JPH03503757A - Proteins and their derivatives - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

[Detailed description of the invention] 34, a human thrombomolecule defined by binding with high affinity to thrombin A protein that has almost the same biological activity as dhurin; It has the ability to impart the ability to activate protein C to a complex with thrombin and 32. A method for producing a protein comprising: a) administering the vector according to claim 31 to a cell; b) growing said cells in a suitable medium; and c) inserting said vector into has thrombomodulin activity encoded and produced by said cells. Isolate the protein product The method for producing the protein, comprising:

35, said cell is a bacterial cell, a yeast cell, a fungal cell or a mammalian cell, preferably 35. The method according to claim 34, preferably in mammalian cells.

36. In combination with a physiologically acceptable carrier or excipient, claims 1- 16 or its physiologically compatible counterpart. medicines containing salts or esters of

37. A medicament according to claim 36 in the form of a physiological solution.

38. The method according to any one of claims 1 to 16 for the treatment or prevention of thrombin symptoms. 38. Use of a peptide according to claim 36 or 37 or a medicament according to claim 36 or 37.

39. at least one protein according to any one of claims 1 to 16; A mammal comprising administering to a mammal an effective amount of the pharmaceutical according to item 36 or 37. Methods for treating thrombin symptoms in mammals.

40, at least one protein or claim according to any one of claims 1 to 16; A mammal comprising administering to a mammal an effective amount of the pharmaceutical according to item 36 or 37. Methods for preventing thrombin symptoms in mammals.

41. Contact with blood and/or insertion and/or implantation into the body of a mammal. According to any of claims 1 to 16, for application to a product designed for Use of peptides.

42, contact with blood and/or insertion and/or implantation into the body of a mammal. 17. A product devised for the use of the peptide according to any of claims 1 to 16. Products that have a coating with a composition that includes

Engraving (no changes to the content) Specification Proteins and their derivatives The present invention describes authentic and modified human thrombomodules made by recombinant DNA technology. Phosphorus, the DNA sequences encoding these molecules, and pharmaceutical products containing these molecules. in human therapy and prophylaxis for the treatment and prevention of and thrombin episodes. regarding the use of these.

Background of the invention Blood clotting is a classic example of chemical amplification. Key substances in coagulation, such as blood Minimal stimulation of platelets, X■ and/or ■factors induces complete gelation of blood can be done.

Amplification involves a series of proteolytically activated products such as coagulation factors xn, ■, ■, mediated by V and prothrombin, which deposits fibrin in the plasma. This results in the confinement of cellular elements. However, blood coagulation is counterbalanced by the precoagulant stimulus. regulated by other interactions and adapted to local physiological needs. This must be consistent with the originally dangerous stepwise reaction. Start without these effects The induced clot will escape and disseminated intravenous clots will occur.

Endothelial cells that form the inner capsule of blood vessels are one source of potential antithrombotic substances. . Heparin sulfate on the endothelial surface can inhibit the coagulation process at several levels ■ Greatly strengthens antithrombin.

Tissue plasminogen activator, another blood fluidity regulating element, is activated after constant stimulation reaction that releases fibrin fibers from dermal cells and redissolves already formed fibrin fibers. Start.

A third example, to which this invention is directed, is thrombomodulin.

Thrombomodulin is a glycoprotein on the surface of the endothelium and certain other cells that inhibits clotting. It contributes to the regulation of stiffness (D'Owen W, Oinen and C. , Esmon, C., Esmon, J.

Biol, Che+s, % melon: 5532-5535 iN, Esmon et al.N , Esmon etal, J, Biol, Chem, 257: 859 -864.1982; also L, Crows L, C1ouse and B, Ko Nbu P, Comp, N, Engl, J, Med.

314: 1298-1304.1986). This is the end of the coagulation cascade. It binds to thrombin stoichiometrically at the second to last position, and its protein hydrolysis Change the solution singularity. Normally, thrombin converts fibrinogen to insoluble fibrin. change. This also activates factor V and factor ■ to factor Va and factor ■a, respectively. sexualized, thereby enhancing coagulation through positive feedback. Trombo model After binding to turin, a new activity becomes prominent: thrombin-thrombo model The turin complex activates protein C. Activated protein C (PCa) In combination with Lotin S, it degrades activated Va and ■a cofactors and thus Stop solidity (R, Marlar etal, Blood 59: 1067-1072.1982). Activated protein C is also a protein Decomposes inhibitors of sminogen activator (FAI) and thereby fibrinolytic Facilitate solutions (V, van Hinsburg et al.) Iinsburg h at al, Blood 65: 444-451+1985). same Sometimes the interaction between thrombomodulin and thrombin is clearly Reduces the ability of fibrinogen, activated factor V and aggregated platelets to clot. (C, Esmon et al., J. Biol. Chem., 257: 7944- 7947.1982, N. Esmon et al., J. Biol, Chem, 258 : 12238-12242.1983).

In summary, the interaction with trompomodulin transforms thrombin from a clotting precursor to an anticoagulant. It converts it into a solid agent and converts it into a fibrinolytic action. Effect of thrombomodulin The consequences are dramatic: it accelerates PCa formation 100 to 20,000 times. fruit The thrombin-thrombomodulin complex is by far the most powerful protein C complex. activator and probably the only or important physiologically relevant substance .

Initiated by the thrombin-thrombomodulin complex and activated by protein C. Negative feedback loops mediated by . Possesses partial protein C deficiency, probably due to heterozygous gene deficiency. Occasionally, humans have episodes of intravenous thrombosis (L, Clowes L, C1 ouse and Bi, Kombu P, Comp, ibid.).

The fate of patients with complete protein C deficiency is more severe.

They cause many thrombotic symptoms in infants unless treated with protein C-rich concentrates. die like that.

Therefore, thrombomodulin-initiated feedback is important in the body's hemostasis mechanisms. It is clear that it plays an important regulatory function. According to this perspective, dissolved Thrombomodulin has anticoagulant properties in vitro. Solution by surfactant The partial thromboplastin time of human plasma was maintained at a concentration of approximately 4 nM. Reported to double (varnish).

Kurosawa S, Xurosawa and N, Aoki N, Aoki, Throm b.

Res, 37: 353-364.1985).

Trompomodulin molecule Human thrombomodulin is purified from placenta (H.

Saleem et al.) 1. salem et al, J, Biol, Chem, 25 9: 12246-12251; Nis, Kurosawa and N, Aoki, same as above. ). Briefly, the method involves membrane preparation, solubilization in nonionic surfactants and The protease activity was destroyed by diisopropyl phosphofluridate. Consists of two rounds of affinity chromatography in phase thrombin. Refining is both Both require additional steps, i.e. ion exchange chromatography or size exclusion chromatography. Contains any of the tographies.

Thrombomodulin is a very stable glycoprotein. Activity is 1% SOS, 8 Samples treated with M urea, pH 2, pH 10, or boiled for 10 minutes can be quantitatively recovered from

However, treatment with mercaptoethanol or pepsin completely abolished the activity. destroy. The molecule is very poorly soluble in the absence of surfactants.

A purified preparation of trompomodulin shows one predominant band on gel electrophoresis. shows. Biological activity is recovered from the gel and coincident with the bands. electrophoretic transfer The mobility roughly corresponds to a molecular weight of 88-105,000 Daltons, but it is estimated that The value is rather clear depending on the gel system. The isoelectric point is low, around 4.

The estimated amino acid composition has been published (Niss, Kurosawa and N, Aoki). , ibid.), but detailed characterization was seriously hampered by small amounts of material.

Studies of thrombomodulin from other species greatly strengthen the above statement (N. , Esmon et al., N., Esmon et al., J., btol.

Cbem, 257: 859-864.1982). Furthermore, recent results sheds further light on the molecular properties of human thrombomodulin. From the C-terminal half The partial cDNA sequence of bovine thromboduran is that this part is the LDL receptor. (R, Jackman et al., R, Jack an et al, Proc.

Natl, Acad, Sci USA 83: 8834-8838.198 6). The 240-amino acid region of the skin contains cysteine residues, and the spacing between them is determined by epidermal growth. It corresponds to a 6-unit formation similar to factor (EGF). In this area, N- There are two potential sites for combined glycosylation. Also, this is serine, to A region of 56 amino acids rich in leonine and proline residues It has an O-linked sugar chain, similar to the LDL receptor. Probably. followed by 24 hydrophobic amino acids that probably represent the transmembrane region. and finally a 56 amino acid segment starting with a polypositively charged residue. This is followed by a protein that probably represents a short cytoplasmic domain. listed below Our results suggest that human and bovine thrombodurans are at least partially classified as It shows that they are similar.

Bovine thromboduran has recently been treated with acidic and anticoagulant properties that differ by ion exchange. and non-acidic fractions (M, C, Boulin et al. rin et al, Proc.

Natl, Acad, Sci, USA Kagefuki 5924-5928.1986) . Both fractions contain thrombin cofactor activity required for protein C activation. had. In addition, the acid fraction prevents blood clots and neutralizes thrombin with antithrombin in a similar manner to heparin. Facilitate. The two latter properties are achieved by polycationic polybrene and by hebaliner. abolished by ze. These results indicate that direct and indirect thrombin neutralizing activity by secondary glycosylation of the tide chain, while the protiin C coactivator – activity indicates otherwise.

International patent application NαPCT JP86100330 (W087100050) The creation of a compound with trompomodulin activity isolated from human lungs has been reported. has been covered.

Certain problems have so far seriously interfered with the use of thrombomodulin as an anticoagulant. 1) The molecule is available in minimal quantities with limited purity from human primary sources. Only. 2) The molecule is only soluble in the presence of surfactants.

These issues must be resolved before thrombomodulin can be clinically useful. Must be. Furthermore, by targeting molecules to specific physiological structures, It is preferred to enhance the specificity of embomodulin.

In this regard, we have shown that there is a soluble form of thrombomodulin. It is interesting to note that (H, Ishii H, l5hii and B, double , Majerus, P., W., Majerus.

J, Cl1n, Invest, 76: 217B-2181, 1985).

The authors also speculated about the composition of soluble thrombomodulin and the membrane-bound domain. Reference is made to the scales resulting from the synthesis of thrombomodulin without in.

Here, the inventors of the present invention have demonstrated that human thrombomodulin can be expressed in a suitable host. By using recombinant DNA technology to express genes and naturally produced human To increase its use by eliminating and/or attacking deficiencies inherent to embomodulin. The problem was solved by changing the gene in order to

definition Before describing the present invention, it is important to define certain terms used hereinafter to understand the invention. will help.

Complementary DNA or cDNA: enzymatically extracted from the sequence present in the mRNA template A DNA molecule or sequence that is synthesized.

DNA construct: a DNA molecule or a clone of this molecule, -terminal or double-stranded , which is a partially isolated or otherwise naturally occurring gene. contain DNA segments that are assembled and arranged in ways that do not occur naturally. This has been changed in order to

Plasmid or vector: a gene that can provide for its replication when inserted into a host cell Plasmids of DNA constructs containing child information generally contain a small amount of information to be expressed in host cells. This sequence contains at least one gene sequence, as well as the promoter and transcription start site. Contains sequences encoding functions that promote gene expression such as This is also line blowing or a closed ring molecule.

Binding: A DNA sequence is formed by combining the 5' and 3' ends of one sequence into each of the adjacent sequences. When it is connected to the 3' and 5' ends by a phosphodiester bond, it is said to be bonded. It is being said. Linking can be done by methods such as blunt-end or cohesive end ligation. by synthesis of binding sequences via A cloning or via direct mutagenesis methods. This is accomplished by removing or inserting sequences.

The prepro region commonly occurs at the amino acid terminus of two specific protein precursors, and is secreted an amino acid sequence, at least a portion of which is commonly cleaved from a protein. pre-professional territory The region consists of sequences that direct proteins to the secretory pathway of the cell.

Domain or module: Three-dimensional, self-assembling arrangement of amino acids in a protein molecule. sequence containing the structural elements necessary for the specific biological activity of the protein.

Further definition of domains and modules with special relevance of coagulation and fibrinolysis. Definitions and other references include fingers, growth factor regions, kringles and vitamins Include the mono-dependent gamma carboxylation region and refer to: El, Bani. Alrari, Banyal et al, FEBS Letter 163 : 37-41.1983 and Elle, Patty L, Patthy, Ce1l 41: 657-663.1985゜Thrombomodulin activity Thrombomodulin has three distinct activities. Firstly, this is thrombin and Binds with high affinity. Second, it specifically interacts with the thrombin-thrombo module. confers the ability to activate protein C to the protein complex. Third, this combination is compound fibrinogen, platelets and antithrombin by altering the reactivity of thrombin. Make it into several different ingredients including bottles.

For the purposes of the present invention, we assume that thrombomodulin activity is the primary of these activities. and the second type, ignoring the third type of activity. therefore , thrombomodulin derivatives or thrombomodulin in general, these bind whether or not they alter the reactivity of thrombin It is considered active if it has protein C coactivator activity.

Activation of protein C Protein C is a double-chain glycoprotein with a molecular weight of approximately 57,000 daltons. Ru. One chain, termed the light chain, has an amino-terminal gamma carboxylation region followed by It consists of two domains similar to epidermal growth factor (EGF). called a heavy chain The other chain contains a serine protease domain. Activation of protein C is a heavy chain consists of cleavage of one peptide bond, Arg-12 and Leu-13. child This greatly promotes the catalytic action of thrombin-thrombomodulin, and generally This is a reaction that increases the amount by 100 to 20,000 times. In fact, the thrombin-thrombo model Yuri”i?1 is a known very strong activator of protein C, and only one physiological correlate.

Description of the invention In one aspect, the invention herein provides thrombomodulin and its It relates to some compounds called trompomodulin, which are composed of derivatives. This invention Toro All of the mbomodulins mentioned above and specified in further detail below have certain characteristics in common.

It is foreseen that thrombomodulin will be useful in the therapeutic management of coagulation. . By increasing the amount of thrombomodulin in patients, protein C could enhance activation and thus strengthen the patient's anticoagulant ability. .

The thrombomodulin-inducing anticoagulant of the present invention is similar to the well-known anticoagulant. It can be expected that heparin and vitamins are superior to antagonists. these Well-known anticoagulants interfere at several levels of the coagulation cascade and inhibit the synthesis of interfere with normal clotting mechanisms by inhibiting or inhibiting clotting factor activity . Furthermore, antagonists to vitamins indiscriminately inhibit the formation of gamma-carboxylated proteins. reduce the physiological anticoagulant response of protein C by blocking Thrombotic episodes, typically manifested as skin necrosis, treated with antivitamins In contrast, thrombomodulin occurs early in the F natural anti-inflammatory agents by limiting the survival of AI and activated Va and α factors. would solidify coagulation and fibrinolytic mechanisms, but clotting factors in plasma The group of children is mostly left as is.

The spatial specificity, which may be as high as the activity, depends on the local formation of thrombin; The systemic activity is therefore negligible. Thrombomodulin of the present invention The anticoagulant activity of fibrin does not directly interfere with the formation of hemostatic clots, but rather changes the structure of fibrin. It's not something that will make you change. Therefore complications in the form of episodic washouts are common with anticoagulants. Less is expected compared to quality usage.

Thrombomodulin is recommended for use in patients with increased risk of bleeding or who are at risk for such bleeding. It is particularly useful as an anticoagulant in patients who are unable to undergo treatment. like this Patients include those who have recently suffered a stroke due to a blood clot in the brain, or those who have recently undergone surgery. Includes those with severe injuries or potential sources of bleeding (tumor, cancer, etc.).

The invention will be further described in detail below with reference to the drawings and examples, but as claimed in the appended claims. The scope of the present invention as defined in the following is not limited thereto.

Brief description of the drawing In the figure Figure 1 shows the clones used to identify human thrombomodulin cDNA clones. The sequence of the 60-mer DNA probe is shown.

Figure 2 shows bovine thrombomodulin (B) cDNA (nucleotide 850 ~1035) (Jackman et al, Jack+++an et al, PNA S, USAi: 8834-8838.1986, Figure 3) and human toro Corresponding in nbomodulin (H) cDNA clone 92.1C (present invention) Represents a string of DNA sequences containing deduced amino acid sequences from a region. strong homology (indicated by a boxed line) is found in this part of the molecule, which is a transmembrane plan. Contains areas.

Figure 3 shows bovine thrombomodulin CB) cDNA (Jackman et al., PNAS , ll5A, Residence: 8834-8838.1986, Figure 3) and Hitotoro nbomodulin (H) cDNA clone p2. Corresponding area in H present invention) A series of DNA sequences with amino acid sequences deduced from Two areas (U) sinucleotides Nα1-66 and 145-186) were compared, and the two Surrounds identical parts of molecules.

Figure 4 shows the human thrombomodenylin cDNA sequence from clone 22.1 (in accordance with the present invention). ) is shown. The sequence is a bovine cDNA sequence (Jackman et al., PNAS, USA, : 8834-8838.1986. , Figure 3) in the 3' untranslated part. Shows 365hp corresponding to cleotide 1754-2123 (369bp) .

FIG. 5 shows an RNA A plot analysis of human cell line A349 mRNA. two Separate 5 g of mRNA from different preparations on a 1% agarose gel, and Plot on Rulose and ninku translaceion from plasmid 22.1. hybridize using the modified restriction fragments. Nucleotide length of known DNA shows.

Figure 6 shows a human population with selected domains marked A, B and C. The amino acid sequence of tissue plasminogen activator is shown.

Figure 7 shows the DNA sequence of the 3640 bp insertion in 22.1.

The amino acid of human thrombomodulin with its signal peptide at the amine terminus The amino acid sequence is shown with all amino acid residues indicated by these one-letter symbols. It will be done.

Figure 8 shows the sequence of Ba+wHI insertion in plasmid pBoe1743-2-9-8. show. Regions constructed from synthetic oligonucleotides are underlined with horizontal arrows. pull. Encoded human tPA signal peptide and human thrombomodel The amino acid sequence of the urin mutant is determined by the one-letter code for all amino acid residues. shown. Several restriction endonuclease identification sites are shown.

Figure 9 shows the construction of the mammalian expression vector pBoel-TM1.

Figure 10 shows the construction of the mammalian expression vector pBoel-TM2.

Detailed description of the invention In one main aspect, the present invention is defined by strong affinity binding to thrombin. Some compounds that have thrombomodulin activity, and such compounds It has the power to impart the ability to activate protein C to a complex with thrombin and Contains two or more of the following structural elements from the C-terminal portion of the molecule: a) approximately 56 amino acids; a short cytoplasmic domain; b) a transmembrane region of approximately 24 amino acids; C) a region rich in serine, threonine and proline residues; d) at least two a domain consisting of two EGF domains, and e) N-terminus , in which case one or more of elements a), b) and /' or C) are deleted. or affinity-imparting moieties or moieties that enhance solubility in physiological solutions. or to physiologically compatible derivatives thereof.

In this regard, the present invention describes molecules with thrombomodulin activity. , this results in improved solubility compared to authentic human thrombomodulin in physiological solution. Given the solution properties. Other molecules of the invention respond to specific tissue structures in vivo. or an association with a surface or other molecule or entity. A conclusion is given.

Such modified thrombomodulin is based on the amino acid sequence of human thrombomodulin. but with some or all of the hydrophobic membrane bunning region The C-terminal portion containing is deleted or replaced by an affinity conferring agent.

One preferred site for terminating the human thrombomodulin sequence is the former 5- This is the starting point of the hydrophobic membrane bunning region corresponding to 12-Gly-14. (Figure 7) Corresponds to 1is-514 to Gly-516 (bases 1670-1678) ).

A second preferred site for terminating human thrombomodulin sequences is the growth factor domain. at the C-terminus of the sequence.

A further preferred embodiment is that the number of EGF domains is equal to or greater than 4. It consists of a molecule containing only certain regions e) and d).

This indicates that the human thrombomodulin sequence contains two initial growth factor domains. terminating at either N-terminus and opening a hydrophobic membrane spanning region at the C-terminus. or the C-terminus of either growth factor domain 4.5 or 6. This shows that this is a more preferred embodiment.

The modified thrombomodulins also contain these as N- or C-terminal extensions. A novel preferred heterologous protein domain, wherein said domain has a specific structure. Physiological structures such as fibrin clots, membranous surfaces, receptor molecules or has a favorable affinity for extracytoplasmic matrix components. may be a fusion protein.

One method for fusing human thrombomodulin sequences with appropriate heterologous structural domains is The preferred site is the menplan corresponding to old 5-12 to G1y44 in Figure 2. This is the starting point for the spanning region.

A second preference for fusing human thrombomodulin with an appropriate heterologous structural domain. The new site is the C-terminus of the growth factor unit sequence.

Further preferred methods for fusing human thrombomodulin with appropriate heterologous structural domains The new site is the N-terminus of either growth factor domain 1.2 or 3 or the growth factor domain. C-terminus of either child domain 4.5 or 6.

A domain that has a specific affinity for a physiological structure and is suitable as a fusion partner. Some include growth factor modules, kringles, finger modules, and vitamins. Calcium-binding gamma carboxylation region dependent on, and antibody induction, antigen- Contains an identification structure.

Preferred heterologous structural domains with affinity for physiological structures include tissue plasminoids. Genactivator and fibronectin finger module, Urokina growth factor modi-ase, tissue plasminogen activator and protein C Kringle module and protein of tissue plasminogen activator. Contains the 1st, 4th and 5th kringle modules of lasminogen. Ru.

In one particular embodiment of the invention, the modified thrombomodulin is N-terminal sequence of human thrombomodulin up to er-13, tissue plasminogen activator finger domain (region A in Figure 6, amino acids 4 to 50). This is a fib in the molecule Grants affinity for phosphorus.

In a second specific embodiment of the invention, the modified thrombomodulin is 5e of FIG. N-terminal sequence of human thrombomodulin up to r-13 and tissue plasminogen The second kringle domain of the activator (region in Figure 6, amino acid 1 76-263).

This also gives the molecule an affinity for fibrin.

In a third specific embodiment of the invention, the modified thrombomodulin is 5e of FIG. N-terminal sequence of human thrombomodulin up to t-13 and tissue plasminogen activator growth factor module (region C in Figure 6, amino acid 50 ~87).

In a fourth specific embodiment of the invention, the modified thrombomodulin is Humans up to but not including the first cysteine residue of the growth factor module. The N-terminal sequence of rhombomodulin, expressed at the first cysteine residue in the molecule. The growth factor module of tissue plasminogen activator (see Figure 6) The C-terminus is extended to include amino acid 51).

In a fifth specific embodiment of the invention, the modified trompomodulin is of human tissue type Blasminogen activator (tPA) and short adapter sequence (second Figure 8) and four N-terminally linked extracellular O-glycosylation-rich domains. Consists of a carboxyl-terminal epidermal growth factor domain.

A sixth embodiment corresponds to the third embodiment above, but with extracellular O-glycemia. Eliminate cosylation-rich domains.

Alternatively, the molecule contains a free cysteine residue, or one or more lysine residues. Contains a C-terminal extension to facilitate covalent attachment in vitro or to facilitate lysine attachment. and very high in arginine or glutamate or aspartate It may include charged regions to mediate non-covalent adhesion to the surface.

In another embodiment of the invention, the modified thrombomodenylin is N-terminal sequence of human thrombomodulin up to the cleavage site, including the spacer The N-terminal sequence imparts affinity through molecules such as antibodies or fragments thereof. It is something that is made by combining with things. For description of suitable spacer molecules and techniques Tijssen"Practice and Theory of Enzya+e Immunoassays, Amsterdam, Netherlands Lessebourg, 1985 or Tenmark Patent Application No. 1107/87 (which is referred to as (incorporated by the Act).

In a second major aspect, the invention provides fully human thrombomodulin in suitable cells. by expressing a cloned nucleic acid construct encoding all or part of the The present invention also provides a means for producing authentic as well as modified human thrombomodulin as described above. It is. Thrombomodulin or related parts thereof alone or with other domains expressed as a fusion with a Provide another domain.

In one preferred embodiment, authentic or modified thrombomodulin contains the natural region of the human thrombomodulin gene in a cloned nucleic acid construct. The region is encoded in a manner that is active in the transport of native proteins from the cell. and eventually become completely or at least partially detached from the cell. This is caused by the expression of eel amino acids.

In a second preferred embodiment, authentic or modified thrombomodulin is a cloned nucleic acid construct containing tissue plasminogen activator protein. Encoded in brepro format containing regions.

In a third main aspect, the present invention provides a method for preventing or reversing thrombotic diseases. It also describes medicinal products containing authentic or modified thrombomodulin that are useful for the treatment of patients. It is.

For the purposes of the present invention, cDNA or genomic clones are used herein as starting material. Authentic human thrombomodulin as well as denatured This makes it possible to produce human thrombomodulin.

Techniques for determining the complete sequence of DNA clones and new independent Techniques for obtaining similar clones whose partial sequences have already been determined are well known in the art. For example, Maniatis et al.'s “Mo1ecullar Clo ning+　A　Laboratory　Manual”　Co1d　Spr ing Harbor Press+ New York, USA, New York, which are incorporated herein by reference. Ru.

DNA sequences encoding preferred terminalized human thrombomodulin and human thrombomodulin -) Parts of rhombomodulin and preferred functional domains from other proteins Construction of a DNA sequence encoding a fusion of human thrombomodulin cDNA restriction enzymes specific for specific positions in the cDNA of A and preferred domain donor molecules. It is best to do this after introducing the base identification site. Restriction enzyme recognition at specific positions of DNA molecules Introducing an alternative site is an oligodeoxyribonucleotide-directed site-specific mutation. There are several well-known and highly efficient methods of mutagenesis (e.g. Morinaga et al., BIO/TEC) INOL OGY2: 636-639.1984). C - The generation of terminally deleted modified human thrombomodulin is based on the oligonucleotide directed site. Advantageously, it is obtained using specific mutagenesis. Hydrophobic, Menpuran・ This preferred modified human thrombomodule terminates at the beginning of the spanning region. One of the phosphors is the present Gly-codon GGC (base Nα889 in Figure 2). -891) by specifically introducing a stop codon at the position.

In this same mutagenesis experiment, oligonucleotides were used to introduce By introducing a convenient restriction enzyme recognition site just 3' into the top codon, this short The translation of the human thrombomodulin cDNA is used to aid in other construction efforts. . Different parts of human thrombomodulin cDNA and specific to be recruited Different parts of other cDNAs from the domain can be transferred into small RNA vectors (e.g. pUc19. pBR322 and pGEM3) and then suddenly Perform mutagenesis. Introduce a new restriction site at the binding site by inducing appropriate mutations Afterwards, the cDNAs are sequentially sequenced to confirm the mutated genotype. mutated The fragments can then be combined directly by ligation in an expression vector. or linked together through the use of short double-stranded synthetic oligonucleotide adapters do.

All these operations can be performed by means well known in the art.

Maniathes et al., “Mo1ecular Cloning, A Labora tory manual''.

Co1d Spring Harbor Press, New York, USA New York, 1982), including, for example, ligation of DNA fragments and of separate constructs or encoded mutant and fusion proteins. Either cloning these in different vectors for expression.

A variety of host cells make proteins, including mammalian cells, yeast, fungi, and bacteria. can be used for However, cultured mammalian cells are preferred. one A particularly preferred cell line is the BHK cell line tk-ts13 (Vechta-Waech ter and Baserga), Proc, Natl, Acad, S ci, USA 79: 1106-1110+1982). these Methods for expressing cloned genes in each type of host are known in the art. .

For expression of denatured thrombomodulin in cultured mammalian cells, a suitable Transfection methods such as calcium phosphate-mediated transfection ( Graham and Van der Eb, Vir ologV 52: 456-467゜1973; (as denaturation by et al.) into cells. DNA-phosphate A lucium precipitate is formed and this precipitate is applied to the cells. Part of the cell is DNA and keep it inside the cells for several days. A small fraction of cells are DN A is integrated into the genome of the host cell. These integrations have a selectable phenotype (selection by co-transfection with a gene that confers a possible marker (possible marker). determined. A preferred selectable marker is mouse dihydrofolate reductase. (DHFR), which indicates cellular resistance to the drug methotrexate (MTX). Grant. A marker that can be selected in an appropriate manner after the host cell has taken up the DNA. Drug selection is performed to select cell populations that express

Thrombomodulin active compounds produced by transfected cells are cells by adsorption onto an on-exchange column or by affinity chromatography. Purified from culture medium. One preferred affinity column is an inert immobilized column. Contains rhombin (H, Salem et at, J, Bi ol.

Chew, 259: 12246-12251.1984). Another advantageous technique The technique is directed to specific antigenic determinants on the desired thrombomodulin. using noclonal antibodies or fragments thereof. These are called solid phase Can be used as a bound affinity reagent to impart efficient column purification Can be done.

The expansion of monoclonal antibodies, their binding to column matrices, and their isolation The use of antibody affinity columns for protein and purification is well known in the art. Ru.

Example 1 Preparation of metsenger RNA from human cell line A349 lung cancer tissue (Gier et al. iard et al. (1972) J. Natl. CancerInst. 51:1417-1423) isolated from human cell line A349 (American Ricatype Power Luture Collection CCL 185) is It is known that approximately 10,000 rhombomodulin molecules are expressed. A349 was used as a source for mRNA preparation. A349 is lO% fetal bovine serum and grown to a total cell number of 9.4 x 10' in RPM11640 containing antibiotics. Ta.

Total RNA was extracted using the guanidinium thiocyanate method (guanidinium thiocyanate method). yanate method) (Chirgwin et a (1979) Biochemistry 18: 5293-5299) and purified by CsCj2 gradient centrifugation. R.N. A: The total amount of 4SOn is obtained, and the mRNA is oligo(dT)-cellulose colored. Aviv & Leder (197 2) PNAS Dan: 1408-1412). Total RNA from 750■-RNA 61 moths were obtained (once). After ethanol precipitation, this preparation of mRNA was finalized. 10mM at a concentration of 1jtg/m) Squirrel HCf pH 7.5, 0.1+oM ED Resuspended in TA-Nag and stored at -80°C for next use.

QIRNA prepared as described was used for cDNA library construction and mRNA Used for A-plot analysis.

A349 Construction of cDNA library from mRNA , Okayama Okayan+a and Berg Berg (Mo1. Ce11. Biol, 2: 161-170 (1982): Mol.

Ce11. Biol, 3: 280-289 (1983)) .

12 (MC1061) for Escherichia coli (Ca5adaban and Coenshi) , Cohen C, J, Mo1. Biol, 138: 179-2 07) was used for transformation. MC1061 0D in L-broth at 37°C Proliferated to iao=0.5. Centrifuge for 20 d and sterilize the cell pellet in water. Resuspend in 0,1 M CaCj2z7- and incubate in water for 30 min. lysed, centrifuged briefly, and finally kept overnight in a cooling room.

Transformation - cDNA preparation 10 of competent E. coli MC1061 95111 Added per m. The mixture was incubated in water for 30 min and incubated at 43.5 °C for 4 min. Apply a heat shock for 5 seconds and finally incubate at 37°C for 30 minutes after adding L-Pros. Betshita. After resuspension, cells were plated in L-broth containing ampicillin (50x/m). and grown for 8 hours at 37°C. Individual colonies from this library -2,9 The entire XIO' was obtained.

549 copies of cDNA colonies encoding human thrombomodulin. Screening of 4 x 10' individual colonies on a nitrocellulose sheet. by the standard colony hybridization method using filters (Manniais et al., supra). Screened. Jackman et al. (19 86) PNAS Fj4: As reported by 8834-8838, The first corresponding to the bovine thrombomodulin sequence covering octides 532-591. Synthesis of the 60-mer oligonucleotide shown in the figure (Applied Biosystems, DNA synthesizer from USA) and “P” (T, polynucleotide kinase and T-''P-ATP) and used for screening.

The hybridization solution was 6x5SC15xDenhardt's solution. 5 solution), 0.05% SOS (Maniais et al.) and 10”c Contained pm/d. After low stringency washing, select 4 colonies for further analysis did. Prepare plasmid preparations and use Hindll! Perform digestion and transfer to 1% agarose and plotted on a nitrocellulose filter, and compared with the above 60-mer. hybridized to both. One of the plasmids, designated 22.1, is a strong hybrid. gave a good signal and was selected for further characterization.

22.1 characteristic display 22.1 has a cDNA insert of approximately 3.8 kb, and within this insert a partial DNA A sequence (Maxam and Gilbert, Methods Enzymol.

Fusashi 499-560.1980, Sanger et al. PNAS, USA74: 5463-5467, 1977) with different characteristics and for clone identification. Figures 2 and 3 show the selection of cows. area (Jackman et al., PNAS, USA 8834-8838.198 6, Figure 3) and the human cDNA obtained from 22.1. . Enclose the region of amino acid identity with a box. From Figure 2, the 24 amino acids in the bovine sequence Within the putative transmembrane region of acid residue length, only two amino acids The only difference is that the acid substituents are the same.

Figure 4 shows the sequence from the 3' untranslated region of p2.1. in this part of the molecule The highly conserved regions between the bovine and human sequences are also identical.

The following experiment is performed to assess the integrity of this clone.

Plotting analysis of human trompomodulin mRN^ human cell line A349m Electrophoresis of RNA 5-nitrate through 1% agarose gel containing 2.2M formamide A denatured 32p-labeled DNA molecular weight marker (a function called HindI) λ DNA) (Maniais et al., “Mo1ecular cloning: ALaboratory Manual, Co1d S pring Harbor 1 laboratory press” New York, USA (1982). After electrophoresis, run the gel at 1X5SC (1x ssc is 0.150 M NaCf and 0.015 m sodium citrate (pH 7).

Rinse for 2x10 minutes in Gene 5cr een) (TM) Transfer mRNA to hybridization transfer membrane overnight. Blotting was performed in 10X SSC. Plotted mRNA for 2 hours 80 The membrane was baked at °C. Prehybridization (5 hours) and hybridization (20 hours) 50% formamide; bovine serum albumin, Ficoll and and polyvinylpyrrolidone 0.1% each, 5XSSC, 1% SDS and heat denatured The experiment was carried out at 42°C in salmon sperm DNA of 0.5 μ/d. hybridization pro Nick-translated p2.1 cDNA restriction fragment as a probe I used After hybridization, mRNA plots were prepared 2x5 at room temperature. min in 2x ssc, 2x 5sc at 65 °C, 2x 30 min in 0,5% SDS and 0 at room temperature. Washed consecutively for 2 x 30 minutes in IX5SC. In Figure 5 The autoradiography from this experiment is shown. Lanes 1 and 2 are two different Lane 3 shows the DNA molecular weight marker. this Experiments identified human thrombomodulin mRNA approximately 3.8 kb in length. .

This human thrombomodulin mRNA size 0 to 22.1 is sufficient length or It was concluded that the protein contained a human thrombomodulin cDNA insert of almost sufficient length. can be attached.

The complete sequence of the cDNA in plasmid 22.1 was determined (Tabo, Nis, T abor, S., and Richardson, C., C.

Richardson, C.C. (1987) Proc. Natl. Acad. , Sci, USA, 84: 4767-4771) and in Fig. show. In addition to the sequences shown, this plasmid contains a sequence at the 3' end of the cDNA insert. Contains an extension of the G:C homopolymer tail at the 5′ end in addition to a poly(A) tail .

Example 2 Human thrombomodulin mutant The desired human thrombomodulin (hTM) variant has a membrane banning region. Expressed as a soluble protein with no To obtain such a mutant strain, To do so, take the following steps: p2.1 was digested with PstI to create an 870bp fragment. The fragment (nucleotides 952-1821 in Figure 7) was isolated and pGEM It was subcloned in S (Promega Biotic). Multiliquid in pGEM a Kpn I region in hTM cDNA oriented to the Bam81 site of the linker The subclone containing this position was designated pBoe1743-2.

The insert in this plasmid is an oligodeoxyribonucleotide, N0R57. 0: 5’ (GATGGAGATGCCTATGGGATCCTAGGAGTGC Mutagenesis was performed using ACGAGCCCACAGGC) 3' (Model Linaga, Y. et al. (1984) BIO/TECHNOLOGY, 2: 6 36-639).

All synthetic oligodeoxyribonucleotides described in this invention are uplinked. Synthesized using a DNA synthesizer manufactured by Biosystems (USA), and polyacrylic It was purified in a lylamide gel.

This mutation results in a TAG translation stop codon at the glycine 516 codon GGC. This resulted in the introduction of In addition to this change, the oligonucleotide is a new translation ApaL I (GTGCAC) site exactly 5' to the stop signal, Avr II (CCTAGG) site spanning stop signal and A Bas+HI (GGATCC) site was introduced on the 3' side. Correct mutant pBo e1743-2-9 was subjected to colony hybridization and appropriate restriction enzymes. Identified through mapping using

In one desired hTM-induced mutant, the expressed protein is extracellular 0- Only 4 carboxyl-terminal epidermal growth factors with glycosylation-rich domains Contains similar domains.

This mutant was generated as follows. pBoe1743-2-9 with BamHI and old nclI, and 0.53kb)lincII/-Bam The HI fragment was isolated. This fragment was synthesized and ligated with NA, which was converted into BamHI-digested p Human tissue-type plasminogen activator (tPA) (beta) in Llc13 Pennica et al. (1983) Nature, narrow :214-221) and encoded a short adapter sequence. correct group Recombinant pBoe1743-2-9-8 was identified by restriction enzyme digestion and synthesized. The areas have been arranged.

tPA encoding region, adapter and old n of pBoe1743-2-9-8 The 711 bp sequence of the cIt/BamHI cross section is shown in FIG.

In this figure, all composite NAs are indicated by horizontal arrows.

Purification, annealing, cloning and adapter cross section of 0.53 kb t ( All methods used for ligation to inc II/BamHI fragments were standard. are standard techniques and are well known to those skilled in the art of recombinant DNA. pBoe1743-2-9-8 was digested with BamHI, and 0, which corresponds to the synthetic region, 71 kb was purified by agarose gel purification. This fragment was digested with Ban) Zem219b (described in U.S. Patent Application No. 58061, June 4, 1987) ) was cloned in 7.

Zem219b is a blowhole animal expression vector, which expresses mouse metallothionein cD inserted under the control of a promoter and human growth hormone terminator Expresses NA. The plasmid also contains mouse DHFR under the control of the SV40 regulatory element. (dihydrofolate reductase) carries cDNA and is transfected by this provides a selectable marker to the selected mammalian cells.

The correct recombinant pBoel-TM1 was isolated and characterized by restriction enzyme digestion. became. pBoel-TM1 was grown in large quantities in Escherichia coli and purified by ultracentrifugation. Purified in a sC1/ethidium bromide gradient. Another desired hTM mutant is Soluble without O-glycosylation-rich regions and membrane spanning regions expressed as a sexual protein. To obtain such mutants, the following steps was carried out. pBoel, 743-2 oligonucleotide, N0R571: 5　　　　　(CTCGCCAGAGCCGCTGGATCCCTAGTCCA CCTTGCCGGA)3' was mutagenized.

This mutation creates a TAG translation stop codon at the glycine-487 codon GGT. This results in the introduction of In addition to this change, oligonucleotides stop translation. A Ball11 (GGATCC) site was introduced just 3' into the signal.

The correct mutant pBoe1743-2-10 was cloned by colony hybridization. Identification was made through restriction enzyme mapping and DNA sequencing.

pBoe1743-2-10 was digested with HincII and BamHI to yield 0.44kb. The fragment was purified on a polyacrylamide gel. This DNA fragment was digested with BamHI. pBoe1743- in Zem219b and alkaline phosphatase treatment Binds with 0.18 kb BamH1/-Hlnc II fragment from 2-9-8 and pBoel-TM2 were obtained.

The correct structure of this plasmid was extracted by restriction enzyme digestion. pB+ el-TM2 encodes a mutant hTM precursor, here human tPA signal four carboxy-terminal epidermal growth factor-like molecules from mammals under the control of a null peptide. Main can be secreted.

pBoel-TM2 grows in large quantities in E. coli and can be used to transfect mammalian cells. Prepare a plasmid of sufficient purity for the application.

Example 3 Expression of TM variants in mammalian cells Cultured BHK cells (Syrian Hamus ter, thymidine kinase mutant system tk-ts13, Vecta-Waech te r and Baserga (1982), Proc, Natl, Ac. ad, Sci, USA, 79: 1106-1110° American type For expression of mutant hTM in culture collection CRL 1632) Expression vectors pBoel-TM 1 and pBoel-TM 2 were added to calcium phosphate. system-mediated transfection method (Graham and van der Knibb, (1973)) , Virology.

52:456-467) into cells.

short-term onset 48 hours after transfection, serum-free Dulbecco Socosmodium Dulbeccos Modified Eagle Medium) (25DIM N-2-hydroxyethyl-piperazine N '-2-ethanesulfonic acid (HEPES), pH 7,4,10/! Insu phosphorus, containing 0.2% bovine serum albumin), and washed each vetri dish with the same medium. Incubate for 24 hours. The used medium was collected and analyzed as below. 7M activity was analyzed by.

Selection of TM-mutant producing clones 48 hours after transfection, cells were trypsinized with 400mM The mixture was diluted into a medium containing MTX (MTX). After 10-12 days, pieces Each colony was cloned and expanded separately. Blood swollen cultures described above Produced clones were grown for 24 hours in serum-free medium and treated with protein C coactivator. activator activity was identified using an assay.

Protein C coactivator activity Protein C activation was performed using a modified method by Bourin et al. Proc, Natl, Acad, Sci, US 83.5924 (1986) ) was measured. 200 m of serum-free supernatant from transfected cultures Protein C 40m and thrombin 10il! (Final concentration 1 group and 20 nM, respectively) and calcium chloride was added to a final concentration of 2mM. then The mixture was incubated at 37°C for 30 minutes and the reaction was It was stopped with thrombin ■ and 5U heparin. 50mM) Squirrel, HCI! ／　 0.1 M NaCj! , adjust the capacity to 650 d at pH 8.3, and 1 mM S-2266 (D~Val-Leu-Arg-p- = 100 Ill of troaniline (Kabi Vitrum) was added. .

Increasing absorbance at 405 nm was recorded for protein C activity. The standard curve is , protein C was fully activated by thrombin in the presence of rabbit TM. The results of this test are shown in Table 1 below.

Table 1 Protein C coactivator activity in supernatants of transfected cultures None Gradient 0.57M-1 Gradient 1.7 7M-2 slope 1.3 None Constriction cells 0.3 None Constriction cells 0.9 7? I-1 clone 11.5 TM-1 clone 26.5 7M-2 clone 13.8 7M-2 clone 24.8 From the table, it can be seen that the modified thrombomodulin of the present invention inhibits protein C coactivation. It is clear that it has activity.

Inhibition of coagulation activity 500mM of serum-free tissue culture supernatant was spiked with 100mM NaC for inhibition of coagulation activity. Dialysis was performed against 2.50Il1M Tris-HCl pH 7.4.

APTT reagent (Dade) Loom with standard citrate plasma 100JLl Incubated for 3 minutes at 37°C. Add 100I of dialyzed tissue culture supernatant, Immediately after that, 30mM calcium chloride 100J! 1 was added.

Aggregation was measured (seconds).

The results of this test are shown in Table 2 below: Table 2 Anticoagulant activity DNA transfection of dialysis supernatants from transfected cultures G Cultured type No aggregation time (seconds) Host cells 28 From Table 2, the aggregation time for the supernatant containing the modified thrombomodulin of the present invention is It is clear that it is considerably longer than the counterpart that does not contain rhombomodulin. be.

Although the invention has been disclosed and described with respect to specific embodiments thereof, it is within the understanding of those skilled in the art. The invention should be considered to include equivalents and variations such as those within shall be further understood and construed in connection with the appended claims. .

CYS GLN MET PHE CYS ASN GLN THRSERCY S-5' TGCCAG ATG TTCTGCAACCAG ACT T CG TGC-PROALA ASP CYS ASP PROHls TYR PROTHRCCG GCT GACTGCGAT CCT CACTACCC G ACC3’AAAAAACACrAAAAAA TAAAAAA TGGCCAT r　TGI:Tm”r(:AC(:AGA　TTTGCrAA　TTTAcrocodile-= -6557 :b-’-”-4371 3,13kb-1-, l11. ,− Ring drawing, -2028 FIG. 6 l AA to AAGTGTCTG to GCTCCGAC to ACAGGAGAG GCT(TCGC(CC to ATCG; TCCTGTGCCCbT 60 LGLOLMCTAPPGAVQGBVARFIG,'7 Tsua.

Hun 1 FIG. 7 FIG, 7 7 TCTACCAmCAGAGAGGCCTTTTGGAATGTG GAACAAGAATsG 3120 FIG. 7 FIG, 9B FIG. 10 Procedural amendment (formality) June 6, 1991 Commissioner of the Patent Office Toshi Ue Matsu 1.Display of the incident PCT/DK88100089 Z Name of invention Proteins and their derivatives 3. Person who makes corrections Relationship to the incident Patent applicant Name: Novo Nordisk Acteasel Scab 4, agent Address: 8-10-5 Toranomon-chome, Minato-ku, Tokyo 105, Date of amendment order March 12, 1991 (shipment date) 6. Subject of correction (1) “Representative of patent applicant” in writing pursuant to Article 184-5, Paragraph 1 of the Patent Law column (2) Translation of the description and claims (3) Power of attorney 7. Contents of amendment (1) (3) As per attached sheet (2) Translation of the description and claims (no change in content) 8. List of attached documents (1) Amended Article 184 of the Patent Act 5. Document pursuant to the provisions of paragraph 1: 1 copy (2) Translation of the description and scope of claims. Translation: 1 copy each (3) Power of attorney and its translation: 1 copy each (4) Qualification certificate and its translation　　　　　　　　　　　　International search report 1＾-Ek■＾-ekmm N@, P CT / D to [1B100089 Crow 1 ．． ,1. , 21.11. Yuchi^2.嘗1.11～. ．． PCT/DK8B100 089 special table 13-503757 (17)

Claims (42)

[Claims] 1. Thrombomodulin defined by high affinity binding to thrombin A protein that has activity, and which is a complex of the protein and thrombin. It has the power to confer the ability to activate Tein C, and from the C-terminus of the molecule Consists of two or more of the following structural elements: a) short cytoplasmic domain of approximately 56 amino acids, b) approximately 24 amino acids c) rich in serine, threonine and proline residues region, d) a domain consisting of at least two EGF domains, and e) N-terminus; In doing so, one or more of elements a), b) and/or c) may be deleted or a force-imparting moiety or a moiety that increases the solubility of said protein in physiological solutions; These proteins or those of physiological compatibility that may be exchanged by derivatives of. 2. said structural elements a) and b) are deleted or transformed; The protein according to claim 1. 3. whether said girder elements a), b) and c) are deleted or replaced; The protein according to claim 1, comprising: 4. Claims 1 and 2, wherein said structural element d) consists of at least four EGF domains. or the protein described in 3. 5. The structural element (e) is human tissue-type plasminogen activator (tPA). ) and a short adapter sequence. or the protein described in 4. 6. From the C-terminus, c) an O-glycosylation-rich domain; d) at least four EGF domains; e) Signal peptide from human tissue-type plasminogen activator (tPA) 5. The protein according to claim 4, comprising a short adapter sequence. 7. From the C-terminus, d) at least four EGF domains; e) human tissue type plasminogen actinase; consisting of a signal peptide from beta (tPA) and a short adapter sequence. The protein according to claim 5. 8. The following amino acid sequence: [There is an array] The protein according to claim 6, consisting of. 9. The following amino acid sequence: [There is an array] The protein according to claim 7, consisting of. 10. The protein according to claim 2 or 3, wherein the exchange portion is an affinity-imparting portion. quality. 11. The moiety may be a physiological structure such as a fibrin clot, a membrane surface, a receptor, etc. affinity for molecules, or extracellular matrix elements, preferably fibrin clots 11. The protein according to claim 10, which imparts sex to the protein. 12. The growth factor module, XringIe, Fin Gar module, vitamin K-dependent calcium-binding r-carboxylation domain and 12. The protein of claim 11 selected from the group consisting of: and antibody-inducing structures. 13. a growth factor in which said portion originates from human tissue plasminogen activator; , finger or kringle module. . 14. Artificial products, such as those inserted into the body of a mammal, in which said parts come into contact with blood. and/or products designed for implantation, such as compatibility with the surface of vascular grafts. 11. The protein according to claim 10, which imparts sex. 15. two for binding said affinity-imparting moiety to said structural element d) or e); 15. Protein according to any of claims 10 to 14, comprising a functional spacer molecule. 16. Any of claims 1 to 15, which contains almost no human-generated contaminants. A protein described in any of the following. 17. The following areas: a) a first region encoding an N-terminal region; b) located downstream of said first region; This is the second region that encodes several EGF domains; when the number is greater than 1, c) a third region located downstream of the second region, comprising serine and threonine; and a region encoding a domain rich in proline residues, d) a fourth region located downstream of the third region, the fourth region comprising membrane spanin e) a fifth region located downstream of the fourth region; The region that encodes the cytoplasmic domain consisting essentially of two or more of areas e), d) and/or c); The above is omitted or a region or ethochondrial region or region encoding an affinity granter is omitted. A domain that encodes something that increases the solubility of the coded protein A DNA construct comprising a nucleotide sequence that may be exchanged with thrombin. Same biological activity and same biological activity as human thrombomodulin defined by high affinity binding. and activate protein C into a complex between the encoded protein and thrombin. A DNA construct encoding a protein that has the ability to confer sexualization ability. 18. 18. The method according to claim 17, wherein said regions d) and e) are omitted or replaced. DNA constructs. 19. Claim 17, wherein said regions c), d), e) are omitted or replaced. DNA constructs described. 20. 5. wherein said region b) encodes at least four EGF domains. 17, 18 or 19. 21. The region a) contains human tissue-type plasminogen activator (tPA) or Claim 17, 18, 19 or 20 encoding a short adapter sequence The DNA construct described in. 22. a) Signal peptide from human tissue-type plasminogen activator (tPA) b) at least four EGF domains; and C) O-glycosylation-rich domain. 21. A DNA construct according to claim 20, comprising a nucleotide sequence encoding. 23. a) Signal peptide from human tissue-type plasminogen activator (tPA) b) at least four EGF domains 22. A DNA construct according to claim 21, comprising a nucleotide sequence encoding. 24. The following nucleotide sequence: [There is an array] The DNA construct according to claim 22, comprising: 25. The following nucleotide sequence: [There is an array] The DNA construct according to claim 23, comprising: 26. Claim 1: The region to be exchanged is a region encoding an affinity imparting portion. 20. The DNA construct according to 8 or 19. 27. The portion may be a fibrin clot, a membrane surface, a receptor molecule or an extracellular matrix. affinity for physiological structures such as oxele elements, preferably fibrin clots; 27. The DNA construct according to claim 26. 28. The above parts include growth factor module, taringal, finger module, and bipolar module. Tamin K-dependent calcium-binding r-carboxylation region and antibody-derived constructs 28. The DNA construct according to claim 27, selected from the group consisting of: 29. a growth factor in which said portion originates from human tissue plasminogen activator; , finger or kringle module. thing. 30. Artificial products in which said parts are intended to come into contact with blood, e.g. Products designed to be inserted and/or implanted, e.g. on the surface of a vascular graft. 20. The DNA construct according to claim 18 or 19, which has affinity for. 31. Human thrombomodule defined by high affinity binding to thrombin A protein that has substantially the same biological activity as a protein and that has a biological activity similar to that of a protein. A protein that has the power to confer the ability to activate protein C in complex with protein C. Claims 17 to 30 are an expression vector capable of directing the expression of a promoter operably linked to a DNA construct defined as An expression vector consisting of 32. A cell comprising the vector of claim 31. 33. The cell is preferably a bacterial cell, a fungal cell, a yeast cell or a mammalian cell. 33. The cell according to claim 32, which is a mammalian cell. 34. A human thrombomolecule defined by binding with high affinity to thrombin A protein that has almost the same biological activity as dhurin; It has the ability to impart the ability to activate protein C to a complex with thrombin. 32. A method for producing a protein comprising: a) administering the vector according to claim 31 to a cell; b) growing said cells in a suitable medium; and c) inserting said vector into has thrombomodulin activity encoded and produced by said cells. Isolate the protein product The method for producing the protein, comprising: 35. Said cells are bacterial cells, yeast cells, fungal cells or mammalian cells, preferably 35. The method according to claim 34, preferably in mammalian cells. 36. in combination with a physiologically acceptable carrier or excipient. 16 or a physiologically compatible variant thereof. medicines containing salts or esters of 37. 37. A medicament according to claim 36 in the form of a physiological solution. 38. The method according to any one of claims 1 to 16 for the treatment or prevention of thrombin symptoms. 38. Use of a peptide according to claim 36 or 37 or a medicament according to claim 36 or 37. 39. At least one protein or claim according to any one of claims 1 to 16 A mammal comprising administering to a mammal an effective amount of the pharmaceutical according to item 36 or 37. Methods for treating thrombin symptoms in mammals. 40. At least one protein or claim according to any one of claims 1 to 16 A mammal comprising administering to a mammal an effective amount of the pharmaceutical according to item 36 or 37. Methods for preventing thrombin symptoms in mammals. 41. contact with blood and/or insertion and/or implantation into the body of a mammal. According to any of claims 1 to 16, for application to a product designed for Use of peptides. 42. contact with blood and/or insertion and/or implantation into the body of a mammal. 17. A product devised for the use of the peptide according to any of claims 1 to 16. Products that have a coating with a composition that includes