JPH04117285A - Dihydrofolate reductase-antiallergic pentapeptide polymer fused protein (i) - Google Patents

Abstract

NEW MATERIAL:A recombinant plasmid containing a base sequence encoding dihydrofolate reductase-antiallergic peptide polymer fused protein (I). EXAMPLE:A recombinant plasmid wherein an antiallergic pentapeptide, a fused protein (I) of dimer contains an amino acid sequence shown by the formula (underline shows amino acid existing between dihydrofolate reductase and antiallergic pentapeptide). USE:Production of DSDGK. PREPARATION:A DNA encoding DSDGK polymer obtained by chemically synthesizing a single strand DNA and annealing both chains is inserted into a vector plasmid capable of manifesting DHFR.

Description

[Detailed Description of the Invention] [Industrial Application Field] The present invention relates to dihydrofolate reductase (hereinafter abbreviated as DHFR) and an antiallergic peptide aspartic acid (Asp)-serine (Ser)-aspartic acid. (As
A novel recombinant plasmid that enables mass production of a fusion protein (I) containing a multimer of a peptide (hereinafter abbreviated as DSDGK) consisting of a 5-amino acid sequence of p)-glycine (Gly)-lysine (Lys) , Escherichia coli containing the plasmid, DHFR-DSDGK multimer fusion protein (I), method for producing DHPR-DSDGK multimer fusion protein (I), method for producing DSDGK multimer, and method for producing DSDGK. .

The present invention can be effectively utilized in fields such as fermentation engineering and pharmaceutical industry.

[Conventional technology]

DSDGK is a type of anti-allergic peptide,
It is an interesting bioactive peptide that is expected to be used as a prophylactic and therapeutic agent for allergic rhinitis, allergic dermatitis, bronchial asthma, and other allergic diseases caused by chemical mediators (Japanese Patent Application Laid-Open No. −
No. 316398).

Chemical synthesis methods are generally known as methods for producing oligopeptides with a small number of amino acids, but in recent years, methods have been developed that allow easy production using genetic recombination technology. For example, Iwakura et al. created a plasmid pTP70-1 capable of expressing a large amount of DHPR in E. coli (Japanese Patent Application Laid-Open No. 63-267276), and made various modifications to the base sequence encoding the vicinity of the carboxyl-terminal amino acid of DHPR. Introducing a heterologous gene and producing a useful polypeptide D)I
It was produced in Escherichia coli in the form of fusion protein (I) with FR. An example of this is somatostatin (Unexamined Japanese Patent Publication No. 1-14
4977, JP-A-1-144995), and bradykinin (JP-A-1-252289).

In addition, in order to increase the production efficiency of DHPR, Iwakura et al. created a recombinant plasmid pTP using the rrnB gene, which is known as an efficient terminator region, and pTP70-1.
104-4 (Japanese Patent Application Laid-open No. 1-144979), and using it, we are also producing a recombinant plasmid pLEK1 that can express DHPR-leucine enkephalin fusion protein (I). Since the fusion protein (I) obtained here also retains the enzymatic activity of DHFR, its purification is easily carried out using the properties and activity of DI (FR).
It has been obtained by subjecting fusion protein (I) to bromo cyanide treatment or trypsin treatment and then purifying it by HPLC (Japanese Patent Application Laid-open No. 1-252290).

In these examples, the promoter region and terminator region are modified in order to increase the production amount of the target polypeptide, but it is not possible to produce a polypeptide in which multiple target polypeptides are linked in tandem. It has also been done (Japanese Unexamined Patent Publication No. 31090/1983).

[Problem to be solved by the invention]

An object of the present invention is to produce DSDGK in large quantities by genetic engineering techniques, and for this purpose, it is an attempt to create an effective plasmid incorporating a gene encoding a repeat multimer of DSDGK. This plasmid must meet the following requirements.

(i) Fusion protein containing repeating DSDGK (I
) (ii) The gene for fusion protein (I) can be expressed in large amounts (iii) The produced fusion protein (I) can be easily purified ( iv) Fusion protein! It is easy to separate DSDGK from (I) [Means for solving the problem] As a result of intensive research, the present inventors have found that the above problem can be solved by using the E. coli dihydrofolate reductase gene. Find out what can be solved and develop DHPR and DS based on that knowledge.
A recombinant plasmid incorporating a gene encoding a fusion protein (I) consisting of a multimer of DGK was created,
The present invention has been completed.

That is, the present invention resides in a recombinant plasmid containing the base sequence encoding the dihydrofolate reductase-antiallergic pentapeptide multimer fusion protein (I).

The antiallergic pentapeptide portion consists of the amino acid sequence of aspartic acid-serine-aspartic acid-glycine-lysine.

Dihydrofolate reductase in the above recombinant plasmid -
In the antiallergic pentapeptide multimer fusion protein (I), the fusion protein (I) in which the antiallergic pentapeptide is a dimer has the following amino acid sequence.

Met Ile Ser Leu Ile Ala^l
a Leu^la ValAsp Arg Val I
le Gly Met Glu Asn Ala Me
tPro Trp Asn Leu Pro^la A
sp Leu Ala TrpPhe Lys Arg
Asn Thr Leu Asn Lys Pro
Valle Met Gly Arg His Th
r Trp Glu Ser l1eGly Arg
Pro Leu Pro Gly Arg Lys A
sn l1e11e Leu Ser Ser Gin
Pro Gly Thr Asp AspArg
Val Thr Trp Val Lys
Ser Val Asp GluAla li
e Ala Ala Cys Gly As
p Val Pro Glulie Met V
al lie Gly Gly Gly Arg Va
l TyrGlu Gin Phe Leu
Pro Lys Ala Gln Lys
LeuTyr Leu Thr His Ile As
p^la Glu Vat GluGly Asp T
hr His Phe Pro Asp Tyr Gl
u Pr.

Asp Asp Trp Glu Ser Val
Phe Ser Glu PheHis Asp Al
a Asp Ala Gin Asn Ser t(i
s 5erTyr Glu Phe Glu Tie
Leu Glu Arg Arg lie phantom 1^sp
Ser Asp Gly Lys Asp Ser A
sp GlyLys (wherein represents an intervening amino acid between dihydrofolate reductase and antiallergic pentapeptide) A fusion protein in which the above antiallergic pentapeptide is a dimer (
Examples of base sequences encoding I) include the following base sequences.

ATG ATCAGT CTG ATT GCG GC
G TTA GCG GTAGAT CGCGTT A
TCGGCATG GAA AACGCCATGCCG
TGG AACCTG CCT GCCGAT CT
CGCCTGGTTT AAA CGCAACACCT
TA AAT^^A CCCGTG^TT ATG G
GCCGCCAT ACCTGG GAA TCA A
TCGGT CGT CCG TTG CCA GGA
CGCAAA AAT ATT＾TCCTCAGCA
GT CAA CCG GGT ACG GACGAT
CGCGTA ACG TGG GTG AAG TC
G GTG GAT GAAGCCATCGCG G
CG TGT GGT GACGTA CCA
GAAATCAG GTG ATT GGCGG
CGGT CGCGTT TATGAA CAG
TTCTTG CCA AAA GCG CA
A To A^ CTGTAT CTG ACG C
AT ATCGAC GCA GAA GTG
GAAGGCGACACCCAT TTCCCG GA
T TACGAG CCGGAT GACTGG GA
A TCG GTA TTCAGCGAA TTCCA
CGAT GCT GAT GCG CAG AAC
TCT CACAGCTAT GAG TTCGAA
ATT CTG GAG CGG CGG
ATCCGT GAT TCA GAT G
GCAAA GAT TCT GACGGTAA (In the formula, represents a base sequence encoding an amino acid that mediates dihydrofolate reductase and antiallergic pentapeptide.) Furthermore, a large amount of dihydrofolate reductase-antiallergic pentapeptide in the above recombinant plasmid. The fusion protein (I) in which the antiallergic pentapeptide is a trimer has the following amino acid sequence.

Met Ile Ser Leu Ile Ala A
la Leu Ala ValAsp Arg Val
lie Gly Met Glu Asn Ala
MetPro Trp Asn Leu Pro A
la Asp Leu Ala TrpPhe Ly
s Arg Asn Thr Leu As
n Lys Pro Vallie Met G
ly Arg Flis Thr Trp Glu S
er l1eGly Arg Pro Leu
Pro Gly Arg Lys Asn
1ieTie Leu Ser Ser Gin
Pro Gly Thr Asp AspArg Va
l Thr Trp Vat Lys Ser Val
Asp GluAla Ile Ala Ala
Cys Gly Asp Val Pro Glull
e Met Vat lie Gly Gly Gl
y Arg Vat TyrGlu Gln Phe
Leu Pro Lys Ala Gln Lys L
euTyr Leu Thr His lie Asp
Ala Glu Val GluGly Asp T
hr His Phe Pro Asp Tyr Gl
u Pr.

Asp Asp Trp Glu Ser Val
Phe Ser Glu PheHis Asp Al
a Asp Ala Gin Asn Ser His
5erTyr Glu Phe Glu lie L
eu Glu Arg Arg lie phantom 1^sp S
er Asp Gly Lys Asp Ser As
p GlyLys Asp Ser Asp Gly
Lys (in the formula, has the same meaning as above) The following nucleotide sequence is exemplified as a nucleotide sequence encoding the fusion protein award (I) in which the above antiallergic pentapeptide is a trimer.

ATG ATCAGT CTG ATT GCG GC
G TTA GCG GTAGAT CGCGTT A
TCGGCATG GAA AACGCCATGCCG
TGG AACCTG CCT GCCGAT CT
CGCCTGGTTT AAA CGCAACACCT
TA AAT AAA CCCGTGATT ATG
GGCCGCCAT ACCTGG GAA
TCA ATCGGT CGT CCG TTG
CCA GGA CGCAA AAT ATT^TC
CTCAGCAGT CAA CCG GGT ACG
GACGATCGCGTA ACG TGG GTG
AAG TCG GTG GAT GAAGCCAT
CGCG GCG TGT GGT GACG
TA CCA GAAATCATG GTG AT
T GGCGGCGGT CGCGTT TATGAA
CAG TTCTTG CCA AAA GCG C
AA AAA CTGTAT CTG ACG CAT
ATCGACGCA GAA GTG GAAGGC
GACACCCAT TTCCCG GAT TACG
AG CCGGAT GACTGG GAA TCG
GTA TTCAGCGAA TTCCACGAT G
CT GAT GCG CAG AACTCT CAC
AGCTAT GAG TTCGAA ATT CTG
GAG CGG CGG ATCCGT GAT
TCA GAT GGCAAA GAT T
CT GACGGTAAA GACTCG GACG
GG AAA (in the formula, - has the same meaning as above) Furthermore, the recombinant plasmid containing the nucleotide sequence encoding the fusion protein (I) in which the above-mentioned antiallergic pentapeptide is a dimer is stable in E. coli. This includes those that are replicated in E. coli and confer trimethoprim resistance and ampicillin resistance to the host E. coli, and that have a size of 4655 base pairs.

Furthermore, the recombinant plasmid containing the nucleotide sequence encoding the fusion protein (I), which is a dimer of the above-mentioned antiallergic pentapeptide, has the ability to be stably replicated in E. coli,
This includes those that confer trimethoprim resistance and ampicillin resistance to host E. coli and have a size of 4670 base pairs.

The recombinant plasmid mentioned above includes the recombinant plasmid pBBK7DA having the base sequence shown in FIG.

Furthermore, the above recombinant plasmid includes a recombinant plasmid pBBX5.6TA having the base sequence shown in FIG.

Furthermore, the present invention resides in E. coli transformed with the above recombinant plasmid.

Furthermore, the present invention resides in a dihydrofolate reductase-antiallergic pentabeptide dimer fusion protein (I) having the following amino acid sequence.

Met lie Ser Leu Ile Ala A
la Leu Ala ValAsp Arg Val
Ile Gly Met Glu Asn Ala
MetPro Trp Asn Leu Pro Al
a Asp Leu Ala TrpPhe Lys
Arg Asn Thr Leu Asn Lys P
ro Vallie Met Gly Arg His
Thr Trp Glu Ser l1eGly
Arg Pro Leu Pro G1. y
Arg Lys Asn 1ie11e L
eu Ser Ser Ser Gin Pro G
ly Thr Asp AspArg Val
Thr Trp Val Lys Ser Val A
sp GluAla Ile Ala Ala Cys
Gly Asp Val Pro Glulle M
et Val Ile Gly Gly Gly Ar
g Val TyrGlu Gin Phe Leu
Pro Lys Ala Gin Lys LeuTy
r Leu Thr His Ile Asp Ala
Glu Val Glu Gly Asp Thr)
Iis Phe Pro Asp Tyr Glu P
r.

Asp Asp Trp Glu Ser Val P
he Ser Glu PheHis Asp Aha
Asp Ala Gin Asn Ser His
5erTyr Glu Phe Glu Ile Le
u Glu Arg Arg Ilephantom IAsp Se
r Asp Gly Lys Asp Ser Asp
Glyys (wherein - has the same meaning as above) Furthermore, the present invention resides in a dihydrofolate reductase-antiallergic pentapeptide dimer fusion protein (I) having the following amino acid sequence.

Met Ile Ser Leu Ile Ala A
la Leu Ala ValAsp Arg Val
Ile Gly Met Glu Asn Ala
MetPro Trp Asn Leu Pro Al
a Asp Leu Aha TrpPhe Lys
Arg Asn Thr Leu Asn Lys P
ro Valle Met Gly Arg His
Thr Trp Glu Ser l1eGly A
rg Pro Leu Pro Gly Arg Ly
s Asn l1elle Leu Ser S
er Gln Pro Gly Thr A
sp AspArg Val Thr Trp Va
l Lys Ser Val Asp GluAla
lie Ala Ala Cys Gly
Asp Val Pro Glulle Me
t Val Ile Gly Gly Gly Arg
Val TyrGlu Gln Phe Leu P
ro Lys Ala Gln Lys LeuTyr
Leu Thr His lie Asp Ala
Glu Val GluGly Asp Thr Hi
s Phe Pro Asp Tyr Glu Pr.

Asp Asp Trp Glu Ser Val P
he Ser Glu PheHis Asp Ala
Asp^Ia Gln Asn Ser His 5
erTyr Glu Phe Glu Ile
Leu Glu Arg Arg Ile
I! JiAsp Ser Asp Gly Lys A
sp Ser Asp GlyLys Asp Ser
Asp Gly Lys (wherein - has the same meaning as above) Furthermore, the present invention cultivates the transformed Escherichia coli, and produces the dihydrofolate reductase-antiallergic pentapeptide dimer fusion protein from the cultured cells. (I) or dihydrofolate reductase anti-allergic pentapeptide trimer fusion protein (I) characterized in that the dihydrofolate reductase anti-allergic pentapeptide trimer fusion protein (I) is obtained. It's in the manufacturing method. and,
The step of collecting the dihydrofolate reductase-antiallergic pentapeptide multimer fusion protein (I) is performed by sequentially using streptomycin treatment, ammonium sulfate precipitation, and mesotrixate-linked affinity chromatography from a cell-free extract of cultured bacteria. It includes a refining process.

Furthermore, the present invention provides an antiallergic pentapeptide consisting of the amino acid sequence aspartic acid-serine-aspartic acid-glycine-lysine by enzymatically treating the dihydrofolate reductase-antiallergic pentapeptide multimer fusion protein (I). The purpose is to collect.

The enzyme used in the above enzyme treatment includes trypsin.

The details of the present invention are described below: (I) Production of a novel recombinant plasmid, (2) Transformed E. coli, (3) DHFR-D
Manufacturing process of SDGK multimer fusion protein (I), (
4) Obtained DHFR-DSDGK multimer fusion protein (I), (5) DSDGK multimer manufacturing process, (
6) DSDGK manufacturing process will be explained in order.

(I) Preparation of new recombinant plasmid) Preparation of DNA encoding DSDGK multimer DSD
Preparation of DNA encoding GK multimer is carried out by - waterway DNA
After chemically synthesizing each, both columns are annealed. If the target double-stranded DNA is long, it may be prepared by dividing it into several parts along the way.

The DNA encoding the DSDGK multimer has sticky ends on both ends to be ligated to the vector, and between them, from the side closest to the IFR coding region, D) at least one component for cleaving the bond between the IFR and the DSDGK multimer. This structure includes a base sequence encoding 1 amino acid, a base sequence encoding a DSDGK multimer, and a base sequence instructing termination of translation.

The sticky end is the nucleotide sequence of the cut surface generated by the action of a restriction enzyme. When using plasmid pMEK2, the end closest to the DHPR coding region is cut with BamHI, and the opposite end is cut with XhoI. It is convenient to use surfaces.

DHFI? The amino acids or oligopeptides interposed between
Isoleucine - Glutamic acid - Glycine - Arginine [
The recognition sequence of Factor Tenney (FXa) can be used. Therefore, the fusion protein of the present invention (I
) include fusion proteins containing the above intervening amino acids or oligopeptides, respectively.

The degree of polymerization of the DSDGK multimer is not particularly limited, but is preferably from dimer to dimer. In addition, a dimer and a trimer were illustrated as specific examples described later.

ii) Insertion of DNA encoding DSDGK multimer into vector plasmid A vector capable of expressing DIIFR is used to express DNA encoding DSDGK multimer. An example of this is the recombinant plasmid pMEK2 (Japanese Unexamined Patent Publication No. 1-25228
(Refer to Publication No. 9). pMEK2 is stably retained in Escherichia coli, and Escherichia coli containing pMEK2 was sent to FIKEN.
It has been deposited as ERM BP-1816. pME
K2 can be isolated and purified from Escherichia coli containing ρMEK2 according to a conventional plasmid isolation method and used. Purified pMEK2 was purified with BamHI and
o The double strand D of i) above is added to the DNA fragment obtained by cutting with I.
The NAs are ligated using 74-DNA ligase to obtain a novel recombinant plasmid that allows expression of the desired fusion protein (I) in E. coli cells.

ij) Base sequence of new plasmid Figure 1 shows the new recombinant plasmid pB, which is an example of the present invention.
The entire base sequence of BK70A is shown. double stranded circular DN
Only one DNA strand base sequence encoding genetic information of A is processed by restriction enzyme C1, which is the only one present in the plasmid.
The first "A" of the recognition cleavage site of aI, 5'-ATCGAT-3', is counted as number 1 and is written in the direction from the 5' end to the 3' end. pBBK7DA is 4655
It has a base pair size and can confer trimethoprim and ampicillin resistance to the host E. coli. p
BBK7DA is the larger DNA fragment (consisting of 4614 base pairs) obtained by BamHI and Xho I digestion of pMEK2 (consisting of 4640 base pairs).
It has a structure in which 41 base pairs of chemically synthesized RNA containing the base sequence encoding the DSDGK dimer are bound. 1st
In the figure, the sequence from position 533 to position 573 is derived from chemically synthesized NA. By the way, pMEK2
The entire nucleotide sequence of the nucleotide sequence has already been revealed by the present inventors (see JP-A-1-252289), and the sequence from the 533rd to the 573rd nucleotide sequence shown in Figure 1 is the 26 nucleotide sequence shown below. It is a structure that has been replaced with a base pair sequence.

5'-GATCCGTTACGGTGGTTTCAT
The terminal sequence of GTAAC-3 chemically synthesized double-stranded DNA includes: - A sticky end generated upon cleavage with the restriction enzyme Bam)I, and 5'-GATC-3' (53 in Figure 1).
Array from 3rd to 536th. ), and restriction enzyme X
Sticky end generated during cleavage by hoI, 3'-AG
CT-5' (a sequence complementary to the sequence from 574th to 577th in FIG. 1). pMEK
Since the portion derived from 2 has a sticky end site generated by BamHI and Xho I cleavage, a fusion gene with the DHPR gene can be easily created by introducing heterologous DNA in a determined direction.

The array from 57th to 569th in Figure 1 is DII
D) IFR-DSDGK dimer fusion protein f(I) in which a DSDGK dimer is linked to the FR carboxyl terminal side via arginine is encoded.

Upstream of the sequence encoding the DHPR-DSDGK dimer fusion protein (I), there is a sequence that allows efficient expression of the DHPR-DSDGK dimer fusion protein (I) gene (Japanese Patent Laid-Open No. 63 -267276 specification).

In other words, the sequence from the 43rd to the 50th is called the SD sequence, and is useful for efficient translation.
The third position, 641,641, is a consensus transcription promoter and contributes to efficient transcription. Therefore pBB
K7[IA produces large amounts of DHP when introduced into E. coli.
Create R-DSDGK dimer fusion protein (I).

The produced D) IFR-DSDGK dimer fusion protein Prize (I) accumulates in a soluble state in the bacterial body in an amount of about 20% of the bacterial body protein.

Trimethoprim is an inhibitor of this DHPR, but E. coli harboring pBBX7DA is DHFR-DSDG
Since the K-dimer fusion protein (I) accumulates in large quantities within the bacterial cells, it becomes resistant to trimethoprim.

FIG. 2 shows the entire base sequence of the novel recombinant plasmid pBBK56TA, which is another example of the present invention.

Similarly to Fig. 1, only the base sequence of one DNA strand of the double-stranded circular DNA encoding genetic information is cut at the recognition cleavage site of the only restriction enzyme C1al in the plasmid, 5'-ATCGAT- 3', the first "eight" is counted as number 1, and it is written in the direction from the 5° end to the 3° end. pBBK56TA has a size of 4670 base pairs,
p? Bam of IEK2 (consists of 4640 base pairs)
)I The larger DNA fragment (consisting of 4614 base pairs) obtained by I and XhoI digestion and DSDGK
It has a structure in which 59 base pairs of chemically synthesized NA containing a base sequence encoding a trimer are bound.

In FIG. 2, the sequence from position 533 to position 588 is derived from chemically synthesized NA.

The array from 57th to 584th in Figure 2 is DHP
It encodes a DHPR-DSDGK trimer fusion protein (I) in which a DSDGK trimer is linked to the carboxyl terminal side of R via arginine.

pBBK56TA has similar characteristics to pBBK70A, except that it produces a large amount of DHPR-DSDGK trimer fusion protein (I) when introduced into E. coli.

pBBK7DA and pBBK56TA can be produced according to Example 1 and Example 2, respectively, but the present invention is not limited by the method for producing recombinant plasmids.

(2) Transformed E. coli The recombinant plasmid prepared in (I) above is incorporated into E. coli according to a conventional method. The transformed E. coli exhibits resistance to trimethoprim and ampicillin. E. coli containing this plasmid has [1)I on the plasmid.
As a result of efficient expression of the FR-IISDGK multimeric fusion protein (I) gene, a large amount of IFR-DSDGK multimeric fusion protein (I) is accumulated in the bacterial body in a soluble state. E. coli containing the plasmid was added to 5 g of NaC1,8 in YT+AT) medium (medium IL).
g tryptone, 5 g yeast extract, and 100 g
liquid medium containing ampicillin sodium. ) and cultured at 37°C to stationary phase, the accumulated DI (
The FR-DSDGK multimer fusion protein (I) accounts for about 20% of the bacterial protein. If cultured bacterial cells are suspended in an appropriate buffer such as phosphate buffer, disrupted using the French press method or ultrasonic disruption method, and then separated into supernatant and precipitate using centrifugation, most All DHPR
-DSDGK multimer fusion protein (I) is recovered in the supernatant. Of this new recombinant plasmid, pB
Escherichia coli containing 7DA in I3 is
No. 1 (FERM BP2391) and pBBK
E. coli containing 56TA has been deposited as FERM BP-2390.

(3) Manufacturing process of DHPR-DSDGK multimer fusion protein (I) The manufacturing process of D) IPR-DSDGK multimer fusion protein (I) of the present invention includes i) culturing of bacterial cells, 11) culturing of bacterial cells. It consists of five steps: disruption, ii) streptomycin treatment, iv) ammonium sulfate precipitation, and V) mesotrixate (MTX)-coupled affinity chromatography.

i) Cultivation of bacterial cells Culture of Escherichia coli containing the plasmid of the present invention is carried out using YT+
It can be cultured in Ap medium (liquid medium containing 5 g NaCl, 8 g tryptone, 5 g yeast extract, and 50 mg ampicillin sodium in medium IL). In addition to this, the medium includes ST+Ap medium (medium IL contains 2 g of glucose, 1 g of disodium phosphate, 5 g of polypeptone, 5 g of yeast extract, and
Any medium can be used as long as the bacterial cells can grow, such as a liquid medium containing 0 mg of ampicillin sodium, but for the production of DHPR-DSDGK multimer fusion protein (I), YT Medium is preferred. E. coli containing the plasmid of the present invention is inoculated into a medium and cultured at 37°C until the late logarithmic growth phase or stationary phase. D) IFR-DSD in bacterial cells depending on culture temperature
The amount of GK multimer fusion protein \t (I) accumulated varied, and as far as we investigated, the higher the culture temperature, the greater the amount accumulated.

The cultured bacterial cells are collected by centrifugation at 4,70QXg. Bacterial cells with a wet weight of 2 to 4 g are obtained from the medium IL. Bacteria collection and subsequent operations should be performed at low temperatures (unless otherwise specified).
Preferably, the temperature is between 0 and 10''C, preferably 4°C.

ii) The bacterial cells obtained by disrupting the bacterial cells were added to the buffer solution [0, tmM disodium ethylenediaminetetraacetate (EDTA-Na) and 14 mM 2-mercaptoethanol at a ratio of 1:1 to 10 μl per culture solution IL. 10 mM potassium phosphate buffer (p)I 7.0)] and disrupt the bacterial cells using a French press or an ultrasonic disruptor.

27. Centrifuge at oooxg for 20 minutes to obtain a supernatant (hereinafter referred to as cell-free extract).

iii) 1.5% (W/V) streptomycin sulfate is slowly added to the streptomycin-treated cell-free extract while stirring with a stirrer. After stirring for 20 minutes, the streptomycin-treated solution was added to 27. Centrifuge at OOOXg for 20 minutes to obtain a supernatant.

iv) Ammonium sulfate precipitation 0.8 to 0 per volume of supernatant obtained by the above procedure
．． Slowly add 9 volumes of saturated ammonium sulfate solution with stirring. After stirring for 20 minutes, the ammonium sulfate precipitated solution was centrifuged at 27,0 OOX g for 20 minutes to obtain a supernatant.

v) MTχ binding affinity chromatography 25 ml of MTX binding agarose gel (manufactured by Sigma) equilibrated with buffer 1 in advance is added to the supernatant obtained by the above procedure. After allowing it to adsorb to the gel for 10 minutes, the gel is packed into a column. Column was mixed with buffer solution 1, buffer solution 1 containing IMKCI, buffer solution 2 containing IMMCI [0,1 m
M ethylenediaminetetraacetic acid disodium (EDTA-N
az), 10 containing 14mM 2-mercaptoethanol
mM potassium phosphate buffer (pH 8,5). ] Wash in this order. DHFRDSDGK multimer fusion protein (I)
The elution is performed using a solution of buffer 1 containing 1M MCI and 3mM folic acid whose pH is adjusted to 9.3 with 2N NaOH, and the eluate is fractionated in fixed amounts using a fraction collector. The DHFR activity of the fractionated eluate is measured, and both fractions containing enzyme activity are collected. The resulting solution is dialyzed against buffer 1. At this stage, a DHFR-DSDGK multimer fusion protein (I) with a purity of 90% or more is obtained.

By the above operations, the DHFR-DSDGK multimer fusion protein (I) can be purified with good reproducibility. According to the present invention, D) purification of the lFR-DSDGK multimer fusion protein (I) can be performed within 3 days including culturing, and a homogeneous protein preparation can be obtained with a recovery rate of about 80%. I can do it.

The DHFR enzyme activity was measured using a reaction solution [50 mM potassium phosphate buffer (pH 7.0) containing 0.05 mM dihydrofolic acid, 0.06 mM NADPI, and 12 mM 2-mercaptoethanol. ] 11 m as a cue, add a sample to it, and measure the change in absorbance at 340 nm over time at 25°C. Enzyme activity is expressed in units, and one unit is defined as the amount of enzyme required to reduce 1 micromole of dihydrofolate per minute under the above reaction conditions.

This measurement can be easily performed using a spectrophotometer.

(4) Obtained DHFR-DSDGK multimer fusion protein Figure 3 shows the DHFR-DSDGK dimer fusion protein (I) contained in pBBK7DA as an example of the DHFR-DSDGK multimer fusion protein (I). The DNA sequence of the coding part and the amino acid sequence of the protein produced from it are shown. DHFR-DSD
GK dimer fusion protein (I) is a novel protein consisting of 171 amino acids. The sequence from positions 1 to 159 counting from the amino terminus corresponds to E. coli wild type DI (one amino acid substitution occurred in FR [Cys
-152(wild)→Glu-152] sequence,
The sequence from position 162 to position 171 is the DSDGK dimer fusion protein (I). The 160th isoleucine (I le) is a sequence generated to match the reading frame of the genetic information when introducing the gene encoding the DSDGK dimer into the BamHI site of pMEK2. The 161st amino acid, that is, the amino acid immediately before the DSDGK dimer sequence, is arginine (Arg). Therefore, the DSDGK dimer can be excised by treating the DI (FRDSDGK dimer fusion protein (I) with arginyl endopeptidase.DHFR-DSDGK dimer fusion protein (I)
The molecular weight of is 19.299.

In addition, Figure 4 shows another example of the FR-DSDGK multimeric fusion protein (I) in which the trimeric fusion protein (I) is encoded in D) IFR-DSDI contained in pBBK5.6TA. The partial DNA sequence and the amino acid sequence of the protein produced from it are shown. DHF
R-DSDGK trimeric fusion protein (I) is 176
It is a novel protein consisting of amino acids. The sequence from position 1 to 171 counting from the amino terminal side is the above D.
HFR-DSD (is identical to the dimeric fusion protein (I), but D) IFR-DSDGK trimeric fusion protein (I) is the carboxyl of the DHFR-DSDGK dimeric fusion protein (I) Another DSD on the end side
It has a structure in which GK is combined. DHFR-DSDG
The molecular weight of K trimer fusion protein (I) is 19.80
It is 1.

In addition, DHPR-DSDGK dimer fusion protein (
I) and DI (PR-DSDGK trimer fusion protein (I) have a structure in which the DSDGK dimer and DSDGK trimer are bound to the carboxy terminal side of D) IFR, respectively. , has DHFR enzyme activity. Therefore, when E. coli produces large amounts of DHFR-O301 dimeric fusion protein (I) and DHPR-DSDGK trimeric protein (I), it becomes resistant to trimethoprim, an inhibitor of DHFR. It comes to show.

(5) Manufacturing process of DSDGK multimer In the DHPR-DSDGK multimer fusion protein (I) of (4) above, the amino acid immediately before the DSDGK multimer is arginine (Arg). So this DHPR-
When the DSDIJ multimer fusion protein (I) is enzymatically treated with arginyl endopeptidase, DHFRDSD
The DSDGK multimer is excised from the GK multimer fusion protein (I). The enzyme-treated decomposition product is purified by HPLC to obtain a DSDGK multimer.

(6) Manufacturing process of DSDGK The DSDGK multimer obtained in the above (5) is treated with trypsin or with lysyl endopeptidase to produce DSDGK.
Get SDGK. Also, D)IFfl-D obtained in (4)
DSDGK can also be obtained directly without going through the DSDGK multimer by treating the SDGK multimer fusion protein (I) with trypsin and purifying the decomposition product by HPLC.

〔Example] Next, the present invention will be explained in more detail with reference to Examples.

However, the present invention is not limited to these Examples.

(Example 1) Preparation of pBBK7DA The DNA encoding the DSDGK dimer was 1
, 5'-GATCCGTGATTCAGATGGC
AAAGATTCTGACGGTAAATAAC-3 2,5'-TCGAGTTATTTACCGTCAGA
DNA consisting of two 41 nucleotides ATCTTTGCCATCTGAATCACG-3 was synthesized using a chemical synthesizer (manufactured by Millisien, 750 nucleotides) according to the phosphoramidide method.
After chemical synthesis using oligonucleotide purification cartridge (manufactured by Applied Hyosystems), approximately 0.02 d of DNA (containing approximately 0.1 ug of DNA) was extracted and added to this. Reaction solution for caination (50mM Tris-HCI pH 7, 8, 10mM
MgC1z, 5mM dithiothreitol, 0.5mM
ATP) is 180μ! and T4 polynucleotide kinase (manufactured by Zenshuzo Co., Ltd., 10 units/μr) at 1μ! In addition, 3
5 by incubating at 7°C for 30 minutes.
Phosphorylated the terminal. After incubating this at 80°C, both DNAs were gradually cooled.
was annealed to obtain the following double-stranded DNA (hereinafter referred to as DNAI).

1, 5'-GATCCGTGATTCAGATGGC
AAAGATTCTGACGGT2.3'-GCACT
Approximately 1 μg of pMEK2 prepared into AAGTCTACCGTTTCTAAGACTGCC8AAATAAC-3'TTTATTGAGCT-5' was added to 20 units of Bam
After cutting with H1 (manufactured by Zenshuzo Co., Ltd.) and 20 units of XhoT (manufactured by Zenshuzo Co., Ltd.), the fragments were separated by 0.85% agarose gel electrophoresis. A gel containing a DNA fragment of approximately 4.6 kilobase pairs was excised, and DNA was recovered from the gel (hereinafter referred to as DNA 2). BamHI and XhoT
The operation of cutting DNA by “MolecularC
loning: A Laboratory Manu
al” [T, ManiatisE, P, Fr1tsc
h, J., Sambrook, eds, cold S.
pring Harbor Laboratory (
I982). This was carried out according to the method described in 1.

Total 20μ! Add 20μm ligase reaction solution (
10mM Tris-HCI pH7,4,5mMg
C1z, 10mM dithiothreitol, 5mM AT
P), add 10μi of DNAI to which 1μp of T4
-DNA ligase (Takara Shuzo Co., Ltd. 300 units/μβ)
was added, and the DNA ligation reaction was carried out at room temperature for 19 hours. This reaction product was transformed using a transformation method.
a ti onmethod, the above phylum aniatis
Described in the literature by et al. ), Escherichia coli (Zen Shuzo Co., Ltd. E,
coli) IBIOI competent cells). The treated bacterial cells were mixed with 100 μ/l of ampicillin sodium and 5 μ/l of ampicillin sodium. , nutrient agar containing trimethoprim (in medium IL, 2 g of glucose, 1
Contains g dipotassium phosphate, 5 g yeast extract, 5 g polypeptone, and 15 g agar. ) and cultured at 37°C for 24 hours, several dozen colonies could be obtained. 6 of these colonies
5 g of N in YT+Ap medium (medium IL) for 2 d.
aC1, contains 8g tryptone, 5g yeast extract, and 100mg ampicillin sodium. ) and 3
7゛C1-late bacterial cells were cultured. Transfer each culture solution to an Eppendorf centrifuge tube (I, 5d volume) and use an Eppendorf centrifuge (model 54145) to
The mixture was centrifuged at 0 rpm for 10 minutes, and the bacterial cells were collected as a precipitate. To this, 0.1 d of sample preparation solution for electrophoresis [
0,0709M Tris41C1 pH 6, 8, 2% (
W/V) Sodium Lauryl Sulfate (SDS), 11%
Contains (V/V) glycerin, 5% (V/V) 2-mercaptoethanol, and 0.045% (W/V) bromophenol blue. ] was added to suspend the bacterial cells, and this was kept in boiling water for 5 minutes to dissolve the bacterial cells.

This treated sample was subjected to 5DS-polyacrylamide gel electrophoresis [U., Laemmli;
e, vol.

227, p680 (I970), ]. Lactalbumin (molecular weight 14,200) and trypsin inhibitor (molecular weight 120) were used as molecular weight markers.
, 100), trypsinogen (molecular weight 24,000)
, carboni-7 quanhydrase (molecular weight 29.000
), glyceraldehyde-3-phosphate dehydrogenase (molecular weight 36.000), egg albumin (molecular weight 45.000).
000), and bovine serum albumin (molecular weight 66.000
) mixture (DALTON ?IARK■- manufactured by Sigma)
L) was used for electrophoresis on a concentration gradient gel (manufactured by Daiichi Kagaku Co., Ltd.) with an acrylamide concentration of 10 to 20%. The results revealed that one out of six colonies produced a protein of the estimated size. This colony was cultured in YT+AP medium, and Tana
ka and -eisblum's method [T, Tanaka,
B, Weisblum; J, Bacteriology
yvol, 12Lp, 354 (I975), ]. The obtained plasmid was named pBBK7DA. 98BK71) A is pM
It should have a structure in which the sequence between the Bam1 (I and Xho 1 sites) of EK2 is synthesized and replaced with NA.

Synthetic NA contains a sequence, 5'-CTCGAG-3', which is recognized and cleaved by the restriction enzyme Xhol.
When we attempted to cleave pBBK7DA with Xho I, it was indeed cleaved. In addition, EcoRI of pBBK7DA
(sequences 471-476 in Figure 1) and 5alI (
Sequences 872-877 in FIG. ), the dideoxy method using M13 phage [J, Mess.
ing；Methods in Enzymology
, vol, 101. p20 (I983). 1, the base sequence was determined in the direction from EcoRI to SalI. As a result, the sequence from 471st to 872nd of the entire base sequence of pBBK7DA shown in FIG. 1 was confirmed.

In addition, approximately 4.6 kilobase pairs of DNA obtained by Bam81-Xho I digestion of pBBK7DA was
RI + PstL Hindlli, Hpal,
As a result of restriction enzyme cleavage experiments using PvuII, BglII, CIaI (all manufactured by Takara Shuzo Co., Ltd.) and Aat[ (manufactured by Toyobo Co., Ltd.), BamHI-
It was shown to be exactly identical to the approximately 4.6 kilobase pairs obtained by Xho I cleavage.

Based on the above results, the entire base sequence of pBBK70A was determined as shown in FIG.

(Example 2) DHPR-DS produced by E. coli containing ρBBK7DA
DGK II fusion protein (I) DHPR-DS produced by E. coli containing pBBK7DA
The amino acid sequence of DGK dimer fusion protein (I) is DHFR-DSDGK dimer fusion protein (I)
It can be predicted from the base sequence of the gene. The array from 57th to 569th in Figure 1 is DHFR-DSD.
Since it encodes a GK dimer fusion protein (I), the amino acid sequence was estimated using a triplet code table. As a result, the amino acid sequence shown in FIG. 3 was obtained. Using Escherichia coli containing pBBK7DA, DHFR-DSDGK dimer fusion protein (I) was isolated and purified and identified as follows.

Purification A of DHFR-DSDGK dimer fusion protein (I), amount of bacterial cells used: wet weight 15.9 g/3 L culture solution B
, Enzyme purification step: Shown in Table 1 below (in the table, ■ represents cell-free extract, ■ represents streptomycin treatment, and ■ represents mesotrixate bond affinity chromatography.

Table 1 ■ 45 1,320 400
100■ 39 1010 3
10 78■ 31 170
Measurement of 170 43DHPR enzyme activity is
Reaction solution [0.05mM dihydrofolic acid, 0.06mM NADPH, 12mM 2-mercaptoethanol, 5
0mM potassium phosphate buffer (pH 7,0) 11 d
into a cuvette, add the sample to it, and incubate at 25°C for 3
This was done by measuring the change in absorbance at 40 nm over time. Enzyme activity is expressed in units, and one unit was defined as the amount of enzyme required to reduce 1 micromole of dihydrofolate per minute under the above reaction conditions.

The obtained DHFR-DSDGK dimer fusion protein (I) was subjected to 5Ds-polyacrylamide gel electrophoresis (
Method as described in Example 1. ), approximately 2
2,000 single protein hands are shown and the resulting DHPR-DSDGK secondary fusion protein (r)
The specimen was shown to be homogeneous.

(Example 3) Separation of DSDGK dimer from purified DI (PR-DSDGK dimer fusion protein (I)) 31ml purified homogenized leaf FRDSDGK dimer fusion obtained in Example 2 The protein (I) solution was concentrated using an ultrafiltration membrane (Amicon YM5, diameter 25 mm), and EDTA-
D) IFR of 6 cells dialyzed against Naz-free buffer 1
- A concentrated solution of DSDGK dimer fusion protein (I) was obtained. This shows that DHFR-DS at a concentration of 27.6 mg/m
It contained a DGK dimer fusion protein (I).

This DI (LM to 20 μl of Fil-DSDGK dimer fusion protein (I) concentrate) Lis-HCl buffer (pH
8,0) 10 μl, purified water 130 μl! , 1 unit/-
Arginyl endopeptidase (manufactured by Takara Shuzo Co., Ltd.) 60μ
2 was added and incubated overnight at 37°C. After the reaction, 25μ of this reaction solution! was separated using a YMC-005-5 column (manufactured by Yamamura Chemical Co., Ltd., diameter 4.6 x 250 mm) using a high performance liquid chromatography device (Hitachi Model 655). Elution was performed by applying a concentration gradient of acetonitrile (0% to 10%) in 0.1% trifluoroacetic acid. From 0 to 5 minutes, 0% acetonitrile was used, and from 5 minutes to 35 minutes, a linear concentration gradient of 0% to 10% acetonitrile was applied. As a result, an elution curve as shown in FIG. 5 was obtained.

The peak fraction approximately 28 minutes after sample injection was separated, and a small amount of water was added to the separated eluate and lyophilized to remove the solvent to obtain a peptide. After acid hydrolysis of the obtained peptide, Part 1
．． One quarter was used for amino acid analysis. As a result, 1.8 nmole of aspartic acid and 0.9 nmole each of serine, glycine, and lysine were detected. The amino acid composition was consistent with that of the DSDGK dimer. From this result, purified homogenized D) IFR-DSD (
, by treating the dimeric fusion protein (I) with arginyl endopeptidase and then separating it using high performance liquid chromatography to produce DSDG in a yield of about 19%.
It has become clear that K dimer can be recovered. DHPR
- The yield of purification of DSDGK dimer fusion protein (I) is about 43%, and the yield of separation of DSDGK dimer from DIIFR-DSDGK dimer fusion protein (I) is about 19%. Therefore, D from the cell-free extract
The isolation yield of SDGK was about 8%.

(Example 4) Separation of DSDGK from the separated and purified DHFR-DSDGK dimer fusion protein (I) 20μ of the DHFR-DSDGK dimer fusion protein (I) concentrate used in Example 3! was placed in an Eppendorf centrifuge tube (I, 5d volume), and 80 μl of acetone was added thereto. Then place it in the freezer at -20°C for 30 minutes.
) IFR-DSD (J dimer fusion protein (I) was precipitated. This was precipitated using an Eppendorf centrifuge (5
414S type) for 2 minutes at 12,000 rpm to remove the supernatant, add 10 μl of IMF Lis-HCl buffer (pH 8,0), 90 μl (7) Purified water,
10 ul of TPCK-trypsin (manufactured by Sigma) was added, and the mixture was incubated at 37°C overnight. After the reaction, the temperature was cooled to 10 μC, and a YMC-ODS-5 column (
They were separated using a diameter 4.6 x 250 fence (manufactured by Yamamura Chemical Co., Ltd.). Elution was performed under the same conditions as in Example 3. As a result, an elution curve as shown in FIG. 6 was obtained. The peak approximately 8 minutes after sample injection is DSDGK. Using a DSDGK solution obtained by chemical synthesis and having a known concentration as a standard, the amount of DSDGK obtained was determined from the peak height of the chromatogram, and was found to be 1.8 μg. From this, DHP
When R-DSDGK dimer fusion protein (I) is treated with trypsin to obtain DSDGK, the recovery rate is approximately 69
It is calculated as %.

(Example 5) Creation of pBBK567A The DNA encoding the 5DGK triketa is 1,
5'-GATCCGTGATTCAGATGGCAA
AG-3'2, 5'-ATTCTGACGGTAAA
GACTCGGACGGGAAATAAC-335'-
CGTCAGAATCTTTGCCATCTGAATC
ACG-34,5°-TCGAGTTATTTCCCG
TCCGAGTCTTTTAC-3'04 tree DNA was chemically synthesized using a chemical synthesizer (Model 7500, manufactured by Millisien) according to the phosphoramidide method, and after purification using an oligonucleotide purification cartridge (manufactured by Applied Hiosystems), the DNA was purified to approximately 0.1 d ( Contains about 0.1 μg of DNA) and add reaction solution for caination (50mM Tris-HCI pH 7, 8, 10mM
MgCIz, 5mM dithiothreitol, 0.5mM
Add 180 uff of ATP) and 1 μr of T4 polynucleotide kinase (manufactured by Takara Shuzo Co., Ltd., 10 units/μr),
By incubating at 37°C for 30 minutes,
The 5′ end was phosphorylated. By incubating this at 80°C and then gradually cooling it, both DN
A was annealed to obtain the following double-stranded DNA (hereinafter referred to as DNA3).

1,5-GATCCGTGATTCAGATGGCA
AAGATTCTGACGG2.3'-GCACTAA
GTCTACCGTTTCTAAGACTGCCTAA
AGACTCGGACGGGAAATAAC-3ATT
TCTGAGCCTGCCCTTTATTGAGCT-
5'10μ! of DNA3, 20μl of DNAI, 20
μ! A reaction solution for glue gauze and 1 μl of Tl-DNA ligase (both described in Example 1) were added to carry out a DNA ligation reaction at room temperature for 19 hours. Then, according to the method described in Example 1, E. coli was transformed, the transformant was cultured, and the cultured cells were subjected to 5DS-polyacrylamide gel electrophoresis.

As a result, production of protein of the size estimated for four colonies was observed. Therefore, one of these
Colonies were cultured in YT+AP medium, and the Tana
Plasmids were prepared according to the method of Ka and Eisblum. The resulting plasmid was named pBBK56TA. pBBK56TA contains BamHI and Xh of pMEK2.

■It should have a structure in which the sequence between the sites is synthesized and replaced with NA. For synthetic NA, restriction enzyme Xho
Sequence recognized and cleaved by I, 5"-CTCGAG-3",
When we attempted to cleave pBBK56TA with Xho I, it was indeed cleaved. Also, pBB
EcoRI of K56TA (471-476 in Figure 2)
About 400 nucleotides long DNA obtained by cleavage with 5all (sequence 887-892 in Figure 2) and 5all (sequence 887-892 in Figure 2) was sequenced in the direction from EcoRl to Sal 1 according to the dideoxy method using M13 phage. Decided.

As a result, the sequence from 471st to 887th of the entire base sequence of pBBK56TA shown in FIG. 2 was confirmed.

In addition, approximately 4.6 kilobase pairs of DNA obtained by BamHI-Xho I digestion of pBBK56TA is
coRI + Pstl, HindI[I, )Ip
al, PvuII, Bgll, C1al (
The above is the result of a restriction enzyme cleavage experiment using AatI (manufactured by Takara Shuzo Co., Ltd.) and AatI (manufactured by Toyobo Co., Ltd.).
It was shown to be exactly identical to the approximately 4.6 kilobase pairs obtained by mHl-Xho I cleavage.

From the above results, we determined that the entire base sequence of pBBK56TA was
The decision was made as shown in the figure.

(Example 6) DHPR-D produced by E. coli containing pBBK567A
SDGK trimer fusion protein (I) DHFR-D produced by E. coli containing pBBK56TA
The amino acid sequence of SDGK trimer fusion protein (I) is DHFR-'DSDGK trimer fusion protein (I).
I) Can be predicted from the i-base sequence of the gene. Second
The array from 57th to 584th in the diagram is DHFR-D
Since it encodes SDGK trimer fusion protein (I), the amino acid sequence was estimated using the triblet code table. As a result, the amino acid sequence shown in FIG. 4 was obtained. Then, using Escherichia coli containing pBBK567A, DHPR-DSDGK trimer fusion Kumbaku substance (I) was isolated and purified and identified as follows.

Purification A of DHPR-DSDGK trimer fusion protein (I), amount of bacterial cells used: wet weight 28.4 g/3 L culture solution B, enzyme purification step: shown in Table 2 below. (■ in the table represents cell-free extract, ■ represents streptomycin treatment, and ■ represents mesotrixate-binding affinity chromatography.

(Margin below this page) Table 2 ■ 87 2,700 990
100■ 83 1.900 9
30 94 ■ 56 480
The method for measuring 890 90DHFR enzyme activity and the definition of activity were in accordance with Example 2.

The obtained DHPR-DSDGK trimeric protein (I) was subjected to 5DS-polyacrylamide gel electrophoresis (
Method as described in Example 1. ), approximately 2
The single protein hand of L500 is shown and the resulting D) IFR-DSDGK trimeric fusion protein (I)
The specimen was shown to be homogeneous.

(Example 7) Trimer of DSDGK trimer from isolated and purified DHFR-DSDGK trimer fusion protein (I) 56 lines of purified IFR-DSDGK trimer obtained in Example 6 D) Fusion of IFR-DSDGK trimer The protein (I) solution was concentrated using an ultrafiltration membrane (YM5, manufactured by Amicon, diameter 25 mm) to obtain 6.5 volumes of DHFR-DSDGK trimer fusion protein (I) concentrate. This shows that DHFR-
It contained a DSDGK trimeric fusion protein (I).

This DHPR-DSDGK trimeric protein (I
) 1M Tris-HCl buffer (pH 8,
0) '10μ! , purified water 140ul, 1 unit/
ml of arginyl endopeptidase (manufactured by Takara Shuzo Co., Ltd.) 6
0 μl was added and incubated overnight at 37°C. After the reaction, 30μ of this reaction solution! and YMC-ODS using high performance liquid chromatography instrument W (Hitachi 655 type).
-5 column (manufactured by Yamamura Chemical Co., Ltd., diameter 4.6 x 250 mm)
) was separated.

Elution was performed under the same conditions as in Example 3. As a result, the seventh
An elution curve as shown in the figure was obtained. Approximately 34 hours after sample injection
After a few minutes, the peak fraction was separated, and a small amount of water was added to the separated eluate and lyophilized to remove the solvent to obtain the peptide. After acid hydrolysis of the obtained peptide, 1/4 of it was used for amino acid analysis. As a result, aspartic acid was 3.1n
mole, serine, glycine and lysine are each 1
．． 5n moles were inspected in each field. The amino acid composition is D
It matched with the three quantities of SDGK Sankeitai. Based on this result, the purified DHPR-DSDGK trimer protein was treated with arginyl entobenobebutitase and then separated using high performance liquid chromatography, resulting in a yield of approximately 17%.
It turns out that it is possible to make three DSDGK Sankeitais. D.H.
The yield of purification of PR-DSDGK trimeric protein (I) is about 90%, and the yield of DSDGK trimeric trimer from DHFR-DSDGK trimeric fusion protein (I) is about 17%. %, the yield of DSDGK trimer from the cell-free extract is calculated to be approximately 15%.

(Example 8) Isolation of DSDGK from the separated and purified DHPR-DSDGK trimer fusion protein (I) 10 μl of the DHPR-DSDGK trimeric protein (I) concentrate used in Example 7 was transferred to an Eppendorf centrifuge tube. (I, 5 mff 1 volume) and add 40μ of acetone to this.
Added l. Then, the DHFR-DSDGK trimeric fusion protein (I
) was precipitated.

Use this with an Enbendorf centrifuge (model 5414S)
Centrifuge the supernatant for 2 minutes at 12,000 revolutions/min using and dissolved. Additionally, 80 μl of 0.1 M) Lys-HCl buffer (pH 8,0), 10 μl of 0.5% trypsin (D
ifc.

(manufactured by Co., Ltd.) was added and incubated overnight at 37°C.

After the reaction, 20μ of the sample was taken, and YMC-ODS was collected using a high performance liquid chromatography device (Hitachi 655 model).
-5 column (manufactured by Yamamura Chemical Co., Ltd., diameter 4.6 x 250 mm). Elution was performed under the same conditions as in Example 3. As a result, an elution curve as shown in FIG. 8 was obtained. The peak fraction approximately 9 minutes after sample injection was separated, and after the separated elution, a small amount of water was added and lyophilized to remove the solvent to obtain a peptide.

After acid hydrolysis of the obtained peptide, 1/1/6 of it was used for amino acid analysis. As a result, aspartic acid is 9
, 2 nmole, and 4.7 nmole each of serine, glycine, and lysine were detected. The amino acid composition matched that of DSDGK. From this result, purified DHPR-DSDGK trimeric protein (I)
DSDG in approximately 42% yield by trypsinization and subsequent separation using high performance liquid chromatography.
It turns out that it is possible to recover k. DIIFR-DSDG
The yield of purification of K trimer fusion protein (I) was approximately 90%.
%, and the yield of separation of DSDGK from the DHFR-DSDGK trimer fusion protein (I) is 42%, so the yield of DSDGK from the cell-free extract is approximately 3.
It is calculated to be 8%.

[Effect of the invention] As mentioned above, the novel recombinant plasmid of the present invention has DI
(Since it encodes the PR-DSDGK multimer fusion protein (I), E. coli carrying this plasmid produces and accumulates a large amount of the DHFR-DSDGK multimer fusion protein (I) in a soluble state. DHFR-DSDGK multimer fusion protein (I)
retains DHPR enzyme activity and can be easily purified. By following the purification method of the present invention, D
The HPR-DSDGK multimer fusion protein N) can be purified quickly and efficiently.

Alternatively, trypsin can be directly applied to the DHPR-DSDGK multimer fusion protein (I) obtained in this way, or trypsin can be applied after cutting out the DSDGK multimer using a common enzyme such as arginyl endopeptidase. , D by high performance liquid chromatography
SDGK can be isolated and purified. purified DS
DGK is useful as a therapeutic agent for allergic diseases.

Therefore, the present invention provides an advantageous means for producing 5DGK, which is useful as a therapeutic agent for allergic diseases, by genetic engineering technology.

[Brief explanation of the drawing]

Figures 1 and 2 show pBBK7DA and ρB, respectively.
It is a diagram showing the entire base sequence of BK56TA, and double-stranded D
DNAt*, one of the NAs that encodes genetic information
Only the base sequence of is described from the 5' end to the 3' end. The symbols in the figure represent nucleic acid bases; A represents adenine, C represents cytosine, G represents guanine, and T represents thymine. Numbers in the figure are pBBK7DA and pBBK5
The first "
The numbers are shown with A'' as number 1. Figures 3 and 4 are numbers for pBBX7DA and pB, respectively.
FIG. 2 is a diagram showing the base sequence of the portion encoding the DHFR-DSDGK dimer fusion protein (I) and the DHFR-DSDGK trimer fusion protein (I) present in BK567A, and the amino acid sequence of the protein. The symbols in the figure represent nucleobases and amino acids, A is adenine, C is cytosine, G is guanine, T is thymine, G is
ll/ stands for glycine, Ala stands for alanine, Val stands for valine, Leu stands for leucine, Ile stands for isoleucine, Ser stands for serine, Thr stands for threonine, Cys
is cysteine, Met is methionine, Asp is aspartic acid, Asn is asparagine, Glu is glutamic acid, Gln is glutamine, Arg is arginine, Lys is lysine, His is histidine, Ph
e is phenylalanine, Tyr is tyrosine, Trp
indicates tryptophan, and Pro indicates proline. The numbers in the figure indicate the numbers counted starting from methionine, which is the amino terminal amino acid of the fusion protein (T). Figures 5 and 7 show DHFR-DSDGK dimer fusion protein (I) and DHFR-DSDGK, respectively.
This figure shows a chromatogram obtained when trimeric fusion protein (I) was treated with arginyl endopeptidase and separated using a high-performance liquid chromatography device using a reversed phase column. The horizontal axis represents time in minutes, and the vertical axis represents absorbance at 220 nm in arbitrary units. Arrows in the figure indicate DSDGK dimer and DSDGK, respectively.
It shows the position where the Sankeitai forms the Mitata body. Figures 6 and 8 show that D) IFR-DSDGK dimer fusion protein (I) and DHFR-DSDGK trimer fusion protein (I) were treated with trypsin, and then treated with high-performance liquid using a reversed phase column. This shows a chromatogram when separated using a chromatography device. The horizontal axis represents time in minutes, and the vertical axis represents absorbance at 220 nm in arbitrary units. All arrows in the figure indicate the positions where DSDGK is eluted. Figure 3 Lys Asp Ser Asp Gly
Lys Figure 1 of this book (its work) CCATGAACA et al. AAATTUCL;Ll;
TTAI;
At;t;＾A＾shihachishi Heheheheheheshi Lit;
ShishiTI'Aheshi^I'[i LiLt;L:RashirTT^ TCAG8A et al.cA G to C to TT A
C et al. Figure 1 (Part 2) d70 A30 ALL+AL+Lit, L, U'l 'l'l'1.
;till;Tll;A AIJAAT1'AATT
to TTATC Fig. 2 (Part 1) 211Ll 1LitIZljLI
i:14Ll tLDu〒rrflTf
iTrflT TAC1″CrrATn AACA
r, A static TT CCCCCTTAC^ CGGAGG
CATCA＾GTGAL;l;AA A11L+
AAAAAA Ashishitishishi1. ;'l'l^ Ha Shiha 1 Shishi Shishi Li 1 Figure 2 (Part 2) T^8 to T[;TT^T [;uli[;TL;AU
AA l"l'AA'l"Iti'lL+ AL;
AAi'l'ALi'l'i' AACTATTTG
T TATAAT[iT'Ai'TL;Al'A
AliL;l”t aFigure 4Lys Ala Gln Lys Leu
Tyr Leu Thr H4s lle
Asp Ala Glu Val Time (min) Lys Asp Ser Asp Gly
Lys Asp Ser Asp Gly
Lys Book Book Book Figure 6 2゜

Claims (1)

[Scope of Claims] 1. A recombinant plasmid containing a base sequence encoding a dihydrofolate reductase-antiallergic pentapeptide multimer fusion protein (I). 2. The recombinant plasmid according to claim 1, wherein the antiallergic pentapeptide portion consists of the amino acid sequence of aspartic acid-serine-aspartic acid-glycine-lysine. 3. In the dihydrofolate reductase-antiallergic pentapeptide multimer fusion protein (I), the fusion protein (I) in which the antiallergic pentapeptide is a dimer has the following amino acid sequence: The recombinant plasmid described in 1. [There is a gene sequence. ] [There is a gene sequence. ] (In the formula, _ represents an intervening amino acid between dihydrofolate reductase and antiallergic pentapeptide.) 4. The base sequence encoding the fusion protein (I) in which the antiallergic pentapeptide is a dimer is as follows. The recombinant plasmid according to claim 3, which has a base sequence. [There is a gene sequence. ] (In the formula, _ represents a base sequence encoding an amino acid that mediates dihydrofolate reductase and antiallergic pentapeptide) 5. Dihydrofolate reductase-antiallergic pentapeptide multimer fusion protein (I) The recombinant plasmid according to claim 1, wherein the trimeric fusion protein (I) of the antiallergic pentapeptide has the following amino acid sequence. [There is a gene sequence. ] [There is a gene sequence. ] (In the formula, _ has the same meaning as above.) 6. The set according to claim 5, wherein the base sequence encoding the fusion protein (I) in which the antiallergic pentapeptide is a trimer is the following base sequence. Replacement plasmid. [There is a gene sequence. ] [There is a gene sequence. ] (In the formula, _ has the same meaning as above) 7. The recombinant plasmid is stably replicated in E. coli, confers trimethoprim resistance and ampicillin resistance to the host E. coli, and has a size of 4655 base pairs. The recombinant plasmid according to claim 3, which is a recombinant plasmid. 8. The recombinant plasmid according to claim 5, wherein the recombinant plasmid is stably replicated in E. coli, confers trimethoprim resistance and ampicillin resistance to the host E. coli, and has a size of 4670 base material. 9. The recombinant plasmid according to claim 3, wherein the recombinant plasmid is pBBK7DA having the base sequence shown in FIG. 10. The recombinant plasmid according to claim 5, wherein the recombinant plasmid is pBBK5.6TA having the base sequence shown in FIG. 11. E. coli transformed with the recombinant plasmid according to claims 1 to 10. 12. Dihydrofolate reductase-antiallergic pentapeptide dimer fusion protein (I) having the following amino acid sequence. [There is a gene sequence. ] [There is a gene sequence. (In the formula, _ has the same meaning as above.) 13. A dihydrofolate reductase-antiallergic pentapeptide trimer fusion protein (I) having the following amino acid sequence. [There is a gene sequence. ] [There is a gene sequence. ] (In the formula, _ has the same meaning as above.) 14. Cultivating the Escherichia coli according to claim 11, and collecting the dihydrofolate reductase-antiallergic pentapeptide multimer fusion protein (I) from the cultured cells. A method for producing a dihydrofolate reductase-antiallergic pentapeptide multimer fusion protein (I), characterized in that: 15. The step of collecting dihydrofolate reductase-antiallergic pentapeptide multimer fusion protein (I)
15. The production method according to claim 14, which comprises a step of purifying the cell-free extract of cultured microbial cells by sequentially using streptomycin treatment, ammonium sulfate precipitation, and mesotrixate-binding affinity chromatography. 16. Dihydrofolate reductase-antiallergic pentapeptide dimer fusion protein (I) or dihydrofolate reductase-antiallergic pentapeptide trimer fusion protein (I) according to claim 12 or 13.
By enzymatically treating aspartic acid-serine-
A method for producing an anti-allergic pentapeptide consisting of an amino acid sequence of aspartic acid-serine-aspartic acid-glycine-lysine, which comprises collecting an anti-allergic pentapeptide consisting of an amino acid sequence of aspartic acid-serine-aspartic acid-glycine-lysine. 17. The production method according to claim 16, wherein the enzyme is trypsin.