvuIl, 匡R1, 弣1. 弣1. and Theory 1-3'). These restriction sites are used in the hybrid genes of the invention. or other sites within the gene sequence may be used to facilitate construction of child sequences. , may be formed using techniques generally known to those skilled in the art. The resulting CAT sequence is In all cases, the resulting CAT fusion retains the ability to enhance expression of the desired heterologous peptide. It is considered useful to the extent that

In the expression constructs of the invention, most of the gene sequence encoding CAT, or The N-terminus of the CAT protein linked to the gene encoding the desired heterologous polypeptide A substantially truncated portion of the sequence encoding the end may be used. of the present invention In one embodiment, the CAT portion of the fusion extends from the N-terminus of the CAT sequence to about Code up to one-third.

Expression exemplified herein showing enhanced expression levels of various heterologous proteins In the constructs, CA ranging in size from 73 to 210 amino acids Various lengths of T proteins are used. This 73 amino acid CAT fusion The ingredients are Ec.

This can be achieved by digesting the CAT nucleotide sequence at the R1 restriction site. It is formed as follows. Similarly, the amino acid CAT fusion component at 21o is the CAT nucleotide. It is formed by digesting the code sequence with Sea l. These are then: As with other CAT restriction fragments, the protein of interest can be used to increase expression of the desired protein. It can be linked to all nucleotide sequences that cover the protein.

The expression level of the fusion protein (approximately 15-20% of total cellular protein) is similar to that of CAT (15-20% of total cellular protein). 06 amino acids)-5P-C fusion and CAT (210 amino acids)-SP -C fusion, but in the former case, the desired 5p-c 2 shows a significant increase in the expression level of the lipeptid. Because in the former case, 5p-c This is because the polypeptide constitutes substantially the majority of the total fusion protein.

desired polypeptide by reducing the size of the fused CAT protein sequence. The ability to increase the expression level of there were. In general, with prior art techniques, even if the size of the bacterial leader sequence is reduced, Due to the concomitant and more significant decrease in the expression level of the fusion protein, It has not been possible to increase the production of synthetic heterologous polypeptides.

One exception is that the various CAT-heterologous fusion proteins exemplified herein are was found to be expressed in the range of approximately 10-20% of the cell proteins. Therefore, C The pleiotropy of AT fusions means that they have the ability to enhance expression of desired proteins. The ability to use different CAT-encoding sequences allows for CAT hybrid genetics. Allows a great deal of flexibility of choice when constructing children.

The reading frame for translating a nucleotide sequence into a protein is CA, Starting from the 7 min terminal part of T, its length varies, but within the frame continuous with or without a linker sequence to the expressed protein, and , the protein terminates at the carboxy terminus of the protein. Enzymatic or chemical opening A cleavage site can be introduced downstream of the CAT sequence and cleaved from the hybrid protein. This allows for the recovery of recycled products.

Such cleavage sequences are known in the art as conditions under which cleavage can occur. It is knowledge. Following cleavage, the desired heterologous polypeptide is purified using known protein purification techniques. can be recovered using techniques. A suitable cleavage sequence includes a methionine residue followed by cleavage ( cyanogen bromide), glutamic acid residue (endoproteinase Glu-C), trypyl Tophan residues (N-chlorosuccinimide, and urea or dodecyl sulfate) (SDS)) and cleavage between asparagine and lysine residues (hydrolysine) (loxylamine), but are not limited to these.

To avoid internal cleavage within the CAT sequence, amino acid substitutions can be made using conventional site-directed mutagenesis. Different induction techniques (Zoller, M. J., and S+eith.

M, (1982), Nuc Ac1ds Res 10:6487-65 00. and Adelman, J.P., et al. (1983), DNA 2:1 83-193). This is a single-stranded fur that causes mutations. except for di-DNA and limited mismatches (which cause the desired mutation) is made using complementary synthetic oligonucleotide primers.

These substitutions can be made when CAT expression is not significantly affected. short CAT Where there is only one internal cysteine residue, as in the sequence, this residue can be substituted to reduce polymerization via disulfide bridges.

C0 臥” 1 litigation Σmu Kyuji Prokaryotic systems can be used to express CAT fusion entries. Of course, the prokaryotic host , is the most appropriate for cloning techniques. Prokaryotes include various bacteria such as E. Although most frequently indicated by strain, other bacterial strains may also be used. reproduction department A plasmid containing a sequence, a selectable marker and control sequences derived from a species compatible with the host. vector is used. For example, E. colt is typically described by Bolivar et al., G. ene 2:95 (1977) with a plasmid derived from E. colt species. A derivative of pBR322 is used for transformation.

pBR322 contains genes for ampicillin and tetracycline resistance. , a number of options can be retained or destroyed in constructing the desired vector. Provides performance markers.

In addition to the above modifications that facilitate cleavage and purification of the polypeptide product, tet Genes conferring lacecline resistance represent an alternative method of plasmid selection and maintenance. and can be recovered into the exemplified CAT fusion vector.

E, cot i tryptophan promoter-operator sequence according to the present invention CAT vector, but different control sequences are included in the m regulatory sequence. This is also considered to be within the scope of this invention. In this application, the transcription start Promoter for and optionally operator and liposome binding site sequences. Commonly used prokaryotic control sequences are maase (benicillinase) and lactose (lac) promoter systems (Cha ng et al., Nature 198:1056), the λ-derived PL promoter (Sh imatake et al., Nature 292:128 (1981)) and N- Gene liposome binding site and trp-1ac (tre) promoter system ( Agann and Brosius, Gene 40:1B3 (1985)) Contains commonly used promoters such as.

The common use of these CAT vectors is to transport a wide variety of mammalian peptides (proteins). size, presence or absence of disulfide bonds, and whether it is hydrophobic or hydrophilic. vectors with unique restriction sites. Alternatives to the pBR322-derived vectors formed or exemplified in this example. It can be used for

D. protein The amino-terminal DNA sequence of CAT is expressed at high levels in the bacterial host E, colt. For expression, it was fused to a DNA sequence encoding a human polypeptide.

The polypeptides described in this application have a comparison of amino acid residues ranging from about 30 to 76 amino acid residues. It is a small mammalian polypeptide. In bacteria, each of these polypeptides Attempts to express it directly, eg in unfused form, have not been successful. This is m This is thought to be due to degradation by proteolytic enzymes that occur during translation of RNA products. be exposed. For highly hydrophobic polypeptides, use β-galactosidase fusions If one attempts to express such a polypeptide using Consistently low levels of protein were produced.

Using truncated CAT fusions, polypeptides expressed at sufficiently high levels in bacteria can be Examples of peptides include amyloid protein A4-751 insertion sequence, glucagon-like peptide, Ptide I5 Adipsin/D.

Lung surfactant protein SP5 (SP-C) and lung surfactant 5P18 (SP -B). As mammalian protein, Although other origins are also considered within the scope of the invention, human origins are preferred.

A4-751 is an A4 protein associated with Alzheimer's disease. It is a 57 amino acid sequence identified within the precursor of myloid protein, and is a serine protein. It is homologous to the roteinase inhibitor Kunitz genus (Pont e.

P. et al. (1988) Nature 331:525-527; Tanzzj , R, E, et al. (1988) Nature 331:528-530) o Glucagon-like peptide I (GLP-1,7-31) has a strong effect on insulin release. It is a powerful stimulant and contains 31 amino acid hormones co-encoded in the glucagon gene. Moj sow, S, et al. (1987) J C11n Inve s79:616-619) aAdipsin/D is synthesized in adipocytes and separated. It is a secreted serine protease (Zusalak, et al. (1985) J Mol Ce1l Biol 5:419). Pulmonary surfactant 5P-B is It is a 76 amino acid hydrophobic protein. Pulmonary surfactant 5p-c contains 35 amino acids. It is a hydrophobic protein. 5P-8 and 5P-C are both air and water significantly enhances the diffusion of surface-active phospholipids.

The host strains are as follows.

Cloning and sequencing and under the control of most bacterial promoters For the expression of the construct, MC1061, DHI, RRI,! 3110, MM294, BC60f) hfl, , 803, HBLol, JA221 and JMIOI ( 7) Bacterial strains can be used for cases E and co.

F, second class n 亙迭 Recombinant DNA methods, unless specifically cited in the examples below, Aniatis et al. (1982), Molecular CloningxCol d Spring Harbor Laboratories Co1d Spr ing Harbor, New York. this sentence The present study also includes visualization of inclusion bodies, isolation of inclusion bodies from cells, and subsequent hybridization. Methods for protein solubilization, purification, and cleavage have been described (e.g., rtakur a, K, et al. (1977) 5science 198:1056-1063: 5hine, J., et al. (1980) Nature 285:455-46 1) If necessary, a method for refolding the protein product is also available. (Creighton, T.E., Proceedings of Genex-UCLA Syn+posium, 1985. Kingsto nes (in print). The entire teachings of these references are incorporated into this application by reference. It will be done.

Real Jl sex 1. Chloramphenicol acetyltransfera in E, colt - human heart sodium peptide hybrid protein A, 3rd moat - 2nd post aiming anus 1 Expression vector pchNF109 contains endobrotinase Glu-C protein. 241 amino acid CAT-hANP hybrid protein containing enzymatic cleavage site (Figure 1). Most CAT genes (1-210 amino acids) are ANP (1 02-126) gene and cleavage site (26 amino acids).

hANP polypeptides contain approximately 10% hybrid protein. this vector was constructed from plasmids pTrp233, pcAT21, and phNF75. It was done.

These plasmids contain the plasmid bapbone and the t promoter-operator. CAT gene; and hANP (102-126) gene and and cleavage sites, respectively.

1. Big sister xuan 1 ko Plasmid pTrp233 was transferred to E, calf, L! J Promoter - Operator Synthetic Ec containing protein sequence, liposome binding site and downstream cloning site The oRI-Pstl fragment was combined with strong transcription termination signals, TIT2 and β-lacta. by inserting it into the plasmid pH233-2-Ndel containing the Mase gene. It was constructed by The synthetic fragment (see Figure 2A) was prepared by Vlasuk et al. (1986), J. , Biol Che + * 261: 4789-4796 method and San Ger et al. (1977), Proc Natl Acad Sci USA 7 M13mp8 and M13m confirmed by the method of 4:5463-5467. Assembled by using sequences within p9. Plasmid pKK233 -2-Ndel (filed on May 8, 1985, incorporated by reference in this application) (disclosed in co-pending U.S. patent application Ser. No. 766,030) Digested with eoRl and Cy± and ligated with a synthetic EcoRI-Pstl fragment. Plasmid pT rp233 was transformed into ampicillin resistant E, colt JA22L or (Fig. 2B).

Plasmid pcAT21 contains the CAT gene (transposon Tn9, mu1ton and Vapnek, (1979) Nature 282:1164-86 9) was transformed into plasmid pTrp2 under the control of the E2 promoter operator. It was constructed by inserting into 33. Plasmid pALL3ATCAT (1 1 Jishikata filed on September 11, 1987 and incorporated as a reference in this application], Naka no Ume Plasmids disclosed in National Patent Application No. 095.742) were prepared in ±1 and H Digest the CAT gene with indll [starting M An approximately 750 bp NdeI-Htndlll fragment containing (along with et residues) was Purified using low gel electrophoresis. CAT gene with T4 DNA ligase was used to ligate pTrp233 digested with Ndel and Hindlll. . MC1061 (Casadaban et al. (1980), I Mol Biol 138: 179-209) Plasma from ampicillin-resistant transformants Sumid pcAT2L was isolated (Figure 2C).

Plasmid phNF75 undergoes synthesis preceded by a proteolytic enzyme cleavage site. It was constructed by inserting the hANP gene into plasmid pBgal (S hine et al. (1980), Nature 285:456). 8 oligodeos The xyribonucleotides (Figure 2D) were extracted using the endoproteinase Glu-C cleavage site. Synthetic hANP (102-126) was integrated into the gene preceded by the position ( '/1asuk et al. (1986) method, supra). Synthetic NA fragment (Eco at 5') with a RI tail and a blunt end at the 3' end) as T4D for DNA sequencing purposes. with EcoRl and Small restriction endonucleases using NA ligase. ligated to digested M13mp19 (method of Sanger et al. (1977), supra. ). Ugly! old and Digest with mIr and purify the fragment containing the hANP gene by agarose gel electrophoresis. The fragments were then digested and dephosphorylated with bacterial alkaline phosphatase. It was ligated to pTrp233 using T4 DNA ligase. hANP gene 3 ' provides a Hindl lIs Bam old and EcoR1 site adjacent to the end. A plasmid with an insert in the same direction as phNF? 3, Htndll! Oyo Identification was made by the size of fragments produced by digestion with Pvu and Pvu. P The lasmid phNF73 was digested with EcoRI and the hANP gene was digested with polyacrylic acid. Purified using midgel electrophoresis, the gene was digested with EcoRl and It was ligated to plasmid pBgal which had been dephosphorylated with fungal alkaline phosphatase.

E, Plasmid ph from coli Mc1061 ampicillin-resistant transformant By digesting NF7s (Fig. 5142E) with 匡1 and ±dll+ Identification was made by the size of the generated DNA fragment.

The expression vector pchNF109 is decomposed by CAT, hANP Oyohi9, and NHAKU! The DNA fragment containing the primary cleavage site and the linker sequence were added to plasmid pTrp233. Constructed by inserting into . Plasmid phNF75 was transformed into EcoRl and About 80 bp (7) EcoR [-H1 The ndlll fragment was purified by polyacrylamide gel electrophoresis and T4DN pTrp233 digested with Hastan R1 and old ndll using A ligase. connected to. Plasmid phNF87 was transferred to E, calL MC1061 Ambici It was isolated from a phosphorus-resistant transformant, digested with Cy1, and the fragment was digested with bacterial alkaline phosphorus. Dephosphorylated using fatase. Digest pcAT2L with 5eal, BateHI synthetic linker (5°-CGGATCCG-3°) was added to T4 DNA linker. Use gauze to attach the blunt ends and dilute the ligation! Digest with old and agaro By purifying the 740 bp old fragment by gel electrophoresis, m promoter-operator, liposome binding site and size of the CAT gene. b! Contains a long amino-terminal fragment! Generated by the old cassette. This Baa old top cassette and plasmid phNF87 were ligated using T4 ligase and ampicillin A resistant transformant, E. colt MC161, was obtained. CAT gene is the frame fused to the endoproteinase Glu-C cleavage site in Plasmid pchN, which carries the old cassette with orientation such that the gene continues. F109 (Figure 2F) was extracted from the DNA fragment in the EcoRI digest of the plasmid. Selected based on size.

2. Plasmid Ch NF to 9 to 17) CAT 1-210-hANP 102-126 Vibrator 1 piece Plasmid pchNF109 contains E, colf tg4 promoter-operator CAT-hANP (102-126) hybrid protein under the control of manifest. Using this plasmid, E. coli W3L10 (ATCC Accession No. 27325) was transformed to be resistant to ampicillin, and one horned colony was -wo, M9(7) salt, 2mM Mg5O4, 0.1mM cac12.094 % glucose, 0.5% casamino acids, 40 ug/+al tryptophan , 2 ug/+1 thiamine hydrochloride and 100 ugl of ampicillin sulfate. The cells were cultured overnight at 37°C in M9 complete medium containing - Cultures incubated overnight as described above (non-induced culture) diluted 100-fold in M9 medium similar to M with fan replaced by 25 ug/ml 3-β-indoleacrylic acid 9 (induced culture).

The cultures were shaken at 370C for 6 hours and then evaluated. Uninduced cultures are highly Cell density (stationary phase) had been reached, but the induced culture was at low cell density (logarithmic phase). there were. Phase contrast microscopy shows cells with normal morphology in uninduced cultures. Induced cultures show elongated cells containing some refractive inclusions. Ta. Boil the cell pellets in Raemli 11 buffer for 5 minutes. Prepare whole cell protein samples by boiling and incubating with 12% 5DS-polymer. Electrophoresis on an acrylamide gel, then the protein was analyzed using Coomassie blue. It was analyzed by staining with

B, Akane 1 and Ichiotomata 2 Ueshima Shimito.

The expression vector pchNF12+ contains endoproteinase Glu-C protein. A 99 amino acid CAT-hANP hybrid protein containing an enzymatic cleavage site code (Figure 4A). Approximately one third of the CAT gene (amino acids 1-73) is hANP (102-125) and proteolytic enzymes without intervening linkers fused to the cleavage site (26 amino acids). The hANP polypeptide is a hybrid Contains 25% of protein. This vector combines plasmids pchNF109 and and phNF87. These plasmids contain amino acids of the CAT gene. The terminal fragment, the hANP gene, and the proteolytic enzyme cleavage site were supply each.

(Margin below) 1, IF121 (resistant i) Plasmid phNF87 was digested with EcoRl, and its ends were digested with bacterial alkaline phosphatide. Dephosphorylated by sphatase and trp bromo-ter operator , a ribosome binding site, and the amino-terminal portion of the CAT gene. Approximately 32 It was ligated to the 0 bp R1 fragment. This EcoRI cassette was prepared on an agarose gel. It was purified from the EcoRI digest of pchNF109 using electrophoresis. P The lasmid pChNF121 (Figure 2G) was isolated from E. coli MC1061. isolated from a picillin-resistant transformant. DNA fragment derived from Pvul I degradation product Based on the size of the pieces, the CAT and hANP genes are fused in frame. It was assumed that a hybrid protein was produced.

2. CT-73-hANP 102-106 of plasmid ChNF21 Development of hybrid proteins Plasmid pchNF121 is an E. coli fi promoter operator. CAT-hANP(102-126) was isolated under the control of It expresses the effect. Using this plasmid, E. coli W31LO (prototrophic strain , TrpR+) to ampicillin resistance, and one colony was transformed into a complete M 9 medium (A, see Section 2) overnight at 37°C. -Late culture , in complete M9 medium (uninduced cultures), and in 40 μg/ml tryptophan. in M9 medium with 25 μg/l 3-β-indole acrylic acid instead. (induced culture) diluted 100 times.

9 expression was evaluated after shaking the culture for 6 hours at 37°C. uninduced culture had reached a high cell density, but the density of the induced culture was approximately 173% below this density. It stopped. Using phase contrast microscopy, uninduced cultures show cells with normal morphology. The induction medium contained some refractile inclusion bodies (fncl). Elongated cells with a fusion body were seen. All Cellular Protein Assays To prepare, boil the cell pellet for 5 minutes in Laemli buffer. A 12% 5DS-polyacrylamide gel was prepared by After being subjected to pneumophoresis, it was coated with Coomassie Blue. 1. By staining the protein, the expression vector pchNF142 was analyzed with 99 proteins. It encodes a amino acid CAT-hANP hybrid protein. This protein is , the only Trp residue following amino acid residue 73 of the CAT protein was chemically cleaved. It is held as a position. Almost one-third (amino acids 1-73) of the CAT gene is hA NP(102-126) gene and chemical cleavage site (26 amino acids) ing. This amino-terminal fragment in CAT replaces Trp[16] with a Tyr residue. and modified to replace Cys[31] with a Ser residue. this is , removing additional chemical cleavage sites and hybridization by disulfide bridges. This is to reduce protein multimerization. The sequence encoding the Trp residue precedes A synthetic hANP gene was constructed for this vector.

1. Animal ■■ Dandan Eitsuki Plasmid pTrp233 was digested with EcoRl, and its ends were transformed into E and coli D. NA polymerase I, filled in with Klenov fragment (EcoRI restriction using T4 DNA ligase (to remove endonuclease cleavage sites) Connected. E, coli M (produced from ampicillin-resistant transformant of JO61) Isolation of lasmid pTrp81 showed resistance to cleavage by EcoRl. . Plasmid pTrp81 was digested with Ndel and Hindll and agarose Purified by gel electrophoresis.

Then, it was ligated to 9 synthetic CAT gene fragments using T4 DNA ligase. synthesis The Ndel-Hindll [CAT gene fragment (Fig. 2H) Constructed from godeoxyribonucleotides.

Plasmids were obtained from ampicillin-resistant transformants of E. coli MC1061. AT127 was isolated. Also, EcoR [and Mu1! By decomposing with 2 It was shown to have a synthetic CAT fragment. This plasmid was transferred to Ban+HI and Digested with Hindl II. Shu's former retainer 1ndllll fragment containing CAT , purified by agarose gel electrophoresis, and purified by Sanger et al. (1977) (supra). ) The correct DNA sequence was confirmed by sequencing.

Plasmid pcAT127 was digested with NanadanR1 and old YudlI+, and T4DN A! , Trp residue in the EcoR[-old ndl11 fragment using I gauze. A pair of annealed proteins encoding hANP(102-125) preceded by ligated with synthetic oligodeoxyribonucleotides. Plasmid pchNF142 (Fig. 2 ■) is an ampicillin-resistant transformant of E. coli MC1061. isolated from Insertion of hANP was carried out in Ban old and Hindll of this plasmid. This was confirmed by the size of DNA fragments in the 1-digested product. hANP gene The sequence is an EcoR[-5eal agarose gel purified fragment from pchNF142. confirmed by.

2, CAT 1-73 T r 16 Ser 13-hANP 102-12 6 ChNF142.

1 ri Expression of modified CAT-hANP (102-126) hybrid protein.

The teachings of Examples A, 2 and B, 2 above are carried out substantially.

■9 Chromephenicol acetyltransferase-amyloid A4 tan E, cali of hybrid protein consisting of Pak-human A4-7S1i In all the following examples, the addition of 57 amyl into amyloid A4-751 protein. High-level expression with a noic acid insert was achieved on a pBR322-derived plasmid with E. coli) 9 synthetic A4-7 under the control of the liptophan promoter operator Fusing the 51i gene to a DNA sequence encoding the amino-terminal fragment of CAT. This was achieved by The synthetic A4-751i gene has a chemical cleavage site Asn-G ly is leading. 289-345a derived from amyloid A4-751 protein encodes a amino acid (Ponte et al. (1988), Nature 331:52 7). between these two residues. Hydroxyl of this hybrid protein Amine cleavage yields an insert protein with a cty residue at the amino terminus.

A0 expression vector CAPi132 Expression vector pcAPi132 has a hydroxylamine cleavage site 1 Encodes a 32 amino acid CAT-A4751i hybrid protein (4th Figure A). Approximately 173 (amino acids 1-73) of the amine terminal portion of the CAT gene is A linked in frame with the 4-751i gene and cleavage site (59 amino acids) There is. A4-7Sli protein accounts for approximately 43% of this hybrid protein. Ru. This vector is.

Plasmid pTrpZ33 and pchNF121 and 9 synthetic A4-751 i genes. Constructed from the gene and cleavage site.

1. Lombardy ■dandan! And Plasmid I) Trp233 was digested with Nanada R1 and Hind[II, The protein encoding A4-751i protein was purified by low gel electrophoresis and analyzed. The synthetic gene and cleavage site were ligated using T4 DNA ligase. this The gene was constructed from six oligodeoxyribonucleotides using the method described above. and its sequence was confirmed (Fig. 4A). Plasmid pAPi131, E, e It was isolated from an ampicillin-resistant transformant of Oli MCl061. synthetic gene Insertion of Pvu of plasmid mini-prep DNA This was confirmed by the size of the DNA fragments derived from the old digests of 1 and Bam.

Plasmid pAPi131 was digested with EcoRI to linearize the vector and The terminals were then dephosphorylated with bacterial alkaline phosphatase. plasmid p chNF121 was digested with EcoRI, and the tXi promoter operator was added. Ribbonome binding site and amino terminal part of CAT gene (amino acids 1-73) An approximately 320 bp coRI fragment with Manufactured. This EcoRI cassette was ligated to pAPi13 using T4 DNA ligase. 1 plasmid to obtain an ampicillin-resistant transformant of MC1061.

Size of DNA fragment in PvuII digested product of minipretub plasmid DNA Based on the Sumid PCAPi132 was isolated.

2. CAT from plasmid CAPi132 (L-73-A4-751i hive Development of lid protein Plasmid pcAPi132 *L”L, txx promoter ° operator Under the control of CAT-A4-? 51i hybrid protein. This program E. coli W3110 was transformed to ampicillin resistance using rasmid. , one colony was cultured overnight at 37°C in complete M9 medium. - Late culture in complete M9 medium containing 40 μg/ml tryptophan (uninduced cultures), and 25 μg/ml 3-β-indoleacrylic instead of tryptophan. Diluted 100 times into complete M9 medium containing acid (induced culture).

2 expression was assessed after shaking the culture for 6 hours at 37°C. Uninduced cultures have high cell density was reached, but the cell density of the induced culture was low. using a phase contrast microscope When the uninduced cultures had cells with normal morphology, the induced cultures had "pre-inclusion bodies". (Pre-inclusion body) Cells containing J were observed. here As used in the term, “preinclusion bodies” are hybrid proteins that accumulate inside cells. As this occurs, it is thought that it will eventually change into an "inclusion body" with higher refractive properties. Than Defined as having low refraction. All cell protein samples were collected from cell pellets. To.

Prepared by boiling for 5 minutes in Laemmli buffer.

After electrophoresis using a 12% 5DS-polyacrylamide gel, Coomassie -Blue staining (Fig. 3A). This CAT(1- 73) -A4-751i hybrid protein is.

Lysozyme (molecular weight 14.300) protein standard was applied on this gel.

β-lactoglobulin has a molecular weight of 111.4QQ) and transfers between protein standards. Ru. Kontes fiber optic scanner and Heulet printer This was done using a Hewlett-Packard integrator. By scanning the gel, we found that approximately 7% of all cellular proteins are hybrid proteins. It was estimated that there was. Almost half of this tanbaku is A4-751i.

To confirm the presence of A4-7 S l i in the hybrid protein , these protein samples were run on an unstained 12% 5DS-polyacrylamide gel. Western blot analysis was performed using Proteins are plated on nitrocellulose. lot, anti-A4751i serum (amino acid insertion protein of 57 amino acids) prepared for a synthetic peptide consisting of 16 amino acids with acids 11-26) incubated with. 12sI-tannoic A (Amersham (Ame) rsham)), the plots were incubated at -70°C. It was placed on X-ray film for several days. Synthetic peptide antiserum allows hybridization protein and several other E. coliformes proteins were detected.

B0 expression vector CAPi136 Expression vector pcAPi136 has a hydrohemidylamine cleavage site 274 Encodes the amino acid CAT-A4-751i. C Most of the AT gene (amino acids 1-210) has a linker sequence (5 amino acids). via the A4-7S1i gene and the cleavage site (59 amino acids). are connected. A4-751i polypeptide is a hybrid protein. It accounts for about 21%. This vector consists of plasmids pAPi13i and pchNF Constructed from 109.

1, fish) i136 (placement alternate) Plasmid pAPi131 was digested with EcoRI to linearize the vector. So The terminus of was dephosphorylated using bacterial alkaline phosphatase. pchNF From the partial EcoRI digest of 109, approximately The 740 bp EcoRI fragment, the CAT gene (amino acids 1-210), and the phosphorus The car sequence was purified by agarose gel electrophoresis. This EcoR [case] ligate and vector pAPi131 using T4 DNA ligase, Ampicillin-resistant transformants of E. coli MC1061 were isolated. Ji1 old From the size of DNA fragments in minipletubes of degraded plasmids.

Plasmid with CAT gene and synthetic A4-75Li gene in frame pcAPi136 was isolated.

2. Plasmid CAPi136 or CAT l-210-A4-751i high Expression of Brid protein Plasmid pcAPi136 is under the control of LμEri 1 promoter-operator pair. Under the control, the CAT-A4-751i hybrid protein is expressed. this plus Transform E. coli W3110 to ampicillin resistance using midi, One colony was grown overnight at 37°C in complete M9 medium. -Late culture 25 in the same M9 medium (uninduced cultures) and tryptophan replaced. in M9 complete medium containing μg/ml 3-β-indoleacrylic acid (induced cultures ) was diluted 100 times.

2 expression was evaluated after shaking the culture for 6 hours at 37°C.

Both uninduced and induced cultures reached high cell densities. phase difference Using a microscope, cells with normal morphology are seen in uninduced cultures and cells with normal morphology in induced cultures. Cells containing inclusion bodies or pre-inclusion bodies (So': 50) were observed. all To prepare a cell protein sample, boil the cell pellet in Ramue buffer for 5 minutes. Electrophoresis using a 12% 5DS-polyacrylamide gel prepared by After exposure, 2 analyzes were carried out by staining with Coomassie blue (Fig. 3A). ). This CAT-A4-751i hybrid protein passed through the gel with α- Chymotrypsinogen (molecular weight 25.700) protein standard and ovalbumin (molecular weight 43,000) and the protein standard. Comtesse's light facade Uses an iberscanner, a Huhle, and a yh Barakad inch grater. I scanned this gel.

Hybrid proteins were estimated to account for approximately 15% of total cellular protein. this is +E, which is a rather high level of expression for coli.

To confirm the presence of A4-7Sli in the hybrid protein, this protein samples were analyzed using an unstained 12% 5DS-polyacrylamide gel. A Western Pro Soto analysis was performed. Using the above method (IIS, A, 2) 1 Synthetic peptide antiserum has been used to detect hybrid proteins and other proteins. Some E and cot f proteins were detected.

■, Chloramphenicol acetyltransferase-glucagon peptide Expression of hybrid protein consisting of 17-37 in E. coli In the examples below, high level expression of the 31 amino acid GLP-1 (7-37> On the BR322-derived plasmid, [:, colih ribtofan promo DNA encoding an amino-terminal fragment of CAT under the control of a motor operator. This was achieved by fusing the synthetic GLP-1 gene to the sequence. This synthetic residue The gene hoods amino acids 7-37 of GLP-1 preceded by a Met residue (M ojsov et al. (1987), J.

CHn Invest 79:616-619>. Treated with cyanogen ovoid When treated, insulin peptides are released.

A, Vector CGLP139 The expression vector GLP139 has a cyanogen bromide cleavage site of 105 It encodes the amino acid CAT-GLP-1 hybrid protein (Figure 4B).

Approximately one-third of the amine terminal portion (amino acids 1-73) of the CAT gene is GLP-1 Linked in frame to the gene and cleavage site (32 amino acids). GLP -1 peptide accounts for approximately 30% of hybrid proteins. This vector is Plasmid pTrp233 and pchNF109 and one synthetic GLP-] gene or and cleavage site.

1. Animals Plasmid pTrp233 was digested with R and Hindll and agarose Purified by gel electrophoresis and ligated to synthetic gene using T4 DNA ligase did. This gene is constructed from four oligodeoxyribonucleotides. , its sequence has also been confirmed (Fig. 4B). E,eoLi MC106L Ann Plasmid pGLP138 was isolated from the picillin-resistant transformant. synthetic genetics The insertion of the child is due to the fact that the plasmid mini and bleb DNA are not cut with Pstl. confirmed.

Plasmid pGLPL38 was digested with EeoRI to linearize the vector and its The ends were dephosphorylated with bacterial alkaline phosphotase and T4 DNA ligation was performed. Using gauze, connect the coRI cassette (derived from plasmid pchNF109). concluded. Plasmid pchNF109 was first digested with coRI and tXJL protein Motor operator, liposome binding site, and amino terminal of the CAT gene An approximately 320 bp EcoRI fragment with end fragments was subjected to agarose gel electrophoresis. It was more refined. Plasmid pcGLP139 is an amplicon of M (JO61). isolated from a phosphorus-tolerant transformant. Plasmid Minibre Knob DNA Av Based on the size of DNA fragments in al and 5 ■ digests.

It was confirmed that the CAT sequence and GLP-I sequence were fused in frame. Ta.

2.2'Las Mid, J? CGL213 [Ba] Hoshie to Danki U211Σ2'' ” Plasmid pcGLP139 is a coli-enclosed oral promoter promoter. CAT-GLP-1/) Ivli tudotannoic is expressed under the control of CAT-GLP-1/). child Transform E. coli W3000 to ampicillin resistance using the plasmid. One colony was grown overnight at 37°C in complete M9 medium. -Late culture The sample was placed in complete M9 medium containing 40 μg/a+1 tryptophan (uninduced). Culture) 2 and 25 μg/ml 3-β-indo instead of tryptophan diluted 100 times into complete M9 medium (induced culture) where acrylic acid is used. did.

Expression was evaluated after the cultures were shaken at 37° C. for 6 hours.

Uninduced cultures had reached high cell densities, whereas induced cultures had low cell densities . Using phase-contrast microscopy, cells with normal morphology are seen in uninduced cultures; Cultures showed elongated cells growing three or more refractive inclusion bodies.

For all cell protein samples, boil the cell pellet for 5 minutes in Mueli buffer. Using a 12% 5DS-polyacrylamide gel prepared by boiling After electrophoresis, it was analyzed by staining with Coomassie blue (see Figure 3B).

This CAT(1-73)-GLP-1(1-73) hybrid protein is Trypsin inhibitor (molecule @ 6. Zoo) protein standard and lysozyme (molecule j!14,300) is transferred between the protein standards. Contes' light Using the Eyebar Scanner and Huuret Paracard Inch Grater By scanning this gel, the hybrid protein can be found in whole cell size. (taking into account the number of inclusion bodies observed per cell) Then, not all of the hybrid protein will be solubilized in Rameli buffer, so , this may be an underestimate). This is a high level for E. coli. It is an expression.

The molecular weight of the hybrid protein is as predicted by this gene fusion. Ru. Amino acid composition analysis of purified hybrid protein or cyanogen analysis The expression can be confirmed by protein sequencing of the peptide after immunobromide release. can do.

■ Human 5P-B and 5p-c and CATA mature forms of human 1-'5P-C and and 5P-B are both expressed as fusions with a portion of bacterial CAT. interface Active factor peptide.

Due to the hydroxylamine-sensitive asparagine-glycine bond, the CAT sequence linked at the carboxy terminus. The CAT-surfactant fusion is pTrp233 is expressed from the tryptophan promoter of vector pTrp233.

A, Vector C210SP-B The SP-B expression vector pc210sP-B is a hydroxylamine-sensitive cleavage vector. The 210 amino acids of CAT are linked to 5P- It encodes a fusion protein of 293 residues linked to the 76 amino acids of B. Hi Cleavage of the fusion with droxylamine yields the 76-residue mature form of 5P-B and the amino A 77 amino acid 5P-B product with a terminal glycine residue is released.

To construct pc210sP-B, a short EcoR[-H The 1ndlll segment was removed from pchNF109 and the nucleotide (n t) Human extending from the mu11 site of 643 (Figure 6) to the stop1 site of nt804 Part of 5P-B cDNA #3 was replaced. The EcoR1 site consists of two complementary It is linked at the Pst1 site via an oligonucleotide. These oligos The nucleotide has a hydroxylamine-sensitive cleavage site and an amino acid site for mature 5P-B. It encodes the terminal residue (surigo $2307 + 5-AAT TCA AC G GTT TCCCCA TTCCTCTCCCCT ATT GCT GG CTCT GCA-3° and oligo #2308:5-GACCCA GCA ATA GGG GAG AGG AAT GGG GAA ACCGTT G -3°). The mold 1 site connects PTrp233 through a second set of complementary nucleotides. Hfndl! Connected to one part. These nucleotides represent the mature 5P-H (oligo, t3313:5'-AGCT TA CCG GAG GACGAG GCG GCA GACCAG CTG GGG CAGCAT G-3° and Oligo 33314: So-CTG C CCCAG CTG GTCTGCCGCCTCGTC, CTCCGG TA- 3°).

Using this expression plasmid, E. coli stains W311Q to ampicillin resistance. was transformed into. pc210sP-B/W3 rapidly growing in M9 medium 25 μg/ml in 110 cultures! AA (3-β-indole acrylate) To, Sigma! -1625) to induce the Trp promoter. uttered. By 1 hour after induction, refractive cytoplasmic inclusions are present inside the proliferating cells. The existence of 1 was confirmed by phase contrast microscopy. 5 hours after induction, 10. D, sss equivalent amount of cells were pelleted by centrifugation and then added to SDS sample buffer. Boil for 5 minutes in a 12% SDS polyacrylamide gel. After that, it was stained with Coomassie blue (Figure 7).

Lane A = molecular size standard; Lane B = pTrp233 vector control and lane C = induced pc2 10sP-B/W3110. The expected molecular weight of CAT:5P-B fusion protein is 4 It is 5,000 Daltons. Hybrid CAT:5P-B protein is It has been estimated that it accounts for 15-20% of the total cellular protein in the diet.

B, CAT fusion with 5P-C A series of vectors is designed to transform mature human 5p-c into hydroxylamine-sensitive aspens. fused to the carboxy terminus of various parts of CAT via paragine-glycine bonds was constructed to encode a fusion protein. produced by each construct When the resulting fusion protein is cleaved with hydroxylamine, a portion of the natural human 5P-C is released. The mature 5p of 35 amino acids lacks the amine-terminal phenylalanine residue found in the =c is released.

1. Litter note ≦ The amino acid sequence of the fusion protein consisting of 251 residues is derived from the plasmid pc210sP. It was coded -C. The 210 amino acids of CAT have a 6 amino acid linker. 35 amino acids of mature 5p-c. composition in the total fusion protein. The ripe 5pc portion accounts for 14%.

FIG. 8 shows the nucleotide sequence of pc210sP-C.

In this nucleotide sequence, pc210sP-B with the 5P-8 sequence Mudan R1-H1ndll! The fragment starts from the Hatake L1 site at nucleotide 123. The sequence of human 5P-C cDNA #18 extending to the AvaIr site of leotide 161. replaced by the statement. The EcoR1 site of the CAT vector contains two complementary SF3 is linked to the L1 site via a unique oligonucleotide. this The oligonucleotide has a 2-hydroxylamine-sensitive cleavage site and a mature 5p- (Oligo 82462: 5°-AAT T CA ACG GCA TTCCCT GCT GCCCAG-3° and ori Go#2463:5-TGCACT GGG CAG CAG GGA ATG CCG TTG-3'). 5pc shindan! ■The site is a second set of complementary nucleotides. It is linked to the ±dl11 site of pc210sP-H through the tido. This nook Reotide encodes the carboxy-terminal residues of mature 5p-c and a stop codon. (Oligo #2871:5-AGCTTA GTG GAG ACCCAT GA G CAG GGCTCCCACAAT CACCACGACGAT GAG- 3' and oligo 92872: 5°-GTCCTCATCGTCGTGGTG ATT GTG GGA GCCCTG CTCCATG GGT CTCCA CTA-3°).

2. Animals Σヱ≦ pci? Amino acids of the 217 residue fusion protein encoded by 9sP-C The sequence is slightly modified from the sequence shown in FIG. pci79sP -C, the 179 amino acids of CAT are replaced by 3 amino acids (Glu, Phe, Asn ) to the 35 amino acids of mature 5pc. Full fusion The 5pc site of the protein occupies 16%.

To construct pci79sP-C, part of the sequence of CAT was cloned into pc210sP -Taken out from C. Starting from pc210sP-C, nt603 (east 8 DNA fragment extending from the Nco1 site in Figure) to the EcoR1 site in 1t72B and insert the sticky ends of Ncol and EcoRI into two complementary oligonucleotides. Reotide (oligo #3083:5'-CAT ccc CAA ATA TTA TACGCA AG-3° and oligo #3084:5°-AAT TCT TGCGTA TAA TAT TTG CC-3°). required In particular, 31 residues of CAT and 3 residues of the linker polypeptide are deleted in the new fusion protein encoded by ci79sP-C.

3. Bar (garden transport) Amino acids of the 187 residue fusion protein encoded by pc149sP-C The sequence is slightly modified from the sequence shown in FIG. plasmid pc In L49sP-C, the 149 amino acids of CAT are replaced by 3 amino acids (Glu, Phe , Asr+) linked to the 35 amino acids of mature 5p-c. There is. The 5pc portion accounts for 18.7% of the total fusion protein.

and two complementary oligonucleotides (oligo 83082:5' -TCA ccc AAT CCCG-3° and oligo #3081:5°-A ATTCG GGA TTG GC-3°).

4. A superior animal to avoid a rival Amino acids of the 144-residue fusion protein encoded by pc106sP-C The sequence is slightly modified from the sequence shown in FIG. plasmid pc In 106sP-C, the 106 amino acids of CAT are 3 amino acids (Glu, Phe , Asn) linked to the 35 amino acids of mature 5P-C. Ru. The 5pc portion accounts for 24% of the total fusion protein.

pc106sl'-C were linked to each other via homology regions after annealing Two sets of complementary oligos were used to generate the EcoRl fragment of pc210sP-C (from nt302 nt728. (Fig. 8) was constructed by replacing.

These complementary oligos are as follows (oligo #3079:5'-AAT TCCGTA TGG CAA TGA AAG ACG GTG AGCTG G TGA TAT GGG ATA GTG TTCACCCTT GT-3 ° is oligo:3085:5°-ACA CTATCCCAT ATCACCA GCTCA CCG TCT TTCATT GCCATA CGG~3° and a Neiled: Oligo #3080: 5°-TACACCGTT TTCCAT GAG CAA ACT GAA ACG TTT TCA TC:G CTC TGG G-3' is oligo #3078:5°-AAT TCCCA, G GA T GAA AAACGTT TCA GTT TGCTCA TGG AAA Annealed with ACG GTG TAA CAA GGG TGA-3').

5, Gongyo and Glue 79 Second Girl” Piυlmata Using each 5P7C expression vector, E. coli W3110 strain was treated with ampicillin. transformed into resistant. a rapidly growing culture.

induced as described above. By 1 hour after induction, a refractive index is found inside the proliferating cells. The presence of cytoplasmic inclusions was observed by two-phase contrast microscopy. 5 o'clock trigger After that, 10. D, 556 equivalents of cells were pelleted by centrifugation and then S Boiled for 5 hours in DS sample buffer, then extracted in a 2% 5DS-polyacrylamide gel. After electrophoresis, the cells were stained with Coomassie blue. The results are shown in Figure 9. is being given. Lane A = molecular size standard; Lane B = pTrp233 W3110 cells induced with vector control; Lane C-induced W3110 cells with vector control; pc106sP-C; Lane D-pc149sP-C; Lane E-p ci79sP-C; Lane F = pC210SP-C, produced by each vector. The hybrid CAT:5P-C protein produced is a protein that contains total cellular protein in induced cultures. It was estimated that they accounted for 15-20% of the population.

■ Improved CAT vector for producing hybrid proteins in E. coli ctor In the following examples, the basic CAT gene fusion vector is modified in several ways. Good = (1) Cloning specific to inserting the gene to be expressed (2) to optimize peptide cleavage and/or purification; and (3) imparting tetracycline resistance. Recovering genes for plasmids and providing other methods for selecting and maintaining plasmids and.

A, Current Hek9-CAT73 and CAT2LCI expression vector pCAT73. Genes conferring resistance to ampicillin and tetracycline and 9 expressed EcoRI and Hindu cloning specific to insert the gene to be site and the amine-terminal fragment (1-73) of the CAT gene. The cleavage site is Although it is included with the introduced gene, it is not unique.)

This plasmid includes plasmids pBR322, pTrp233. pcAT21 ．． and constructed from oligodeoxyribonucleotides.

The expression vector pcArzto differs from pCAT73 in the following points.

2 expression vector pCAT210 contains residues 72 and 73 (Glu-Phe ) of the CAT gene in which the EcoR1 site in the coding sequence has been removed. It has a longer amino terminal fragment (1-210).

(Even if other codon selections are made, this Glu will be conserved).

This allows for the use of unique EcoRI and HindIII cloning sites.

) amine of the CAT gene by inserting an EcoR1 site at the desired fusion point. It encodes the terminal end and is smaller than 73 amino acids.

Or between 73 and 210 amino acids. construct other DNA [r pieces] You can also.

1. Dandan! plan For gene restoration of tetracycline resistance, pB It is necessary to recover the R1 fragment once the R322 di1-reconstruction dlII-Ec. Ru. The unique cloning sites desired for this vector are EcoRI and H jndm, this removes these sites but does not allow tetracycline to must be made to maintain resistance to upstream of the coding region Inserting DNA into the Hindm site often inhibits gene expression. This site was removed by making a point mutation at the Hindm site. Ru. Plasmid pBR322 was digested with EeoRI and HindDI and the vector Turback bones were gel purified. This backbone is a synthetic EcoRI-Hi ndm fragment. These fragments were ligated using T4 DNA ligase. It is formed by annealing a set of oligonucleotides. These fragments are A point mutation (G or C) in the first adenine of the recognition sequence 5'-AAGCTT-3' It has the normal EcoRI-old ndI sequence, except that it is seen. intermediate The plasmid is obtained by decomposing the plasmid miniblad DNA with HindIff. No, ampicillin- and tetracycline-resistant E. coli MC10 isolated from 61.

The old-EcoRI fragment, which no longer has the L-dIII site, was added to the plasmid pT Purify e from old ■old and EeoR1 degradation products by agarose gel electrophoresis. It was done. This fragment was ligated to plasmid pTrp23 using T4 DNA ligase. Connected with 3. However, pTrp233 is also degraded in Shiwagu and KugitanR1. and purified on agarose gel. Since it has been transformed by ligation, E, Colonies of coli MC1061 are ampicillin resistant and/or tetra Selected for cyclin resistance. Plasmid pTrpT233 contains both antibiotics. He was resistant to the substance.

In other embodiments, degradation of pTrpT233 by EcoRI, using T4 DAN ligase, blunting of the ends with Klenow fragment, and T4 DAN ligase. ligation removes the EcoR1 site (but (It has no effect on the resistance to Deletion of unnecessary I (indm and EcoR1 sites) The tetracycline-resistant plasmid I) Tri) T234 is added to this ligation. It is isolated from a colony of E. coli MC1061 transformed by E. coli.

The CAT gene is derived from pcAT21 Nde[-HlndI[[Agarose Obtained as a ±[-Hindm fragment purified by gel electrophoresis.

Plasmid pTrpdel taHind contains Ndel and HindI [[ Decomposed.

It was purified by agarose gel electrophoresis, and C. It was linked to the AT gene. To confirm the incorporation of the CAT gene, EeoR EcoRIMC1061 ampicillin (or Plasmid I) CAT73 (31 (Figure 5A) is isolated.

2. 41 drunkenness! m promoter operator and liposome binding site.

The Rongu-Hindm fragment containing the CAT gene is a fragment of the plasmid pcAT21. ! Old and Hindm digests are purified by agarose gel electrophoresis. M2 Sites were added to this fragment using S and mutagenic oligodeoxyribonucleotides. By performing specific mutation treatment, the EcoR1 site 5°-GAATTC-3' GAA of Glu: ton was changed to GAG (also Glu). child One of the plasmids, M2S-CATdR, is degraded by 5eal, The vector was linearized and the MutanRI linker (pc (to the same reading frame as ATT3). 2M13 from transformants -CATRI was isolated and digested with Ndel and HindII. new The CAT gene was purified by agarose gel electrophoresis, and T4 DNA ligator The plasmid pTrpT234 was ligated with the plasmid pTrpT234 using a . Plasmid pcAT210 (Figure 5B) was cloned from E. coli MC1061. Isolated from picillin (or tetracycline) resistant transformants.

B0 expression vector CAT73-T and CAT73-M expression vector pCAT? 3-T and pCAT73M are two-site-directed mutagenesis of the amino acid sequence of CAT. This is an example of a method used and modified to facilitate purification of the product protein. In these cases , the Trp residue at position 16 was replaced with Tyr, and the Met residue at position 67 was replaced with lie or L Substitution with eu may remove a chemically cleavable site within CAT.

Furthermore, Cys is also ranked 31st. Conservative amino acid changes, i.e. biologically active Substitutions may be made by substitution with amino acids that do not have an adverse effect. The preferred residue is , aniline, serine, leucine, isoleucine, and valine; most preferred. These latter changes prevent multimerization through disulfide bridges. It is intended to reduce

Generation of C0 CAT-GLP-1 Plasmid pTrpdel taHind is a T et” gene (l (although the indm site is deleted); in the CAT gene sequence Trp16 to Tyr, CYS31 to Set, Meter to Leu with each substitution; through a methionine residue, the modified CAT gene and frame It has a fused L7 gene (shown in Example 2) with the GLP-1 gene. this vector W3110. MC1061, DHI, MM294. and R Several E. coli strains were transformed, including old.

E. eoli RRI transformants are more stable than any other host.

It appears to provide better control of Trp promoter induction/repression. This vector Other ways to construct TetR genes include by inverting the TetR gene (as described in the present invention). In the construct, the Tet” promoter and the Trp promoter are in opposite directions. If a bacterial host other than the Y, RRI transformant is used to avoid This includes mitigating stability issues observed when

Vl, Tr CAT72: di sin D mature human adipsin/D co The code sequence was fused to pCAT72 to produce the fusion protein. This fusion tongue For example, Park is 9.

Suitable for generating antiserum against human adipsin/D.

A. Drunkenness” Edited IL Namiei F Section 4 Plasmid pcAT72 Q3S1 is a peptide fused to CAT that can be obtained by humans. Constructed to remove the sn residue. T-mino acid positions 26, 51, and 78 of CAT The Asn residue at position was changed to a Gin residue. The only Cys that is also ranked 231st Ser It was changed to .

Vector pcAT72 Q3S1 was constructed as follows: oligoCAT7 2-1 to 6 (see below) were annealed, and pl cleaved with 1 and EcoR[ It was linked to Jc-9. In this way, the mutated CAT72 was transferred to pUC plus ligated to the mid polylinker region. Next.

The polylinker is separated from ndm by cleavage with Ndel and Hindm. By inserting between each, pTrpcAT7ZQ3S1 was obtained.

CAT72-1 TATGGAGAAA AAAATCACTG GATATACCACCGTT GATATA TCCCAATGGCATCGTAAAGA ACATTTTG AG GCATTTCACAT72-2 CAAAATGTTCTTTACGATGCCATTGGGATA TATCA ACGGT GGTATATCCATGATTTTTTTCTCCA (Margin below) CAT72-3 TCAGTTGCT CAATCTACCT ATCAGCAGACCGTTC AGCTG GATAATTACGGCCTTTTAAA GACCGTAAA G AAACAGAAGCCTTTACGGTCTTTAAAAAAGG CCG TAATATCCAGCTGAACG GTCTGCTGATAGGTAGAT TG AGCAAACTGACTGAAATGCCTCAT72-5 ACAAGTTTTTA TCCGGCCTTT ATTCACATTCTTGC CCGCCT GATGCAGGCTCCATCCGG CAT72-6 AATTCCGGAT GAGCCTGCAT CAGGCGGGCA AGA ATGTGAA TAAAGGCCGGATAAAAACTTGTGCTTCT GTT TB, Tr CAT72 6S3 Starting from pcAT72 Q3S1, pcAT1s3 Q6S3 starts from CAT's 130th place.

The Asn residues at positions 141 and 148 were changed to Gin residues, and the Asn residues at positions 91 and 1 were changed to Gin residues. It was constructed to change the Cys residue at position 26 to a Ser residue.

Plasmid CAT72Q3SL in pUC-9 was cleaved with EcoRI. O Anneal RigoCATIS3-1~6 (see below) and connect to pcAT72. By doing so, pcAT153Q6S3 was obtained. Then Ndel and n The modified pcAT153 was removed from puc by cleavage with dm. By inserting the resulting fragment into pTrp233, pTrpcA T153 Q6S3 was obtained.

CAT153-1 AATTTCGTAT GGCAATGAAA GACGGTGAGCTGGT GATATG GGATAGTGTT60 70’80 CACCCTTCTT ACACCGTTTT CCATGAGCAACAT1 53-2 AAAACGGTGT AAGAAGGGTG AACACTATCCCATA TCACCA GCTCACCGTCTTTCATTGCCATACGA CAT153-3 10 20 30 40 S.

ACTGAAACGT TTTCATCGCT CTGGAGTGAA TAC CACGACG ATTTCCGGCA60 To 80 GTTTCTACACATATATATTCGCAAGATGTGGCCAT153 -4 10 20 30 40 S.

GCGAATATAT GTGTAGAAAACTGCCGGAAAT CGTC GTGGTA　TTCACTCCAGAGCGATGAAA　ACGTTTCA GT TTGCTCATGGCAT153-5 GTCTTTACGT GAACAGCTGG CCTATTTCCCCTAAA GGGTTT ATTGAGCAGATGTTTTTTCGT CTCAGCCC AG CCCGCAT153-6 AATTCGGGCT GGGCTGAGACGAAAAAACATCTGCTC AATAAACCCTTTAGGGAAAATAGGCCAGCTGTTCAC CGTAAGACGCCACATCTT (hereinafter referred to as "Atoday") Next, h)-7 Jibushi7/D cDNA hg31-40 (Figure 10) was constructed. did. It has a mature code region! The Paleo-Era II fragment was gel purified and b! old o and inserted into pUc-9 cleaved with Hindm.

The II end of this cDNA was inserted with two oligos (:3886 S'-CATGGG TGCCGGGGCCTGA-3° and 338875-AGCTTCAGGC CCCGGCACC-3°) was used to ligate to the old ndm end of puc. this By inserting the BamHI-II fragment of adipsin/D into pUC, , the coding sequence of adipsin/D is placed in frame with the EcoR1 site of pUC-9. placed inside. The EcoRI-Hind ■ fragment of this construct was removed from pUc-9. and inserted between the EcoR1 site and HindlII site of pTrpcAT72. Come in.

pTrpCAT72 Niadobusin/D was obtained.

This construct was induced in W3110S cells to a level of 10-15%. given the fusion protein.

Modifications to the above-described modes of carrying out the invention may be found in molecular biology, protein is obvious to those skilled in chemistry, cell biology, or related fields. and is intended to be within the scope of the following claims.

8 yen 3 yen general 5 ``Lip za 4shi FIG. 28 FIG, 2C IacZ FIG, 2E FIG, 2F FIG, 2G FIG, 2H Mr 12345 432 1 Mr FIG, 3A FIG, 3B FIG, 5A FIG, 5B Loco to C5 Polo Lu1l C! l　co 81shi3 Ll, -I CJΦ ←−To− Ll＞　＜1-1 <arrogant Q- Q-1 phrase C5<　B> City 13go C hat B: ++, pb.

L) F-1<+ (jl-+ u＜　C! +Ll　u< ■　■　■ C! +111 (j5 L)- Part 3 g Oro U Monument Q:+ 8 companies Tom ■ U be (j m (J O Li 1. l0L-LL)1. I Q＜　Ro＜　○− Jikiri Low Loco 3 Error 3 υΦ Roku 0I-1 1-1,-1! -1Φ I-I cabinet <H (J, J (+ t5 Kojimi l ←−＜−0＞ (J, -14+I Q- u<　u>　ua cpbo L) l-1u co Foot two j;'2 e5 C.B.A. ― FIG. 7 Entrustment: Sho Kaizen Sho Entrustment of ― Day! Day! 48CD E F one FIG.9 -5cpbo aou-cqum wcpta oubo -suw''''e3 <　E:;　:3. =:sgo　;　8＜　F’l! ;’;”: Fuki 1 sleep dazzling Ic death ura tJbo Ll:5 ua uI+Iup.

8'5 82 7:! A - E item 48'! ＞Shi, 2 and 1 82 8mi 　8巳hu　u＜　B＞　U＜　ω-Q- US　○C1l　CJ＞　Qal　Cj　cpetJ　P-1＜　-s　C j? CJ P-14F-1 < -u < use c, p+, p a < (J C5u+, ppea cpra <m ω-C50 low CJ +-I CJ-C J? (ψ　(JW(jΦa＜　a＜　C5＜　Q＜　ucb　＜C/)C5 +'6　B=+Uri　(J:5　cpe　uaL)p-1<ps　C5>　(1 knee <r-+ <+acp< CJLI hp ucp ucp a<ku> ○ 1) C Co Q Co Li-0 mouth 8self 8; shi 3 ji 3 and δ 8 Kuko Qko Qψ Q's loco Q cut 3, please; 3, please; I++u=+t-+<bo u"tum cy+uw c-"+u-to u.

NtG5 Owl Yomi = 8th day = Tomae Shi and δ Ka8 and 0 - ω> 0> 0 Haiku 0ri riichi shi>, g 8 death 8; seedlings shig Loco u> pc Cj1-ro1) Kutaji 5 8ki 1 ton:= a=, = international search report 1, #, l, 111. PCT/US89103417

Claims (1)

[Claims] Embodiments of the invention that claim exclusive rights or privileges are described below. . 1. 1. A method of stabilizing heterologous protein expression in a prokaryotic host, the method comprising: (a) Amyloid protein A4-751 insertion sequence, glucagon-like peptide I, a Gypsin/D, lung surfactant protein SP-B and lung surfactant protein SP-C a heterologous gene sequence and sequence encoding a mammalian polypeptide selected from the group consisting of 3'-truncated chloramphenicol acetyl fused within the frame transferase (CAT) gene sequence of CAT gene and heterologous gene. constructing a hybrid gene comprising the polypeptide in sequence; conditions, which cannot be recovered in bacterial expression systems and, upon translation, the high The BRID gene produces the fusion protein in recoverable yield; (b) providing a vector for the expression of said hybrid gene; (c) culturing said prokaryotic host transformed with said expression vector; and Beauty (d) recovering the fusion protein. 2. 2. The method of claim 1, wherein the prokaryotic host is a bacterial cell. 3. The bacterial cells are E. 3. The method according to claim 2, wherein the method is E. coli. 4. A heterologous species in which the 3'-truncated CAT gene sequence is present in all cellular proteins. 2. The method of claim 1, wherein the level of protein is increased. 5. The truncated CAT gene sequence has a length of about 73 to about 210 amino acids. 2. The method of claim 1, wherein the method encodes a T peptide. 6. The hybrid gene further comprises the CAT gene sequence and a heterologous gene. Claim 1 or 2 comprising a DNA sequence encoding a selective cleavage site located between the sequences. or the method described in 5. 7. The selective cleavage site is tributophane, methionine, asparagine-glycine. or glutamic acid. 8. 1. A method of stabilizing heterologous protein expression in a prokaryotic host, the method comprising: (a) Amyloid protein A4-751 insertion sequence, glucagon-like peptide I, a Dibusin/D, lung surfactant protein SP-B and lung surfactant protein SP-C a heterologous gene sequence and sequence encoding a mammalian polypeptide selected from the group consisting of CAT peptides of about 73 to about 180 amino acids fused within the frame Chloramphenicol with truncated 3' part encoding acetyltransfera (CAT) gene sequence, a CAT gene and a heterologous gene in this order. constructing a lid gene; wherein the heterologous protein under normal conditions During translation, the hybrid gene cannot be recovered in a bacterial expression system. (b) for the expression of said hybrid gene; to provide vectors of (c) culturing the prokaryotic host transformed with the expression vector; and Beauty (d) recovering the fusion protein. 9. The hybrid gene further comprises the CAT gene sequence and a heterologous gene. Claim 8 comprising a DNA sequence encoding a selective cleavage site located between the sequences. Method described. 10. Increases the expression level of non-stable, heterologous polypeptides produced by bacteria A bacterial expression vector capable of amyloid protein A4-751 insertion sequence, glucagon-like peptide I, ajibushi from lung surfactant protein SP-B and lung surfactant protein SP-C. a heterologous gene sequence encoding a mammalian polypeptide selected from the group consisting of: A CAT gene sequence with a truncated 3' portion is included in the order of the CAT gene and the heterologous gene. The polypeptide contains a hybrid gene containing a bacterial expression system under normal conditions. the truncated CAT gene sequence could not be recovered in the resulting fusion tag. It is possible to make proteins resistant to degradation by proteolytic enzymes, Expression vector. 11. The truncated CAT gene sequence has a length of about 73 to about 210 amino acids. 11. The method of claim 10, wherein the method encodes an AT peptide. 12. The hybrid gene further comprises the CAT gene sequence and the heterologous gene. Claim 1 comprising a DNA sequence encoding a selective cleavage site located between child sequences. 12. The bacterial expression vector according to 0 or 11. 13. The hybrid gene having the CAT gene sequence with the 3′ portion truncated, Increases the level of heterologous protein present in the total protein of the cell upon expression, claims The vector according to item 12. 14. Increases the expression level of non-stable, heterologous polypeptides produced by bacteria A bacterial expression vector capable of The vector contains polypeptides that cannot be recovered in bacterial expression systems under normal conditions. A CAT gene sequence with a truncated 3' portion linked to a heterologous gene sequence encoding Tide , a CAT gene and a heterologous gene in this order, The truncated CAT gene sequence allows the resulting fusion protein to be degraded by proteolytic enzymes. and in the expression vector, The truncated C to remove potential chemical cleavage sites within the CAT protein. An improved bacterial strain in which one or more DNA codons of the AT gene have been changed. Current vector. 15. The conversion is performed on a) a DNA encoding methionine at position 67 of CAT; into the DNA encoding isoleucine or leucine; b) the residue at position 31 of CAT stain into the DNA encoding serine; or c) at position 16 of CAT. Replacing the DNA encoding tributophane with the DNA encoding tyrosine 33. The improved bacterial expression vector of claim 32, comprising: