JPH05317049A - Promoter for expression and its use - Google Patents

Abstract

PURPOSE:To provide a promoter containing the promoter region of a brain- originated neurotrophic factor (BDNF), efficiently expressing a BDNF gene and other genes, and useful for the production of diseased model animals and therapeutic medicines, for the searches of medicines, etc. CONSTITUTION:The production of the expression promoter containing the DNA of the promoter region of the BDNF having the base sequence of the formula, etc., is performed as follows: using a cDNA library originated from a human glioma, multiplying a swine BDNF gene by a PCR method using an oligonucleotide comprising a part of a swine genome BDNF, screening the multiplied genes by a plaque hybridization method using a restriction enzyme- treated fragment as a probe, screening a human genome DNA library originated from a human placenta while using the restriction enzyme-treated fragment of the cDNA of a human BDNF obtained from the obtained positive clone, selecting a positive clone, recovering its DNA, treating the DNA with a restriction enzyme, and subsequently recombining the treated DNA fragment with a vector.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a novel gene expression promoter and its use. More specifically, the present invention relates to a recombinant DNA containing a promoter region of brain-derived neurotrophic factor (BDNF) gene, a recombinant DNA containing the DNA, and a transformant.

[0002]

2. Description of the Related Art In animals, especially higher animals, various organs are differentiated and matured from the time of their development, and various functions of living bodies can be exerted. During this process, transient or constitutive expression of various organ-specific proteins occurs,
It gives specificity to the organ. The gene of a protein that is specifically expressed in the fetal and maturation stages of development / differentiation has a transcription induction system (promoter, enhancer) that operates only during that period, and this promoter part is responsible for protein synthesis. It controls the transcription of directed mRNAs. Furthermore, promoters that are hormone-dependent or growth-factor-dependent are also known, and drug screening systems and transgenic mice using these promoters have already been created and used for drug screening and analysis of biological functions. Has been done.

[0003]

Therefore, by using a promoter portion that operates only during the fetal or maturation stage of development / differentiation, genes encoding various proteins are linked downstream thereof, and the gene is injected into an egg cell. If a so-called transgenic animal (transgenic animal) is created, it becomes possible to synthesize the protein only during the fetal and maturation stages of development / differentiation and study its action in the living body. Further, by connecting an appropriate reporter gene to the above promoter part and establishing a cell line in which it is expressed, it can be used as a screening system for a drug having an action of promoting or suppressing BDNF synthesis. However, no clear expression timing specificity was detected in the promoters that direct transcription of most genes, and promoters showing specificity have been craved. Neurotrophic factor is a trophic factor that is essential for the differentiation, growth and survival of nerve cells, and has been known as NGF (Leui-Monntalcin).
i, Ann. NY Acad. Sci. 55 : 330, 1952),
NGF-2 / NT-3 (European Patent Application Publication No. 38
6,752) and BDNF (J. Leibrock et al.,
Nature 341 : 149, 1989) and the like are known. Of these, BDNF is suggested to be synthesized from the embryonic stage at the 5th week after the synthesis of its mRNA (Y. Kaisho et al., Bioch).
em. Biophy. Res. Commun., 174 , 379, 199
1). The central nervous system is composed of nerve cells (neurons) and glial cells (glia cells) differentiated from the neural tube, and can be said to be a cellular society that performs complex functions. The promoter that specifically functions at a specific stage of differentiation in the nervous system is useful as a means for analyzing the regulatory mechanism of the expression of nerve-specific proteins for functional differentiation. Also, by linking various genes downstream and transferring them into cells or animals, they can be specifically expressed in neural cells or brain at a specific time.

[0004]

[Means for Solving the Problems] As a promoter that operates at a specific time of development / differentiation, the present inventors have
The human BDNF genomic gene was cloned using the human BDNF cDNA fragment as a probe, with the goal of finding and removing the F gene promoter. This gene was digested with a restriction enzyme to obtain a 2.5 kb DNA in the upstream portion containing a part of the structural gene encoding BDNF, which was cloned again on the plasmid DNA. Downstream of this 2.5 kb DNA, chloramphenicol acetyl transferase (CA) as a reporter gene.
T) constructing a plasmid DNA ligated with the gene,
By measuring the CAT activity in transformants such as glial cells or other animal cells transformed with NA,
The upstream portion of the BDNF structural gene, 2.5 kb DNA, contained BDN
I was able to find the F promoter.

The present inventors have completed the present invention as a result of further research based on these findings. That is, the present invention provides (1) a recombinant DNA containing the promoter region of the BDNF gene, (2) a recombinant vector containing the recombinant DNA according to (1) above, and (3) a structural gene linked downstream. The present invention relates to the recombinant vector according to (2) above, and (4) a transformant carrying the vector according to (2) or (3) above. The promoter of the BDNF gene described in (1) above is preferably of human origin. Also what the promoter region containing the content or part of the following nucleotide sequence TGCTGGGATGGGGAGGAAGGGGAGAGTTGAAAGCTAGGGGAGCGAGACCTCGGGGCGTGCGATTCTCACTCG CTCCCTCCCGCCCCAGCGCCCACAGCCGGGGTTTCTGCAGAGGGAGAGGGACGCGGGGTTCCCCGGGGCTGA GGCTGGGGCTGGAACACCCCTCGAAGCCGCGGGCGTCCTGTCCAAGGCGCCCCAGGAGGGCGCAGGACTCGC AGGGCGATGTCGCGGGGCCCTAGGGGAGGAGGTGAGGACAGGCCCCGGGGGAGCGGGGAGTTCCGGGCGCCC CTCGGTTTCCCCGCGCGAGGAAAAGACGCGGCGTTCCCTTTAAGCGGCCGCCTCGAACGGGTATCGGTAGCG CGGGCGAGCGGGGAGCGGGGGGCGGGGGGCGGGGGGGGGGGCGGCGCCGTTTGACCAATCGAAGCTCAACCG AAGAGCTAAATAATGTCTGACCCGGGCGCAAG are preferred. As a part of the above, a part of the base sequence,
It means a portion having promoter activity.

The recombinant DNA containing the BDNF promoter region of the present invention can be obtained, for example, as follows. First, Nature, 341 , 1
49 (1989), a synthetic oligonucleotide corresponding to the amino acid sequence of porcine BDNF is used as a probe to screen a human brain cDNA library incorporated into the λgt10 vector. Using the uppermost stream region of the thus obtained cDNA as a probe, for example, a human gene library is screened to obtain a clone of λ phage that reacts with this probe. DNA is extracted from this phage clone, a restriction enzyme map of the incorporated human gene portion is prepared, and a DNA fragment that reacts with the uppermost basin probe of cDNA, for example, by digestion with a restriction enzyme is used, for example, plasmid pUC118 (Vieira.
J. and Messing J. (1987), Methods in Enzymolo
gy 153 , 3-11.). The position of the translation initiation codon on the gene can be known by determining the base sequence of the cloned DNA and comparing it with the base sequence of the cDNA, for example. Further, using human mRNA, for example, SI mapping method [B
erk, AJ, and Sharp, PA, Cell, 12 , 7
21, 1977], the transcription start point of the gene can be known.

In the recombinant vector containing the recombinant DNA containing the BDNF promoter region thus obtained, the recombinant vector incorporating the BDNF promoter is not particularly limited, and examples thereof include pCD vector and cDM8. Vectors [Aruffo, A. and Se
ed, B., Proc. Natl. Acad. Sci.
USA), 84 , 8573-8577 (1987)],
Retrovirus vector [Cone, RD and Mulligan,
RC, Proc. Natl. Acad. Sci,
USA), 81 , 6349-6353 (1984)] for animal cells, pUC (Vieira, J. and Messing
J. (1987), Methods in Enzymology 153 , 3
-11) and the like for E. coli.

[0008] The structural gene linked to the downstream of the promoter region in the recombinant vector encodes a polypeptide for knowing the functions of various gene products in the central nervous system during the fetal and maturation stages of development and differentiation. Structural genes are mentioned. Examples thereof include nerve cell growth factor (NGF) and basic fibroblast growth factor (basi).
c FGF), acidic fibroblast growth factor (acidic FG)
Other growth factors including neurotrophic factors such as F), lymphokines and the like. As the structural gene,
You may use the reporter gene mentioned later. As a reporter gene, CAT (Chloramphenicol acetyl trans
ferase) gene and alkaline phosphatase gene, β-galactosidase gene is widely used, but any other structural gene can be used if there is a method for detecting its gene product. In order to incorporate the structural gene into a vector, it may be ligated to an appropriate restriction enzyme cleavage site located downstream of the promoter region in the direction in which the structural gene is correctly transcribed. Animal cells, particularly glial cells and cranial nervous system cells, can be used as the host transformed with the recombinant vector. Egg cells or ES cells [Evans, MJ and Kaufman, KH, Nature (Na
ture), 292 , 154 (1981)] are also used.
As a method for transforming these cells, the calcium phosphate method [Graham et al., Virology 52 ,
456 (1973)], electroporation method [Ishizaki et al., Cell engineering, 5 , 557 (1986)], microinjection method and the like.

[0009] By using the promoter of the present invention, cells such as the cranial nervous system can be made to produce various polypeptides as described above. When an oncogene such as myc or ras is used as the above structural gene, the obtained vector is administered to an animal (eg, mouse, rat, dog, cat), and the fetus of development and differentiation in the cranial nervous system of the animal is administered. It is possible to produce a disease model animal in which a specific lesion such as a cancer is caused in the adolescent or mature stage. Furthermore, in the case where the above structural gene encodes a peptide useful for treatment of genetic diseases of the brain (eg, Alzheimer's disease, Parkinson's disease, etc.), the vector of the present invention is directly administered to a mammal (eg, mouse, Rats, dogs, cats, humans) can be treated in the brain, or the vector can be introduced into cultured brain-derived cells and then transplanted into the brain to treat the disease.

Further, a brain tumor can be treated by constructing a vector using a tumor suppressor gene as a structural gene and directly introducing the vector into tumor cells. Furthermore, if it is known that the promoter of the present invention controls the promoter activity of a specific compound in cells of the cranial nervous system, when the specific compound is administered so as to reach the brain of the living body, Since the ability of the compound to control the promoter activity can be known, the compound activates the BDNF gene promoter in the brain to increase the amount of BDNF produced in the brain, whereby dementia can be treated.
The transformant is cultured in the presence of the specific compound,
By measuring and comparing the amount of the gene product in the culture, the ability of the compound to control the promoter activity can be known.

The transformant is cultured by a method known per se. Examples of the medium include MEM medium containing about 5 to 20% bovine serum [Science 122 ,
501 (1952)], DMEM medium [Virology 8 , 396 (1959)], RPMI 1
640 medium [The Journal of the American
Medical Association (The Journal of Medic
al Association) 199 , 519 (1967)], 19
9 Medium [Proceeding of the Society for the Biological Medicine (Proceeding o
f the Society for the Biological Medicine) 73 ,
1 (1950)] and the like. The pH is preferably about 6-8. Culturing is usually performed at about 30 to 40 ° C for about 1
Perform for 5 to 60 hours, adding aeration and agitation as needed.

In the present specification and drawings, when abbreviations are used for bases, amino acids, etc., IUPAC-IUB
It is based on the abbreviations by Commision on Biochemical Nomenclature or the abbreviations commonly used in this field. When amino acids may have optical isomers, they are L-forms unless otherwise specified. DNA: Deoxyribonucleic acid cDNA: Complementary deoxyribonucleic acid A: Adenine T: Thymine G: Guanine C: Cytosine A, Ala: Alanine C, Cys: Cysteine D, Asp: Aspartic acid E, Glu: Glutamic acid F, Phe: Phenylalanine G, Gly: Glycine H, His: Histidine I, Ile: Isoleucine K, Lys: Lysine L, Leu: Leucine M, Met: Methionine N, Asn: Asparagine P, Pro: Proline Q, Gln: Glutamine R, Arg: Arginine S, Ser: Serine T, Thr: Threonine V, Val: Valine W, Trp: Tryptophan Y, Tyr: Tyrosine

The transformants Escherichia coli DH1 / pTB1429 obtained in Examples 2 and 3 described later.
And Escherichia coli DH1 / pTB1528 have been deposited in the Institute for Fermentation (IFO) and the Institute for Microbial Technology (FRI), Ministry of International Trade and Industry. The deposit date and deposit number are shown in Table 1 below.

[Table 1] −−−−−−− ────────────────────────────────────────────────────── ───────────────────────────────── Escherichia coli DH1 / pTB 1429 IFO 15180 FERM BP-3427 (May 1991) 17 days) (May 29, 1991) Escherichia coli DH1 / pTB 1528 IFO 15332 Postal underwriting number (underwriting date) (May 28, 1992) 163-14-46806-3 (May 29, 1992) ─ ──────────────────────────────── −−−−

Reference Example 1 Cloning of human BDNF cDNA Using 1 μg of porcine genomic DNA (manufactured by Clontech) as a template, previously reported porcine genomic BDNF (J. Leibr).
5'-GACCATCCTTTTCCTTACT from base number 169 to 188 of ock et al., Nature 341 , 149 (1989)).
-3 'and 5', which is the complementary strand from 907 to 926
-CACTATCTTCCCCTCTTAAT PCR method using 3'oligonucleotide primer (94 ℃ 1min, 60 ℃
2min, 72 ℃, 3min, 30cycles) Pig BDN
After the F gene was amplified, it was digested with Sau3AI to prepare a 540 bp fragment, which was used as a probe for human glioma cDNA.
1 × 10 ⁷ phages of the library (manufactured by Clontech) were screened by a plaque hybridization method using a nitrocellulose filter.
The reaction was 6 × SSC (1 × SSC = 0.15M NaC).
l, 0.015M Sodium Citrate), 5 × Denhalt's
100 μg / ml, heat denatured salmon sperum DNA
Performed in 0.1% SDS at 65 ° C. for 16 hours. After the reaction, put the filter in 2 × SSC room temperature for 5 minutes 3 times and further 1 × S
It was washed at SC65 ° C. for 1.5 hours. After washing, a radio-gram of the filter was taken (Kodak XAR-5 film) to search for a phage that reacts with the probe.
As a result, 1.3 kb cDNA was digested with the restriction enzyme EcoRI.
We were able to obtain the phage λhBDNF # 7 which gave the fragment. The cDNA of phage λhBDNF # 7 is human B
It was found to contain the entire structural region of DNF and about 0.3 kb of 5'and 3'untranslated regions [Fig. 1]. The human BDNF amino acid sequence predicted from the nucleotide sequence consisted of 247 amino acid residues, had 92% homology with porcine BDNF, and had a 100% agreement with the region considered to be the mature protein portion.

Example 1 Cloning of human BDNF genomic DNA 5'untranslated region EcoR of the obtained human BDNF cDNA
Using the I-DraIII 280 bp fragment [FIG. 1] as a probe, 2 × 10 ⁶ phages of human genomic DNA library (derived from Clontech human placenta genomic DNA) were screened. The reaction is 6 × SSC, 5 × denhalt's 100
μg / ml heat denatured salmon sperum DNA, 0.1
% SDS at 65 ° C. for 16 hours. After the reaction, filter the filter at 2 x SSC at room temperature for 15 minutes twice, then 1 x SSC.
The cells were washed twice at 65 ° C for 15 minutes, and radioautograms of the filter were collected to search for phages that react with the probe. As a result, 4 kinds of positive clones were obtained from 2 × 10 ⁶ phages, and all clones were confirmed to have EcoRI 1. by Southern blot hybridization.
The 5 kb fragment was shown to cross the probe. So, this EcoRI 1.5 kb fragment and its upstream about 1.6 kb
The entire base sequence was determined for the above, and this is shown as a sequence of [FIG. 2], [FIG. 3] and [FIG. 4]. That is, the nucleotide sequence of about 3.3 kb containing the 5'upstream region of the human BDNF gene obtained here is shown as a continuous sequence of [Fig. 2], [Fig. 3] and [Fig. 4]. As shown in [FIG. 2], [FIG. 3] and [FIG. 4], +29 to +294 completely matched the nucleotide sequence of human BDNF cDNA λhBDNF # 7. Further, TATA box-like sequences (-26 to -19) and CAAT b are located upstream from the 5'end of cDNA.
Since the ox-like sequence (-49 to -46) was observed, it was shown that the vicinity of this region is the promoter region of the human BDNF gene, and the region downstream from +294 is an intron.

Example 2 Assay of Promoter Activity of Human BDNF Gene In order to confirm that the cloned genomic DNA fragment has promoter activity, a CAT assay method, which is one of the promoter activity test methods, was performed. The plasmid having CAT as a reporter gene is pCAT-Basic plasmi.
d, pCAT-Enhancer plasmid (Promega) was used as a vector. PCAT-Control p for positive control
lasmid (manufactured by Promega) was used. The upstream part from the SacI site of the human BDNF genomic gene was isolated and blunted with T4 DNA polymerase, and then HindIII linker (pCAA
The fragment added with GCTTG (Takara Shuzo) was introduced into the vector at the HindIII site upstream of the CAT gene. Deletion of the 5'upstream region was carried out using a TAKARA kilosequencing deletion kit. Infection of the plasmid into human glioma Hs683 cells, calcium phosphate method (M. Wigler et al., Cell 1 6, 777 (1979 ))
Was used. After infection, the cells were cultured in DMEM medium containing 10% FCS (fetal calf serum), and cells were collected 48 hours later. The CAT enzyme activity of the cell extract was measured. For CAT enzyme activity, cell extract was added to 5 mM Acetyl Co
A, in the presence of 0.25 μCi ¹⁴ C-chloramphenicol 3
After reacting at 7 ° C. for 4 hours, the mixture was extracted with ethyl acetate, the ethyl acetate was evaporated to dryness, and the residue was dissolved in 15 μl ethyl acetate, and 7.5 μl thereof was spotted on a thin layer plate (Merck). After developing with a developing solvent of CHCl ₃ : Methanol = 95: 1, an autoradiogram was taken. First, −2374 to + in [FIG. 2], [FIG. 3] and [FIG. 4]
The 2.4 kb DNA fragment up to 11 was digested with pCAT-Basic plas
The expression plasmid pTB1429 inserted into mid was constructed. To preserve this plasmid pTB1429, it was used to transform E. coli DH1 and transformant E.
coli DH1 / pTB1429 (IFO 15180, F
ERM BP-3427) was prepared.

Human glioma Hs683 cells were transformed with the above plasmid pTB1429 to prepare transformant human glioma Hs683 / pTB1429.
This transformant was subjected to 2 in DMEM medium containing 10% FCS.
After culturing for one day, the cells were collected, and the cell extract was subjected to the method of Widen. SG et al. (J. Biol. Chem. 263 , 1).
6992-16998 (1988)). The results are shown in lane 1 of FIG. 5 and FIG.
Shown in. In addition, [FIG. 5] shows the range of the 5 ′ upstream region of the human BDNF gene contained in the used plasmid, and [FIG. 6] shows the result of the autoradiogram of the result of the CAT assay. As shown in FIG. 6, C expressed under the control of the SV40 early promoter used as a positive control (shown as lane P in FIG. 6).
A clear CAT activity was observed, although it was lower than the AT activity, and it was confirmed that a DNA fragment having a functional promoter activity was present in this genomic DNA fragment. Next, various deletion mutants were constructed in order to know whether the expression of activity was controlled by the presence of so-called silencer enhancers, and the same CAT assay was performed.
I did. The results are shown in [FIG. 5] and [FIG. 6].
In FIGS. 5 and 6, lanes 1 to 8 are pTB1429, pTB1430, and pTB143, respectively.
2, pTB1433, pTB1434, pTB1435,
The results of transfection of pTB1436 and pTB1437 are shown below. In addition, pTB1430
For the region from −2158 to +11, pTB1432
The pTB1433 region from -1751 to +11 is
The region from -1493 to +11 is pTB1434,
For the region from -908 to +11, pTB1435 has-
The area from 699 to +11 is -4 in pTB1436.
The region from 63 to +11 is -30 for pTB1437.
The area from 8 to +11 is pCAT-Basic
This is a vector introduced into a plasmid. As shown in [FIG. 5] and [FIG. 6], CAT activities were observed in the upstream side from −463 to +11 without any significant difference, whereas the activity was not observed in −308 to +11. It was In addition, the -308 to +11 DNA fragment was added to SV4
CAT vector pCAT-Enhan with 0 enhancer
When it was introduced into cer plasmid and the same assay was performed, an activity about 10 times that of the negative control was observed [Fig. 7]. Lane P in FIG. 7 is a positive control (pCA
T-Control plasmid), lane N the negative control (pCAT-Enhancer plasmid), lanes 1 to 3
Is −699 to +11, −463 to +11, −308 to
Human BDNF gene fragments up to + 11
PTB1438, p introduced into AT-Enhancer plasmid
The results obtained by transfecting TB1439 and pTB1440 are shown below. From the above, human BDN
There is no clear silencer in the F gene promoter, and the core promoter activity is -3.
It was considered that it was suggested that 08 was sufficient and that a region having an enhancer activity was present in the region of -463 to -308.

Example 3 Establishment of Human Glioma Hs683 Stable Strain Introduced with Human BDNF Promoter-Alkaline Phosphatase Fusion Plasmid The construction of a plasmid using alkaline phosphatase as a reporter gene is shown in FIGS. 8 and 9.

[Chemical 1] 6 , 1-10 (1988)) EcoRI-KpnI.
The 2.0 Kbp fragment was isolated and blunted with T4 DNA polymerase before EcoRI linker (pGGAA).
TTCC (Takara Shuzo) was added to the vector pTB
389 (Y. Ono et al., Science 236 , 1116-112.
0 (1987)) pT introduced on EcoRI site
B1330 was constructed. Next, Hind of pTB1330
After isolation of III-XhoI 4.7 kb and blunting with T4 DNA polymerase, pTB1329 ligated with T4 DNA ligase was constructed and used as a vector. Human BDNF genomic gene EcoRI-SacI
0.7 kbp was isolated, blunted with T4 DNA polymerase, and then HindIII linker (pCAAGCTT).
GTB Takara Shuzo) -added fragment was introduced into the vector at the HindIII site upstream of the alkaline phosphatase gene to construct pTB1528. This plasmid pTB
E. coli DH1 was transformed with the transformant E. coli DH1 / pTB15
28 (IFO 15332, FRI mail acceptance number 163
-14-46806-3, underwriting date May 29, 1992). The drug resistance marker is pTB6 (R. Sasa
da et al., Cell Structure and Function 12 , 205-2
17 (1987)). pTB1528 and pTB
6 were simultaneously infected with human glioma Hs683 cells, and 500 μg / ml G418 (O-2-Am
ino-2,7-dideoxy-D-glycero-α-D-glucoheptopyranosyl
[1 → 4] -O-3-deoxy-4C-methyl-3- [methylamino] -β-L-ar
abinopyranosyl-D-streptamine, Sigma), 10% F
The cells were cultured in DMEM medium containing CS (fetal calf serum) to obtain neomycin resistant strains. From the obtained neomycin resistant strain, two clones stably expressing alkaline phosphatase were obtained. Alkaline phosphatase activity is obtained by using p-nitrophenylphosphate as a substrate.
Measured as an increase in ₄₀₅ absorbance. Culture supernatant at 65 ° C 5
100 μl of supernatant after centrifugation at 12000 × g for 5 minutes
1 x SEAP assay buffer (1.0M diethano
lamine, pH 9.8, 0.5 mM MgCl ₂ , 10 mM
L-homoarginine) and the final volume was 200 μl. Place in a 96-well microtiter plate and add 20 μl of 120 mM p-nitrophenylphosphate.
(In 1 × SEAP assay Buffer) was added to measure A ₄₀₅ . Alkaline phosphatase 1mU is 1pmole
The amount of alkaline phosphatase that hydrolyzes the substrate in 1 minute is defined as 1 mU = 0.04ΔA ₄₀₅ / min.
[FIG. 10] shows the two clones (Hs683 /
pTB1528-1 and Hs683 / pTB1528
The cell growth curve and alkaline phosphatase activity of -2) are shown.

[0019]

INDUSTRIAL APPLICABILITY Since the BDNF promoter of the present invention has an effect of efficiently expressing a gene, it is used as a promoter to be incorporated into a vector used in the production of disease model animals, treatment of biological diseases, setting of drug screening systems and the like. it can.

[Brief description of drawings]

FIG. 1 shows the nucleotide sequence of cloned human BDNF cDNA obtained in Reference Example 1 and the amino acid sequence translated therefrom.

FIG. 2 shows the nucleotide sequences from -2373 to -1294 in the human BDNF gene 5'upstream region obtained in Example 1.

FIG. 3 shows the nucleotide sequences of -1293 to -214 in the 5'upstream region of the human BDNF gene obtained in Example 1.

FIG. 4 shows the nucleotide sequences from −213 to +879 containing the 5 ′ upstream region of the human BDNF gene obtained in Example 1.

FIG. 5: Human BDN contained in the used plasmid
The range of the 5'upstream region of the F gene is shown.

FIG. 6 shows an autoradiogram of the CAT assay results obtained in Example 2.

FIG. 7 shows an autoradiogram of the results of the CAT assay obtained in Example 2.

FIG. 8 shows the plasmid pTB1 obtained in Example 3.
329 represents a construction drawing.

FIG. 9 shows the plasmid pTB1 obtained in Example 3.
5 represents a construction drawing of 528.

FIG. 10 shows the results of cell growth curves and alkaline phosphatase activity for the two clones obtained in Example 3.

[Explanation of symbols]

 A represents the growth curve. B represents alkaline phosphatase activity. ● represents the result of Hs683 / pTB1528-1.

[Chemical 2]

─────────────────────────────────────────────────── ───

[Procedure amendment]

[Submission date] June 9, 1992

[Procedure Amendment 1]

[Document name to be amended] Statement

[Correction target item name] 0013

[Correction method] Change

[Correction content]

The transformants Escherichia coli DH1 / pTB1429 obtained in Examples 2 and 3 described later.
And Escherichia coli DH1 / pTB1528 have been deposited in the Institute for Fermentation (IFO) and the Institute for Microbial Technology (FRI), Ministry of International Trade and Industry. The deposit date and deposit number are shown in Table 1 below.

[Table 1] −−−−−−− ────────────────────────────────────────────────────── ───────────────────────────────── Escherichia coli DH1 / pTB 1429 IFO 15180 FERM BP-3427 (May 1991) 17 days) (May 29, 1991) Escherichia coli DH1 / pTB 1528 IFO 15332 FERM P-12979 (May 28, 1992) (June 1, 1992) ──────────── ────────────────────── −−−−

[Procedure Amendment 2]

[Document name to be amended] Statement

[Correction target item name] 0018

[Correction method] Change

[Correction content]

Example 3 Establishment of Human Glioma Hs683 Stable Strain Introduced with Human BDNF Promoter-Alkaline Phosphatase Fusion Plasmid The construction of a plasmid using alkaline phosphatase as a reporter gene is shown in FIGS. 8 and 9.

[Chemical 1] 6 , 1-10 (1988)) EcoRI-KpnI.
The 2.0 Kbp fragment was isolated and blunted with T4 DNA polymerase before EcoRI linker (pGGAA).
TTCC (Takara Shuzo) was added to the vector pTB
389 (Y. Ono et al., Science 236 , 1116-112.
0 (1987)) pT introduced on EcoRI site
B1330 was constructed. Next, Hind of pTB1330
After isolation of III-XhoI 4.7 kb and blunting with T4 DNA polymerase, pTB1329 ligated with T4 DNA ligase was constructed and used as a vector. Human BDNF genomic gene EcoRI-SacI
0.7 kbp was isolated, blunted with T4 DNA polymerase, and then HindIII linker (pCAAGCTT).
GTB Takara Shuzo) -added fragment was introduced into the vector at the HindIII site upstream of the alkaline phosphatase gene to construct pTB1528. This plasmid pTB
E. coli DH1 was transformed with the transformant E. coli DH1 / pTB15
28 (IFO 15332, FERMP-12979)
Was produced. P is a drug resistance marker with the neo gene
TB6 (R. Sasada et al., Cell Structure and Function 1
2 , 205-217 (1987)) was used. pTB1
Human glioma Hs683 cells were simultaneously infected with 528 and pTB6, and 500 μg / mlG from 48 hours after infection.
418 (O-2-Amino-2,7-dideoxy-D-glycero-α-D-glucose
heptopyranosyl [1 → 4] -O-3-deoxy-4C-methyl-3- [methyl
amino] -β-L-arabinopyranosyl-D-streptamine, Sigma), DM containing 10% FCS (fetal calf Serum)
It was cultured in EM medium to obtain a neomycin resistant strain.
From the obtained neomycin resistant strain, two clones stably expressing alkaline phosphatase were obtained. Alkaline phosphatase activity is p-nitrophenylphosphat
It was measured as an increase in A ₄₀₅ absorbance using e as a substrate. The culture supernatant was treated at 65 ° C. for 5 minutes and then centrifuged at 12,000 × g for 5 minutes, and 100 μl of the supernatant was added to 1 × SEAP assay buffer (1.0 M diethanolamine, pH 9.8, 0.5 mM M
gCl ₂ , 10 mM L-homoarginine), and the final volume was 200 μl. Place in a 96-well microtiter plate and add 20 μl of 120 mM p-nitrop
Henylphosphate (in 1 × SEAP assay Buffer) was added to measure A ₄₀₅ . Alkaline phosphatase 1mU
Is the amount of alkaline phosphatase that hydrolyzes 1 pmole substrate in 1 minute, and 1 mU = 0.04ΔA ₄₀₅
/ Min. [Fig. 10] shows that the two clones (Hs683 / pTB1528-1 and Hs68) obtained.
3 / pTB1528-2) shows a cell growth curve and alkaline phosphatase activity.

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁵ Identification code Office reference number FI technical display location C12N 15/85 // C12N 15/16 (C12N 15/11 C12R 1:91)

Claims (6)

[Claims] 1. A recombinant DNA containing a promoter region of brain-derived neurotrophic factor (BDNF). 2. The recombinant DNA according to claim 1, wherein the promoter region is of human origin. 3. A promoter region following nucleotide sequence TGCTGGGATGGGGAGGAAGGGGAGAGTTGAAAGCTAGGGGAGCGAGACCTCGGGGCGTGCGATTCTCACTCG CTCCCTCCCGCCCCAGCGCCCACAGCCGGGGTTTCTGCAGAGGGAGAGGGACGCGGGGTTCCCCGGGGCTGA GGCTGGGGCTGGAACACCCCTCGAAGCCGCGGGCGTCCTGTCCAAGGCGCCCCAGGAGGGCGCAGGACTCGC AGGGCGATGTCGCGGGGCCCTAGGGGAGGAGGTGAGGACAGGCCCCGGGGGAGCGGGGAGTTCCGGGCGCCC CTCGGTTTCCCCGCGCGAGGAAAAGACGCGGCGTTCCCTTTAAGCGGCCGCCTCGAACGGGTATCGGTAGCG CGGGCGAGCGGGGAGCGGGGGGCGGGGGGCGGGGGGGGGGGCGGCGCCGTTTGACCAATCGAAGCTCAACCG AAGAGCTAAATAATGTCTGACCCGGGCGCAAG the content or claim 1 wherein the recombinant DNA containing a part thereof. 4. A recombinant vector containing the recombinant DNA according to claim 1. 5. A structural gene is linked downstream.
The recombinant vector described. 6. A transformant carrying the recombinant vector according to claim 4 or 5.